NAME: MARIA FLORDELONA A.

CENTRO MODULE NUMBER: 4

SUBJECT: BIO 105 Date of Submission:

The Nucleus

LESSON 1 Chromosomal Structure and Genes

Activity Recall the structure of a eukaryotic cell and prokaryotic cell. Draw the
structure of the nucleus and identify its parts. Afterward, answer the
questions in the Analysis.

Analysis 1. Where can you find the chromosomes in both types of cells
(Prokaryote and eukaryote)?

 In prokaryotic cell, chromosome is found in the cytoplasm in the

region known as nucleoid. On the other hand, in eukaryotic cell,
chromosomes stored inside a structure called the nucleus.

2. Were chromosomes readily visible in the nucleus of the cell?

 When a cell is not dividing, chromosomes are not visible in the

nucleus, even under a microscope. However, during cell division,
the DNA that makes up chromosomes becomes more densely
packed and visible under a microscope.

3. Do you think chromosomes can also be found in other parts of

the cell aside from the nucleus? What are those organelles?

 As we all know, chromosomes are located in almost every cell,

however there are some complex organisms which carries small
type of chromosome that is said to be found in mitochondria

1|Cell and Molecular Biology

Application 1. Create a three–dimensional model of the nucleus showing the
chromatin network. (RUBRIC is attached at the end part of the
end of the module)

2. Describe the components that make up the nucleus.

 Nuclear envelope, nuclear lamina, nucleolus, chromosomes,

nucleoplasm are some of the components that work together to
make up nucleus. Nuclear envelope, a double membrane that
encloses the entire organelle and isolates its contents from the
cellular cytoplasm; and the nuclear matrix (which includes the
nuclear lamina), a network within the nucleus that adds
mechanical support, much like the cytoskeleton that supports the
cell as a whole.

3. Illustrate the structure of chromosomes identify, and label its

2|Cell and Molecular Biology

 parts. Place your drawing inside the box.

4. Illustrate the basic structure of a prokaryotic and eukaryotic gene.

LESSON 2 Cell Cycle and DNA Replication

Activity Diagram the cell cycle and identify the checkpoints. Label the different
phases. In each phase, discuss the activities that occur. Answer the
following questions in the Analysis.

3|Cell and Molecular Biology

Analysis 1. What is the primary function of the cell cycle?

 The primary function of the cell cycle is to perfectly duplicate

the massive amount of DNA in the chromosomes and then
separate the DNA into genetically identical daughter cells.

2. Do all cells proceed to cell division after the growth stage?

 Not all multicellular organisms proceed to cell division as most
of them will differentiate to carry out their specialized functions.
These cells are in the Go phase

3. What is wrong with the cell if it continues to divide?

 If a cell is continuously and uncontrollably dividing ehrn it is
supposed to stop, this will cause cancer.

4. Do you think cell cycle can be controlled? In what ways can cell
cycle be regulated?
 A number of protein-controlled feedback processes regulate the
cell cycle. Cyclins activate kinases by binding to them;
specificically cyclin-dependent kinases are activated (CDK).

Application 1. Make a video showing the process of DNA replication. You can
choose either of the two: eukaryotic or prokaryotic DNA
replication. You can use any materials to represent the different
proteins required for the process.

4|Cell and Molecular Biology

 2. Briefly discuss the process of the cell cycle.
 The cell cycle generally ensues in four phases. First, the cell
grows continuously during interphase, consisting of three phases:
G1, S, and G2. DNA replication is confined to the S phase. G1 is
the gap between the M and S phases, and G2 is between the S
and M phases. During the M phase, the nucleus divides in
mitosis; then the cytoplasm divides in a process called
cytokinesis.

3. Discuss how the cell cycle control system is controlling the cell
cycle progression.
 The cell cycle process has a control system to ensure the
accuracy of the process. This control system comprises complex
networks of regulatory proteins guaranteeing the accuracy of cell
division and DNA replication. For instance, cells must receive
the right cues for this phase for the proper growth signal from
their environment so that progression from this point of the G1
phase will be accomplished. Otherwise, the cell may continue to
live on or commit suicide by apoptosis (also known as
programmed cell death).

LESSON Transcription and RNA Processing

3
Activity Look at the following DNA sequence below. Using each strand as a
template, synthesize a new mRNA transcript by complementary base
pairing. Remember that Adenine (A) pairs with thymine (T) and guanine
(G) pairs with cytosine (C) in DNA synthesis. However, considering the
RNA structure, Adenine (A) will pair up with Uracil (U) instead of
thymine (T).

5′-
AAGAATTGCGGAATTCGGGCCTTAAGCGCCGCGTCGAGGCCTT
A-3′
3′TTCTTAACGCCTTAAGCCCGGAATTCGCGGCGCAGCTCCGGA
AT-5′

5|Cell and Molecular Biology

Analysis 1. What did you understand with your activity?
2. What is produced after the synthesis of each strand?
3. Where do you think this process takes place?

Applicatio
n 1. Make a video simulation showing the process of DNA
transcription (RUBRIC is attached at the end of the module).

2. Why is it necessary for the pre-mRNA to undergo post-

transcriptional modifications?
 Because the initial precursor mRNA produced by transcription
often contains both exons (coding sequences) and introns, this
processing is critical for the correct translation of eukaryotic
genomes (non-coding sequences)

3. Explain how exon splicing is carried out.

 Exons will be spliced together. RNA molecules rather than
proteins do RNA splicing. These RNA molecules are called small
nuclear RNAs (snRNAs), and they are packaged with extra
proteins to form small ribonucleoproteins (snRNPs, pronounced as
"snurps"). These snRNPs recognize splice site sequences through

6|Cell and Molecular Biology

 the base – pairing between their RNA components and the
sequences in the pre-mRNA, and they carry out the chemistry of
splicing. And splicing is accomplished out along with snRNPs,
which are a collection of RNA–protein complexes.

LESSON 4 Organization of RNA

Activity Sketch the structure of an RNA molecule and label the components.
Answer the questions in Analysis.

7|Cell and Molecular Biology

Analysis

1. What are the bases that make up the RNA?

 RNA is made up of ribonucleotides that are linked through
phosphodiester bonds. A ribonucleotide in the RNA chain
comprises the following: 1) ribose (pentose sugar), 2) one of the
four nitrogenous bases [(Adenine (A), Uracil (U), Guanine (G),
and Cytosine (C)], and 3) a phosphate group.

2. How RNA differs from DNA in terms of complementary base

pairing and structural configuration?
 So, the three main structural differences between RNA and DNA
in terms of base pairing and structural configuration: RNA is
single-stranded, whereas DNA is double-stranded. In RNA, a
base called Uracil (U) is found instead of Thymine (T) in DNA.
Then, RNA contains the sugar ribose, whereas DNA contains the
sugar deoxyribose.

Application
1. Illustrate the biochemical configuration of an RNA molecule in a
three–dimensional presentation (Use the previous RUBRIC for
your guide).

8|Cell and Molecular Biology

 2. Using your own words, compare the structure of the significant
types of RNA molecules? Briefly discuss the function/s of each
type.
 There are three main types of RNA directly involved in protein
synthesis and these are messenger RNA (mRNA), ribosomal
RNA (rRNA), and transfer (tRNA). Messenger RNA molecules,
also known as transccripts, carry the coding sequences for
protein synthesis; Ribosomal RNA molecules form the core of a
cell’s ribosomes (the structures in which proetein synthesis
occurs); and Transfer RNA molecules transport amino acids to
the ribosomes during protein synthesis.

LESSON 5 Regulation of Gene Expression

Activity

Analysis
1. Based on the diagram, what will happen to the operon when
glucose and lactose are absent?
 Operon will be turn off

2. What happens to the operon when lac repressor blocks the

9|Cell and Molecular Biology

 operator?
 When lac repressor blocks operator by binding or sticking to it, it
prevents transcription of RNA polymerase resulting for the
operon to shut off.

3. What makes the Lac operon to be turned on?

 Two conditions should be met in order for the operon to be
turned on and that are Lactose is available while glucose should
be low or not existing.

4. What are the possible conditions that could make the Lac operon
to be turned off?

 When glucose is present and lactose is absent.

Application
1. How is transcription regulated in Eukaryotes?
 Transcription in eukaryotic cells is controlled by proteins that
bind to specific regulatory sequences and modulate the activity
of RNA polymerase.

2. How does lactose regulate the transcription of the lac operon?

 The lac repressor loses its capacity to bind to DNA when lactose
is present. This frees up the promoter for RNA polymerase to
attach to and transcribe the lac operon.

3. How does repressors and activators regulate transcription?

 Repressors stop a gene from being transcribed in response to an

external stimulus, whereas activators make a gene more
transcribed in response to an external stimulus.

4. Describe DNA methylation and histone acetylation. What is the

relationship of chromatin structure to transcription?

 DNA he addition of a methyl group occurs at the 5-carbon

position of cytosine residues in DNA while histone acetylation
is the addition of an acetyl group, a three-carbon molecule, to a
lysine "residue" at one end of a histone molecule. Chromatin
eventually condenses to form big loops of DNA, and this DNA
packaging in chromatin had significant effects as it will serve as
a mold for transcription. Thus, chromatin structure is a vital

10 | C e l l a n d M o l e c u l a r B i o l o g y
 characteristic of gene expression eukaryotic cells.

11 | C e l l a n d M o l e c u l a r B i o l o g y