Journal of Animal Breeding and Genomics JABG.

2019 March, 3(1): 027-036

pISSN:1226-5543 eISSN:2586-4297 https://doi.org/10.12972/jabng.20190004
Research Article OPEN ACCESS

Identification of Single Nucleotide Polymorphism and

Restriction Enzyme in FASN and CAPN-1 Genes in Ongole
Grade cattle
Rahmatika Choiria1, Rusman2, Dyah Maharani1,*
1
Department of Animal Breeding and Reproduction, Faculty of Animal Science, Universitas Gadjah Mada, Yogyakarta 55281, Indonesia
2
Department of Animal Product and Technology, Faculty of Animal Science, Universitas Gadjah Mada, Yogyakarta 55281, Indonesia

Abstract
FASN have responsible for the activity of FASN enzymes and fatty acid synthesis. CAPN-1 gene is the primary enzyme
in the postmortem tenderization process. This study aims to identify Single Nucleotide Polymorphism (SNP) FASN and
CAPN-1 genes, and restriction enzymes that will be used in determining animal genotype. Thirty-eight meat samples from
22 Ongole Grade cattle slaughter in Giwangan slaughter house and 16 Kebumen Ongole Grade cattle were collected in
Kebumen slaughter house. The samples were analyzed using the PCR method and sequencing for SNP identification. Two
SNPs of FASN were detected in intron region (g.17066 G>A and g.17104 T>C) by direct sequencing. Restriction enzyme Fat I
has been identified to digest FASN gene target in the SNP g.17104T>C. However, no enzyme detected in SNP g.17066 G>A
of FASN gene. Nine SNPs was detected with GenBank’s alignments (g.16838G>A, g.16844G>C, g.16986G>A, g.17058C>A,
g.17091G>A, g.17100G>A, g.17104T>C, g.17194C>A, g.17195C>A). Using direct sequencing, the CAPN-1 gene was revealed
three synonymous polymorphism (g.4481A>G, g.4519C>A, which located in intron 4 and g.4631T>C which located in intron
5) and one non-synonymous polymorphism (g.4554C>T) located in exon 4. Only one SNP detected (g.4732T>G) with
GenBank’s alignment. The AciI and Fau I for SNP g.4481A>G, Mnl I and Bcc I for SNP g.4519C>A, and Sau3A I, Mbo I, Dpn II,
Dpn I, and Bcl I restriction enzyme could digest the SNP g.4554C>T. In conclusion, the identified the SNPs could be utilized
for genotyping of Ongole Grade and Kebumen Ongole Grade cattle for future studies

Keywords: CAPN-1 gene, FASN gene, Ongole Grade cattle, Restriction Enzymes, SNP

Introduction

Ongole Grade cattle are the result of a cross between local cattle from Java and Ongole cattle from
India that have an important role in meeting beef demand in Indonesia (Astuti, 2004). The qualitative
characteristics of Ongole Grade cattle based on Indonesian National Standards (SNI 7356: 2008) are white-
gray fur, fur around black eyes, large body, large hump, neck and short horns (Anonymous, 2008).
Another Ongole grade namely Kebumen Ongole Grade cattle, is a result of crossing between Java, Ongole
and Brahman cattle (Nugraha, 2014). Kebumen Ongole Grade cattle have special characteristics with a
black muzzle, black tail fan, black color around the eyes, long and hanging ears and has a large hump

*Corresponding author: Dyah Maharani

Department of Animal Breeding and Reproduction, Faculty of Animal Science, Universitas Gadjah Mada, Yogyakarta 55281, Indonesia
E-mail: d.maharani@ugm.ac.id

Ⓒ Journal of Animal Breeding and Genomics 2018. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-
Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in
any medium, provided the original work is properly cited.
 SNP and enzymes detection of FASN and CAPN-1 gene

and dewlap (Ngadiyono et al., 2017). The population of beef cattle in DIY (Yogyakarta Special Regency) in
2016 is ranked 12th at the national level with Ongole Grade cattle composing 40% of the total population
of beef cattle (Ditjennak, 2016). The population of beef cattle in Kebumen Regency was higher, with it
composing 90% of the total population (Department of Agriculture and Animal Husbandry of Kebumen
Regency, 2011). In order to fulfill the demands and tastes of consumers for quality beef, several efforts
such as analysis of meat quality and identification of superior livestock should be conducted. One of the
methods to improve meat quality is through molecular approach with DNA markers of the gene encoding
the meat quality as a selection tool.
FASN is a gene that encodes the quality of meat, including carcass weight and fat content. The FASN
gene is responsible for the activity of FASN enzymes and fatty acid synthesis. Zhang et al. (2008) identified
SNP in exon 39 (g.17924G>A) which resulted in changes amino acids from threonine to alanine, and was
associated with fatty acid composition. In addition, variations in 5 locations (g.15531C>A, g.16907T>C,
g.15603G, g.17250–17251A>T in del>, and g.17924G>A) have a significant relationship with the percentage
of C14: 0 on the cow adipose tissue and milk fat (Morris et al., 2007). Fat metabolism and the characteristics
of obesity have been associated with FASN expression or polymorphism in cattle (Abe et al., 2008). Studies
in humans show an increase in FASN expression in adipose tissue from obesity subjects and there is an
SNP association in FASN with its expression in cases of obesity (Berndt et al., 2007; Schleinitz et al., 2010).
Rempel et al. (2012) found that there were SNP in the genotypes of FASN markers that were associated
with growth traits includes final body weight and carcass weight. Maharani et al. (2012) obtaining SNP on
the genotypes of FASN markers on fatty acid composition in Hanwoo cattle which revealed this marker
had a significant effect on the fatty acid composition.
CAPN-1 gene, encoding protease cysteine which is the primary enzyme in the postmortem tenderization
process, is responsible for the breakdown of the myofibrillar protein associated with meat tenderness
(Chung et al., 2014). The coding gene for 1-calpain (CAPN1) is located on cattle chromosome number 29,
considered a strong functional candidate for beef tenderness (Curi et al., 2009). Some SNPs have been
developed for the CAPN-1 gene and these markers have been reported to be associated with meat
tenderness in Bos Taurus (White et al., 2005). Two non-identical Single Nucleotide Polymorphisms (SNPs)
in the CAPN1 gene have been associated with the traits of meat quality in Bos Taurus (Page et al., 2004).
CAPN316, located on exon 9, and CAPN530, is located on exon 14, which is responsible for substitution
of amino acids p.Gly316Ala and p.Val530Ile. White et al. (2005) have identified markers in the CAPN1
gene on Bos Indicus. The results showed a separation of CAPN4751 polymorphism (AF_248054.2:
g.6545C>T), which was located at intron 17, and there was a significant relationship with meat tenderness
in the Bos Indicus, Bos Taurus and the cross of Bos Indicus and Bos Taurus.
Identification SNP of FASN and CAPN-1 genes in this study was conducted on Ongole Grade and
Kebumen Ongole Grade cattle. SNP detected will be suggested to be used for genotyping and genetic
diversity analysis of Ongole Grade and Kebumen Ongole Grade based on FASN and CAPN-1 gene.

28 • Journal of Animal Breeding and Genomics Vol. 3, No. 1, 2019

 SNP and enzymes detection of FASN and CAPN-1 gene

Materials and Methods

Meat Samples and DNA Isolation
The meat samples were collected from twenty-two Ongole Grade cattle in Giwangan slaughter house
Yogyakarta and sixteen Kebumen Ongole Grade cattle were collected from slaughter house in Kebumen.
The meat samples were taken from longisimuss dorsi which was a part of sirloin. The longisimuss dorsi
samples were collected for Genomic DNA isolation using SYNCTM DNA Extraction Kit (Geneaid, Taiwan).

Target Gene Amplifications

Primer used for PCR amplification of FASN is forward: 5 '-TCTTCACAGAGCTGACGGAC-3' and reverse:
5 '-GGAGGAAGAGCTGTTGCAGT -3' with GenBank Acc.No.: NC_032668.1 (Maharani et al., 2012) and
CAPN-1: forward: 5'- AGTGAGTAGAAAGCCCTCCC -3 'and reverse: 5'- AGGTAAACAGCTCAGCACAGAC -3'
with GenBank Acc.No. : AF248054 (Chung et al., 2014). Amplifications for FASN were performed under
the following conditions: 10 minutes for 94oC, 35 cycles of 30 seconds at 94oC, annealing 61oC for 30
seconds, extension 72oC for 30 seconds and the final extension 72oC for 10 minutes. Amplifications for
CAPN-1 run with conditions: pre-denaturation occurred at 95oC for 2 minutes, denaturation 94oC for 1
minute, annealing 65oC for 1 minute, extension 72oC for 90 seconds and the final extension 72oC for 10
minutes in 35 cycles. The products were visualized in 1.5% agarose gels and stained with ethidium
bromide then visually with Ultra Violet (UV) light and documented using a digital camera.

Determination of SNP and restriction enzymes

SNP determination was carried out using the sequence alignment method of various types of cattle
based on the FASN and CAPN-1 GenBank from www.ncbi.nlm.org and alignment sequences of Ongole
Grade and Kebumen Ongole Grade samples. Sequencing was performed by 1st Base PT Genetika Science
Indonesia. Determination of restriction enzymes was performed using Bioedit and Nebcutter software
(http://nc2.neb.com/NEBcutter2/).

Results
Identification SNP of FASN gene and Restriction Enzyme
In order to detect SNPs of FASN gene, alignment based on three GenBank sequence (NC_032668 as
target sequence, AF285607, NC_037346) from Bos Taurus cattle and direct DNA sequencing of Ongole
Grade and Kebumen Ongole Grade cattle were performed. As a results, nine SNPs in the FASN gene
based on the GenBank’s alignment sequences have been identified namely SNP g.16838G>A, g.16844G>C,
g.16986G>A, g.17058C>A, g.17091G>A, g.17100G>A, g.17104T>C, g.17194C>A, and g.17195C>A (Fig 1).
Moreover, all of the nine SNPs have a non-synonymous mutation with the amino acid changes shown in
Fig 2. Based on the direct sequencing, two SNP were found in intron 27, namely SNP g.17066G>A and SNP
g.17104T>C (Fig 3). SNP g.17104T>C found in both GenBank alignments and direct sequencing. The SNPs
g.17066G>A and g.17104T>C were not induce to amino acid changes.

Journal of Animal Breeding and Genomics Vol. 3, No. 1, 2019 • 29

 SNP and enzymes detection of FASN and CAPN-1 gene

Restriction enzymes are determined based on the SNP identified in GenBank alignment and SNPs
found in this study. The list of restriction enzymes and their fragment size based on the results of
GenBank alignment shown in Table 1. One recommended enzymes for genotyping the Ongole Grade

Fig 1. Multiple alignment of FASN gene with 4 GenBank Acc No. NC_03228, AF285607, and NC_037346

Figure 2. Amino Acid Changes Based on SNP in the GenBank alignment of FASN Gene

30 • Journal of Animal Breeding and Genomics Vol. 3, No. 1, 2019

 SNP and enzymes detection of FASN and CAPN-1 gene

cattle and Kebumen Ongole Grade cattle in SNP position g. 17104T>C was FatI enzyme. However, no
restriction enzyme detected in SNP g.17066G>A.

SNP identification of CAPN-1 Gene and Restriction Enzymes

Only one SNP detected (g.4732T>G) on the sequence alignment with three GenBank (AF248054 as a
target sequence, NC_032678, NC_037356) (Fig 4). However, four SNPs were found indirect sequencing of
Ongole Grade cattle and Kebumen Ongole Grade cattle, namely g.4481A>G, g.4519C>A, g.4554C>T, and
g.4631T>C (Fig 5). Two SNPs located in intron 4 (SNPs g.4481A>G and g.4519C>A) and one SNP in intron

(A1). g.17066G>A (A2) g.17066G>A (B1) g.17104T>C (B2) g.17104T>C

Figure 3. SNP identification of FASN in Ongole Grade cattle and Kebumen Ongole Grade cattle based on
electrophoregram

Table 1. The list of restriction enzymes based on GenBank alignments of FASN gene
No. SNP location Restriction enzymes
1 g.16838G>A
2 g.16844G>C
3 g.16986G>A
4 g.17058C>A
5 g.17091G>A
6 g. 17100G>A
7 g. 17104T>C
8 g. 17194C>A
9 g. 17195C>A
Location Fragmen Size (bp)
BmrI exon 37 GG: 41, 582, AA: 623,
AG: 41, 582, 623
BsrI exon 37 GG: 47, 579, AA: 623,
AG: 47, 579, 623
MwoI exon 37 GG: 59, 199, 67, 28, 68, 9, 17, 23, 55,
111, 38 CC: 59, 199, 67, 28, 68, 9,
17, 23, 55, 111, 38, CG: 59, 199, 67, 28, 68, 9, 17, 23, 55,
111, 38
AciI exon 37 GG: 137, 59, 130, 5, 80, 148, 9, 12,
46, AA: 137, 189, 5, 80, 148, 9, 12, 46, AG: 137, 59, 189,
130, 5, 80, 148, 9, 12, 46
BstXI intron 12 CC: 276, 347, AA: 623,
AC: 276, 347, 623
MnlI intron 12 GG: 86, 72, 73, 65, 97, 121, 34, 75,
AA: 86, 72, 73, 162, 121, 34, 75,
AG: 86, 72, 73, 65,
97, 121, 34, 75, 162
BlpI intron 13 GG: 204, 104, 315, AA: 204, 419,
AG: 204, 104, 315, 419
FatI intron 15 TT: 623, CC: 315, 308,
CT: 308, 315, 623
ApaI exon 38 CC: 99, 308, 216, AA: 99, 524,
AC: 99, 308, 216, 524
PspOMI exon 38 CC: 95, 308, 220, AA: 95, 528
AC: 95, 308, 220, 528

Journal of Animal Breeding and Genomics Vol. 3, No. 1, 2019 • 31

 SNP and enzymes detection of FASN and CAPN-1 gene

5 (SNP g.4631T>C). The SNP g.4554C>T was located in exon 4. This SNP have synonymous mutation
without amino acid changes.
Determination of restriction enzymes was carried out in accordance with SNP results from GenBank
alignment and SNP identified from direct sequencing of both sample breeds. Restriction enzymes based
on the results of GenBank alignment with SNP g.4732T>G, namely DpnII, Sau3AI, MboI, DpnI, TaqI,
PvuI, ClaI, and BspDI. The restriction enzymes and the fragment size of SNP detected in Ongole Grade
cattle and Kebumen Ongole Grade cattle shown in Table 2.

Table 2. The list of restriction enzymes based on SNP of CAPN-1 gene detected in Ongole Grade cattle and
Kebumen Ongole Grade cattle
No. SNP location
1 g.4481A>G
2 g.4519C>A
3 g.4554C>T
4 g.4631T>C
Restriction enzymes Fragmen Size (bp)
AciI AA: 358, GG: 39, 319, AG: 39, 319, 358
FauI AA: 358, GG: 46, AG: 46, 358
MnlI CC: 15, 20, 25, 29, 45, 99, 102, AA: 358
AC: 15, 20, 25, 29, 45, 99, 102, 358
BccI AA: 358, CC: 86, 272, AC: 86, 372, 358
Sau3AI CC: 358, TT: 69, 111, 178,
CT: 69, 111, 178,358
MboI CC: 358, TT: 69, 111, 178,
CT: 69, 111, 178, 358
DpnII CC: 358, TT: 69, 111, 178,
CT: 69, 111, 178, 358
BclI CC: 358, TT: 111, 247, CT: 111, 247, 358
DpnI CC: 358, TT: 67, 113, 178,
CT: 67, 113, 178, 358
- -

Figure 4. Multiple alignment of CAPN-1 gene with 3 GenBank Acc No AF248054, NC_032678, NC_037356

(A). SNP g.4481A>G (B). SNP g.4519C>A (C). SNP g.4554C>T (D). SNP g.4631T>C

Figure 5. SNP identification of CAPN-1 gene in Ongole Grade cattle and Kebumen Ongole Grade cattle based on
electrophoregram

32 • Journal of Animal Breeding and Genomics Vol. 3, No. 1, 2019

 SNP and enzymes detection of FASN and CAPN-1 gene

Discussion
The FASN enzyme consists of two multifunctional polypeptides identical to the three catalytic domains
in N-terminals (b-ketoacyl synthase, malonyl acetyl transferase, and dehydrase). The catalytic domain is
separated by 600 residues from the C-terminal region formed by four other domains (enoyl reductase,
b-ketoacyl reductase, acyl carrier protein, and thioesterase). The FASN enzyme is one of the most complex
multifunctional enzymes. This enzyme has the catalytic component needed to catalyze a series of 37
reactions that lead to the formation of palmitic acids from acetyl-CoA and malonyl-CoA (Asturias et al.,
2005). The mechanism of action of the FASN gene is by catalyzing the synthesis of palmitate from acetyl-
CoA and malonyl-CoA. One by-product of the pyruvate reaction is acetyl-coenzyme (CoA); together with
malonyl-CoA, it becomes a substrate for FASN, which catalyzes the biosynthesis of palmitic fatty acids in
nicotinamide adenine dinucleotide phosphate - reduced (NADPH) - depending on the reaction. Palmitate
is then conjugated with other proteins or converted to other fatty acids and lipid complexes which are
essential for (i) synthesis of lipids and membrane structures, such as lipid rafts, (ii) protein modification
and localization function, and (iii) receptor localization and signaling main pathways oncogenic
conditions such as PI3K / AKT / mTOR pathway (Jones and Infante, 2015).
In this study, there were 2 polymorphisms detected in the 623 bp fragment of FASN gene of Ongole
Grade cattle and Kebumen Ongole Grade cattle. This study discovered 8 different SNPs and one similar
SNP FASN gene in 5’UTR region when we compared with the direct sequence and 3 GenBanks from
NCBI. This study revealed that sequence of FASN Ongole Grade cattle and Kebumen Ongole Grade cattle
was a similiar with another sequence from Bos Taurus cattle (Maharani et al., 2012). The FASN gene in
this region may be used to distinguish Ongole Grade cattle and Kebumen Ongole Grade with other
species. Both of two SNPs based on direct sequencing (g.17066G>A and g.17104T>C), were located in non-
coding region. Non-coding sequences are important for regulatory functions. An untranslated region
that controls their translation, degradation, and localization include stem-loop structures, upstream
initiation codons and open reading frames, internal ribosome entry sites and various cis-acting elements
that are bound by RNA-binding proteins (Mignone et al., 2002). Five SNPs from GenBank alignments
(g.16838G>A, g.16844G>C, g.16986G>A, g.17194C>A, and g.17195C>A) have amino acid mutation: valine to
isoleucine, aspartic acid to histidine, arginine to histidine, proline to threonine, proline to histidine,
respectively. Therefore the SNPs may control the genotype and phenotypic expression.
An attempt at determining restriction enzymes with SNP in Ongole Grade cattle and Kebumen Ongole
Grade cattle obtained results that only SNP g.17104T>C can be digested by restriction enzymes, namely
FatI enzyme. Therefore, SNP g.17104T>C can be used in the stage of determining the genotype of livestock
by PCR RFLP method. The enzyme can be digested the gene target and revealed TT genotype with similar
size of the gene target (623 bp). The homozygote CC having fragment sizes: 308 bp and 315 bp, and TC
genotypes revealed having fragment size: 308 bp, 315 bp, and 623 bp. Based on previous studies, there are
several SNPs detected in FASN gene that are associated with meat quality. Maharani et al. (2012) found
SNP g.17924G>A with a MscI restriction enzyme associated with myristic acid, which is one of the fatty
acid compositions of meat.
Calpain is a group of cysteine protease enzymes that require calcium ions for their activities. CAPN-1

Journal of Animal Breeding and Genomics Vol. 3, No. 1, 2019 • 33

 SNP and enzymes detection of FASN and CAPN-1 gene

has a broad sub-network and reflects a large number of targets, such as vimentin (VIM), collagen bonds
(COL1A1), or desmin (DES). Calpain has implications for various calcium-dependent cellular processes
such as apoptosis (Perrin and Huttenlocher, 2002). Functional analysis of CAPN-1 tissue involves
developmental process (23%), regulation and apoptosis (19%), an organization of cellular components
and biogenesis (15%), and response to external stimuli (10%). Mechanisms such as development and
stress, apoptosis, glucose metabolism, and muscle contraction contribute to the proteolytic pathway of
CAPN-1. This allows the interaction in the muscle to explain the relationship of protein to tenderness.
Stress plays an important role in forming SUMO4, H2AFX, and HSPs and involves certain cells so that
cells can survive with stressful conditions by maintaining metabolic functions and structural proteins
(Guillemin et al., 2011).
This study in CAPN-1 gene discovered one SNP based on the alignment of three sequences from
GenBank in NCBI. However, it was found that 4 polymorphisms detected in the 358 bp fragment of
CAPN-1 gene in Ongole Grade cattle and Kebumen Ongole Grade cattle. This reveals that sequence of
CAPN-1 from direct sequencing was a difference compared with another sequence from Bos Taurus
cattle. The SNPs in CAPN gene in this region may be used to recognize Ongole Grade cattle and Kebumen
Ongole Grade with other species. Three SNPs in this study were located in noncoding region and 1 SNP
were identified in coding region in exon 4 and were not induced by amino acid changes.
Restriction enzymes based on SNP detected in Ongole Grade cattle and Kebumen Ongole Grade cattle
exhibited that 3 SNPs can be digested by restriction enzymes, and 1 SNPs (SNP g.4631T>C) can not be
digested by enzyme restriction. In previous studies, there are several SNPs from the CAPN-1 gene that are
related to meat quality. Chung et al. (2014) discovered SNP g. 4558A>G with MboI restriction enzyme,
which is responsible for the breakdown of a myofibrillar protein associated with meat tenderness.
In conclusion, we detected two synonymous polymorphisms of FASN gene in Ongole Grade cattle and
Kebumen Ongole Grade cattle in the location g.17066G>A and g.17104T>C. Restriction enzymes FatI may
be used for genotyping Ongole Grade cattle and Kebumen Ongole Grade cattle by applying PCR-RFLP
method in future researches using SNP g.17104T>C. The study of CAPN-1 gene in both cattle detected
three synonymous polymorphism in location g.4481A>G, g.4519C>A, and g.4631T>C and one non-
synonymous polymorphism in location g.4554C>T in exon 4. Restriction enzymes AciI, FauI, MnlI, BccI,
Sau3AI, MboI, DpnII, DpnI, and BclI may be used for genotyping Ongole Grade cattle and Kebumen
Ongole Grade cattle using PCR-RFLP method in the future research.

Acknowlegement
This study was supported by Agricultural and Livestock Bureau of Bantul and Kebumen region in
Central Java Province through their assistance in the collection of tissue samples from the slaugther
house. We would also like to express our utmost gratitude to the research team, Retno Setyawati and Dwi
Nur Happy Hariyono, for laboratory assistance and data analysis.

34 • Journal of Animal Breeding and Genomics Vol. 3, No. 1, 2019

 SNP and enzymes detection of FASN and CAPN-1 gene

References
Abe, T., J. H. Saburi., T. Hasebe., T. Nakagawa., Kawamura., K. Saito, T. Nade, S. Misumi, T. Okumura,
K. Kuchida, T. Hayashi, S. Nakane, T. Mitsuhasi, K. Nirasawa, Y. Sugimoto, and E. Kobayashi. 2008. Bovine
quantitative trait loci analysis for growth, carcass, and meat quality traits in an F2 population from a cross
between Japanese Black and Limousin. J Anim Sci. 86: 2821–2832.
Anonymous. 2008. Bibit Sapi Peranakan Ongole (PO). Badan Standarisasi Nasional (BSN). SNI 7356: 2008.
Asturias, F.J., J.Z. Chadick, and I. K. Cheung. 2005. Structure and molecular organization of mammalian
fatty acid synthase. Nat Struct Mol Biol. 12: 225–232.
Astuti, M. 2004. Potensi dan Keragaman Sumberdaya Genetik Sapi Peranakan Ongole (PO). Lokakarya
Nasional Sapi Potong 2004. Fakultas Peternakan. Universitas Gadjah Mada, Yogyakarta.
Berndt, J., P. Kovacs, K. Ruschke, N. Kloting, M. Fasshauer, M. R. Schon, A. Korner, M. Stumvoll, and M.
Bluher. 2007. Fatty acid synthase gene expression in human adipose tissue: Association with obesity and
type 2 diabetes. Diabetologia. 50:1472–1480.
Chung, H., S. Shin, and E. Chung. 2014. Effects of genetic variants for the bovine calpain gene on meat
tenderness. Mol Biol Rep. 41: 2963–2970.
Department of Agriculture and Animal Husbandry of Kebumen Regency. 2011. Annual Report Distannak.
Kebumen.
Ditjennak. 2016. Statistik Peternakan dan Kesehatan Hewan.Direktorat Jenderal Peternakan dan
Kesehatan Hewan Kementerian Pertanian RI. Jakarta.
Guillemin, N., M. Bonnet, C. Jurrie, B. Picard. 2011. Functional analysis of beef tenderness. Journal Of
Proteomics 75: 352–365.
Jones S. F. and J. R. Infante. 2015. Molecular pathways: Fatty acid synthase. Clinical Cancer research. 21:
5434-5438.
Maharani, D., Y. Jung, W.Y. Jung, C. Jo, S.H. Ryoo, S.H. Lee, S.H. Yeon, J.H. Lee. 2012. Association of five
candidate genes with fatty acid composition in Korean cattle. Mol Biol Rep. 39: 6113-6121.
Mignone F., C. Gissi and S. Liuni, 2002. Untranslated regions of mRNAs (Review). Gen. Bio. 3:1-10.
Morris, C.A., N.G. Cullen, B.C. Glass, D.L. Hyndman, T.R. Manley, S.M. Hickey, J.C. McEwan, W.S. Pitchford,
C.D. Bottema, M.A. Lee. 2007. Fatty acid synthase effects on bovine adipose fat and milk fat. Mamm Genome.
18: 64–74.
Ngadiyono, N., Panjono, S.P.S. Budhi, A.E. Susanti. 2017. Characteristics of Ongole Grade Cows in the
Kebumen Regency, Central Java Province. Proceedings of the International Seminar on Tropical Animal
Production (ISTAP) 7th. Pp. 835-839.
Nugraha, I.H. 2014. Sapi Peranakan Ongole (PO) Kebumen, Si Mutiara dari Selatan. http://
disnakkeswan.jatengprov.go.id/read/sapi-peranakan-ongole-po-kebumen-si-mutiara-dari-selatan-. Accesed
at 30 January 2019.
Page, B.T., E. Casas, R.L. Quaas, R.M. Thallman, T.L. Wheeler, M. Koohmaraie, S.D. Schackelford, S.N.
White, J.W. Keele and T.P.L. Smith. 2004. Association of markers in the bovine CAPN1 with meat tenderness
in large crossbred populations that sample influential industry sires. J.Anim. Sci. 80: 3474 3481.
Perrin B.J. and Huttenlocher A. 2002. Calpain. Int. J. of Biochem Cell B. 34. 722-725.
Rempel, L.A., E. Casas, S.D. Shackelford, T.L. Wheeler. 2012. Relationship of polymorphisms within

Journal of Animal Breeding and Genomics Vol. 3, No. 1, 2019 • 35

 SNP and enzymes detection of FASN and CAPN-1 gene

metabolic genes and carcass traits in crossbred beef cattle. J. Anim. Sci. 90: 1311–1316.
Schleinitz, D., N. Kloting, A. Korner, J. Berndt, M. Reichenbacher, A. Tonjes, K. Ruschke, Y. Bottcher, K.
Dietrich, B. Enigk, M. Filz, M. R. Schon, J. Jenkner, W. Kiess, M. Stumvoll, M. Bluher, and P. Kovacs. 2010.
Effect of genetic variation in the human fatty acid synthase gene (FASN) on obesity and fat depot-specific
mRNA expression. Obesity (Silver Spring). 18: 1218–1225.
White, S.N., E. Casas, T.L. Wheeler, S.D. Shackelford, M. Koohmaraie, D.G. Riley, C.C. Jr. Chase, D.D.
Johnson, J.W. Keele, and T.P. Smith. 2005. A new Single Nucleotide Polymorphism in CAPN1 extends the
current tenderness marker test to include cattle of Bos Indicus, Bos Taurus , and crossbred descent. J Anim
Sci. 83: 2001–2008.
Zhang, S., T.J. Knight, J.M. Reecy, and D.C. Beitz. 2008. DNA polymorphisms in bovine fatty acid synthase
are associated with beef fatty acid composition. Anim Genet. 39: 62–70.

36 • Journal of Animal Breeding and Genomics Vol. 3, No. 1, 2019

 J. Indonesian Trop. Anim. Agric.
J I TAA pISSN 2087-8273 eISSN 2460-6278
http://ejournal.undip.ac.id/index.php/jitaa
44(2):125-134, June 2019
Journal of the Indonesian Tropical Animal Agriculture
Accredited by Ditjen Penguatan Risbang No. 60/E/KPT/2016 DOI:10.14710/jitaa.44.2.125-134

Polymorphism of the SNP g. 1180 C>T in leptin gene and its

association with growth traits and linear body measurement in
Kebumen Ongole Grade cattle

A. Fathoni, D. Maharani*, R. N. Aji, R. Choiri and S. Sumadi

Department of Animal Breeding and Reproduction, Faculty of Animal Science,
Universitas Gadjah Mada,Jl. Fauna No. 3 Bulaksumur, Yogyakarta 55281 - Indonesia
*Corresponding E-mail : d.maharani@ugm.ac.id

Received November 30, 2018; Accepted April 21, 2019

ABSTRAK

Penelitian ini bertujuan mengetahui polimorfisme gen leptin sapi PO Kebumen dan asosiasinya
dengan sifat pertumbuhan. Seratus sampel darah sapi dikoleksi untuk analisis molekuler. Polimorfisme
gen leptin dianalisis menggunakan 2 teknik: Polymerase Chain Reaction - Restriction Fragment Length
Polymorphism (PCR-RFLP) menggunakan enzim restriksi HpyCH4V dan sekuensing. Asosiasi antara
gen leptin dan sifat pertumbuhan dianalisis menggunakan T-test. Hasil penelitian menunjukkan ada SNP
g. 1180 C>T pada gen leptin populasi Sapi PO Kebumen, yang merubah asam amino dari arginin
menjadi sistein. Dua alel, C dan T, dengan frekuensi masing-masing 0,885 dan 0,115 dan 3 genotip, CC,
CT dan TT, dengan frekuensi masing-masing 0,78; 0,21 dan 0,01 telah dideteksi. Populasi yang diamati
berada dalam Hardy-Weinberg equilibrium. Terdapat asosiasi yang signifikan antara genotip dan lingkar
dada saat sapih. Dapat disimpulkan bahwa gen leptin merupakan kandidat gen yang dapat digunakan
sebagai marker seleksi untuk lingkar dada saat sapih pada sapi PO Kebumen.
Kata kunci: identitikasi, polimorfisme, gen Leptin, sapi Peranakan Ongole Kebumen

ABSTRACT

The aim of this study was to identify the polymorphism of leptin gene and its association with
growth traits in Kebumen Ongole Grade cattle. One hundred blood samples were collected for molecular
analysis. Polymorphism of the leptin gene was analyzed using Polymerase Chain Reaction - Restriction
Fragment Length Polymorphism (PCR-RFLP) with HpyCH4V restriction enzyme and DNA sequencing.
Association analysis of the leptin gene with growth traits was analyzed by T-test. The results showed
that SNP g. 1180 C>T was found in the population. The SNP changed amino acid from arginine to
cysteine. The SNP was significantly associated with a high chest circumference at weaning age in
animal having CC genotype (P<0.05). There were two identified alleles, namely C and T, with
frequencies were 0.885 and 0.115, respectively. The genotype frequencies of CC, CT and TT were 0.78,
0.21 and 0.01, respectively. Allelic and genotypic distribution in the studied population were in Hardy-
Weinberg equilibrium. Animals with CC genotype had a higher circumference at weaning age (WCC)
than those with CT genotype. In conclusion, SNP g. 1180 C> T in the leptin gene is potential as genetic
marker for growth traits in Kebumen Ongole Grade cattle.
Keywords: identification, polymorphism, leptin gene, Kebumen Ongole Grade cattle

Association of Leptin Gene with Growth Traits in Cattle (A. Fathoni et al.) 125
 INTRODUCTION
Kebumen Ongole Grade cattle are potential
for beef production in Indonesia. They are
registered as local cattle by the Indonesian
Ministry of Agriculture (No.47/Kpts/SR.120/
I/2015). They are widely distributed throughout
Kebumen regency, making it as a source of
breeding for the cattle (No.
358/Kpts/PK.040/6/2015). Productivity of
Kebumen Ongole Grade cattle could be
maintained and increased by selection.
Quantitative traits, such as growth traits and
carcass characteristics are important economic
traits, which can be used as a selection criteria in
cattle (Vann et al., 2017; Thompson et al., 2014).
Studies on quantitative genetics in Kebumen
Ongole Grade cattle was previously carried out by
Sumadi et al. (2017) and Maharani et al. (2017) in
analyzing of breeding value and prediction of
body weight at puberty using a nonlinear
mathematical model, respectively.
Nowadays, molecular technology based
marker-assisted selection (MAS) has been widely
used in cattle genetic improvement (Putri et al.,
2015; Seong et al., 2012). PCR-RFLP is
commonly used to determine gene polymorphism
by identifying the individual genotype (Agarwal
et al., 2009). Genetic characterization of
Kebumen Ongole Grade cattle has been carried
out in the analysis of MC4R and Cyt b genes
(Maharani et al., 2018; Hartatik et al., 2018).
Many of studies reported the usefulness of
molecular markers in the genetic analysis of
several cattle populations, i.e. Malaysian
(Romaino et al., 2014), Jabres and Rambon
(Sutarno and Setyawan, 2015; Sutarno et al.,
2015), Aceh and Pesisir (Hartatik et al., 2015),
Madura (Hartatik et al., 2014) and Bali cattle
(Jakaria and Noor, 2015).
Leptin is a protein hormone released from
adipose tissue and plays an important role in
animal growth such as body weight regulation, fat
mass and energy metabolism (Sainz et al., 2015;
Wasim, 2015; Sharifzadeh and Doosti 2010).
Leptin gene in bovine located in BTA 4q32. It
consists of three exons and two introns. The first
intron is more than 8 kb and the second intron has
a length of 1.6 kb (Liefers et al., 2002). The
activity of leptin is regulated by leptin receptor
(LEPR). LEPR is included in the gp130 family of
cytokine receptor. There are six isoforms from
LEPR (LEPRa, LEPRb, LEPRc, LEPRd, LEPRe,
LEPRf) but LEPRb was the most important
126
isoform because it is the strongest signal which
affect in animal growth (Nanjappa et al., 2011).
Several studies revealed that mutations in the
exon 2 based on SNP 1047C>T/R25C influenced
body weight, fatness and muscle fat composition
(Woronuk et al., 2012; Orru et al., 2011,
Kawaguchi et al., 2017). Identification of the
bovine leptin gene shows a correlation between
polymorphism of this gene and body weight and
fatness (Woronuk et al., 2012; Kononof et al.,
2017), and meat quality (Shin and Chung, 2006).
SNP mutation in exon 2 of the leptin gene is
strongly associated with carcass quality (DeVuyst
et al., 2011). A causative mutation of A1127T
disturbs the leptin function in the body's
physiological processes (Fortes et al., 2009).
Identification of the leptin gene polymorphism in
5’flanking (promoter) region has been reported in
Brangus (Corva et al., 2009) and Holstein
Friesian cattle (Matteis et al., 2012). Recently,
one synonymous (SNPs g.1025T>C/S17S) and
two non synonymous SNPs (g.1047C>T/R25C
and g.1048G>A/R25H) found in Ongole grade
cattle (Hilmia et al., 2018). The
SNPg.1025T>C/S17S indicated no change amino
acids and SNP g.1047C>T/R25C and
g.1048G>A/R25H changed amino acids from
arginine to cysteine, and arginine to histidine,
respectively. Moreover, A SNP g. 1180 C>T was
found and converted amino acid from arginine to
cysteine. Detection those mutation of the leptin
gene in Kebumen Ongole Grade cattle has not
been performed. Thus, this study was conducted
to identify the polymorphism of leptin gene and
its association with growth traits.
MATERIALS AND METHODS
Animals, Data Collection and Genomic DNA
Extraction
One hundred blood samples of Kebumen
Ongole Grade cattle were used in this study. All
animals studied were reared in Klirong district,
Kebumen regency, Central Java province. An
approximately 3 ml blood sample for each animal
was collected from the jugular vein using
sterilized venoject and vacutainer EDTA.
Genomic DNA was extracted by using gSYNC TM
DNA Extraction Kit (Geneaid, New Taipei City,
Taiwan). This genomic DNA product was used as
a template for PCR amplification. Growth data,
such as body weight and body size were obtained
from recording, provided by Kebumen Ongole
Grade cattle Breeder Association and used for
J.Indonesian Trop.Anim.Agric. 44(2):125-134, June 2019
association analysis with the leptin gene. The
maintenance management such as feeding and
housing is almost uniform under the authority of
the Kebumen Ongole Grade cattle Breeder
Association. The samples are unrelated family
indicated based on their recording.
Polymerase Chain Reaction (PCR)
Ampification
Genbank, primer, gene target and SNP in
according to Shin and Chung (2006) and
Hernandez et al. (2016) are presented in Table 1.
PCR was performed in 25 µL total volume
containing 2 µL of genomic DNA, 12.5 µL PCR
kit (MyTaqTM HS Red Mix), 0.5 µL of each primer
forward and reverse, and 9.5 µL double-distilled
water (DDW). PCR condition was performed in 5
min at 94˚C (pre-denaturation) and 35 cycles of
30 s at 94˚C (denaturation), 30 s at 60˚C
(annealing), 30 s at 72˚C (extension), and 5 min at
72˚C for the final extension in a SEDI Thermo
Cycler PCR machine. PCR products were
visualized onto 1.5% standard agarose gels
stained with ethidium bromide.
Sequencing and SNP Identification
Sequencing was carried out to confirm the
gene target and SNP position based on reference
study and eight Kebumen Ongole Grade cattle
PCR product. The PCR products were used for
direct sequencing which was performed by 1st
BASE DNA Sequencing Service Company
(Malaysia). Determination of the nucleotide
sequences was performed in one direction using
the forward primer. Nucleotide sequences results
were analyzed using MEGA 7.0.9 (Tamura et al.,
2011). SNP g. 1180 C>T was further used to
genotype all animals investigated by using PCR-
RFLP.
PCR-RFLP and Genotyping
Restriction enzyme was determined using
NEBcutter V2.0 (http://nc2.neb.com/
NEBcutter2/). HpyCH4V restriction enzyme was
used to digest the 466 bp of the leptin gene with a
recognition site of 5'-TG│CA-3' (Figure 1). PCR-
RFLP was carried out in 20 µL reaction volume
containing 15 µL of PCR product, 2 µL 10x
buffer, 0.2 µL HpyCH4V and 2.8 µL DDW. The
reaction mixture was incubated at 37oC for 4
hours in multi-heater. The digestion products were
visualized onto 3% agarose gels.
Statistical Analysis
Allelic and genotypic frequencies were
calculated by a simple allele counting method
according to Warwick et al. (1990):
The Frequency of C allele = ∑ C locus/∑ (C locus
+ T locus)
The Frequency of T allele = ∑ C locus/∑ (C locus
+ T locus)
The Frequency of CC genotype = (∑ CC/N ) x
100%
The Frequency of TT genotype = (∑ TT/N ) x
100%
The Frequency of CT genotype = (∑ CT/N ) x
100%
Where :
∑ CC = the number of individual of CC genotype
∑ TT = the number of individual of TT genotype
∑ CT = the number of individual of CT genotype
N = total of individual samples
Hardy-Weinberg equilibrium for identified
locus was determined in a Pearson’s Chi-square
test, with the following mathematical model
(Kang and Shin, 2004):
Where:
X2 = Chi-square test value

Table 1. Genbank, Primer, Target Location of Leptin Gene, SNP to Location of Leptin Gene

Genbank Target Primer (5’-3’) SNP Region Fragment

Location size (bp)
U50365 877-1342 GATTCCGCCGCACCTCTC 1127A>T Exon 2 466
CCTGTGCAAGGCTGCACAGCC
978C>T Intron
1180 C>T Exon 2

Association of Leptin Gene with Growth Traits in Cattle (A. Fathoni et al.) 127
Oi = observed frequency
Ei = expected frequency
n = the number of compared data
Association analysis between leptin gene and
growth traits was analyzed with IBM SPSS
Statistics v. 25 using the following formula (Kim,
2015) :
with
where:
n1 = Sample size (i.e., number of observations) of
the first sample
n2 = Sample size (i.e., number of observations) of
the second sample
S1 = Standard deviation of the first sample
S2 = Standard deviation of the second sample
Sp = Pooled standard deviation
RESULTS AND DISCUSSION
Growth Traits Profile
Mean and standard deviation for each growth
trait, including birth weight (BW), birth body
length (BBL), birth chest circumference (BCC),
birth shoulder height (BSH), weaning weight
(WW), weaning body length (WBL), weaning
chest circumference (WCC), weaning shoulder
height (WSH), average daily gain (ADG),
yearling weight (YW), yearling body length
(YBL), yearling chest circumference (YCC) and
yearling shoulder height (YSH) are presented in
Table 2. The results of this study were in
agreement with previously reports in Kebumen
Ongole grade cattle (Maharani et al., 2018).
Polymorphism, Genotyping and Allele
Distribution of Leptin Gene
Based on reference sequence, only SNP g.
1180 C>T was confirmed, while SNP 1127A>T
and 978C>T were not identified in our population
(Figure 2). The SNP was identified by the
presence of "double peak" at position 1180 based
on GenBank accession number U50365 (Figure
3). The SNP resulting two alleles, C and T (Figure
4). Digestion of 466 bp of the leptin gene by
HpyCH4V restriction enzyme generated three

Table 2. The Growth Profile of Kebumen Ongole Grade Cattle

Variable n Mean±SD Minimum Maximum

Birth Weight (kg) 99 29.76±3.09 22.00 41.00
Birth Shoulder Height (cm) 99 71.44±5.14 48.00 80.00
Birth Body Length (cm) 99 57.03±5.82 44.00 74.00
Birth Chest Circumference (cm) 98 68.12±4.19 56.00 76.00
Weaning Weight (kg) 67 129.98±40.33 66.00 275.00
Weaning Shoulder Height (cm) 67 103.30±11.82 69.00 125.00
Weaning Body Length (cm) 67 92.55±12.02 70.00 127.00
Weaning Chest Circumference (cm) 67 114.67±12.17 74.00 151.00
Average Daily Gain (kg/d) 48 0.58±0.15 31.00 101.00
Yearling Weight (kg) 8 237.45±59.23 158.00 325.00
Yearling Shoulder Height (cm) 8 115.45±14.73 73.00 125.00
Yearling Body Length (cm) 8 110.91±14.39 84.00 127.00
Yearling Chest Circumference (cm) 8 137.27±12.88 122.00 159.00
n= number of animal; Means in the same row with different superscripts differ significantly (P<0.05); n=
number of animal;

128 J.Indonesian Trop.Anim.Agric. 44(2):125-134, June 2019

Figure 1. The Site and Cut Position of HpyCH4V Restriction Enzyme

Figure 2. SNPs Identification using Sequences Alignment (466 bp). Note : SNP 1 and 2 were not found
in the Kebumen Ongole Grade cattle; SNP 3 was indicated in the samples

genotypes: an undigested PCR product (466 bp)
fragment of genotype TT; 6, 8, 147 and 305 bp
fragments of genotype CC; and 6, 8, 147, 305 and
466 bp fragments of genotype CT. CC and CT
genotypes were found in 78 and 21 animals,
respectively, while TT genotype was found only
in 1 animal. Therefore, only 2 genotypes (CC and
CT) were used for next steps. The fragment size
below 100 bp were not visible during the
visualization process. Allelic frequencies of C and
T were 0.885 and 0.115, respectively, while
genotypic frequencies of CC, CT and TT were
0.78, 0.21 and 0.01, respectively (Table 3). Based
on the frequency values, the population was
dominated by C alleles and CC genotypes. The
Chi-square test revealed that SNP g. 1180 C>T in

Association of Leptin Gene with Growth Traits in Cattle (A. Fathoni et al.) 129
the studied population was in the Hardy-Weinberg
equilibrium.
PCR-RFLP products revealed polymorphism
of the leptin gene, resulting two alleles, C and T.
Similarly, C and T alleles at SNP g.1180 C>T
were also identified in Brahman (Hernández et
al., 2016) and Simmental bulls (Orrù et al., 2011).
The frequency of C allele was higher than T
allele. This results with the same SNP g.1180 C>T
indicated similar to those observed in Korean
cattle, with frequencies of 0.64 for C allele and
Figure 3. The Electrophoregram which Indicated
the Polymorphism of Leptin Gene (SNP g. 1180
C> T)
Figure 4. The Results of PCR-RFLP with HpyCH4V Restriction Enzyme. Note: M=Marker, CC, CT,
TT=Genotype Sample
130
0.36 for T allele (Shin and Chung, 2006). The
frequencies of C allele was also higher than T
allele in Turkey cattle which were 0.52 and 0.28
respectively (Kaygisiz et al., 2011). In this study,
the genotypic frequencies of CC, CT and TT were
0.78, 0.21 and 0.01, respectively. CC genotype
had a higher frequency than CT and TT
genotypes. Previously, CT genotype had the
highest frequency in Korean (Shin and Chung,
2006), Sistani and Sarabi cattle (Aslaminejad
2010). The genotype of CC was predominat
genotype found in crossbred cattle and CT was
the most frequent genotype observed in Friesian
Holstein (Choundhary et al., 2005). In contrast,
TT genotype was absence in Golpayegani cattle
(Nassiry et al., 2007). The differences of allelic
and genotypic distribution might be due to
difference of cattle breeds, which may produce
different genetic expression.
A Chi-square test showed that the
distribution of allele and gentoype in the
population was in to Hardy-Weinberg
equilibrium. This indicate the population will
remain constant from one generation to the next
generation in absence of disturbing factors
(Moonesinghe et al., 2010). This is similar with
reports in Hanwoo (Han et al., 2010), Qinchuan
(Zhang et al., 2009), Zebu (Mukesh et al., 2008)
and Holstein Turkey cattle (Ozdemer, 2012).
HWE in a particular population is determined by
the absence of several factors, such as gene
recombination, genetic drift, inbreeding, mutation
and gene flow from other populations (Banos et
al., 2008).
J.Indonesian Trop.Anim.Agric. 44(2):125-134, June 2019
Effect of Leptin Gene to Growth Ttraits
Genotypes of animals based on the SNP g.
1180 C>T were associated with their growth
traits. TT genotype was not used in association
analysis due to it contains only 1 individual in the
population. The results showed that SNP g. 1180
C>T had a significant effect (P<0.05) on WCC
(Table 4). Animals with CT genotype had higher
WCC than those with CC genotype. However,
there was no significant association between
genotype and several growth traits, such as BW,
BSH, BBL, BCC, WW, WSH, WBL, WCC, ADG,
YW, YSH, YBL and YCC (P>0.05).
The SNP g. 1180 C>T changed amino acid
from arginine to cysteine (Javanmard et al.,
2010). This mutation may effect on the different
expression of leptin gene on WCC in Kebumen
Ongole Grade cattle. Circulation of leptin in fat
tissue in the human body and animals correlates
with body weight which is body weight had
possitive correlations with WCC (Friedman, 2011;
Sahu et al., 2017). Moreover, leptin which is
bounded by neural receptors in the hypothalamus
will increase the concentration of
Proopiomelanocortin (POMC) and Cocaine and
Amphetamine Regulated Transcript (CART).
Increased POMC and CART concentrations
stimulate the formation of α-melanocortin
stimulating hormone (α-MSH). The α-MSH
activated the melanocortin receptor (MC4R)
signal and stimulated the hypothalamus to secrete
thyrotropin releasing hormone (TRH) and

Table 3. Frequency of Alleles and Genotypes based on Leptin Gene with SNP g. 1180 g C>T

Allele Frequency Genotype Frequency

Item
C T CC CT TT
N 177 23 78 21 1
Value 0.885 0.115 0.78 0.21 0.01
N = Number of sample

Table 4. The Mean and Standard Error of the Growth Traits and Level of Significant for the Leptin Gene
using SNP 1180 g. C>T

Genotype
Variable n
CC CT
Birth Weight (kg) 99 29.53±2.94 30.62±3.54
Birth Shoulder Height (cm) 99 71.15±5.44 72.52±3.76
Birth Body Length (cm) 99 57.54±5.57 55.14±6.47
Birth Chest Circumference (cm) 98 67.99±4.37 68.62±3.51
Weaning Weight (kg) 67 127.05±37.80 146.7±51.69
Weaning Shoulder Height (cm) 67 103.46±11.66 102.8±12.80
Weaning Body Length (cm) 67 92.58±13.71 92.4±8.59
Weaning Chest Circumference (cm) 67 113.42±11.77a 121.8±12.54b
Average Daily Gain (kg/d) 48 0.57±0.12 0.65±0.22
Yearling Weight (kg) 8 297.0±24.43 225.8±61.90
Yearling Shoulder Height (cm) 8 123.67±1.15 118.6±4.67
Yearling Body Length (cm) 8 124.0±2.64 110.8±13.66
Yearling Chest Circumference (cm) 8 146.67±13.65 134.2±12.1

Association of Leptin Gene with Growth Traits in Cattle (A. Fathoni et al.) 131
corticotropin releasing hormone (CRH) (Denver
et al., 2011). Both of these hormones may
increase energy consumption and caused the
differences of WCC in Kebumen Ongole Grade
cattle.
These results were in agreement with reports
from previously study in which the SNP of Leptin
gene affected on backfat thickness and marbling
score in Korean cattle with CC genotype was
more superior than TT genotypes (Shin and
Chung, 2006). Schenkel et al. (2005) reported that
this SNP was significantly associated with carcass
quality and composition in cattle. Furthermore,
leptin gene had been reported to have an effect on
body weight and body size in Chinese cattle
(Yang et al., 2007), growth traits in Nellore cattle
(Silva et al., 2013).
CONCLUSION
The SNP g. 1180 C>T of the leptin gene is
significantly associated with high weaning chest
circumference in Kebumen Ongole Grade cattle.
The results of this study indicated that the leptin
gene may affect on the economic traits in cattle.
The SNP g. 1180 C>T could be used as a marker-
assiLsted selection in a large population of
Kebumen Ongole Grade cattle
ACKNOWLEDGMENTS
This research was supported by Hibah
Peningkatan Kapasitas Dosen Muda 2018 from
Universitas Gadjah Mada with the contract
number: 3126/UN1/DITLIT/DIT-LIT/LT/2018.
Authors thank to the Association of Kebumen PO
Breeders (ASPOKEB) for their cooperation in
data collection (blood samples and recording
data).
REFERENCES
Agarwal, R., P.K. Rout and S.K. Singh. 2009.
Leptin: a biomolecule for enhancing
livestock productivity. Indian J. Biotech.
8(2):169-176.
Aslaminejad, A.A., M.R. Nassiry, H. Farajollahi,
M. Mahdavi, H. Abbasi and A. Javadmanes.
2010. Polymorphism in exon 3 of leptin gene
in Iranian native cattle breeds. J. Appl.
Anim. Res. 37(2):159-162.
Banos, G., J.A. Woolliam, B.W. Woodward, A.B.
Forbes and M.P. Coffey. 2008. Impact of
single nucleotide polymorphism in leptin,
132
leptin receptor, growth hormone receptor
and diacylglycerol acyltransferase (DGAT1)
gene loci on milk production, feed and body
energy traits of UK Dairy cows. J. Dairy Sci.
91(8):3190-3200.
Choundhary, V., P. Kumar, T.K. Bhattacharya, B.
Bhushan and A. Sharma. 2005. DNA
polymorphism of leptin gene in Bos indicus
and Bos taurus cattle. Genet. Mol. Biol.
28(4):740-742.
Corva, P.M., G.V.F. Macedo, L.A. Soria, J.P.
Mazzucco, M. Motter, E. L. Villarreal, A.
Schor, C.A. Mezzadra, L.M. Melucci and
M.C. Miquel. 2009. Effect of Leptin gene
polymorphism on growth, slaughter and
meat quality traits of grazing Brangus steers.
Genet. Mol. Res. 8(1):105-116.
DeVuyst, E.A., J.T. Biermacher, J.L. Lusk, R.G.
Mateescu, J.B. Blanton, J.S. Swigert, B.J.
Cook and R.R. Reuter. 2011. Relationships
between fed cattle traits and Igenity panel
scores. J. Anim. Sci. 89(5):1260-1269.
Denver, R. J., R. M. Bonett, G. C. Boorse. 2011.
Evolution of leptin structure and function.
Neuroendocrinology. 94(1):21-38.
Fortes, M.R.S., R. A. Curi, L.A.L. Chardulo, A.C.
Silveira, M.E.O.D. Assumpção, J.A. Visintin
and H.N. de Oliveira. 2009. Bovine gene
polymorphisms related to fat deposition and
meat tenderness. Genet. Mol. Biol. 32(1):75-
82.
Friedman, J. M. 2011. Leptin and the regulation
of body weight. Keio J. Med. 60(1):1-9
Han, S.H., I.C. Cho, M.S. Ko, H.Y. Jeong, H.S.
Oh and S.S. Lee. 2010. Effects of POU1F1
and GH1 genotypes on carcass traits in
Hanwoo cattle. Genes & Genomics.
32(2):105-109.
Hartatik, T., D. Maharani, J.H.P. Sidadolog, A.
Fathoni and Sumadi. 2018. Haplotype
diversity of partial Cytochrome b Gene in
Kebumen Ongole Grade Cattle. Trop. Anim.
Sci. J. 41(1):8-14.
Hartatik, T., T.S.M. Widi, S.D. Volkandari, D.
Maharani, and Sumadi. 2014. Analysis of
DNA polymorphism in SRY Gene of
Madura Cattle populations. Procedia
Environ. Sci. 20:365–369.
Hartatik, T., W.B.P. Putra., S.D. Volkandari, and
Sumadi. 2015. Polymorphism of mtDNA
Cytochrome b Gene of Local Cattle in
Indonesia. J-SustaiN. 3(1):1-24.
Hernández, N., J.C. Martínez-González, G.M.
Parra-Bracamonte, A.M. Sifuentes-Rincón,
J.Indonesian Trop.Anim.Agric. 44(2):125-134, June 2019
 N. López-Villalobos, S.T. Morris, F.
Briones-Encinia, E. Ortega-Rivas, V.I.
Pacheco-Contreras and L.A. Meza-García.
2016. Association of polymorphisms in
growth hormone and leptin candidate genes
with live weight traits of Brahman cattle.
Genet. Mol. Res. 15(3):1-9.
Hilmia, N., D. Rahmat and D. Dudi. 2018. Leptin
gene polymorphism of Ongole Grade cattle
based on single nucleotide polymorphism. J.
Indonesian Trop. Anim. Agric. 43(4):309-
314.
Jakaria and R.R. Noor. 2015. Identification of a
single nucleotide polymorphism at hinf-1
enzyme restriction site of pit-1 gene on
Indonesian Bali cattle population. Media
Peternakan. 38(2):104-109.
Javanmard, A., N. Asadzadeh and F. Sarhadi.
2010. DNA polymorphism of bovine
pituitary-specific transcription factor and
leptin gene between Iranian Bos indicus and
Bos taurus cattle. Am. J. Agric. Biol. Sci.
5(3):282-285.
Kang, S. and D. Shin. 2004. The size of the chi-
square test for the Hardy-Weinberg law.
Hum. Hered. 58(1):10–17.
Kaygisiz, A., C. Bengi and S. Cilek. 2011.
Investigation of leptin gene polymorphisms
in East Anatolian Red Anatolian and Black
cattle and determination of genetic distance
from Brown Swiss Cattle. J. Anim. Plant.
Sci. 21(2):121-125.
Kawaguchi, F., K. Okura, K. Oyama, H. Mannen
and S. Sasazaki. 2017. Identification of
leptin gene polymorphisms associated with
carcass traits and fatty Japanese Black cattle.
Anim. Sci. J. 88(3):433-438.
Kim, T. K. 2015. T test as a parametric statistic.
Korean J. Anesthesiol. 68(6): 540-546.
Kononoff, P.J, P.J. Defoor, M.J. Engler, J.F.
Gleghorn, R.S. Swingle, S.T. James and
F.L.S. Marquess. 2017. Impacts of a leptin
SNP on growth performance and carcass
characters in finishing steers studied over
time. J. Anim. Sci. 95(1):194-200.
Liefers, S.C., R.F. Veerkamp, M.F.W. Te Pas, C.
Delavaud, Y. Chilliard, M. Platje, and T. Van
der Lende. 2002. Associations between
leptin gene polymorphisms and production,
live weight, energy balance, feed intake, and
fertility in holstein heifers. J. Dairy Sci.
85(6):1633–1638.
Maharani, D., A. Fathoni, Sumadi, T. Hartatik and
M. Khusnudin. 2018. Identification of
Association of Leptin Gene with Growth Traits in Cattle (A. Fathoni et al.)
MC4R gene and its association with body
weight and body size in Kebumen Ongole
Grade cattle. J. Indonesian Trop. Anim.
Agric. 43(2):87-93.
Maharani, D., A. H. K. Amrullah, D.T. Widayati,
Sumadi, A. Fathoni and M. Khusnudin.
2017. Predicting the age and weight at
puberty of Ongole Grade cattle using
nonlinear mathematical model in Kebumen
Farmer Association. J. Indonesian Trop.
Anim. Agric. 42(4):233-239.
Matteis, G.D., M.C. Scata, F. Grandoni, F.
Petrera, F. Abeni, G. Catillo, F. Napolitano
and B. Moioli. 2012. Association analyses of
single nucleotide polymorphisms in the
leptin and leptin receptor genes on milk and
morphological traits in Holstein cows. J.
Anim. Sci. 2(3):174-182.
Moonesinghe, R., A. Yesupriya, M. Chang, N.F.
Dowling, M.J. Khoury and A.J. Scott. 2010.
A Hardy-weinberg equilibrium test for
analyzing population genetic surveys with
complex sample designs. Am. J. Epidemiol.
171(8):932–941.
Mukesh, M., M. Sodhi, R.C. Sobti, B. Sobti, B.
Prakash, R. Kaushik, R.A.K. Aggarwal and
B.P. Mishra. 2008. Analysis of bovine
pituitary specific transcription factor-HinfI
gene polymorphisms in Indian zebuine
cattle. Livest. Sci. 113(1):81-86.
Nanjappa, V., R. Raju, B. Muthusamy, J. Sharma
and J.K. Thomas. 2011. A comprehensive
curated reaction map of leptin signaling
pathway. J. Proteomics Bioinform. 4(9):184-
189.
Nassiry, M.R., A.H. Moussavi, A.R. Alashawkany
and S. Ghovati. 2007. Leptin gene
polymorphism in Iranian native Golpayegani
and Taleshi cows. Pak. J. Biol. Sci.
10(20):3738-3741.
Orrù, L., G.F. Cifuni, E. Piasentier and M.
Corazzin. 2011. Association analyses of
single nucleotide polymorphisms in the LEP
and SCD1 genes on the fatty acid profile of
muscle fat in Simmental bulls. Meat Sci.
87(4):344-348.
Ozdemir, M. 2012. Determination of PIT-
1/HINF1 polymorphism in Holstein and
native ear cattle raised as genetic resource in
Turkey. J. Anim. Plant Sci. 22(1):25-28.
Putri, R., R. Priyanto, A. Gunawan, and Jakaria.
2015. Association of Calpastatin (CAST)
gene with growth traits and carcass
characteristics in Bali Cattle. Media
133
 Peternakan. 38(3):145-149.
Romaino, S.M.N. , Z.A. Fazly-Ann , S.S. Loo,
M.M. Hafiz , M.D. Hafiz , M.I. Iswadi , P.
Kashiani , M.K.A. Rosli , S.M.F. Syed-
Shabthar , B.M. Md-Zain and O. Abas-
Mazni. 2014. Species identification of
Malayan Gaur, Kedah Kelantan and Bali
cattle using polymerase chain
reactionrestricted fragment length
polymorphism. Genet. Mol. Res. 13(1):406-
414.
Sahu, S.S., S.K. Choursia, A.K. Chaturvedani and
Om Prakash. 2017. Correlation between
body weight and linear body measurements
in adult female Sahiwal cattle. Indian J. Vet.
Sci. Biotech. 12(3):90-93
Sáinz, N., J. Barrenetxe, M. J. Moreno-Aliaga and
J.A. Martínez. 2015. Leptin resistance and
diet-induced obesity: central and peripheral
actions of leptin. J. Metabolism. 64:35-46.
Schenkel, F.S., S.P. Miller, X. Ye, S.S. More, J.D.
Nkrumah, C. Li, J. Yu, I.B. Mandell, J.W.
Wilton and J.L. Williams. 2005. Association
of single nucleotide polymorphisms in the
leptin gene with carcass and meat quality
traits of beef cattle. J. Anim. Sci.
83(9):2009-2020.
Seong, J., D. S. Suh, K. D. Park, H. K. Lee and H.
S. Kong. 2012. Identification and analysis of
MC4R polymorphisms and their association
with economic traits of Korean cattle
(Hanwoo). Mol. Biol. Rep. 39(4):3597-3601.
Sharifzadeh, A., A. Doosti and S. Moshkelani.
2010. Genetic polymorphism at the leptin
gene in Iranian Holstein cattle by PCR-
RFLP. J. Anim. Vet. Adv. 9(10):1420-1422.
Shin, S.C. and E.R. Chun. 2006. Association of
134
SNP marker in the leptin gene with carcass
and meat quality traits in Korean cattle.
Asian-Aust. J. Anim. Sci. 20(1):1-6.
Silva, D.B.S., B.A. Crispim, L.E. Silva, J.A.
Oliveira, F. Siqueira, L.O. Seno and A.B.
Grisolia. 2014. Genetic variations in the
leptin gene associated with growth and
carcass traits in Nellore cattle. Genet. Mol.
Res. 13(2):3002-3012.
Sutarno and A.D. Setyawan. 2015. Review:
Genetic diversity of local and exotic cattle
and their crossbreeding impact on the quality
of Indonesian cattle. Biodiversitas.
16(2):327-354.
Sutarno, A.D. Setyawan, and A.J. Lymbery. 2015.
Genetic diversity of five Indonesian native
cattle breeds at microsatellite loci. Asian J.
Anim. Sci. 9(2):57-64.
Tamura, K., D. Peterson, N. Peterson, G. Stecher,
M. Nei and S. Kumar. 2011. MEGA5:
Molecular evolutionary genetics analysis
using maximum likelihood, evolutionary
distance, and maximum parsimony methods.
Mol. Biol. Evol. 28(10): 2731-2739.
Thompson, N.M., E. A. DeVuyst, B.W. Brorsen
and J.L. Lusk. 2014. Value of genetic
information for management and selection of
feedlot cattle. J. Agric. Res. Econom.
39(1):139-155.
Vann, R.C., J.A. Parish and B.B. Karisch. 2017.
Using Live Animal Carcass Ultrasound
Information in Beef Cattle Selection,
Mississippi State University.
Warwick, E.J., J.M. Astuti, dan W. Hardjosubroto.
(1990) Pemuliaan Ternak. Universitas
Gadjah Mada Press. Yogyakarta, Indonesia.
J.Indonesian Trop.Anim.Agric. 44(2):125-134, June 2019
159
160
161
162
163