Original Study

Vitamin D Receptor Genetic Variants are

Associated With Chemotherapy Response and
Prognosis in Patients With Advanced
Non–Small-Cell Lung Cancer
Liwen Xiong,1 Jinsong Cheng,2 Jinyu Gao,3 Jipeng Wang,4
Xiaoning Liu,5 Lixin Wang4

Abstract
The purpose of this study was to explore whether vitamin D receptor (VDR) genetic polymorphisms affect the
chemotherapy response in non–small-cell lung cancer (NSCLC). Seven hundred fifty-five patients with ad-
vanced NSCLC (stage III [A ⴙ B] or stage IV) were enrolled. Only ApaI T > G significantly affected the
chemotherapy response and overall survival (OS), suggesting that ApaI thymine (T) > guanine (G) polymor-
phisms may be used as a marker for chemotherapy response in patients with NSCLC.
Background: The aim of this study was to explore the association between vitamin D receptor (VDR) genetic
polymorphisms and platinum-based chemotherapy response as well as the prognosis of non–small-cell lung cancer
(NSCLC) in a Chinese cohort. Patients and Methods: Seven hundred fifty-five patients with advanced NSCLC (stage
III [A ⫹ B] or stage IV) were enrolled. Platinum-based chemotherapy was given to each patient with NSCLC, and the
therapeutic effect was evaluated. The VDR polymorphisms were genotyped. Results: Three hundred twenty-one
(42.5%) patients responded to chemotherapy (complete response [CR] or partial response [PR]) and 434 (57.5%)
patients were nonresponders (stable disease [SD] or progressive disease [PD]). The genotypic and allelic frequencies
of FokI, BsmI, and TaqI were not significantly different between chemotherapy responders and nonresponders.
However, the genotypic and allelic frequencies of ApaI thymine (T) ⬎ guanine (G) were significantly different between
the responders and nonresponders. Multivariate logistic regression analysis showed that GG genotype carriers of
ApaI T ⬎ G had a higher chance of being responders. The ApaI T ⬎ G polymorphisms affected mean overall survival
(OS). The GG genotype carriers of ApaI polymorphisms had a longer mean OS compared with TT carriers. Multivariate
Cox regression analyses showed that ApaI T ⬎ G was significantly associated with OS. Conclusion: We found that
there was an effect of ApaI T ⬎ G polymorphisms of the VDR gene on the chemotherapy response in patients with
NSCLC, as well as a prognostic role of the VDR gene polymorphisms in Chinese patients with advanced NSCLC.

Clinical Lung Cancer, Vol. xx, No. x, xxx © 2013 Elsevier Inc. All rights reserved.
Keywords: Chemotherapy response, Non–small-cell lung cancer, Polymorphisms, Prognosis, Vitamin D receptor

Liwen Xiong and Jinsong Cheng contributed equally to this work Medical University, 6 Beijing Road West, Huai’an, Jiangsu 223300, P.R.
China
1 5
Department of Pulmonary Disease, Shanghai Chest Hospital, Shanghai Jiao Tong Central Laboratory, Huai’an First People’s Hospital, Nanjing Medical
University, 241 Huaihai West Road, Shanghai 200030, P.R. China University, 6 Beijing Road West, Huai’an, Jiangsu 223300, P.R. China
2
Department of Medical Oncology, Huai’an First People’s Hospital, Nanjing Medical
University, 6 Beijing Road West, Huai’an, Jiangsu 223300, P.R. China Received: Oct 14, 2012; Revised: Jan 21, 2013; Accepted: Jan 29, 2013
3
Department of Gynecology and Obstetrics, Huai’an First People’s Hospital,
Address for correspondence: Lixin Wang, MD, Department of Respiratory Medicine,
Nanjing Medical University, 6 Beijing Road West, Huai’an, Jiangsu 223300, P.R.
Huai’an First People’s Hospital, Nanjing Medical University, 6 Beijing Road West,
China Huai’an, Jiangsu 223300, P.R. China
4
Department of Respiratory Medicine, Huai’an First People’s Hospital, Nanjing E-mail contact: drwlx@yahoo.com.cn

1525-7304/$ - see frontmatter © 2013 Elsevier Inc. All rights reserved.

http://dx.doi.org/10.1016/j.cllc.2013.01.004 Clinical Lung Cancer Month 2013 1
AQ: 1 VDR Polymorphism and Chemotherapy Response of NSCLC
Introduction Table 1 Patient Characteristics in Chemotherapy Responders
Non–small-cell lung cancer (NSCLC) is the most common and Nonresponders
cause of cancer death in many countries. Although there has been
recent progress in treatment, the prognosis of advanced NSCLC Responders Nonresponders P
Patient Characteristics
(%) (%) Value
remains very poor. Currently, platinum-based chemotherapy is
the first line of treatment for advanced NSCLC; however, the Age (y) 65.6 ⫾5.3 65.4 ⫾5.1 NS
response to platinum-based chemotherapy in patients with Sex
NSCLC varies significantly.1 Only about one third of patients Male 210 (65.42) 283 (65.21)
respond well to standard chemotherapy. The mechanism by NS
Female 111 (34.58) 151 (34.79)
which NSCLC patients respond differently to chemotherapy re-
Smoking Status
mains unclear. Recent studies have shown that genetic back-
Nonsmokers 115 (35.83) 164 (37.79)
ground plays an important role in determining response in pa- NS
tients with cancer who receive chemotherapy.2-4 Smokers 206 (64.17) 270 (62.21)
Epidemiologic studies indicate that vitamin D insufficiency could Histologic Type
have a causative role in various human cancers.5-9 Recent studies Squamous cell carcinoma 150 (46.73) 190 (43.78)
NS
have shown that vitamin D potentiates gemcitabine- and cisplatin- Adenocarcinoma 171 (53.27) 244 (56.22)
mediated growth inhibition in human bladder cancer models in vitro Stage 217 265
and in vivo, suggesting that the vitamin D signal pathway might
IIIA 121 (38.78) 111 (26.18)
determine the chemotherapy response.10
IIIB 87 (27.88) 144 (33.96) ⬍ .001
The effect of vitamin D is mediated by the vitamin D receptor
(VDR), a member of the nuclear receptor superfamily of ligand- IV 104 (33.33) 169 (39.86)
inducible transcription factors, which are involved in many patho- Differentiation
logic processes.11-13 Several single-nucleotide restriction fragment Good 101 (46.73) 178 (43.78)
length polymorphisms have been described in the VDR gene in as- Moderate 132 (37.38) 143 (36.18) .001
sociation with carcinogenesis. Increasing studies have revealed that Poor 88 (15.89) 113 (20.05)
VDR gene polymorphisms influence the risk of certain cancers, in-
Chemotherapy Regimens
cluding breast, prostate, skin, liver, colon-rectum, and bladder can-
DDP/CBP ⫹ TAX/TXT/DOC 121 (46.73) 176 (43.78)
cers, renal cell carcinoma, and malignant melanoma.14-19 In lung
cancer, it has been established that VDR gene polymorphisms may be DDP/CBP ⫹ GEM 113 (37.38) 143 (36.18) NS

associated with survival in patients with early-stage and advanced
NSCLC in American patients.20,21 However, the role of VDR gene
polymorphisms in determining the chemotherapy response in pa-
tients with NSCLC remains undocumented. The prognostic role of
VDR gene polymorphisms in Chinese patients with NSCLC also has
not been reported.
Patients and Methods
A total of 755 patients with inoperable advanced-stage NSCLC—
namely, stage III (A ⫹ B) and stage IV NSCLC—that was confirmed
cytologically or histologically were enrolled in this study. We used
The seventh edition of the TNM Classification of Malignant Tu-
mors published in 2009.22 To avoid the potential influence of poor
clinical conditions on chemotherapy response, other eligibility
criteria included normal blood chemistry panels (hemoglobin
value ⬎ 9 g/dL, neutrophil count ⬎ 1500/mm3, and platelet
count ⬎ 100,000/mm3), normal hepatic function (bilirubin ⬍
1.5 times the normal upper limit, aspartate aminotransferase and
alanine aminotransferase levels ⬍ 2 times the normal upper
limit), normal renal function (creatine clearance rate ⬎ 50 mL/s),
and a normal electrocardiogram at the beginning of treatment.23
Exclusion criteria included symptomatic brain metastases, spinal
cord compression, uncontrolled massive pleural effusion, other
chronic disease, and previous chemotherapy. The study was ap-
proved by the ethics committees of our hospitals, and written
informed consent was obtained from each participant.
DDP/CBP ⫹ NVB 87 (15.89) 115 (20.05)
Abbreviations: CBP ⫽ carboplatin; DDP ⫽ cisplatin; DOC ⫽ docetaxel; GEM ⫽ gemcitabine;
NS ⫽ not significant; NVB ⫽ vinorelbine; TAX ⫽ Taxol/paclitaxel; TXT ⫽ Taxetere/docetaxel.
Chemotherapy Regimens and Therapeutic
Effect Evaluation
All patients received platinum-based chemotherapy after diagnosis
(Table 1). Patient response to treatment after 4 cycles was deter-
mined by the World Health Organization criteria,23 which classify
response into 4 categories: complete response (CR), partial response
(PR), stable disease (SD), and progressive disease (PD). CR was de-
fined as complete disappearance of all measurable lesions. PR re-
quired at least 50% reduction in measurable lesions. Patients with
SD had less than a 50% decrease or no more than a 25% increase in
the size of measurable lesions. PD was assigned to patients when
measurable lesions increased by more than 25% or new lesions ap-
peared. For data analysis, CR and PR were combined as responders,
and SD and PD were grouped as nonresponders. The cycle was
repeated every 3 weeks for a maximum of 6 cycles. The dose of
cytotoxic agents in the next cycle would be reduced by 25% if there
was grade ⬎ 3 nonhematologic toxicity (except for alopecia and
vomiting) and grade 4 hematologic toxicity, febrile neutropenia, or
infection and/or thrombocytopenia associated with bleeding. The
chemotherapy response was assessed by 2 independent oncologists
who were blinded to our study.

2 Clinical Lung Cancer Month 2013


Table 2 Polymerase Chain Reaction–Restriction Fragment Length Polymorphism Primers and Conditions for VDR
Gene Polymorphisms
SNP Primer
5=AGCTGGCCCTGGCACTGACTCTGCTCT3=(F)
FokI
5=ATGGAAACACCTTGCTTCTTCTCCCTC3=(R)
5=CAACCAAGACTACAAGTACCGCGTCAGTGA3=(F)
BsmI
5=AACCAGCGGGAAGAGGTCAAGGG3=(R)
5=CAGAGCATGGACAGGGAGCAA3=(F)
ApaI
5=GCAACTCCTCATGGCTGAGGTCTC3=(R)
5=CAGAGCATGGACAGGGAGCAA3=(F)
TaqI
5=GCAACTCCTCATGGCTGAGGTCTC3=(R)
Abbreviations: A ⫽ adenine; C ⫽ cytosine; G ⫽ guanine; SNP ⫽ single-nucleotide polymorphism; T ⫽ thymine.
Sample Collection and Genotyping
Venous blood (10 mL) was collected from each patient into tubes
containing 50 mmol ethylenediaminetetraacetic acid per liter, and
genomic DNA was isolated with DNA blood Mini kit (QIAamp
DNA Blood Mini Kit, QIAGEN, Hilden, Germany) according to
the manufacturer’s instructions. Four diallelic polymorphisms of
VDR were genotyped: FokI C ⬎ T (rs10735810) and TaqI T ⬎ C
(rs10735810) polymorphic sites on the coding sequence, BsmI A ⬎
G (rs1544410) and ApaI G ⬎ T (rs7975232) on the last intron. The
polymerase chain reaction (PCR) technique was applied, followed by
restriction fragment length polymorphism assays. The primer and
conditions for VDR gene polymorphisms are listed in Table 2. All
PCR products were sized by electrophoresis on 2% agarose gel
stained with ethidium bromide.
Outcome Data Collection
Overall survival (OS) and progression-free survival (PFS) were the
end points in this study. OS was calculated from the date of chemo-
therapy to the date of last follow-up or death from any cause. PFS was
defined as the interval between the date of chemotherapy and the
date of confirmed relapse. Patients who were not deceased were cen-
sored at the last date they were known to be alive based on date of last
contact.
Statistical Analyses
␹2 tests were used to compare genotype frequency and demo-
graphic distributions between cases and controls. Multiple logistic
regression analyses were used to evaluate if each polymorphism was
independently associated with NSCLC when adjusted for the poten-
tial confounding effects of important clinical variables. The odds
ratios (ORs) and 95% confidence intervals (CIs) were calculated.
The D= value for the 4 single-nucleotide polymorphisms (SNPs)
studied were calculated with SHEsis software.24 The differences in
OS and PFS across different genotypes were compared using the
log-rank test with adjustment for age, sex, smoking status, cancer
stage, differentiation status, and chemotherapy regimens. A Cox re-
gression model was performed to obtain the adjusted hazard ratio
(HR) and 95% CI for potential prognostic factors for OS in patients
with NSCLC. P ⬍ .05 was considered statistically significant. All
Liwen Xiong et al
Base Change Temperature
C/T 61°C
G/A 57°C
G/T 60°C
T/C 60°C
analyses were performed using SPSS software (Statistical Package for
the Social Sciences, version 16.0, SPSS Inc, Chicago, IL).
Results
Patient Characteristics
All participants received platinum-based chemotherapy: 321
(42.5%) were responders (CR ⫹ PR) and 434 (57.5%) were nonre-
sponders (SD ⫹ PD). There were no significant differences in mean
age, sex distribution, smoking status, histologic type, and chemo-
therapy agent (Table 1). Nonresponders had a higher prevalence of
stage IIIB and stage IV disease than did responders (P ⬍ .001); they
also had poorer differentiation (P ⫽ .001).
Treatment Response and Genotype
The median number of chemotherapy cycles was 4.5 (range, 2-6
cycles). Genotype frequencies of VDR polymorphisms in chemother-
apy responders and nonresponders were found to be in Hardy-Wein-
berg equilibrium (all P ⬎ .05). The genotype and allele frequencies
of FokI, BsmI, and TaqI were not significantly different between
chemotherapy responders and nonresponders. However, the geno-
type and allele frequencies of ApaI T ⬎ G were significantly different
between the responders and nonresponders. Chemotherapy re-
sponders had a markedly higher GG genotype of ApaI than did
nonresponders (35.20% vs. 26.50%; overall P ⫽ .002) (Table 3).
With TT as the reference, multivariate logistic regression analysis
showed that GG genotype carriers had a higher chance of being
responders (adjusted OR, 2.15; 95% CI, 1.30-3.11; adjusted P ⫽
.002), with adjustment for age, sex, smoking status, histologic type,
stage, and chemotherapy status. Carrying the G allele represented a
higher chance of being a responder after adjustment of the previously
mentioned clinical variables (adjusted OR, 1.51; adjusted P ⫽ .002)
compared with carriers of the T allele. However, multivariate logistic
regression analysis did not reveal any association between FokI,
BsmI, and TaqI polymorphisms and chemotherapy response in these
patients (all P ⬎ .05 (Table 3).
VDR Haplotypes and Chemotherapy Response
The association between the VDR haplotypes and chemotherapy
response status were analyzed in this study. The D= value for the 4
SNPs studied were calculated with SHEsis software. All 4 SNPs were
Clinical Lung Cancer Month 2013 3
 VDR Polymorphism and Chemotherapy Response of NSCLC
Table 3 Genotype Frequencies for VDR Polymorphisms in Responders and Nonresponders

Responders Nonresponders
Genotype OR 95% CI ␹2 Test P Value
n % n %
FokI
CC 82 25.55 134 30.88 1.00
CT 188 58.57 229 52.76 1.34 0.96-1.88 2.95 .086
TT 51 15.89 71 16.36 1.17 0.75-1.85 0.48 .488
C 352 54.83 497 57.26 1.00
T 290 45.17 371 42.74 1.10 0.90-1.36 0.88 .347
BsmI
AA 110 34.27 133 30.65 1.00
AG 147 45.79 199 45.85 0.89 0.64-1.24 0.45 .503
GG 64 19.94 102 23.50 0.76 0.51-1.13 1.82 0.178
A 367 57.17 465 53.57 1.00
G 275 42.83 403 46.43 0.86 0.70-1.06 1.93 0.165
ApaI
TT 46 14.33 94 21.66 1.00
TG 162 50.47 225 51.84 1.47 0.98-2.21 3.49 0.062
GG 113 35.20 115 26.50 2.15 1.30-3.11 9.86 0.002
T 254 39.56 413 47.58 1.00
G 388 60.44 455 52.42 1.51 1.23-1.91 9.62 0.002
TaqI
TT 86 26.79 140 32.26 1.00
TC 152 47.35 196 45.16 1.26 0.90-1.78 1.79 0.181
CC 83 25.86 98 22.58 1.38 0.93-2.05 2.52 0.112
T 324 50.47 476 54.84 1.00
C 318 49.53 392 45.16 1.19 0.97-1.46 2.83 0.092

Abbreviations: A ⫽ adenine; C ⫽ cytosine; CI ⫽ confidence interval; G ⫽ guanine; OR ⫽ odds ratio; T ⫽ thymine.

Table 4 Haplotype Analysis of VDR Gene and Chemotherapy Response Status

Responders Nonresponders
FokI BsmI ApaI TaqI ␹2 Test P Value OR (95% CI)
(Frequency) (Frequency)
C A G T 94 (0.109) 15 (0.024) 39.56 ⬍ .001 4.967 (2.87-8.586)
C G T C 40 (0.047) 61 (0.095) 14.06 ⬍ .001 0.463 (0.307-0.698)
C G T T 73 (0.085) 75 (0.117) 4.41 .04 0.696 (0.496-0.977)
T A G T 35 (0.041) 60 (0.094) 17.10 ⬍ .001 0.416 (0.271-0.637)
T G T C 60 (0.070) 15 (0.024) 16.02 ⬍ .001 3.023 (1.715-5.327)

Abbreviations: A ⫽ adenine; C ⫽ cytosine; CI ⫽ confidence interval; G ⫽ guanine; OR ⫽ odds ratio; T ⫽ thymine.

All frequencies ⬍ 0.03 are ignored in analysis.

in strong linkage disequilibrium (all D= ⬎ 0.8). The estimated hap-
lotype frequencies of the VDR SNPs are shown in Table 4. The
haplotypes Cfok- ABsm-GApa-Ttaq and Tfok- GBsm-TApa-CTaq showed
a significantly higher chance of being responders to chemotherapy
(OR, 4.967 and 3.023, both P ⬍ .001 (Table 4), whereas the Cfok-
GBsm-TApa-Ctaq, Cfok- GBsm-TApa-TCTaq and Tfok- ABsm-GApa-Ttaq
had a significantly lower chance of being chemotherapy responders
(all P ⬍ .05 (Table 4).
The associations between the clinical variables and PFS as well as
OS were analyzed by the log-rank test (Table 5). For PFS, age (P ⫽
.014) and smoking (P ⫽ .044) were significantly associated with the
median PFS. For OS, age (P ⬍ .001), smoking (P ⫽ .004), higher
cancer stage (P ⬍ .001), and poorer differentiation (P ⬍ .001) had
markedly shorter OS (all P ⬍ .05). Chemotherapy regimens did not
influence the OS and PFS (both P ⬎ .05). The ApaI T ⬎ G poly-
morphisms did not significantly affect PFS (P ⫽ .058) but did affect

4 Clinical Lung Cancer Month 2013

 Liwen Xiong et al
Table 5 Associations Between Clinical Variables, VDR Polymorphisms, and PFS and OS in Patients With NSCLC Who
Underwent Chemotherapy

Variable Median PFS 95% CI P Value Median OS 95% CI P Value

Age (y)
⬍ 60 5.76 4.85-6.76 9.19 8.56-10.97
.014 ⬍ .001
⬎ 60 5.46 4.58-5.57 8.78 8.33-9.76
Sex
Male 5.67 5.23-6.28 8.86 8.23-8.98
.063 .105
Female 5.69 5.31-6.19 8.87 8.18-9.14
Smoking Status
Nonsmokers 5.76 5.23-5.96 8.89 8.25-9.01
.044 .004
Smoker 5.61 5.22-5.75 8.22 8.01-8.56
Stage
IIIA 5.72 5.27-5.67 9.15 8.67-11.02
IIIB 5.61 5.13-5.98 .185 8.77 7.88-10.56 .014
IV 5.65 5.11-5.79 8.37 8.19-9.79
Differentiation
Good 5.58 5.35-5.88 8.98 8.54-9.34
.071 ⬍ .001
Moderate ⫹ poor 5.61 5.31-5.82 8.34 8.23-8.56
Chemotherapy Regimens
DDP/CBP ⫹ TAX/TXT/DOC 5.35 5.26-5.89 8.56 8.25-8.86
DDP/CBP ⫹ GEM 5.32 5.28-5.90 .144 8.52 8.23-8.87 .189
DDP/CBP ⫹ NVB 5.38 5.31-5.87 8.54 8.25-8.83
ApaI T > G Polymorphism
ApaI TT 5.27 4.53-5.43 8.19 8.05-8.37
ApaI TG 5.24 4.88-5.57 .058 8.44 8.23-8.86 ⬍ .001
ApaI GG 5.53 5.22-6.05 10.12 8.65-11.22

Abbreviations: CBP ⫽ carboplatin; CI ⫽ confidence interval; DDP ⫽ cisplatin; DOC ⫽ docetaxel; G ⫽ guanine; GEM ⫽ gemcitabine; NS ⫽ not significant; NVB ⫽ vinorelbine; OS ⫽ overall survival;
PFS ⫽ progression-free survival; T ⫽ thymine; TAX ⫽ Taxol/paclitaxel; TXT ⫽ Taxetere/docetaxel; VDR ⫽ vitamin D receptor.

mean OS (P ⬍ .001). The GG genotype carriers of the ApaI poly-
morphism had longer OS compared with TT carriers (10.12 vs. 8.19
months). Multivariate Cox proportional hazards regression models
were performed to estimate HRs for PFS and OS and their 95% CIs,
with adjustment for age, sex, smoking status, histologic type, stage,
and chemotherapy status. With ApaI GG as the reference, the HR for
the TT genotype of ApaI was 1.43 for PFS (95% CI, 0.99-2.78; P ⫽
.053) and 2.84 for OS (95% CI, 2.63-3.94; P ⬍ .001). The gene
polymorphisms at the other 3 loci did not influence PFS and OS
(data not shown).
Discussion
In this study, we investigated the role of 4 loci of VDR gene
polymorphisms in determining the chemotherapy response rate
and clinical outcome in Chinese patients with advanced NSCLC.
We found that only the SNPs of ApaI and not the other 3 SNPs
were closely associated with the chemotherapy response and prog-
nosis of NSCLC. Carriers with the GG genotype of ApaI had
higher response rates to chemotherapy. The ApaI polymorphisms
did not significantly affect PFS but did affect mean OS. The GG
genotype carriers of the ApaI polymorphism had longer mean OS
compared with TT carriers. Multivariate Cox regression analyses
showed that ApaI T ⬎ G was significantly associated with OS. To
the best of our knowledge, this is the first study studying the effect
of VDR gene polymorphisms on chemotherapy response in pa-
tients with NSCLC and is also the first study showing the prog-
nostic role of VDR gene polymorphisms in Chinese patients with
advanced NSCLC. Because identification of predictive markers
for response to chemotherapy is clinically warranted to further
improve the efficacy of chemotherapy in advanced NSCLC, our
findings suggest that the ApaI polymorphism of the VDR gene
might be a genetic marker for individualized chemotherapy and a
prognostic marker after chemotherapy.
Vitamin D has been shown to have antiproliferative effects in a
wide variety of cancers, including lung cancer. The anticancer
effects of vitamin D are mediated primarily by its active metabo-
lite, 1,25-dihydroxyvitamin D (calcitriol), through VDR signal-
ing.25 High nuclear VDR expression was associated with im-
proved OS after adjusting for age, sex, stage, smoking status, and
histologic type, suggesting that nuclear VDR status may be a
prognostic marker in NSCLC.25 Many studies have reported that

Clinical Lung Cancer Month 2013 5

 VDR Polymorphism and Chemotherapy Response of NSCLC
VDR gene polymorphisms may influence the risk and prognosis of
cancers in humans.18,26 A previous report of patients with early-
stage NSCLC who underwent surgery showed that increasing
levels of circulating vitamin D and certain VDR gene polymor-
phisms and haplotypes were associated with better survival
outcome.
The anticancer actions of vitamin D and its receptor have been
reported previously. In 1 study, biopsy specimens were obtained
from patients being treated for adenocarcinoma of the esophagus.
Tumors that did not respond to neoadjuvant therapy had greater
expression of VDR than did tumors that responded completely. Ex-
pression of VDR declined with tumor dedifferentiation. The data
suggest that a relationship between VDR expression and response to
neoadjuvant therapy is plausible.27 There have been no reports re-
garding the association between VDR polymorphisms and the che-
motherapy response. Our findings offer a method to screen candi-
date patients for chemotherapy or predict the treatment response in
those who have undergone chemotherapy.
ApaI (rs7975232) is located in intron 8 at the 3= end of the VDR
gene. In general, the majority of polymorphisms in the VDR gene are
found to be in regulatory areas such as the 5= promoter area and the
3= untranslated region rather than in coding exons.18 The ApaI poly-
morphisms of the VDR gene are considered to be silent SNPs. These
polymorphisms do not change the amino acid sequence of the en-
coded protein but affect gene expression through regulation of
mRNA stability. The ApaI polymorphism has been analyzed in only
a few, generally small studies that were frequently limited to only 1
racial group. However, in contrast with all other polymorphisms,
in most cases an association with cancer risk was reported, includ-
ing breast, prostate, and ovarian cancers.28-30 Because this study
was not designed as a case-control study to investigate the associ-
ation of VDR gene polymorphisms and NSCLC risk, we did not
have any findings on this aspect. A previous study showed that
VDR polymorphisms and cancer status have independent effects
on survival of patients with NSCLC who have undergone opera-
tion31; in this study, we extended this effect to patients with
advanced NSCLC who were not candidates for operation but
were candidates for standard chemotherapy.
Several limitations in this study must be addressed. This study was
a single-center cohort investigation on a relatively small scale, and
thus replication studies with large independent cohorts are war-
ranted. Also, we did not detect VDR expression in either serum or
cancer tissue of participants with NSCLC. The detection of VDR
protein will help clarify the effect of the genetic variants of the VDR
gene on chemotherapy response.
Clinical Practice Points
● The identification of predictive markers for response to chemo-
therapy is clinically warranted to further improve the efficacy of
chemotherapy in advanced NSCLC.
● Recent studies have shown that genetic background plays an im-
portant role in determining chemotherapy response in patients
with cancer receiving chemotherapy. Increasing studies have re-
vealed that VDR gene polymorphisms influence the risk of certain
cancers, including breast, prostate, skin, colon-rectum, liver, and
6 Clinical Lung Cancer Month 2013
bladder cancers, renal cell carcinoma, and malignant melanoma,
but its role in NSCLC remains unknown.
● In this study, we found that the genotypic and allelic frequencies of
FokI, BsmI, and TaqI were not significantly different between
chemotherapy responders and nonresponders. However, the ge-
notypes of ApaI T ⬎ G were significantly different between the
responders and nonresponders.
● Multivariate logistic regression analysis showed the GG genotype
carriers of ApaI T ⬎ G had a higher chance of being responders.
The ApaI T ⬎ G polymorphisms affected mean OS. GG genotype
carriers of ApaI polymorphisms had a longer mean OS compared
with TT carriers.
● Our findings suggest that detection of the ApaI polymorphism of
VDR might be used as a genetic marker for individualized chemo-
therapy and a prognostic marker after chemotherapy.
Acknowledgments
We thank Dr Joseph Tang for help in statistical analyses and
writing this manuscript.
Disclosure
The authors have stated that they have no conflicts of interest.
References
1. Chang A. Chemotherapy, chemoresistance and the changing treatment landscape
for NSCLC. Lung Cancer 2011; 71:3-10.
2. Gautschi O, Hugli B, Ziegler A, et al. Cyclin D1 (CCND1) A870G gene polymor-
phism modulates smoking-induced lung cancer risk and response to platinum-based
chemotherapy in non-small cell lung cancer (NSCLC) patients. Lung Cancer 2006;
51:303-11.
3. Zhou C, Ren S, Zhou S, et al. Predictive effects of ERCC1 and XRCC3 SNP on
efficacy of platinum-based chemotherapy in advanced NSCLC patients. Jpn J Clin
Oncol 2010; 40:954-60.
4. Cui LH, Yu Z, Zhang TT, et al. Influence of polymorphisms in MTHFR 677
C¡T, TYMS 3R¡2R and MTR 2756 A¡G on NSCLC risk and response to
platinum-based chemotherapy in advanced NSCLC. Pharmacogenomics 2011; 12:
797-808.
5. Trump DL, Chadha MK, Sunga AY, et al. Vitamin D deficiency and insufficiency
among patients with prostate cancer. BJU Int 2009; 104:909-14.
6. Garland CF, Gorham ED, Mohr SB, et al. Vitamin D for cancer prevention: global
perspective. Ann Epidemiol 2009; 19:468-83.
7. Cross HS, Peterlik M. Vitamin D, calcium, and cancer. Anticancer Res 2009; 29:
3685.
8. Hines SL, Jorn HK, Thompson KM, et al. Breast cancer survivors and vitamin D: a
review. Nutrition 2010; 26:255-62.
9. Mitchell D. The relationship between vitamin D and cancer. Clin J Oncol Nurs
2011; 15:557-60.
10. Ma Y, Yu WD, Trump DL, et al. 1,25D3 enhances antitumor activity of gemcit-
abine and cisplatin in human bladder cancer models. Cancer 2010; 116:3294-303.
11. Subramaniam N, Leong GM, Cock TA, et al. Cross-talk between 1,25-dihy-
droxyvitamin D3 and transforming growth factor-beta signaling requires binding of
VDR and Smad3 proteins to their cognate DNA recognition elements. J Biol Chem
2001; 276:15741-6.
12. Kato S, Yoko Y. VDR function in skin. [Article in Japanese] Clin Calcium 2004;
14:116-9.
13. Slattery ML. Vitamin D receptor gene (VDR) associations with cancer. Nutr Rev
2007; 65:S102-104.
14. Slatter ML, Yakumo K, Hoffman M, et al. Variants of the VDR gene and risk of
colon cancer (United States). Cancer Causes Control 2001; 12:359-64.
15. Yaylim-Eraltan I, Arzu Ergen H, Arikan S, et al. Investigation of the VDR gene
polymorphisms association with susceptibility to colorectal cancer. Cell Biochem
Funct 2007; 25:731-7.
16. Han J, Colditz GA, Hunter DJ. Polymorphisms in the MTHFR and VDR genes
and skin cancer risk. Carcinogenesis 2007; 28:390-7.
17. Slattery ML, Herrick J, Wolff RK, et al. CDX2 VDR polymorphism and colorectal
cancer. Cancer Epidemiol Biomarkers Prev 2007; 16:2752-5.
18. Köstner K, Denzer N, Müller CS, et al. The relevance of vitamin D receptor (VDR)
gene polymorphisms for cancer: a review of the literature. Anticancer Res 2009;
29:3511-36.
19. Li C, Liu Z, Wang LE, et al. Haplotype and genotypes of the VDR gene and
cutaneous melanoma risk in non-Hispanic whites in Texas: a case-control study. Int
J Cancer 2008; 122:2077-84.

20. Heist RS, Zhou W, Wang Z, et al. Circulating 25-hydroxyvitamin D, VDR poly-
morphisms, and survival in advanced non-small-cell lung cancer. J Clin Oncol 2008;
26:5596-602.
21. Zhou W, Heist RS, Liu G, et al. Polymorphisms of vitamin D receptor and survival
in early-stage non-small cell lung cancer patients. Cancer Epidemiol Biomarkers Prev
2006; 15:2239-45.
22. Goldstraw P, Crowley J, Chansky K, et al. The IASLC Lung Cancer Staging Project: pro-
posals for the revision of the TNM stage groupings in the forthcoming (seventh) edition of
the TNM classification of malignant tumours. J Thorac Oncol 2007; 2:706-14.
23. Wu F, Hu N, Li Y, et al. 2012 Galectin-3 genetic variants are associated with
platinum-based chemotherapy response and prognosis in patients with NSCLC.
Cell Oncol (Dordr) 2012; 35:175-80.
24. Shi YY, He L. SHEsis, a powerful software platform for analyses of linkage disequi-
librium, haplotype construction, and genetic association at polymorphism loci. Cell
Res 2005; 15:97-8.
25. Srinivasan M, Parwani AV, Hershberger PA, et al. Nuclear vitamin D receptor
expression is associated with improved survival in non-small cell lung cancer. J
Steroid Biochem Mol Biol 2011; 123:30-6.
Liwen Xiong et al
26. Denzer N, Vogt T, Reichrath J. Vitamin D receptor (VDR) polymorphisms and
skin cancer: a systematic review. Dermatoendocrinol 2011; 3:205-10.
27. Trowbridge R, Sharma P, Hunter WJ, et al. Vitamin D receptor expression and
neoadjuvant therapy in esophageal adenocarcinoma. Exp Mol Pathol 2012; 93:
147-53.
28. Barroso E, Fernandez LP, Milne RL, et al. Genetic analysis of the vitamin D recep-
tor gene in two epithelial cancers: melanoma and breast cancer case-control studies.
BMC Cancer 2008; 8:385.
29. Cicek MS, Liu X, Schumacher FR, et al. Vitamin D receptor genotypes/haplo-
types and prostate cancer risk. Cancer Epidemiol Biomarkers Prev 2006; 15:
2549-52.
30. Lurie G, Wilkens LR, Thompson PJ, et al. Vitamin D receptor gene polymor-
phisms and epithelial ovarian cancer risk. Cancer Epidemiol Biomarkers Prev
2007; 16:2566-71.
31. Turna A, Pekçolaklar A, Metin M, et al. The effect of season of operation on the
survival of patients with resected non-small cell lung cancer. Interact Cardiovasc
Thorac Surg 2012; 14:151-5.
Clinical Lung Cancer Month 2013 7