General and Comparative Endocrinology 301 (2021) 113647

Contents lists available at ScienceDirect

General and Comparative Endocrinology

journal homepage: www.elsevier.com/locate/ygcen

Research paper

Molecular identification of FNDC5 and effect of irisin on the glucose

metabolism in common carp (Cyprinus carpio L.)
Liping Yang , Shaoyang Zhi , Guokun Yang , Chaobin Qin , Wenli Zhao, Mingming Niu,
Wenlei Zhang, Wenyu Tang, Xiao Yan, Yuru Zhang , Xiaolin Meng , Ronghua Lu , Guoxing Nie *
College of Fisheries, Engineering Technology Research Center of Henan Province for Aquatic Animal Cultivation, Henan Normal University, No. 46 Jianshe Road,
Xinxiang 453007, PR China

A R T I C L E I N F O A B S T R A C T

Keywords: Irisin, encoded by fibronectin type III domain-containing protein 5 (FNDC5) gene, plays a role in energy
FNDC5 expenditure and insulin sensitivity in mice. In fish, the function of irisin related to glucose metabolism is less
Irisin reported. It may increase glucose utilization in fish. The aim of the present study was to characterize the reg­
Plasma glucose
ulatory role of irisin in glucose metabolism in common carp (Cyprinus carpio L.). In this study, FNDC5a and
Glucose metabolism
Cyprinus carpio L.
FNDC5b were isolated from common carp. The cDNA of FNDC5a and FNDC5b were 722 bp and 714 bp, encoding
221 and 207 amino acids, respectively. FNDC5a was abundantly expressed in the brain and gonad. FNDC5b was
mainly expressed in brain. Different expression pattern of FNDC5a and FNDC5b under fasting/refeeding and
OGTT experiment were identified. The recombinant common carp irisinA and irisinB were prepared by pro­
karyotic expression system. Glucose concentration was decreased in treatment with irisinA or irisinB in the in
vitro and in vivo experiments. The mRNA expression levels of gluconeogenesis-related genes were significantly
down-regulated, while the mRNA expression of glycolysis-related genes were significantly up-regulated after
treatment with recombinant irisinA or irisinB in liver in vivo and in primary hepatocytes in vitro. Our research
shows that irisin inhibits hepatic gluconeogenesis and promotes hepatic glycolysis. Taken together, this study for
the first time revealed the two subtypes of FNDC5 and explored the function and mechanisms of irisinA and
irisinB in fish glucose homeostasis.

1. Introduction
FNDC5 is the precursor of irisin, in which includes a N-terminal
signal peptide, a FN3 domain, a hydrophobic domain inserted in the
phospholipid bilayer, and a Carboxy (C)-terminal domain located in the
cytoplasm (Novelle et al., 2013). The C-terminus is cleaved and the
remaining 112 amino acids peptide is released as irisin (Wrann, 2015).
Irisin is a newly identified myokine, produced by skeletal muscle in
response to exercise (Boström et al., 2012). The recent immunohisto­
chemical studies showed that other tissues such as liver, brain, testis,
spleen, pancreas, and stomach are also able to produce irisin (Gür et al.,
2018). Various functions of irisin have been reported, including
uncoupling protein 1(ucp1) induction, white adipocytes browning,
resulting in increased energy expenditure (Boström et al., 2012).
Irisin has recently drawn attention as a regulator in glucose ho­
meostasis (Perakakis et al., 2017). In non-diabetic individuals, serum
irisin was positively correlated with fasting blood glucose, body mass
index (BMI), and age (Huh et al., 2012; Liu et al., 2013). Recently,
FNDC5 overexpression or persistent subcutaneous perfusion of irisin
reduces hyperglycemia in obese mice (Xiong et al., 2015). Moreover,
perfusion of irisin promotes glucose uptake in skeletal muscle cells in
rodents (Lee et al., 2015). Circulating glucose also comes from gluco­
neogenesis and glycogenolysis during fasting, and liver possesses the
remarkable ability to produce and utilize glucose (Adeva-Andany et al.,
2016). In mouse primary hepatocytes, irisin ameliorates the increases in
pepck and g6pase expression, and gs phosphorylation in GlcN-induced
insulin resistance mice (Liu et al., 2015). The effect of irisin on
glucose homeostasis was limited to human and rodents, and the
comparative aspects of FNDC5 in non-mammalian species, especially in
lower vertebrates, are still absent.
To date, the physiological role of irisin on feeding has been reported
in goldfish and zebrafish by peripheral injections of human irisin (Butt
et al., 2017; Sundarrajan et al., 2017). In goldfish, irisin decreases
feeding and increases locomotor activity and increases orexin and cart

* Corresponding author.
E-mail address: niegx@htu.cn (G. Nie).

https://doi.org/10.1016/j.ygcen.2020.113647
Received 6 May 2020; Received in revised form 1 September 2020; Accepted 6 October 2020
Available online 7 November 2020
0016-6480/© 2020 Elsevier Inc. All rights reserved.
L. Yang et al. General and Comparative Endocrinology 301 (2021) 113647

mRNA level (Butt et al., 2017). However, in zebrafish, irisin does not
affect feeding, but food intake is significantly reduced in irisin knock­
down experiment using siRNA (10 ng/g B.W.) (Sundarrajan and
Unniappan, 2017). The serum levels of irisin in Alburnus tarichi is in­
dependent of body weight and length (Caf et al., 2017). Furthermore,
Nadermann and Volkoff found that short-term exercise did not affect
hypothalamic expression of irisin in goldfish (Nadermann and Volkoff,
2020). The role of irisin on energy homeostasis seems different in
various fish species.
Common carp has been used to investigate glucose metabolism
(Deng et al., 2020; Hertz et al., 1989). The aim of the present study was
to investigate the effects of irisin on glucose metabolism in common
carp. First, the common carp FNDC5a and FNDC5b were isolated and
characterized. Second, the recombinant protein of irisin was prepared
by using Escherichia coli expression system. Finally, the effect of irisin on
the genes related to gluconeogenesis and glycolysis were evaluated in in
vivo and in vitro experiments. The results of this research, for the first
time, show a role for irisin in regulating glucose metabolism in fish.
2. Materials and methods
2.1. Animals
Eleven-month-old male and female common carps with a body
weight of 35 to 70 g were purchased from Yanjin Aquaculture Experi­
mental Center of Henan, China. The fishes were distributed into indoor
tanks (30/tank) and cultured in the fresh water circulatory system at
27 ◦ C with a natural photoperiod (light: darkness = 12 h: 12 h). Water
temperature, dissolved O2, pH and ammonia were maintained at 27 ◦ C,
5.5 ± 0.27 mg/L, 7.19 ± 0.35, 0.07 ± 0.02 mg/L. After acclimated to
laboratory conditions for 2 weeks, fish were fed to satiety twice daily
with commercial feed (Tongwei, Xinxiang, China). All fish were anes­
thetized in 55 mg/L MS222 (Aladdin, Shanghai, China) before sacrifice.
All animal procedures were approved by Laboratory Animal Care and
Use Committee of the Henan Normal University.
2.2. Cloning of FNDC5a and FNDC5b in common carp
To demonstrate the open reading frame (ORF) sequence, reverse
transcription-polymerase chain reaction (RT-PCR) was performed.
These sequences obtained by blasting the transcriptome shotgun as­
sembly (TSA) database with the coding sequence (CDS) of zebrafish
FNDC5a (XM_001335368) and FNDC5b (NM_001044337). Using
primers (Table 1) designed based on the transcribed RNA sequence of
common carp FNDC5a (XM_019118418, GFWU01036429,
XM_019118420) and FNDC5b (GFWU01017920). Subsequently, PCR
was performed and two types of common carp FNDC5 cDNA were iso­
lated. The procedure of all PCR was: 94 ◦ C for 3 min; 30 cycles with
denaturation at 94 ◦ C for 10 s, annealing at 55 ◦ C for 5 s, and extension
at 72 ◦ C for 35 s, and the final extension at 72 ◦ C for 5 min. All the PCR
products were purified by the E.Z.N.A Gel Extraction Kit (Omega, Bei­
jing, China) and sub-cloned into pMD19-T vector for DNA sequencing

Table.1
Primers used in this study.
Name Sequences (5′ -3′ ) Purpose GenBank ID

ffndc5aF1 ATCGACGTGAATGCAAGACC Full length of fndc5a cDNA clone XM_019118418

ffndc5aR3 GTTCACCTTTCTGGCTTCT GFWU01036429
ffndc5aR4 TCACCCTTTGATAATGTTCAC XM_019118420
ffndc5bF1 TCGACTTTCTGCGGCAAG GFWU01017920
ffndc5bF2 TCTTGCGAGTAAATGGGAT
ffndc5bR1 AGCCTATTATTGCCGACAG Full length of fndc5b cDNA clone
oirisinAF CGGAATTCCATCATCATCATCATCATTTGGATGCTCCAGTGA Construction of irisinA expression vector MT361875
oirisinAR ATAGTTTAGCGGCCGCTCATTCTTCCATGGTCAC
oirisinBF CGGAATTCCATCATCATCATCATCATGACAGTTTATCTGCTC Construction of irisinB expression vector MT361876
oirisinBR ATAGTTTAGCGGCCGCTTACTCCTCCATGGTCAC
qfndc5aF AACCGCTGCGTTTCAAAACC fndc5a Real time PCR MT361875
qfndc5aR CATGGTCACTTCGTCTTTGCTC
qfndc5bF ATGACAGTTTATCTGCTCCAC fndc5b Real time PCR MT361876
qfndc5bR TCCTCCAAGTCCCACAA
ucp1F TCATTTCGTGTCTGCGTTCG ucp1 Real time PCR AY461434.3
ucp1R TTCATGTAGCGCGTCTTCAC
ucp2F AAGGAACTGGCCCAAACATC ucp2 Real time PCR AJ243486.1
ucp2R ACCAGCTCCAAATGCAGATG
ucp3F TACAACGGCACAATGGATGC ucp3 Real time PCR AY505343.1
ucp3R CGCGTTCCTTGTGATGTTTG
pgc1aF TGCTGCTTTGGTTGGTGAAG pgc1a Real time PCR AB767302.1
pgc1aR TGCATCGAGGTCACTGACATC
glut2F GAGGGTCTTTGTGGGAACTATG glut2 Real time PCR XM_019072653.1
glut2R GTTTCAGGTACACGCAAGTAGA
gsF TTTTGGCCGCTGGTTGATTG gs Real time PCR XM_019090903.1
gsR ATAGGGTAGTCCAATGCTGCAC
pyglF TGGTTGACGACGATGCTTTC pygl Real time PCR XM_019125106.1
pyglR ACTGCGCAAACTTCAGCTTG
g6paseF GAGGCCTTCAACAGACAGAAA g6pase Real-time PCR AF427863.1
g6paseR GAGCTTTGAGAAGCAGGTACAA
fbpaseF CCTGCCATCGGTGAGTTTAT fbpase Real-time PCR AF427864.1
fbpaseR CCATCCTCTGGGAATTTCTTCT
gkF TGGAGTACGACCGTGTTATTG gk Real-time PCR AF053332.2
gkR CGCAAGCTCTCCCATATACTT
pfkF CGTTCGACAGGAATTTTGGC pfk Real-time PCR XM_019074709.1
pfkR TTCATGCCGATCACACAAGC
hkF CGTTGTAGCCGTAGTGAATGA hk Real-time PCR AF119837.1
hkR GCTACCCGTTCCTGCAATTA
pepckF ACTCTTTGGGCAGACCTTTAC pepck Real-time PCR KP250869.1
pepckR CTGTCTGGTGTCAGGAAGATG
18sF GAGACTCCGGCTTGCTAAAT Reference gene FJ710826.1
18sR CAGACCTGTTATTGCTCCATCT

2
L. Yang et al.
(Takara, Dalian, China). The ORF Finder in NCBI (http://www.ncbi.
nlm.nih.gov/gorf/orfig.cgi) was used to get the ORF, the molecular
mass and isoelectric point of irisinA and irisinB protein were analyzed
with ExPASy (http://web.expasy.org/compute_pi/). The signal peptide
of common carp FNDC5 was predicted using the SignalP4.1 Server
(http://www.cbs.dtu.dk/services/SignalP/). The phosphorylation sites
and glycosylation sites of the common carp FNDC5 were analyzed by
NetPhos 2.0 Server (http://www.cbs.dtu.dk/services/NetPhos/) and
NetNGlyc 1.0 Server (http://www.cbs.dtu.dk/services/NetNGlyc/),
respectively. Protein sequence alignment was performed using Clus­
talW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/). The phyloge­
netic tree was constructed with MEGA-X by neighbor-joining method
(bootstrap phylogeny test, 2000 replicates).
2.3. Tissue distribution and effects of different nutritional status on
FNDC5 mRNA expression
Six common carps dissected for tissue distribution analysis. The
brain areas (the telencephalon, mesocerebrum, cerebellum, hypothala­
mus), pituitary and peripheral tissues (the head kidney, kidney, heart,
liver, spleen, foregut, midgut, hindgut, red muscle, white muscle, gonad,
gill, and skin) were collected quickly and snap-frozen in liquid nitrogen,
and then stored at − 80 ◦ C until RNA extraction.
Experimental fish with a body weight of 65 ± 3 g were used in
starvation experiment as described previously (Yang et al., 2017). After
acclimation for 7 days, all fish were divided into 3 groups (n = 6 fish/
group). The first group of fish were fed for 7 days (fed 6 h before sam­
pling on Day 7) and used as the control group (“Fed”), the second group
of fish were maintained under food deprivation for 7 days (“Fasted”),
and the third group of fish were fasted for 7 days and refed 6 h before
sampling on Day 7 (“Refed”). At the end of the experiments, all fish were
anesthetized and dissected. The hypothalamus, heart, liver, white
muscle, red muscle, foregut, midgut, hindgut were collected quickly and
snap-frozen in liquid nitrogen, and then stored at − 80 ◦ C until RNA
extraction.
2.4. Effect of oral glucose tolerance test on FNDC5 mRNA expression
Common carps with body weight of 65 ± 3 g were cultured in 12 h:
12 h (light: dark) cycle and fed twice daily until decapitated. The
common carps were grouped by different treatments at random. Put fish
into different tanks (twelve replicates per tank).
The oral glucose tolerance tests (OGTT) were performed as described
previously (Chen et al., 2018; Lin et al., 1995). After the 24 h of food
deprivation, the glucose solution (dissolved in physiological saline) was
administered to fish by gavage at concentrations of 1.67 mg/g body
weight (B.W.). In control groups, the fish were treated by gavage with
physiological saline based on body weight.
Sampling at 0, 1, 2, 3, 5, 10 h after the treatment. The brain, liver,
white muscle, red muscle and midgut were collected immediately and
snap-frozen in liquid nitrogen and stored in − 80 ◦ C until RNA
extraction.
2.5. Production of recombinant protein by prokaryotic expression system
Recombinant irisinA and irisinB were prepared using the Escherichia
coli expression system. The cDNA fragment of FNDC5 coding for irisin
was cloned by PCR with specific primers. Not I and EcoR I sites were
introduced at the upstream and downstream of the fragment, respec­
tively. In addition, a 6 × His tag was introduced to the site between the
N-terminal sequence and the EcoR I site of irisin for screening. The
primer sequences were shown in Table 1. The cloned fragment was
treated with restriction enzymes (Not I and EcoR I) (NEB, Massachusetts,
USA), and the product was purified and sub-cloned into pET21a
(Thermo, California, USA) (Supplementary Fig. 1). The monoclonal
strains were selected and positive clone samples were sequenced by ABI
3
General and Comparative Endocrinology 301 (2021) 113647
3730 DNA sequencer (Thermo, California, USA). According to manu­
facturer’s protocol, the expression plasmid was transformed into BL21
(DE3) (Solarbio, Beijing, China) by thermal stimulation method. The
Isopropyl-beta-D-thiogalactoside (IPTG) (Sigma, Shanghai, China) was
used to induce protein expression with a final concentration of 1 mmol/
l. Subsequently, the product was treated and loaded into Ni+-NTA resin
column (GE, Pittsburgh, USA). Purified proteins were dialyzed against
PBS buffer (Solarbio, Beijing, China). The purified protein was analyzed
by SDS-PAGE and western blot. The protein concentrations were
quantified using BCA assay (Solarbio, Beijing, China).
2.6. Intraperitoneal injection of the recombinant irisinA and irisinB
For in vivo experiments, common carps with weight of 40 ± 2 g were
maintained in same environment as before. The recombinant irisinA and
irisinB were dissolved in phosphate buffer solution (PBS), and injected
intraperitoneally at concentrations of 10, 100 and 1000 ng/g body
weight.
For the control groups, fish were injected with PBS based on the body
weight. Blood samples were obtained from the caudal vein of each fish at
3 h, 6 h and 12 h after injection (n = 9) using a 22-gauge needle attached
to a 1 ml heparinized syringe. And then, the samples were centrifuged at
7500g for 10 min, and the serum was isolated. The serum was stored at
− 80 ◦ C for the determination of glucose. The concentrations of glucose
was measured with commercial kits (Biogo, Shanghai, China). At the
same time, the liver samples of common carp were collected immedi­
ately and snap-frozen in liquid nitrogen, stored in − 80 ◦ C until use.
2.7. Hepatocytes isolation, culture and treatments
Common carp hepatocytes were isolated by 0.5 mg/ml collagenase 4
(Sigma, shanghai, China) and 100 U/ml DNase 2 (Sangon Biotech,
Shanghai, China) digestion method and the cells were seeded at a den­
sity of 8 × 105 cells/ml into 24-well plates pre-coated with Poly­
ethylenimine (PEI) (Sigma, shanghai, China), at 27 ◦ C. And saturated
humidity with plain air in an incubator as described previously (Wang
et al., 2016). After overnight incubation, the medium was replaced with
serum-free fresh DMEM/F12 medium (Gibco, California, USA). To
observe the effect of irisin on genes related to glucose metabolism, cell
experiment was performed. The cell viability was tested by microscopic
observations (Fischer et al., 2003). The cell cultures were incubated with
serum-free Dulbecco’s Modified Eagle Medium/F12 (DMEM/F12) me­
dium for 1 h before adding recombinant irisinA and irisinB (1 nmol/l,
10 nmol/l and 100 nmol/l) for 3 h, 6 h, 12 h and 24 h treatments. At the
end of the incubation, the culture was slowly removed and the cells were
collected and stored in − 80 ◦ C until RNA extraction. The cells were
collected and stored in − 80 ◦ C until RNA extraction. To measure the
intracellular glucose content, the cells were incubated as above. The
cells were lysed by Radio Immunoprecipitation Assay (RIPA) (Solarbio,
Shanghai, China) and measurement of glucose concentration using the
glucose assay kit and the protein content was measured by BCA assay for
correcting for cell number variations.
2.8. RNA extraction, reverse-transcription, and real-time quantitative
PCR
Total RNA was extracted from tissues or cells using RNAiso Plus
(Takara, Dalian, China) following the manufacturer’s instruction. The
quality of RNA was assessed by agarose gel electrophoresis. The purity
and yield of the RNA were evaluated by a Nanodrop 2000C spectro­
photometer (Thermo, California, USA), and a sample of OD260: 280 at
1.8–2.0 was available. Subsequently, the genomic DNA was eliminated
and the first strand cDNA was synthesized with the PrimeScript™ RT
reagent Kit with gDNA Eraser according to the manufacturer’s protocol.
The gene expression levels were assessed by real-time quantitative PCR.
The reaction components include 5 μl of SYBR Green (Takara, Dalian,
L. Yang et al. General and Comparative Endocrinology 301 (2021) 113647

China), 0.25 μl of forward and reverse primers (10 µM each), 1 µl of 3. Results

diluted cDNA templates and 3.5 µl of water. Samples amplification were
performed using the Roche LightCycler 480 Real-time PCR Detection
System with the following thermal cycling curves: 95 ◦ C for 3 min, 40
cycles of 95 ◦ C for 5 s, 60 ◦ C for 30 s. The relative gene expression levels
were calculated by the 2− ΔΔCt method. All specific primers were per­
formed using serial dilutions of correspond cDNA and amplification ef­
ficiencies close to 100%. The validity of the reference genes (18 s and
β-actin) was previously evaluated by comparing their transcript levels.
All experiments were performed in duplicate.
2.9. Statistical analysis
The data were presented as mean ± S.E.M. Statistical difference was
assessed using SPSS 20.0 software (SPSS Inc., Chicago, USA). The least
significant difference (LSD) test in one-way ANOVA was used to detect
differences in each sample. A significant difference is defined as prob­
ability less than 0.05 (P < 0.05).
3.1. Molecular cloning and sequence analysis of common carp FNDC5
cDNA
Two subtypes of the FNDC5 in common carp have been isolated. The
FNDC5a and FNDC5b cDNA were 722 bp and 714 bp, respectively. The
ORF of FNDC5a was 666 bp encoding 221 amino acids with a deduced
molecular mass of 24.586 KDa and isoelectric point of 5.52 (Supple­
mentary Fig. 2A). The ORF of FNDC5b was 624 bp encoding 207 amino
acids with a deduced molecular mass of 22.668 KDa and isoelectric point
of 4.93, respectively (Supplementary Fig. 2B). Based on sequence
analysis using the SignalP program, the first 25 amino acid of FNDC5a
was predicted to be the signal peptide. The amino acid sequence fol­
lowed the signal peptide was the irisin peptide region (112 amino acids)
(Supplementary Fig. 2A). Twenty-four phosphorylation sites were pre­
dicted in the common carp FNDC5a by NetPhos including thirteen serine
residues, ten threonine residues and one tyrosine residue. Furthermore,
there were two N-glycosylation sites (NVS and NTT) in the common carp
FNDC5a protein(irisinA) predicted by NetNGlyc (Supplementary
Fig. 2A). The first 26 amino acids of FNDC5b were predicted as the
signal peptide. The functional domain of FNDC5b (irisinB) consists of

Fig. 1. The mRNA expressions of FNDC5 in various tissues of common carp. A) The mRNA expressions of FNDC5a in various tissues of common carp. B) The mRNA
expressions of FNDC5b in various tissues of common carp. The mRNA levels were quantified by real-time PCR and normalized against 18 s transcripts. The values
represent the fold of telencephalon. All data were represented as the mean ± S.E.M (n = 6).

4
L. Yang et al. General and Comparative Endocrinology 301 (2021) 113647

112 amino acids (Supplementary Fig. 2B). Twenty-two phosphorylation
sites were predicted in the common carp irisinB by NetPhos including
fifteen serine residues, six threonine residues and one tyrosine residue.
Furthermore, there were two N-glycosylation sites (NVT and NTT) in the
common carp irisinB predicted by NetNGlyc (Supplementary Fig. 2B).
The common carp irisin amino acid sequences were aligned with that of
other species by ClustalW2 program (Supplementary Fig. 3). As shown
in Supplementary Table 1, the common carp FNDC5 displayed a high
degree of identity with other fish FNDC5, and a relatively low degree of
identity with that of other species. The phylogenetic tree was con­
structed using MEGA X based on irisin amino acid sequences of common
carp and other species. And the phylogenetic tree formed two distinct
clusters (Supplementary Fig. 4). irisinA and irisinB of common carp
clustered with their counterparts of other teleosts with high bootstrap
values.
3.2. Tissue distribution of FNDC5 gene expression
of common carp, real-time quantitative PCR was performed using cDNA
samples prepared from all tissues examined. High levels of FNDC5a were
detected in the gonad, mesocerebrum, telencephalon and hypothala­
mus. The lower FNDC5a levels were discovered in heart, liver and gill
(Fig. 1A). High levels of FNDC5b were detected in telencephalon, hy­
pothalamus and mesocerebrum. And a lower extent was discovered in
peripheral tissues (Fig. 1B).
3.3. Effects of nutritional status on the mRNA expression of FNDC5
To evaluate the effects of nutritional condition on FNDC5 mRNA
expression, the fasting and refeeding experiments were performed. In
liver and midgut, the mRNA expression level of FNDC5a was signifi­
cantly up-regulated after fasting 7 days and restored back to the normal
levels after refeeding (Fig. 2C, E). However, the expression of FNDC5b
significantly decreased in heart, hypothalamus and hindgut in fasted
group (Fig. 2I, J, N), while it had an increase tent in liver. Refed groups
restored back to normal levels after refeeding (Fig. 2).

In order to detect the expression pattern of FNDC5 in different tissues

Fig. 2. Effects of fasting and refeeding on the mRNA expressions of FNDC5a. The mRNA expression levels of FNDC5a in the A) hypothalamus, B) heart, C) liver, D)
foregut, E) midgut, F) hindgut, G) white muscle and H) red muscle and the FNDC5b mRNA expression in the I) hypothalamus, J) heart, K) liver, L) foregut, M)
midgut, N) hindgut, O) white muscle and P) red muscle of common carp were quantified by real-time PCR and normalized against 18 s transcripts. The results were
represented as the fold of fed. All data are shown as mean ± S.E.M (n = 5–6). Significant differences (P < 0.05) were indicated by *.

5
L. Yang et al. General and Comparative Endocrinology 301 (2021) 113647

Fig. 3. Relative expression of FNDC5 in the brain, midgut, liver, white muscle, red muscle of common carp after a glucose load. Common carp was orally
administered with glucose (1.67 mg/g B.W) or 0.65% saline for 1, 2, 3, 5, 10 h, the FNDC5a mRNA expression in A) brain, B) liver, C) midgut, D) white muscle, E) red
muscle and the FNDC5b mRNA expression in F) brain, G) liver, H) midgut were investigated and normalized against 18 s transcripts. The results were represented as
the fold of control. All data are shown as mean ± S.E.M (n = 10–12). Significant differences (P < 0.05), (P < 0.01) and (P < 0.001) were indicated by *, ** and ***.

Fig. 4. Common carp FNDC5a and FNDC5b expres­

sion strain selected and Irisin protein expressed. Pos­
itive strain was selected and the expressed protein
were verified by SDS-PAGE and western blot with His
primary antibody. A) SDS-PAGE of IrisinA, B) Western
blot with His primary antibody of IrisinA, C) IrisinA
protein purified with Ni+-NTA resin was verified by
SDS-PAGE, D) SDS-PAGE of IrisinB, E) Western blot
with His primary antibody of IrisinB, F) IrisinB pro­
tein purified with Ni+-NTA resin was verified by SDS-
PAGE.

6
L. Yang et al.
3.4. Effects of oral glucose tolerance test on FNDC5 mRNA expression
To assess the effect of glucose load on the transcript level of FNDC5,
oral glucose tolerance test (OGTT) experiment was performed. The
expression of FNDC5a was significantly up-regulated in brain and
midgut after OGTT 1 h (Fig. 3A, C), while the FNDC5a levels was
significantly up-regulated in red muscle after treatment 2 h (Fig. 3D). On
the contrary, the expression of FNDC5a in the liver was significantly
down-regulated after 1 h of glucose treatment (Fig. 3B). Similar to the
expression pattern of FNDC5a in liver, decreased levels of FNDC5b was
observed after 1 h of glucose tolerance (Fig. 3G). However, the FNDC5b
level was significantly reduced in brain after OGTT 2 h, and the FNDC5b
levels decreased was discovered in midgut after OGTT 1 h (Fig. 3F, H).
3.5. Production and purification of the common carp recombinant irisin
The pET21a-FNDC5 prokaryotic expression vector was constructed.
The positive strain was selected and the expressed protein was verified
by SDS-PAGE and Western blotting. As predicted, the molecular weight
of recombinant irisinA and irisinB were 14.934 KDa and 14.680 KDa,
respectively (Fig. 4A, D). Western blot showed a single protein band and
the band was same as expectations (Fig. 4B, E). The positive strain was
cultured for large scale protein expression and the protein was purified
with Ni+-NTA resin. The molecular weight of recombinant irisinA and
irisinB were verified by SDS-PAGE and stained by Coomassie Brilliant
Blue R250 (Fig. 4C, F).
3.6. Biological activity assay
The primary hepatocytes of common carp were treated by irisinA and
irisinB (10 nmol/l and 100 nmol/l) for 12 h. The mRNA expressions of
ucps and pgc1α were detected. The ucps and pgc1α mRNA expression
were significantly increased after treatment with 100 nmol/l irisinA
(Fig. 5A). In parallel treatment, irisinB has no significant effect on the
7
General and Comparative Endocrinology 301 (2021) 113647
expression of the ucps, but it significantly up-regulated pgc1α (Fig. 5B).
3.7. Effect of irisin on glucose metabolism in common carp primary
hepatocytes
In vitro experiment, the glucose content of primary hepatocytes were
significantly decreased after treatment with 100 nmol/l irisinA or irisinB
(Fig. 6A, B). After treatment with irisinA, the glut2 mRNA expression was
significantly down-regulated at 3 h, and significantly up-regulated at 12
and 24 h (Fig. 6C). The gs expression was increased with a dose-
dependent in the liver at 12 h (Fig. 6C). After treatment with irisinB,
the glut2 mRNA expression was significantly down-regulated at 3 h and
12 h, and significantly up-regulated at 24 h (Fig. 6C). The mRNA
expression of pygl was significantly suppressed at 6 h and 12 h (Fig. 6C).
And the mRNA expression levels of g6pase, pepck, fbpase were signifi­
cantly down-regulated after incubation with recombinant irisinA or
irisinB (Fig. 6C). The mRNA expression of pfk, gk and hk were signifi­
cantly up-regulated (Fig. 6C).
3.8. Effect of irisin on glucose metabolism via intraperitoneal (i.p.)
injection
In vivo experiments, the blood glucose level was significantly
decreased at 3, 6 and 12 h after treatment with irisinA (1000 ng/g B.W)
(Fig. 7A). Blood glucose was significantly reduced in 3, 6 and 12 h after
irisinB treatment (Fig. 7B). Glut2, gs and pygl mRNA levels were detected
in the liver. The result showed that both middle dose (100 ng/g B.W)
and high dose (1000 ng/g B.W) of irisinA could significantly up-regulate
mRNA expression of glut2 at 3 h and 12 h after injection (Fig. 7C). Gs
mRNA expression was significantly increased after treatment with iri­
sinA for 6 h and 12 h (Fig. 7C). After irisinB injection, glut2 mRNA
expression was stimulated at 3, 6 and 12 h (Fig. 7C). Pygl mRNA
expression was remarkably decreased by high dose of irisinB at 3, 6 and
12 h (Fig. 7C). And the fbpase, g6pase and pepck mRNA expression were
Fig. 5. Effects of recombinant Irisin on ucp1, ucp2,
ucp3 and pgc1α gene expression in common carp he­
patocytes. After common carp hepatocytes treatment
with recombinant IrisinA and IrisinB, samples were
collected and the genes expression were detected.
Common carp hepatocytes were incubated with re­
combinant Irisin (10 nmol/l, 100 nmol/l) for 12 h. A)
Treatment with IrisinA. B) Treatment with IrisinB. All
data normalized against 18 s transcripts. In the data
presented means ± S.E.M (n = 6) and significant
differences (P < 0.05), (P < 0.01) and (P < 0.001)
were indicated by *, ** and ***.
L. Yang et al.
significantly down-regulated (Fig. 7C), while gk, hk and pfk mRNA levels
were significantly up-regulated (Fig. 7C).
4. Discussion
In this study, using common carp and the primary hepatocytes cells
as a model, we have demonstrated for the first time that there are two
types of FNDC5 and irisin may serve as an endocrine stimulator to
8
General and Comparative Endocrinology 301 (2021) 113647
Fig. 6. Irisin effects glucose utilization in vitro of
common carp. The common carp hepatocytes were
treated with the indicated concentration (1 nmol/l,
10 nmol/l, 100 nmol/l) for the indicated duration of
time (3 h, 6 h, 12 h, and 24 h after incubated). After
common carp hepatocytes treatment with recombi­
nant IrisinA and IrisinB, samples were collected and
the mRNA expression of genes were detected. A)
Changes in glucose after common carp IrisinA (100
nmol/l) incubation in 3 h, 6 h, 12 h and 24 h (n = 6).
B) Changes in glucose after common carp IrisinB (100
nmol/l) incubation in 3 h, 6 h, 12 h and 24 h (n =
5–6). C) Effect of recombinant common carp IrisinA or
IrisinB on genes related to glucose metabolism of
common carp primary hepatocytes. All data normal­
ized against 18 s transcripts. In the data presented
means ± S.E.M and significant differences (P < 0.05),
(P < 0.01) and (P < 0.001) were indicated by *, **
and ***.
Fig. 7. Irisin effects glucose utilization in vivo of
common carp. Fish were injected intraperitoneally
with vehicle (PBS) or recombinant Irisin (10 ng/g B.
W, 100 ng/g B.W, 1000 ng/g B.W) for the indicated
duration of time (3, 6 or 12 h after i.p. injection). The
mRNA expression levels of genes was detected after
injection of common carp Irisin. A) Changes of com­
mon carp blood glucose after i.p. injection IrisinA
after 3 h, 6 h and 12 h (n = 8–9). B) Changes of
common carp blood glucose after i.p. injection IrisinB
after 3 h, 6 h and 12 h (n = 8–9). C) Effect of re­
combinant common carp IrisinA or IrisinB on genes
related to glucose metabolism of common carp liver.
All data normalized against 18 s transcripts. In the
data presented means ± S.E.M and significant differ­
ences (P < 0.05), (P < 0.01) and (P < 0.001) were
indicated by *, ** and ***.
regulate glucose metabolism in fish. Irisin exerts as a metabolic regu­
lator with impact on glucose metabolism in mammal (Liu et al., 2013;
Perakakis et al., 2017), and recently, the amelioration effect of irisin on
diabetic and obesity has been discovered in genetic-induced or diet-
induced obese mice (Mo et al., 2016; Niranjan et al., 2019). Current
research finds that there was only one kind of FNDC5 genotype in
mammals. It consists of a signal peptide, a hydrophobic domain, a
fibronectin type 3 domains, and a c-terminal domain (Boström et al.,
L. Yang et al.
2012). The composition of FNDC5 was same in fish, but the common
carp has two isoforms of FNDC5 (FNDC5a and FNDC5b). Common carp
irisin was encoded by 112 amino acids, which was similar to that of
mammals (Hecksteden et al., 2013). The study showed that mammal
irisin sequence has two glycosylation sites (Boström et al., 2012), and
two N-linked glycosylation sites were found in tilapia irisin (Lian et al.,
2017). And common carp irisinA and irisinB have two highly conserved
N-linked glycosylation sites and multiple phosphorylation sites. These
sites are critical to maintaining protein function and they are also
important sites for post-translational modification (Nie and Liu, 2017).
In this study, the amino acids sequence of common carp FNDC5 dis­
played high degree of identity with the counterparts of other fish. Based
on phylogenetic analysis and amino acids sequences analysis, the se­
quences we obtained are the prospective FNDC5 of common carp.
Previous studies showed that FNDC5 was found in tilapia intestine,
kidney, liver, muscle, spleen, stomach, and highly expressed in the brain
regions (Lian et al., 2017). In goldfish, FNDC5 was expressed in all
examined tissues with the exception of liver, and with higher expression
levels in brain and intestine (Butt et al., 2017). In the current study,
common carp FNDC5 was widespread in all examined tissues and with
the relative high expression in brain areas. Consistent with this obser­
vation, FNDC5 mRNA and protein were shown in the brain of human
(Aydin et al., 2014; Huh et al., 2012), and rats (Albayrak et al., 2015).
However, the protein irisin was only found in the skeletal muscle and
heart in zebrafish (Sundarrajan et al., 2017). These results suggest the
FNDC5 mRNA expression was distinct to different species.
In order to assess whether the FNDC5 of common carp are related to
energy balance and food intake, fasting and refeeding experiment was
conducted. In this experiment, FNDC5mRNA expression were detected
in the hypothalamus, heart, liver, muscle, and intestine. Although the
hypothalamus plays an important role in regulating food intake (Del­
gado et al., 2017), FNDC5a mRNA in hypothalamus did not change in
common carp. However, the mRNA expression of FNDC5a was signifi­
cantly up-regulated in the liver and midgut. These results are supported
by other studies in rodent, which demonstrating that FNDC5 mRNA was
changed in visceral white adipose tissue but not in hypothalamus
(Varela-Rodríguez et al., 2016). Different from the results of FNDC5a,
the FNDC5b was diminished in hypothalamus, heart and hindgut of
common carp. Our results are similar to goldfish, in which FNDC5
mRNA in brain and intestine were down-regulated after fasting (Butt
et al., 2017). Taken together, these results showed that FNDC5 appear to
be affected by feeding status.
To evaluate the effect of glucose load on FNDC5, the OGTT experi­
ment was performed. In brain, the changes of FNDC5a and FNDC5b
expression are opposite after OGTT. It seems that common carp brain
FNDC5a and FNDC5b could be affected differently by oral glucose load.
FNDC5a and FNDC5b mRNA levels in liver of common carp were
significantly down-regulated after one hour of glucose treatment. As
liver is a major glucose-regulating organ, the level of liver FNDC5 gene
expression was significantly increased in response to endurance and
resistance training in rats (Rashidlamir et al., 2017). Muscle tissue al­
ways considered to be the main site of glucose uptake (Moon, 2001).
This study found that the expression levels of FNDC5a were significantly
up-regulated in red muscle and white muscle after OGTT. Contrary to
our results, glucose treatment with the mouse myoblast progenitor
C2C12 cells significantly inhibited the expression of FNDC5 (Mao,
2016). Overall, these results indicate that the effect of glucose on FNDC5
mRNA is tissue-specific and these mechanisms remain to be explored.
The uncoupling proteins (UCPs) are mitochondrial transporters, di­
verts energy from ATP synthesis to thermogenesis in mitochondria. The
genes encoding UCP homologues have been identified in several fish,
such as common carp (UCP1-3) (Jastroch et al., 2007), zebrafish (UCP1-
5) (Tseng et al., 2011), and puffer fish (UCP1-3) (Jastroch et al., 2005).
In rodents and pigs, irisin enhances the expression of ucps and pgc1α in
adipocytes (Boström et al., 2012; Cai et al., 2017). In goldfish, injections
of human irisin (100 ng/g B.W) up-regulated expressions of UCP2 in
9
General and Comparative Endocrinology 301 (2021) 113647
brain and muscle (Butt et al., 2017). In tilapia, irisin increases UCP1
expression in hepatocytes in vitro (Lian et al., 2017). In our in vitro
experiment, the biological activity of recombinant common carp irisinA
or irisinB were verified in the primary hepatocytes. The ucp1, ucp2, ucp3
and pgc1α mRNA expression can be stimulated after treatment with re­
combinant irisinA or irisinB. Taken together, the recombinant common
carp irisin (irisinA and irisinB) has biological activity.
To evaluate the impact of irisin on the glucose levels and the
expression of glucose transporter 2 (glut2), treatment with irisinA and
irisinB were performed in vivo and in vitro. Our study showed that
glucose concentration was diminished after treatment with irisin. These
results are consistent with other studies in rodents. In obese mice,
persistent perfusion of irisin can significantly decrease fasting plasma
glucose compared to that of saline (Xiong et al., 2015), and the blood
glucose levels in diabetic mice decreased after injection of 1.0 mg/kg of
irisin (Duan et al., 2016). In vitro, Irisin decreases glucose production
from hepatocytes mainly through inhibiting gluconeogenesis (Liu et al.,
2015). However, no effect of human irisin injections is found on glucose
levels in goldfish (Butt et al., 2017). The result indicated that the effect
of human irisin on fish glucose might be weak. The role of irisin on
regulation of glucose level in carp may be similar to that of mammals.
GLUT2 is involved in the uptake and output of glucose in the liver, and it
could be bi-directional transported by GLUT2 (Wood and Trayhurn,
2003). In present study, the mRNA expression of glut2 was increased by
irisin in vivo. Consistent with the results, the recombinant irisin in­
creases mRNA levels of glut2 in HepG2 (Li et al., 2019). Those results
indicated that irisin might promote glucose uptake and utilization of
cells.
The liver has a central role in maintaining glucose homeostasis
through regulation of utilization (glycolysis) and production of glucose
(gluconeogenesis and glycogenolysis) (Adeva-Andany et al., 2016). To
clarify the effect of irisin on the glucose metabolism in common carp,
treatment with recombinant irisinA or irisinB in vitro and in vivo. In
present study, the mRNA expression of glycogen synthesis factor (gs) and
the glycolysis related genes (gk, hk and pfk) were increased. In contrast,
the glycogen phosphorylation related gene (pygl) and the gluconeo­
genesis related genes (pepck, fbpase and g6pase) were decreased. These
results were consistent with the reduction of the glucose level in our in
vivo and in vitro experiment. Similar to our results, fasting blood glucose
levels is reduced in diabetic mice treated 14 days with IP irisin through
decrease the expression of gluconeogenesis related genes including
pepck and g6pase (Xin et al., 2015). In vitro, glucose production from
mice hepatocytes is reduced by incubation with irisin mainly through
inhibiting gluconeogenesis via pepck and g6pase down-regulation and
increasing glycogenesis via gs activation (Liu et al., 2015). And in human
primary hepatocytes, treatment with 50 nmol/l irisin for 15 min, g6pase,
pepck mRNA expression and glucose production were significantly
decreased (Mo et al., 2016). Overall, it appears that irisin has effect on
the expression of gluconeogenesis and glycolysis related genes to regu­
late glucose production and glucose level.
5. Conclusion
In summary, two genotypes of FNDC5 were isolated and character­
ized in common carp. We confirmed that FNDC5a and FNDC5b tran­
scripts were detected at high levels in brain regions. The expression of
FNDC5s appear to be affected by feeding status and OGTT. Recombinant
irisinA and irisinB protein has been produced, and it can induce hepatic
ucps and pgc1α gene expression. Using common carp and primary he­
patocytes cells, we have shown that irisinA and irisinB could decrease
glucose concentration of fish which might be primarily achieved by
inhibiting hepatic gluconeogenesis and promoting hepatic glycolysis.
These results gave a new insight into the function of irisin on glucose
homeostasis in fish.
L. Yang et al.
CRediT authorship contribution statement
Liping Yang: Writing - review & editing. Shaoyang Zhi: Data
curation, Writing - original draft. Guokun Yang: Writing - review &
editing. Chaobin Qin: Conceptualization. Wenli Zhao: . Mingming
Niu: . Wenlei Zhang: . Wenyu Tang: . Xiao Yan: . Yuru Zhang:
Writing - review & editing. Xiaolin Meng: Software. Ronghua Lu:
Methodology. Guoxing Nie: Conceptualization, Funding acquisition.
Acknowledgments
This work was supported by the National Natural Science Foundation
of China (31872581, 31702358 and 31672671), the Innovation Scien­
tists and Technicians Troop Construction Projects of Henan Province
(CXTD2016043), Zhongyuan thousand talents plan-leading talents of
Zhongyuan science and technology of Henan province (204200510025).
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.ygcen.2020.113647.
References
Adeva-Andany, M.M., Pérez-Felpete, N., Fernández-Fernández, C., Donapetry-García, C.,
Pazos-García, C., 2016. Liver glucose metabolism in humans. Biosci. Rep. 36 (6),
e00416 https://doi.org/10.1042/BSR20160385.
Albayrak, S., Atci, I.B., Kalayci, M., Yilmaz, M., Kuloglu, T., Aydin, S., Kom, M.,
Ayden, O., Aydin, S., 2015. Effect of carnosine, methylprednisolone and their
combined application on irisin levels in the plasma and brain of rats with acute
spinal cord injury. Neuropeptides 52, 47–54. https://doi.org/10.1016/j.
npep.2015.06.004.
Aydin, S., Kuloglu, T., Aydin, S., Kalayci, M., Yilmaz, M., Cakmak, T., Albayrak, S.,
Gungor, S., Colakoglu, N., Ozercan, I.H., 2014. A comprehensive
immunohistochemical examination of the distribution of the fat-burning protein
irisin in biological tissues. Peptides 61, 130–136. https://doi.org/10.1016/j.
peptides.2014.09.014.
Boström, P., Wu, J., Jedrychowski, M., 2012. A PGC1-α
dependentmyokinethatdrivesbrowing of whitefatandthermogenesis. Nature 481,
463–468. https://doi.org/10.1038/nature10777.
Butt, Z.D., Hackett, J.D., Volkoff, H., 2017. Irisin in goldfish (Carassius auratus): effects
of irisin injections on feeding behavior and expression of appetite regulators,
uncoupling proteins and lipoprotein lipase, and fasting-induced changes in FNDC5
expression. Peptides 90, 27–36. https://doi.org/10.1016/j.peptides.2017.02.003.
Caf, F., Algul, S., Koyun, M., 2017. Investigation of the irisin, preptin and adropin levels
in the blood serum of Alburnus tarichi. Cell. Mol. Biol. 63 (8), 95–99. https://doi.
org/10.14715/cmb/2017.63.8.20.
Cai, C., Xiao, G., Qian, L., Jiang, S., Li, B., Xie, S., Gao, T., An, X., Cui, W., Li, K., 2017.
Gene location, expression, and function of FNDC5 in Meishan Pigs. Sci. Rep. 7 (1),
7886. https://doi.org/10.1038/s41598-017-08406-y.
Chen, Y.-J., Wang, X.-Y., Pi, R.-R., Feng, J.-Y., Luo, L., Lin, S.-M., Wang, D.-S., 2018.
Preproinsulin expression, insulin release, and hepatic glucose metabolism after a
glucose load in the omnivorous GIFT tilapia Oreochromis niloticus. Aquaculture 482,
183–192. https://doi.org/10.1016/j.aquaculture.2017.10.001.
Delgado, M.J., Cerdareverter, J.M., Soengas, J.L., 2017. Hypothalamic integration of
metabolic, endocrine, and circadian signals in fish: involvement in the control of
food intake. Front. Neurosci. 11, 354. https://doi.org/10.3389/fnins.2017.00354.
Deng, D., Yan, X., Zhao, W., Qin, C., Yang, G., Nie, G., 2020. Glucose transporter 2 in
common carp (Cyprinus carpio L.): molecular cloning, tissue expression, and the
responsiveness to glucose, insulin, and glucagon. Fish Physiol. Biochem. 46 (4),
1207–1218. https://doi.org/10.1007/s10695-020-00782-z.
Duan, H., Ma, B., Ma, X., Wang, H., Ni, Z., Wang, B., Li, X., Jiang, P., Umar, M., Li, M.,
2016. Anti-diabetic activity of recombinant irisin in STZ-induced insulin-deficient
diabetic mice. Int. J. Biol. Macromol. 84, 457–463. https://doi.org/10.1016/j.
ijbiomac.2015.12.049.
Fischer, D., Li, Y., Ahlemeyer, B., Krieglstein, J., Kissel, T., 2003. In vitro cytotoxicity
testing of polycations: influence of polymer structure on cell viability and hemolysis.
Biomaterials 24 (7), 1121–1131. https://doi.org/10.1016/s0142-9612(02)00445-3.
Gür, F.M., Timurkaan, S., Gencer Tarakci, B., Yalcin, M.H., Ozkan, Z.E., Baygeldi, S.B.,
Yilmaz, S., Eroksuz, H., 2018. Identification of immunohistochemical localization of
irisin in the dwarf hamster (Phodopus roborovskii) tissues. Anat. Histol. Embryol. 47
(2), 174–179. https://doi.org/10.1111/ahe.12345.
Hecksteden, A., Wegmann, M., Steffen, A., Kraushaar, J., Morsch, A., Ruppenthal, S.,
Kaestner, L., Meyer, T., 2013. Irisin and exercise training in humans–results from a
randomized controlled training trial. BMC Med. 11 (1), 235. https://doi.org/
10.1186/1741-7015-11-235.
Hertz, Y., Epstein, N., Abraham, M., Madar, Z., Hepher, B., Gertler, A., 1989. Effects of
metformin on plasma insulin, glucose metabolism and protein synthesis in the
10
General and Comparative Endocrinology 301 (2021) 113647
common carp (Cyprinus carpio L.). Aquaculture 80, 175–187. https://doi.org/
10.1016/0044-8486(89)90283-4.
Huh, J.Y., Panagiotou, G., Mougios, V., Brinkoetter, M., Vamvini, M.T., Schneider, B.E.,
Mantzoros, C.S., 2012. FNDC5 and irisin in humans: I. Predictors of circulating
concentrations in serum and plasma and II. mRNA expression and circulating
concentrations in response to weight loss and exercise. Metab.-Clin. Exp. 61 (12),
1725–1738. https://doi.org/10.1016/j.metabol.2012.09.002.
Jastroch, M., Wuertz, S., Kloas, W., Klingenspor, M., 2005. Uncoupling protein 1 in fish
uncovers an ancient evolutionary history of mammalian nonshivering
thermogenesis. Physiol. Genomics 22 (2), 150–156. https://doi.org/10.1152/
physiolgenomics.00070.2005.
Jastroch, M., Buckingham, J.A., Helwig, M., Klingenspor, M., Brand, M.D., 2007.
Functional characterisation of UCP1 in the common carp: uncoupling activity in liver
mitochondria and cold-induced expression in the brain. J. Comp. Physiol. B-
Biochem. Syst. Environ. Physiol. 177 (7), 743–752. https://doi.org/10.1007/
s00360-007-0171-6.
Lee, H.J., Lee, J.O., Kim, N., Kim, J.K., Kim, H.I., Lee, Y.W., Kim, S.J., Choi, J.-I., Oh, Y.,
Kim, J.H., 2015. Irisin, a novel myokine, regulates glucose uptake in skeletal muscle
cells via AMPK. Mol. Endocrinol. 29 (6), 873–881. https://doi.org/10.1210/
me.2014-1353.
Li, X., Duan, H., Liu, Q., Umar, M., Luo, W., Yang, X., Zhu, J., Li, M., 2019. Construction
of a Pichia pastoris strain efficiently secreting irisin and assessment of its bioactivity
in HepG2 cells. Int. J. Biol. Macromol. 124, 60–70. https://doi.org/10.1016/j.
ijbiomac.2018.11.092.
Lian, A., Li, X., Jiang, Q., 2017. Irisin inhibition of growth hormone secretion in cultured
tilapia pituitary cells. Mol. Cell. Endocrinol. 439, 395–406. https://doi.org/
10.1016/j.mce.2016.09.030.
Lin, J.-H., Ho, L.-T., Shiau, S.-Y., 1995. Plasma glucose and insulin concentration in
tilapia after oral administration of glucose and starch. Fish. Sci. 61 (6), 986–988.
https://doi.org/10.2331/fishsci.61.986.
Liu, T.-Y., Shi, C.-X., Gao, R., Sun, H.-J., Xiong, X.-Q., Ding, L., Chen, Q., Li, Y.-H.,
Wang, J.-J., Kang, Y.-M., 2015. Irisin inhibits hepatic gluconeogenesis and increases
glycogen synthesis via the PI3K/Akt pathway in type 2 diabetic mice and
hepatocytes. Clin. Sci. 129 (10), 839–850. https://doi.org/10.1042/CS20150009.
Liu, J., Wong, M.D.S., Toy, W.C., Tan, C.S.H., Liu, S., Ng, X.W., Tavintharan, S., Sum, C.
F., Lim, S.C., 2013. Lower circulating irisin is associated with type 2 diabetes
mellitus. J. Diabetes Complications 27 (4), 365–369. https://doi.org/10.1016/j.
jdiacomp.2013.03.002.
Mao, C., 2016. Effects of uric acid and glucose on the expression of Irisin and GLUT4 in
mouse myoblasts. Tianjin Medical University. DOI:CNKI:CDMD:2.1016.924276.
Mo, L., Shen, J., Liu, Q., Zhang, Y., Kuang, J., Pu, S., Cheng, S., Zou, M., Jiang, W.,
Jiang, C., 2016. Irisin is regulated by CAR in liver and is a mediator of hepatic
glucose and lipid metabolism. Mol. Endocrinol. 30 (5), 533–542. https://doi.org/
10.1210/me.2015-1292.
Moon, T.W., 2001. Glucose intolerance in teleost fish: fact or fiction? Comp. Biochem.
Physiol. B: Biochem. Mol. Biol. 129 (2–3), 243–249. https://doi.org/10.1016/
S1096-4959(01)00316-5.
Nadermann, N., Volkoff, H., 2020. Effects of short-term exercise on food intake and the
expression of appetite-regulating factors in goldfish. Peptides 123, 170182. https://
doi.org/10.1016/j.peptides.2019.170182.
Nie, Y., Liu, D., 2017. N-Glycosylation is required for FDNC5 stabilization and irisin
secretion. Biochem. J 474 (18), 3167–3177. https://doi.org/10.1042/BCJ20170241.
Niranjan, S.B., Belwalkar, S.V., Tambe, S., Venkataraman, K., Mookhtiar, K.A., 2019.
Recombinant irisin induces weight loss in high fat DIO mice through increase in
energy consumption and thermogenesis. Biochem. Biophys. Res. Commun. 519 (2),
422–429. https://doi.org/10.1016/j.bbrc.2019.08.112.
Novelle, M.G., Contreras, C., Romero-Picó, A., López, M., Diéguez, C., 2013. Irisin, two
years later. Int. J. Endocrinol. 2013 https://doi.org/10.1155/2013/746281.
Perakakis, N., Triantafyllou, G.A., Fernández-Real, J.M., Huh, J.Y., Park, K.H., Seufert, J.,
Mantzoros, C.S., 2017. Physiology and role of irisin in glucose homeostasis. Nature
Rev. Endocrinol. 13, 324. https://doi.org/10.1038/nrendo.2016.221.
Rashidlamir, A., Hoseinzadeh, M., Zeiaddini Dashtkhaki, L., 2017. The effects of
resistance and endurance training on the liver tissue fndc5 mrna gene expression in
male rats. Ann. Appl. Sport Sci. 5 (2), 51–60. https://doi.org/10.18869/acadpub.
aassjournal.5.2.51.
Sundarrajan, L., Unniappan, S., 2017. Small interfering RNA mediated knockdown of
irisin suppresses food intake and modulates appetite regulatory peptides in
zebrafish. Gen. Comp. Endocrinol. 252, 200–208. https://doi.org/10.1016/j.
ygcen.2017.06.027.
Sundarrajan, L., Yeung, C., Hahn, L., Weber, L.P., Unniappan, S., 2017. Irisin regulates
cardiac physiology in zebrafish. PLoS One 12 (8). https://doi.org/10.1371/journal.
pone.0181461.
Tseng, Y.-C., Chen, R.-D., Lucassen, M., Schmidt, M.M., Dringen, R., Abele, D.,
Hwang, P.-P., 2011. Exploring uncoupling proteins and antioxidant mechanisms
under acute cold exposure in brains of fish. PLoS One 6 (3), e18180. https://doi.org/
10.1371/journal.pone.0018180.
Varela-Rodríguez, B., Pena-Bello, L., Juiz-Valiña, P., Vidal-Bretal, B., Cordido, F.,
Sangiao-Alvarellos, S., 2016. FNDC5 expression and circulating irisin levels are
modified by diet and hormonal conditions in hypothalamus, adipose tissue and
muscle. Sci. Rep. 6, 29898. https://doi.org/10.1038/srep29898.
Wang, B., Jia, J., Yang, G., Qin, J., Zhang, C., Zhang, Q., Sun, C., Li, W., 2016. In vitro
effects of somatostatin on the growth hormone-insulin-like growth factor axis in
orange-spotted grouper (Epinephelus coioides). Gen. Comp. Endocrinol. 237, 1–9.
https://doi.org/10.1016/j.ygcen.2015.10.014.
L. Yang et al.
Wood, I.S., Trayhurn, P., 2003. Glucose transporters (GLUT and SGLT): expanded
families of sugar transport proteins. Br. J. Nutr. 89 (1), 3–9. https://doi.org/
10.1079/BJN2002763.
Wrann, C.D., 2015. FNDC5/Irisin–their role in the nervous system and as a mediator for
beneficial effects of exercise on the brain. Brain Plast. 1 (1), 55–61. https://doi.org/
10.3233/BPL-150019.
Xin, C., Liu, J., Zhang, J., Zhu, D., Wang, H., Xiong, L., Lee, Y., Ye, J., Lian, K., Xu, C.,
2015. Irisin improves fatty acid oxidation and glucose utilization in type 2 diabetes
by regulating the AMPK signaling pathway. Int. J. Obesity 40 (3), 443. https://doi.
org/10.1038/ijo.2015.199.
11
General and Comparative Endocrinology 301 (2021) 113647
Xiong, X.-Q., Chen, D., Sun, H.-J., Ding, L., Wang, J.-J., Chen, Q., Li, Y.-H., Zhou, Y.-B.,
Han, Y., Zhang, F., 2015. FNDC5 overexpression and irisin ameliorate glucose/lipid
metabolic derangements and enhance lipolysis in obesity. Biochim. Biophys. Acta
(BBA)-Mol. Basis Dis. 1852 (9), 1867–1875. https://doi.org/10.1016/j.
bbadis.2015.06.017.
Yang, G., Qin, C., Wang, B., Jia, J., Yuan, X., Sun, C., Li, W., 2017. Molecular
identification and functional analysis of Ctrp9 in Epinephelus coioides. J. Mol.
Endocrinol. 58 (4), 179–191. https://doi.org/10.1530/JME-16-0171.