PENDAHULUAN

BAHAN
 Metode

Volume lemak tubuh diukur dengan pemindai tomografi

mikrokomputer tiga dimensi (Rigaku Corporation, Tokyo, Jepang)
seperti yang dijelaskan sebelumnya.25Nilai unit jaringan lemak
Hounsfield disesuaikan antara -350,0 dan -145,0 sesuai dengan
instruksi pabrik pemindai. Pengukuran volume lemak tubuh
terbatas pada rongga perut. Lemak tubuh dibagi menjadi lemak
visceral dan lemak subkutan di sepanjang tulang rusuk.
HASIL
HASIL
KESIMPULAN
TERIMAKASIH
ZEBRAFISH
Volume 00, Number 00, 2017 Original Article
ª Mary Ann Liebert, Inc.
DOI: 10.1089/zeb.2017.1475

Fish Oil Suppresses Body Fat Accumulation in Zebrafish

Shinichi Meguro and Takahiro Hasumura

Abstract

Zebrafish is an often used model of vertebrate lipid metabolism. In this article, we examined the effects of diets
rich in fish oil, a dietary fat that has been shown to have antiobesity effects in mammals, or lard on body fat
accumulation in zebrafish. Adult female zebrafish were fed a high-fat diet containing 20% (w/w) fish oil or lard
for 4 weeks. Fish in the fish oil diet group had less body fat accumulation compared with those in the lard diet
group. In the intestine, expression of genes for the alpha (hadhaa) and beta (hadhb) subunits of the beta-
oxidation enzyme hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme
A hydratase was significantly increased in the fish oil diet group compared with the lard diet group ( p < 0.05). In
the liver, expression of the gene for fatty acid synthase (fasn) was significantly decreased in the fish oil diet
group compared with the lard diet group ( p < 0.05). These results suggest that the mechanisms underlying the
antiobesity effect of fish oil are similar in zebrafish and mammals.

Keywords: zebrafish, obesity, body fat, fish oil

Introduction dominantly contain n-6 and n-9 fatty acids.15,16 This suggests
that body fat accumulation is affected not only by the amount

O verweight and obesity are defined as abnormal or

excessive fat accumulation that presents a risk to
health.1 Although obesity is preventable, the World Health
Organization has stated that in 2014 more than 1.9 billion
adults, 18 years and older, were overweight, and of these
more than 600 million were obese.1 Metabolic syndrome,
which represents a cluster of conditions including high blood
pressure, high blood sugar levels, excess body fat around the
waist, and abnormal cholesterol levels, is becoming more
common as a result of the increasing prevalence of obesity.2
In addition, obesity is considered to be a key risk factor for
noncommunicable diseases such as cardiovascular diseases,
diabetes, musculoskeletal disorders, and some cancers.1
Epidemiological studies have shown a positive relationship
between dietary fat intake and obesity.3 A high-fat diet induces
obesity not only in humans but also in laboratory animals.4–6
Studies in humans have demonstrated that dietary fats rich in
saturated fatty acids are more obesogenic than dietary fats rich
in polyunsaturated fatty acids.7–10 These findings are supported
by the results of studies conducted in rat and mouse wherein a
greater accumulation of body fat was observed in animals fed
diets moderate or rich in saturated fatty acids.11–14
Fish oil is a mixture of polyunsaturated fatty acids, pre-
dominantly the n-3 fatty acids eicosapentaenoic acid and
docosahexaenoic acid. In murine models, fish oil has anti-
obesity effects compared with other edible oils, which pre-
of dietary fat consumed but also by its fatty acid composition.
However, the precise mechanisms underlying the antiobesity
effects of fish oil are not yet fully understood.
Zebrafish (Danio rerio) have organs and tissues similar to
those of humans in terms of both structure and function. In
addition, these fish are amenable to genetic manipulation,
breed readily in captivity, and can be inexpensively main-
tained, which together makes them a useful model organism
for investigating many human pathological conditions.17 For
example, several studies have found that zebrafish are an ex-
cellent model of vertebrate lipid metabolism.18,19 Furthermore,
several reports suggest that zebrafish are a suitable model or-
ganism for examining the mechanisms underlying lipid me-
tabolism leading to obesity. For example, overexpression of
the endogenous melanocortin antagonist agouti-related
protein or the serine/threonine protein kinase Akt1 results in
the development of adiposity in zebrafish.20,21 Commer-
cially available fluorescent lipids can be easily deployed in
live zebrafish to understand lipid signaling and metabo-
lism.22 Overfeeding and a high-fat diet have been shown
to induce body fat accumulation in zebrafish through path-
ophysiological pathways common with those underlying
mammalian obesity, making zebrafish a useful model of
human diet-induced obesity.23–25
In this article, we compared the effects of diets containing
fish oil or lard on body fat accumulation in female zebrafish.

Biological Science Research, Kao Corporation, Tochigi, Japan.

1
2 MEGURO AND HASUMURA

We also measured the levels of mRNAs related to fatty acid
oxidation and synthesis in the liver, skeletal muscle, and in-
testine of female zebrafish.
Materials and Methods
Ethics
All animal experiments were carried out in strict accor-
dance with the regulations approved by the Animal Care
and Experimentation Facility Committee of Kao Corporation
(Tokyo, Japan) and with those outlined in The Zebrafish
Book26 and Guide for the Care and Use of Laboratory Ani-
mals, 8th edition.27
Animals
Adult zebrafish were purchased from a local pet supplier
(Meito Suien Co., Ltd., Remix, Nagoya, Japan) and raised and
maintained under a 14:10-h light:dark cycle at 28C in re-
circulating aquaculture systems for zebrafish (Meito Suien Co.,
Ltd.). Water quality was ensured by monitoring and main-
taining parameters such as pH and the concentrations of am-
monia and nitrite in accordance with The Zebrafish Book.26
The animals used in the experiments were all female offspring
of the purchased fish, were from the same spawn, were aged
5–6 months postfertilization, and had not been bred in the
past. They were also not bred during the study period.
similar body weights. The fish were then placed in 1.7-L
tanks (eight fish per tank), and 80 mg of the experimental diet
(lard or fish oil) was added to each tank twice daily for 4
weeks. During feeding, water inflow to the tanks was paused
for 45 min and the fish were allowed to consume the diet for
30 min. Food intake in each tank was monitored weekly
during the experimental period.25 Energy intake was calcu-
lated from food intake as calories per fish. On the final day of
the experiment, all fish were weighed under anesthesia with
0.0075% (w/v) tricaine and blood samples were collected
into heparinized glass capillaries through the caudal artery.
The fish were then euthanized, and computed tomography
was used to determine body fat volume. Samples of liver,
skeletal muscle, and intestine were stored at -80C until
determination of the gene expression patterns.
Computed tomography measurement
of body fat volume
Body fat volume was measured with a three-dimensional
microcomputed tomography scanner (Rigaku Corporation,
Tokyo, Japan) as previously described.25 The Hounsfield unit
value of fat tissue was adjusted to between -350.0 and -145.0
in accordance with the scanner manufacturer’s instructions.
Measurement of body fat volume was limited to the ab-
dominal cavity. Body fat was divided into visceral fat and
subcutaneous fat along the ribs.

Experimental diets Analysis of plasma triacylglycerol level

The zebrafish were fed a diet containing 40% (w/w)
standard zebrafish chow (Otohime B2; Marubeni Nisshin
Feed Co. Ltd., Tokyo, Japan) and 40% (w/w) gluten extracted
from wheat (Wako Pure Chemical Industries, Ltd., Osaka,
Japan) supplemented with 20% (w/w) lard (Oriental Yeast
Co., Ltd., Tokyo, Japan) or fish oil (Kanematsu Shintoa
Foods Corporation, Tokyo, Japan). The fatty acid composi-
tions of the two diets are shown in Table 1.
Plasma was obtained from the blood samples by centri-
fugation at 1500 g for 5 min at 4C. The triacylglycerol
concentration in the plasma was enzymatically determined
by using a Triglyceride E-Test Kit (Wako Pure Chemical
Industries, Ltd.).
RNA extraction and quantitative real-time
polymerase chain reaction

Experimental design Total RNA was extracted from the samples of liver, skeletal
muscle, and intestine by using an RNeasy Lipid Tissue Mini
Female adult zebrafish were weighed under anesthesia Kit (Qiagen, K.K., Tokyo, Japan). cDNA was synthesized by
with 0.0075% (w/v) tricaine (Sigma-Aldrich, St. Louis, MO) using a High Capacity RNA-to-cDNA Kit (Applied Biosys-
and then allocated to two groups (n = 16–24 per group) with tems, CA). Quantitative real-time polymerase chain reaction
(PCR) was performed with an ABI PRISM genetic analyzer
Table 1. Fatty Acid Composition (Applied Biosystems) on the obtained cDNA by using TaqMan
of the High-Fat Experimental Diets Fast Universal PCR Master Mix or Fast SYBR Green Master
Mix (Applied Biosystems) in accordance with the manufac-
Fatty acid (%) Lard diet Fish oil diet turer’s instructions. The TaqMan expression assays were used
for the following genes: rplp0 (encoding ribosomal protein,
C14:0 2.81 4.28 large, P0; Dr03131549_m1), hadhaa (hydroxyacyl-Coenzyme
C16:0 25.11 20.56
C16:1 2.59 4.74 A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-
C18:0 14.12 5.02 Coenzyme A hydratase, alpha subunit a; Dr03098841_m1),
C18:1 31.92 14.58 and hadhb (hydroxyacyl-Coenzyme A dehydrogenase/3-
C18:2 9.42 2.71 ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase,
C18:3n3 1.05 0.87 beta subunit; Dr03094098_m1). The following primer set was
C18:4n3 0.81 1.64 used for SYBR Green-based quantitative real-time PCR for
C20:4n6 0.26 1.54 fasn (fatty acid synthase gene, XM_682295): forward (5¢–3¢),
C20:5n3 2.99 8.34 ATCTGTTCCTGTTCGATGGC; reverse (3¢–5¢), AGCATA
C22:5n3 0.27 1.22 TCTCGGCTGACGTT). The baseline and threshold were set
C22:6n3 2.55 26.52 manually in accordance with the manufacturer’s instructions.
Other 6.10 7.96
100.00 100.00 The expression of rplp0 was used as the endogenous standard
for normalization of the expression of the target genes.
ANTIOBESITY EFFECT OF FISH OIL IN ZEBRAFISH 3

Statistical analysis
All data are reported as mean – standard error (SE) or
mean + SE. The significance of observed differences was
evaluated by nested analysis of variance. A difference was
considered to be significant at p < 0.05. Statistical analyses
were performed with IBM SPSS Statistics ver. 24 (IBM
Corp., Armonk, NY).

Results
Food intake, body weight, and plasma
triacylglycerol concentration
During the experimental period, no marked abnormalities or
major differences were observed in feeding behavior between
the groups. Energy intake and plasma triacylglycerol concen-
tration were comparable between the groups (Table 2). How-
ever, body weight was significantly increased compared with
baseline in both groups over the experimental period ( p < 0.05,
Table 2); there were no among-group differences with respect
to body weight (data not shown).

Body fat accumulation

The volumes of visceral, subcutaneous, and total body fat
were significantly lower in the fish oil diet group than in the
lard diet group ( p < 0.05, Fig. 1A). Visceral, subcutaneous, and
total body fat volume ratios, calculated from body fat volume
and body weight, were also significantly lower in the fish oil
diet group than in the lard diet group ( p < 0.05, Fig. 1B).
FIG. 1. Body fat volume (A) and body fat volume ratio
Gene expression in the liver, skeletal (B) in zebrafish fed a lard or fish oil diet. Female adult
muscle, and intestine zebrafish were fed the indicated diet for 4 weeks (n = 16–24
per group). On the final day, the fish were euthanized, body
To examine the mechanism by which fish oil suppresses weights were measured, and body fat volumes were deter-
body fat accumulation compared with lard, we determined mined by using computed tomography. Values are presented
the expression levels of genes associated with fatty acid ox- as mean + SE. #p < 0.05, ##p < 0.01 compared with the group
idation and synthesis in liver, skeletal muscle, and intestine. fed the lard diet. SE, standard error.
The expression of hadhaa and hadhb was significantly higher
in the intestine in the fish oil diet group than in the lard diet
zebrafish and found less body fat accumulation in fish fed a
group ( p < 0.05, Fig. 2A, B). The expression of fasn was
high-fat diet containing 20% (w/w) fish oil compared with
significantly lower in the liver in the fish oil diet group than in
those fed a high-fat diet containing 20% (w/w) lard. To our
the lard diet group ( p < 0.05, Fig. 3).
knowledge, this is the first report that shows fish oil has an-
tiobesity effects in female zebrafish.
Discussion
A meta-analysis of randomized controlled trials in humans
In this article, we examined the effects of diets containing has shown that fish oil supplementation may reduce ab-
fish oil or lard on body fat accumulation and metabolism in dominal fat in overweight or obese adults.28 Hill et al. re-
ported that a fish oil-containing diet (18.2% w/w) suppressed
Table 2. Energy Intake, Body Weight, and Plasma central adiposity compared with lard- or corn oil-containing
Triacylglycerol Concentration in Zebrafish diets in Wistar rats.29 Ikemoto et al. reported that a fish oil-
fed High-Fat Experimental Diets containing diet (32% w/w) suppressed white adipose tissue
weight gain in C57BL/6J mice fed the diet for 16 weeks
Lard diet Fish oil diet compared with those fed palm oil-, lard-, rapeseed oil-,
soybean oil-, safflower oil-, or perilla oil-containing diets.15
Energy intake (kcal/fish) 2.67 2.66 Together with these previous findings, our present results
Body weight (mg) indicate that the suppressive effect of fish oil on body fat
Initiala 936.0 – 12.3 930.7 – 15.8 accumulation compared with lard in zebrafish may be similar
Finala 1346.4 – 32.6b 1277.2 – 34.3b to that seen in mammals.
Plasma triacylglycerol 816.1 – 48.0 779.7 – 96.5 We also found that the fish oil diet suppressed hepatic
(mg/dL)a expression of the gene encoding fatty acid synthase more
a
Values are presented as mean – SE. than did the lard diet. Although the importance of hepatic
b
p < 0.05 compared with initial body weight. Fasn in the regulation of body fat levels in mammals is rec-
SE, standard error. ognized,30,31 its involvement in the regulation of body fat in
4 MEGURO AND HASUMURA

FIG. 2. Expression levels of the fatty acid oxidation-related genes hadhaa (A) and hadhb (B) in the liver, intestine, and
skeletal muscle of zebrafish fed a lard or fish oil diet. Female adult zebrafish were fed the indicated diet for 4 weeks (n = 16–
24 per group). On the final day, the fish were euthanized and samples of the liver, intestine, and skeletal muscle were
collected and examined by quantitative real-time PCR. mRNA levels were normalized against that for rplp0. Values are
presented as mean + SE. #p < 0.05, ##p < 0.01 compared with the group fed the lard diet. PCR, polymerase chain reaction.

zebrafish is not yet fully understood. Recently, Lyssimachou
et al. showed that tributyltin, a mammalian obesogen, in-
creases hepatic Fasn levels concomitant with increased fat
content in zebrafish.32 This suggests that hepatic Fasn in
zebrafish may also be a lipogenic gene as it is in mammals.
Bargut et al. reported that a diet containing a high amount of
fish oil (fat as fish oil:soybean = 6:1) suppressed hepatic Fasn
levels and body fat accumulation compared with a diet con-
taining a high amount of lard (fat as lard:soybean oil = 6:1) in
C57BL/6J mice fed the diets for 8 weeks.33 Arai et al. re-
ported that KK mice fed docosahexaenoic acid- or eicosa-
pentaenoic acid-rich oil for 8 weeks had lower hepatic Fasn
levels and decreased body fat volume compared with mice
fed a mixed lard and safflower-oil diet (fat as lard:safflow-
er = 4:6).34 Together with the present results, these findings
suggest that zebrafish may be a suitable research tool for
examining the physiological roles not only of obesogens but
also of dietary fats in the development of obesity.

FIG. 3. fasn expression levels in the liver and intestine of zebrafish fed a lard or fish oil diet. Female adult zebrafish were
fed the indicated diet for 4 weeks (n = 16–24 per group). On the final day, fish were euthanized and samples of the liver and
intestine were collected and examined by quantitative real-time PCR. mRNA levels were normalized against that for rplp0.
Values are presented as mean + SE. #p < 0.05 compared with the group fed the lard diet. fasn, fatty acid synthase.
ANTIOBESITY EFFECT OF FISH OIL IN ZEBRAFISH
In rodents, upregulation of fatty acid beta-oxidation in li-
ver, intestine, and skeletal muscle contributes to the body fat
and blood lipid lowering effects of fish oil.16,35–40 In zebra-
fish, the genes encoding beta-oxidation enzymes are ex-
pressed in the liver, skeletal muscle, and intestine, and have
been suggested to be involved in the regulation of body
fat.24,25,41,42 In this study, the expression levels of hadhaa
and hadhb, which encode the alpha and beta subunits of a
protein that catalyzes mitochondrial beta-oxidation, were
upregulated more in the intestine of the fish fed the fish oil
diet than in that of the fish fed the lard diet. This is consistent
with the findings of similar investigations in mammals.16,40
No such difference was detected in the liver and skeletal
muscle. Further investigation of the reasons for this intestine-
specific upregulation of the expression of hadhaa and hadhb
in zebrafish is warranted.
In this article, we found that fish oil suppresses body fat
accumulation and alters the expression of genes related to beta-
oxidation and fatty acid synthesis in the liver and intestine in
female zebrafish. These results suggest that the different effects
of dietary fat on body fat accumulation might be detectable in
female zebrafish. In zebrafish, pathological conditions such as
body fat accumulation, hyperlipidemia, hypercholesterolemia,
fatty liver, and atherosclerosis can be induced through detri-
mental diets (e.g., high-fat, high-cholesterol, or high-glucose)
or dietary habits such as overfeeding.23–25,43,44 Thus, the re-
sults of the previous and present studies suggest that zebrafish
may be a useful model organism for elucidating the physio-
logical functions of nutrients, especially dietary fats.
Acknowledgments
The authors thank Ms. Mari Tsutsumi for maintaining the
zebrafish and measuring food intake, and Ms. Ayumi Okada
for measuring body fat volume by computed tomography.
Disclosure statement
No competing financial interests exist.
References
1. World Health Organization: Obesity and overweight. Fact
sheet, Updated June 2016 www.who.int/mediacentre/fact
sheets/fs311/en Accessed May, 2017.
2. Eckel RH, Grundy SM, Zimmet PZ. The metabolic syn-
drome. Lancet 2005;365:1415–1428.
3. Hariri N, Thibault L. High-fat diet-induced obesity in ani-
mal models. Nutr Res Rev 2010;23:270–299.
4. Warwick ZS, Schiffman SS. Role of dietary fat in calorie
intake and weight gain. Neurosci Biobehav Rev 1992;16:
585–596.
5. Tschöp M, Heiman ML. Rodent obesity models: an over-
view. Exp Clin Endocrinol Diabetes 2001;109:307–319.
6. Buettner R, Schölmerich J, Bollheimer LC. High-fat diets:
modeling the metabolic disorders of human obesity in ro-
dents. Obesity 2007;15:798–808.
7. DeLany JP, Windhauser MM, Champagne CM, Bray GA.
Differential oxidation of individual dietary fatty acids in
humans. Am J Clin Nutr 2000;72:905–911.
8. Kien CL, Bunn JY, Ugrasbul F. Increasing dietary palmitic
acid decreases fat oxidation and daily energy expenditure.
Am J Clin Nutr 2005;82:320–326.
5
9. Lawton GL, Delargy HJ, Brockman J, Smith FC, Blundell
JE. The degree of saturation of fatty acids influences post-
ingestive satiety. Br J Nutr 2000;83:473–482.
10. Piers LS, Walker KZ, Stoney RM, Soares MJ, O’Dea K.
Substitution of saturated with monounsaturated fat in a 4-
week diet affects body weight and composition of over-
weight and obese men. Br J Nutr 2003;90:717–727.
11. Yaqoob P, Sherrington EJ, Jeffery NM, Sanderson P,
Harvey DJ, Newsholme EA, et al. Comparison of the ef-
fects of a range of dietary lipids upon serum and tissue lipid
composition in the rat. Int J Biochem Cell Biol 1995;27:
297–310.
12. Bell RR, Spencer MJ, Sherriff JL. Voluntary exercise and
monounsaturated canola oil reduce fat gain in mice fed
diets high in fat. J Nutr 1997;127:2006–2010.
13. Silva APS, Guimaraes DED, Mizurini DM, Maia IC, Ortiz-
Costa S, Sardinha FL, et al. Dietary fatty acids early in life
affect lipid metabolism and adiposity in young rats. Lipids
2006;41:535–541.
14. Takeuchi H, Matsuo T, Tokuyama K, Shimomura Y, Su-
zuki M. Diet induced thermogenesis is lower in rats fed a
lard diet than in those fed a high-oleic acid safflower oil
diet, a safflower oil diet or a linseed oil diet. J Nutr 1995;
125:920–925.
15. Ikemoto S, Takahashi M, Tsunoda N, Maruyama K, Itakura
H, Ezaki O. High-fat diet-induced hyperglycemia and
obesity in mice: differential effects of dietary oils. Meta-
bolism 1996;45:1539–1546.
16. Mori T, Kondo H, Hase T, Tokimitsu I, Murase T. Dietary
fish oil upregulates intestinal lipid metabolism and reduces
body weight gain in C57BL/6J mice. J Nutr 2007;137:
2629–2634.
17. Lieschke GJ, Currie PD. Animal models of human disease:
zebrafish swim into view. Nat Rev Genet 2007;8:353–367.
18. Hölttä-Vuori M, Salo VT, Nyberg L, Brackmann C, En-
ejder A, Panula P, et al. Zebrafish gaining popularity in
lipid research. Biochem J 2010;429:235–242.
19. Anderson JL, Carten JD, Farber SA. Zebrafish lipid me-
tabolism: from mediating early patterning to the metabo-
lism of dietary fat and cholesterol. Methods Cell Biol 2011;
101:111–114.
20. Song Y, Cone RD. Creation of a genetic model of obesity
in a teleost. FASEB J 2007;21:2042–2049.
21. Chu CY, Chen CF, Rajendran RS, Shen CN, Chen TH, Yen
CC, et al. Overexpression of Akt1 enhances adipogenesis
and leads to lipoma formation in zebrafish. PLoS One 2012;
7:e36474.
22. Anderson JL, Carten JD, Farber SA. Using fluorescent
lipids in live zebrafish larvae: from imaging whole animal
physiology to subcellular lipid trafficking. Methods Cell
Biol 2016;133:165–178.
23. Oka T, Nishimura Y, Zang L, Hirano M, Shimada Y, Wang
Z, et al. Diet-induced obesity in zebrafish shares common
pathophysiological pathways with mammalian obesity.
BMC Physiol 2010;10:21.
24. Hasumura T, Shimada Y, Kuroyanagi J, Nishimura Y,
Meguro S, Takema Y, et al. Green tea extract suppresses
adiposity and affects the expression of lipid metabolism
genes in diet-induced obese zebrafish. Nutr Metab (Lond)
2012;9:73.
25. Meguro S, Hasumura T, Hase T. Body fat accumulation in
zebrafish is induced by a diet rich in fat and reduced by
supplementation with green tea extract. PLoS One 2015;18:
e0120142.
6 MEGURO AND HASUMURA
26. Westerfield M, Streisinger G. The Zebrafish Book Edition
5: A Guide for the Laboratory Use of Zebrafish Danio*
(Brachydanio) rerio. University of Oregon Press, Eugene,
OR, 2007.
27. Guide for the Care and Use of Laboratory Animals, 8th
edition. The National Academies Press, Washington, DC,
2010.
28. Du S, Jin J, Fang W, Su Q. Does fish oil have an anti-obesity
effect in overweight/obese adults? A meta-analysis of ran-
domized controlled trials. PLoS One 2015;10:e0142652.
29. Hill JO, Peters JC, Lin D, Yakubu F, Greene H, Swift L.
Lipid accumulation and body fat distribution is influenced
by type of dietary fat fed to rats. Int J Obes Relat Metab
Disord 1993;17:223–236.
30. Murase T, Misawa K, Minegishi Y, Aoki M, Ominami H,
Suzuki Y, et al. Coffee polyphenols suppress diet-induced
body fat accumulation by downregulating SREBP-1c and
related molecules in C57BL/6J mice. Am J Physiol En-
docrinol Metab 2011;300:E122–E133.
31. Jung CH, Cho I, Ahn J, Jeon TI, Ha TY. Quercetin reduces
high-fat diet-induced fat accumulation in the liver by reg-
ulating lipid metabolism genes. Phytother Res 2013;27:
139–143.
32. Lyssimachou A, Santos JG, André A, Soares J, Lima D,
Guimarães L, et al. The mammalian ‘‘Obesogen’’ tribu-
tyltin targets hepatic triglyceride accumulation and the
transcriptional regulation of lipid metabolism in the liver
and brain of zebrafish. PLoS One 2015;10:e0143911.
33. Bargut TC, Souza-Mello V, Mandarim-de-Lacerda CA,
Aguila MB. Fish oil diet modulates epididymal and in-
guinal adipocyte metabolism in mice. Food Funct 2016;7:
1468–1476.
34. Arai T, Kim HJ, Chiba H, Matsumoto A. Anti-obesity
effect of fish oil and fish oil-fenofibrate combination in
female KK mice. J Atheroscler Thromb 2009;16:674–
683.
35. Shearer GC, Savinova OV, Harris WS. Fish oil- how does it
reduce plasma triglycerides? Biochim Biophys Acta 2012;
1821:843–851.
36. Philp LK, Heilbronn LK, Janovska A, Wittert GA. Dietary
enrichment with fish oil prevents high fat-induced meta-
bolic dysfunction in skeletal muscle in mice. PLoS One
2015;10:e0117494.
37. Lionetti L, Mollica MP, Donizzetti I, Gifuni G, Sica R,
Pignalosa A, et al. High-lard and high-fish-oil diets differ
in their effects on function and dynamic behaviour of rat
hepatic mitochondria. PLoS One 2014;24:e92753.
38. Bargut TC, Frantz ED, Mandarim-de-Lacerda CA, Aguila
MB. Effects of a diet rich in n-3 polyunsaturated fatty acids
on hepatic lipogenesis and beta-oxidation in mice. Lipids
2014;49:431–444.
39. Nakatani T, Kim HJ, Kaburagi Y, Yasuda K, Ezaki O. A low
fish oil inhibits SREBP-1 proteolytic cascade, while a high-
fish-oil feeding decreases SREBP-1 mRNA in mice liver: re-
lationship to anti-obesity. J Lipid Res 2003;44:369–379.
40. van Schothorst EM, Flachs P, Franssen-van Hal NL, Kuda
O, Bunschoten A, Molthoff J, et al. Induction of lipid ox-
idation by polyunsaturated fatty acids of marine origin in
small intestine of mice fed a high-fat diet. BMC Genomics
2009;10:110.
41. Morais S, Knoll-Gellida A, André M, Barthe C, Babin PJ.
Conserved expression of alternative splicing variants of
peroxisomal acyl-CoA oxidase 1 in vertebrates and devel-
opmental and nutritional regulation in fish. Physiol Geno-
mics 2007;28:239–252.
42. Li JM, Li LY, Qin X, Ning LJ, Lu DL, Li DL, et al.
Systemic regulation of L-carnitine in nutritional metabo-
lism in zebrafish, Danio rerio. Sci Rep 2017;7:40815.
43. Stoletov K, Fang L, Choi SH, Hartvigsen K, Hansen LF,
Hall C, et al. Vascular lipid accumulation, lipoprotein ox-
idation, and macrophage lipid uptake in hypercholester-
olemic zebrafish. Circ Res 2009;104:952–960.
44. Meguro S, Hasumura T, Hase T. Coffee polyphenols exert
hypocholesterolemic effects in zebrafish fed a high-cholesterol
diet. Nutr Metab (Lond) 2013;10:61.
Address correspondence to:
Shinichi Meguro, PhD
Biological Science Research
Kao Corporation
2606 Akabane, Ichikai-machi
Haga-gun 321-3497
Tochigi
Japan
E-mail: meguro.shinichi@kao.co.jp