The FASEB Journal • Research Communication
Creation of a genetic model of obesity in a teleost
Youngsup Song and Roger D. Cone1
Center for the Study of Weight Regulation and Associated Disorders, Oregon Health and Science
University, Portland, Oregon, USA
ABSTRACT The adipostat is the mechanism by which
the brain detects and maintains constant levels of
energy stored in adipocytes in the form of lipids. Key
elements of the adipostat include the adipocyte-derived
hormone leptin that is expressed in proportion to
energy levels and serves to communicate this informa-
tion to the central nervous system and the central
circuits, which sense and respond to leptin. Blockade of
one of these circuits, the central melanocortin system,
disrupts leptin action and causes a distinct obesity
syndrome in mice and humans, characterized by in-
creased adiposity as well as increased linear growth. We
show here that transgenic zebrafish overexpressing the
endogenous melanocortin antagonist agouti-related
protein (AgRP) also exhibit obesity, increased linear
growth, and adipocyte hypertrophy. These findings
demonstrate that key elements of the adipostat origi-
nated before the evolution of mammals. Furthermore,
transgenic overexpression of AgRP in zebrafish yields a
new model system for the genetic analysis of energy
homeostasis in a simple vertebrate system.—Song, Y.,
Cone, R. D. Creation of a genetic model of obesity in a
teleost. FASEB J. 21, 2042–2049 (2007)
Key Words: melanocortin receptor 䡠 zebrafish 䡠 AgRP 䡠 energy
homeostasis
Energy homeostasis requires detection of energy
stores present in adipose tissue, and concomitant reg-
ulation of feeding behavior and energy expenditure in
order to keep those stores constant. Energy homeosta-
sis is thus a complex physiological system, often involv-
ing multiple tissues and overlapping regulated path-
ways. Characterization of monogenic obesity mutants in
the mouse and candidate gene approaches have led to
identification of several dozen genes that play impor-
tant roles in energy homeostasis. Given the complexity
of the process, there are likely to be hundreds. The
relatively recent discovery of the adipostatic hormone
leptin (1) and the hunger factor, ghrelin (2– 4), for
example, suggest we are still at an early stage of
discovery in this field. Clearly, the development of
simple vertebrate model systems for the analysis of
energy homeostasis would be a highly valuable ap-
proach, since entire collections of genes physiologically
involved in the process could be identified in an
unbiased fashion, perhaps even identifying entirely new
regulatory pathways.
2042
Relative to mammals, less is known about energy
homeostasis in the fish. Some species, such as Takifugu
rubripes, store triglycerides in the liver (5, 6) whereas
others, such as salmonids, store triglycerides in visceral,
intramuscular, and subcutaneous adipocyte depots.
Even less is known about leptin in the fish. Intracere-
broventricular administration of mammalian leptin in
the goldfish inhibits food intake (7). However, a puta-
tive leptin gene identified in teleosts, based on analysis
of a syntenic region shared by mammals and the
pufferfish (5), shares only 21% amino acid identity with
the mammalian protein and has not yet been function-
ally characterized.
Several of the neuropeptidergic circuits involved in
feeding and metabolism in mammals appear to be
conserved in teleosts. Proopiomelanocortin (POMC)
has been cloned from several fish (8 –10), and POMC
immunoreactivity was detected in pituitary and lateral
tuberal nucleus (NLT) of the hypothalamus, believed
to be a homologous structure to the mammalian arcu-
ate nucleus (11). Receptors for the melanocortin pep-
tides cleaved from POMC have been cloned from fugu
fish (MC1, 2, 4, and 5) and zebrafish (MC1–5R) (12,
13); they also appear to be highly conserved. Recently
goldfish melanocortin receptor 4 was cloned and the
distribution in the brain was mapped by in situ hybrid-
ization (14) to the NLT, lateral septal nucleus, supra-
chiasmatic nucleus (SCN), and paraventricular nu-
cleus. Intracerebroventricular administration of the
synthetic melanocortin agonist, MTII, in the goldfish
inhibited feeding (14) while the synthetic MC4-R an-
tagonist HS024 stimulated food intake; these data
strongly argue that the central melanocortin system
regulates food intake in fish. The endogenous melano-
cocortin antagonist, AgRP, has also been cloned from
goldfish and demonstrated to be regulated by meta-
bolic state in this species (15). In the zebrafish, AgRP
mRNA levels increase by 3-fold after a fast (16). Reduc-
tion of MC4-R signaling, caused by mutations in either
the POMC or MC4-R genes or by overexpression of
MC4-R antagonists like agouti or AgRP, causes obesity
in mammals, demonstrating a role for the circuit in
regulating energy homeostasis (17–19). To ascertain
1
Correspondence: Center for the Study of Weight Regula-
tion, And Associated Disorders, Oregon Health and Science
University, 3181 SW Sam Jackson Park Rd., Portland, OR
97239-3098, USA. E-mail: cone@ohsu.edu
doi: 10.1096/fj.06-7503com
0892-6638/07/0021-2042 © FASEB
the role of the endogenous melanocortin system in
energy homeostasis in teleosts and in an attempt to
create a genetic model of obesity in this simple verte-
brate system, we have developed transgenic zebrafish
expressing the zebrafish AgRP gene under the control
of a constitutive zebrafish promoter.
MATERIALS AND METHODS
Fish strains and culture
Tab 14 strain zebrafish were raised and bred at 26 –28°C
under a 13.5 h light/10.5 h dark cycle. The embryos were
obtained by natural mating and the larval stage was deter-
mined according to Kimmel et al. (20). The fish were fed
twice a day, at ⬃9:30 AM and 4:30 PM. Fish aged from 5 dpf
to 10 dpf were fed rotifers and baby powder, fish from 10 dpf
to 15 dpf were fed rotifer supplemented with uncapsulated
brine shrimp, and fish from 15 dpf to 1 month or older were
fed uncapsulated brine shrimp. For adult fish, food was
prepared by mixing 4 parts of tropical flakes (Aquatic Eco-
systems, Inc., Apopka, FL, USA) and 1 part of brine shrimp
(Brine Shrimp Direct, Ogden, UT, USA) in system water.
Feeding amount was determined based on previous observa-
tions of amounts fish can consume within 5 min after feeding.
Fish food composition was fish flakes: protein 46%, fat 8%,
crude fiber 4%, and moisture 10%, brine shrimp: protein
55%, fat 14%, ash 8.1%, and moisture 7%. Approximate adult
food composition was protein 48%, fat 9%.
Generation of stable transfectants
Zebrafish melanocortin receptor 3 was kindly provided by Dr.
Darren Logan (Edinburgh, Scotland) and subcloned into the
pcDNA3.1⫹vector. Zebrafish melanocortin receptor 4 and 5b
were independently cloned from a zebrafish cDNA library,
then subcloned into pcDNA3.1⫹. Orientation and sequences
of all constructs were verified by PCR and sequencing.
HEK-293 cells were used to generate stable transfectants
expressing zebrafish melanocortin receptors. Transfection
was performed according to the manufacturer’s instruction.
In brief, the day before transfection, HEK-293 cells were
plated at ⬃80 –100% confluency in 100 mm dishes without an
antibiotic. About 20 ␮g of DNA was used for transfection with
40 ␮l of either lipofectamine or lipofectamine2000 (Invitro-
gen, Carlsbad, CA, USA) in Optimem medium (Invitrogen).
Five hours after transfection, 20% FBS/DMEM medium was
supplied; 24 h after transfection, transfectants were split into
two or three 100 mm dishes in 10% FBS/DMEM and incu-
bated for another 24 h. Medium was replaced with 1000
␮g/ml concentration of G418 medium. Fresh G418 medium
was supplied every 3 or 4 days. Two to 3 wk later, when
enough colonies had been grown, whole populations of
individual transfectants were split, pooled, and selected by
G418 medium again until no dead cells were observed in drug
selection.
cAMP assay
Zebrafish melanocortin receptor activity was measured using
a cAMP EIA assay kit (Cayman Chemical, Ann Arbor, MI,
USA). Stable transfectants expressing zebrafish melanocortin
receptors or control HEK-293 cells were plated in 96-well
plate with 5 ⫻ 104 cells per well. Twenty-four hours after
plating, cells were incubated with serially diluted concentra-
GENETIC MODEL OF OBESITY IN A TELEOST
tions of ␣-MSH in the presence or absence of mouse AgRP
(82–131) (Phoenix Peptides, Burlingame, CA, USA) in a 50
␮l volume of 0.1 mM IBMX, 0.01% BSA in DMEM at 37°C for
30 min. After a wash with PBS, cells were lysed in 40 ␮l of
0.1M HCl for 20 min at room temperature. Collected cell
lysates were used for the assay according to the manufactur-
er’s instruction. Color development was measured at 405 nm
with a Benchmark Plus plate spectrophotometer (Bio-Rad,
Hercules, CA, USA). Each condition was examined in tripli-
cate.
Construction of transgenic zebrafish
␤-Actin-EGFP constructs (21) were digested with BamHI and
full-length zebrafish AGRP containing 5⬘ UTR, coding se-
quence, stop codon and 3⬘ UTR sequence was inserted
between the zebrafish ␤-actin promoter and a nonfunctional
EGFP sequence. To remove any RNA contamination, plasmid
DNA constructs was gel purified and resuspended in ddH2O
at 100 ng/␮l concentration. Injection needles were prepared
by two-step pulling of the glass micropipette (Cat.# BF100 –
58-10, Sutter Instrument Co., Movato, CA, USA), first at 66°C
and ⬃10 s later at 82°C, using a vertical pipette puller (Model
PP83, Narishige, Japan). A micropipette beveler (Model#
BV-10, Sutter Instrument Co.) was used to bevel the glass
micropipette so that the tip of the micropipette was at 30°,
with a smooth surface. About 2–3 ␮l of DNA was loaded into
the micropipette using a microloader (Cat.# 5242 956.003,
Eppendorf) and air pressure was adjusted using the micro-
scope micrometer; ⬃1 nl of DNA was injected in each
embryo.
The night before the day of injection, female and male fish
were separated. On the day of injection, when the light was
on, natural mating was performed by placing male and
female fish together. Embryos were embedded in wedged-
shaped troughs made with 1.5% agarose, as described in the
zebrafish book (22). DNA was injected into the middle of the
cell (not into the yolk cell) of one or two cell-stage embryos
using the MPPI-2 pressure injector and dissecting microscope
(Model# SMZ645, Nikon). Injected embryos were transferred
to 100 ml of fresh system water or 0.4 ⫻ Danieau solution.
Unfertilized embryos were sorted out within 6 h after injec-
tion and fertilized embryos were raised until adult stages. To
identify F0 founders capable of germline transmission, natu-
ral crosses were set between injected fish and wild-type fish.
About 20 –50 F1 embryos from mating were collected ran-
domly at 72 hpf and subjected to genomic DNA PCR.
Germline transmission rate varied between 4% and 30%,
depending on the F0 founder. Male or female fish that
showed positive results from genomic DNA PCR were saved
and crossed with a couple of wild-type Tab 14 female or male
fish, respectively. Collected embryos were raised until adult
stage and tail fin genotyping PCR was performed to screen
the heterozygote F1 carriers. Of ⬃300 F0 fish injected and
raised to the adult stage, we found ⬃eight transgenic fish
capable of germline transmission; all experiments in this
paper used fish from the F2 or F3 generations from three
independent founder lines.
Genotyping fish
Either embryos or fin clipped tissues were incubated in
genomic DNA lysis buffer (10 mM Tris-HCl, ph8.0, 2 mM
EDTA, 0.2% Tween20) at 50°C from 6 h to overnight. The
material was heat inactivated at 95°C for 10 min, centrifuged
at 14000 rpm for 2 min, and 5 ␮l of supernatant part was used
directly for genotyping PCR. Two sets of genotyping PCR
were performed with forward primers specific to the C-
2043
terminal region of ␤-actin promoter (CAAAACAGGAAGTT-
GACTCC) and with two individual N-terminal region-specific
AgRP reverse primers (AGATTACTGTGTTCAGCATCAT
and CTGAGTTTATTTCAAGGTGCTCC). Each individual
PCR gives 150 bp and 250 bp PCR products, respectively.
In situ hybridization of AgRP transgenic embryos
AgRP transgenic F1 founders were naturally mated with WT
Table 14 strain, then F2 embryos were collected at 5dpf, fixed,
and whole-mount in situ hybridized with dig-zAgRP cRNA
probes. Expression of zAgRP was visualized by incubation with
sheep alkaline phosphatase-conjugated anti-dig antibody
(Roche, Nutley, NJ, USA), followed by NBT/BCIP (Roche)
staining as described previously (16).
Weight growth curves
Some F1 heterozygotes that carry the ␤-actin-AgRP transgene
were mated with wild-type Table 14 fish; all fertilized F2
embryos were raised in a half-gallon tank for a month or two.
At 1 or 2 months of age, equal numbers of fish were separated
into individual half-gallon tanks. Fish were randomly housed
so each tank had both wild-type and transgenic fish. For
founder #127, four tanks of 12 fish per each half-gallon tank
were raised; for founder #221, two tanks of 9 fish per each
half-gallon tank were raised. When 4 or 5 months old, fish
were tail clipped for genotyping, weighed, and returned to
the original tank. The clipped fin tail was subjected to
genomic DNA PCR. Weight was measured to two decimal
points in grams and statistical analyses were done by unpaired
t test.
Total triglyceride quantification
Whole F2 or F3 fish were homogenized with mortar and
pestle and extracted with 10 ml chloroform:methanol (2:1)
and filtered into a 25 ml centrifuge tube. Two more extrac-
tions were performed, each with 5 ml chloroform:methanol
(2:1). Two milliliters of 0.58% NaCl was added and vortexed
for 30 s and incubated overnight at 4°C. The fat extract was
centrifuged for 10 min at 2000 rpm, and bottom layer was
transferred into new tube. One milliliter of lipid extract was
dried under nitrogen and redissolved in 0.5 ml of isopropyl
alcohol. Triglyceride content was measured according to the
BMC triglyceride/GPO reagent (Roche Diagnostics) and
read using a Hitachi 704 chemistry analyzer. Statistical anal-
yses were done by unpaired t test
Analysis of zebrafish adipocytes
Female transgenic F3 AgRP fish (from founders 284 and 221)
and female wild-type tank mates were sacrificed at 9 months
and fixed in 10% formalin solution (Sigma, St. Louis, MO,
USA). Whole fish were paraffin embedded, then 5 ␮m
sections were prepared and stained with hematoxylin and
eosin. All images were taken and stored digitally by Openlab
or Image-pro plus software. The total number of visceral
adipocytes, along with visceral adipocyte size, was determined
using the NIH Image J program. Briefly, the density of cells in
each section was measured by generating a random grid of
lines [for first set 2000 pixel2 (2170 ␮m2) and the second set
5000 pixel2 (2551 ␮m2)] and counting the visceral adipocyte
cell number using stereology counting rules (23). Adipocyte
cell density in each section was calculated as total number of
cells divided by the area counted. Adipocyte cell size in each
section was calculated as area [2000 pixel2 (2170 ␮m2) or
2044 Vol. 21 July 2007 The FASEB Journal
5000 pixel2 (2551 ␮m2)] divided by cell density. To deter-
mine adipocyte cell number, the area occupied by adipocytes
was estimated by overlaying a random grid of points over the
image and counting the number of points that fall over
adipocytes. Adipocyte cell number was then calculated by
multiplying the area occupied by the random grid of points
by cell density of each section analyzed (23). For both
analyses, sections were randomly chosen every 300 –900 ␮m.
Statistical analyses were done by unpaired t test.
Determining fish length
Wild-type and transgenic F2 fish were sacrificed and fish
length was measured from tip to the end of the tail, then
weighed and genotyped as described. Statistical analyses were
done by unpaired t test.
RESULTS
Characterization of the response of the zebrafish
melanocortin receptors to AgRP
The AgRP and melanocortin receptor genes are highly
conserved in zebrafish (13, 16), but the ability of AgRP
to act as a functional melanocortin antagonist has not
been demonstrated. Thus, we subcloned zebrafish
MC3-R, MC4-R, and MC5b-R cDNA sequences into
expression vectors, and used these to create cells stably
expressing these receptors (Fig. 1). Control nontrans-
fected 293 cells did not respond to ␣-MSH (data not
shown). However, ␣-MSH activated adenylyl cyclase in
each transfected cell population with an EC50 of ⬃2 ⫻
10⫺10 (MC3-R), 5 ⫻ 10⫺10 (MC4-R), and 2 ⫻ 10⫺9
(MC5b-R). The mouse AgRP (82–131) protein acted as
a competitive antagonist at each of these central ze-
brafish melanocortin receptors, with an apparent rank
order of antagonist potency of MC4-R⬎MC3-R⬎
MC5b-R (Fig. 1).
Creation of transgenic zebrafish with constitutive
ectopic expression of AgRP mRNA
Transgenic zebrafish were created by injecting embryos
with plasmids containing a zebrafish AgRP cDNA trans-
gene under the control of the zebrafish ␤-actin pro-
moter (Fig. 2A). Transgene-positive male and female
fish were separated and crossed with wild-type female
or male fish, respectively. Embryos from the matings
were raised to adult stage and tail fin genotyping was
performed to screen the heterozygote carriers. Whole-
mount in situ hybridization demonstrated extensive
expression of AgRP mRNA in transgenic, but not con-
trol, fish at 5dpf (Fig. 2B).
Growth of transgenic zebrafish with constitutive
ectopic expression of AgRP
Growth rates were determined using male or female
offspring from three different transgenic founders.
Clutches, derived from mating heterozygous transgenic
founders with wild-type fish, were cultured together in
SONG AND CONE
 gain appeared greatest in the period from 4 to 6
months postfertilization (Fig. 3A, B), then diminished
to wild-type levels in the male offspring of founder 127
(Fig. 3A). At 6 months postfertilization, the transgenic
fish were 20 –100% heavier than their wild-type tank
mates, depending on the founder and/or sex of the
offspring. Male offspring of founder 127 showed the
smallest increase in weight of ⬃20% (Fig. 3A), while
female offspring of either founder 221 (Fig. 3B) or
founder 284 (not shown) were approximately twice as
heavy as their wild-type female tank mates.

Transgenic zebrafish with constitutive ectopic

expression of AgRP become obese

In both mice and humans, defective melanocortin

signaling leads to an increase in adipose mass. To
determine whether constitutive AgRP expression leads
to obesity in the zebrafish, we cultured clutches of

Figure 1. Inhibition of zebrafish melanocortin receptors by

mouse AgRP (83–131) peptide. The panels show dose-re-
sponse curves of A) zebrafish melanocortin receptor 3, B)
zebrafish melanocortin receptor 4, and C) zebrafish melano-
cortin receptor 5b for ␣-MSH in the presence of 10⫺7 M
(square), 10⫺8 M (triangle) or absence (diamond) of mAgRP
(82–131) peptide. ␣-MSH stimulated activity of zebrafish
melanocortin receptors was monitored by cAMP production.
cAMP content was shown as a percent of maximum spectro-
photometer reading. Experiments were performed in tripli-
cate, and graphs were drawn and analyzed by Prism. Figure 2. Creation of a transgenic zebrafish overexpressing
zAgRP. A) Schematic diagram and partial restriction map of
␤-actin-zAgRP transgene construct. Full-length cDNA se-
tanks at a same density of 9 –12 fish per tank. Fish were quence of zAGRP containing 5⬘ UTR, coding region, and
weighed, as described in Materials and Methods, at 3⬘UTR was inserted between ␤-actin promoter and a spacer
multiple times from 4 to 12 months, and genotyped sequence containing an unexpressed EGFP gene. B) Expres-
immediately after each weighing by polymerase chain sion pattern of ␤-actin-derived zebrafish AgRP by whole-
reaction using tail fin tissue. Weights were averaged mount in situ hybridization. F1 transgenic heterozygote carri-
ers were mated with weight strain and all embryos were
among all the transgenic or wild-type fish in the clutch. whole-mount in situ hybridized with zAgRP cRNA probes.
Transgenic fish from all three founders were signifi- Upper panel shows weight type and bottom panel shows trans-
cantly heavier than their wild-type tank mates by 4 – 6 genic embryos. The ratio of weight and transgenic was approx-
months postfertilization. The increased rate of weight imately a Mendelian inheritance pattern. Scale bar ⫽ 100 ␮m.

GENETIC MODEL OF OBESITY IN A TELEOST 2045

 ture. To determine whether obesity in the zebrafish
produces an increase in lipid storage in visceral adipo-
cytes, and thus adipocyte hypertrophy, we examined
the distribution, size, and number of adipocytes in two
randomly selected wild-type and AgRP transgenic fish 9
months of age. The transgenic fish were derived, one
each, from strain 284 and 221; as with fish derived from
founder 127 and 221, fish derived from founder 284
showed increased weight, length, and total triglyceride
content (data not shown). Paraffin-embedded sections
were prepared for histological analysis, extending from

Figure 3. Overexpression of zAgRP causes an increased rate of

weight gain in the zebrafish. Weight growth curves of A) male,
founder AgRP-127 (WT n⫽22, TG (⫹/–) n⫽11), and B)
female, founder AGRP-221 (WT n⫽5, TG (⫹/–) n⫽8. Het-
erozygote transgenic carriers (⫹/–) were mated with weight
strain (⫺/⫺), and the progeny were raised in one tank
together. One to 2 months later, equal numbers of fish were
randomly distributed to multiple half-gallon aquariums. Begin-
ning at 4 to 5 months of age, fish were tail clipped, body weights
were measured, and fish were returned to their original tank.
The procedure was repeated monthly thereafter. Results are
expressed as mean ⫾ sem, and statistical analyses were done by
unpaired t test. *P ⬍ 0.05; **P ⬍ 0.01; ***P ⬍ 0.001.

mixed transgenic and wild-type fish as described above,

then determined total triglyceride content using the
method of Wahlefeld (24) after homogenization and
extraction of lipids from whole fish with chloroform/
methanol. In both 1-year-old male fish (strain 127, Fig.
4A, B), and 6-month-old female fish (strain 221, Fig. 4C,
D), total triglycerides were increased 42% and 141%,
respectively, compared to wild-type clutch mates.
Adipocyte hypertrophy in transgenic zebrafish with
constitutive ectopic expression of AgRP
The distribution of lipids and adipocytes in the ze-
brafish has not been previously described in the litera-
Figure 4. Overexpression of zAgRP causes obesity in the
zebrafish. Total triglyceride content of A) 1-year-old males,
founder AgRP-127 (WT n⫽22, TG (⫹/–) n⫽11), and C)
6-month-old females, founder AgRP-221 (WT n⫽5, TG (⫹/–)
n⫽8). Corresponding percent triglycerides content per body
weight of B) males, founder AgRP-127, and D) females,
founder AgRP-221. Total fat was extracted from individual
whole fish using a chloroform/methanol method and the
amount of total triglyceride was determined using the Wahl-
efeld method. Results are expressed as mean ⫾ sem, and
statistical analyses were done by unpaired t test. *P ⬍ 0.05;
**P ⬍ 0.01.

2046 Vol. 21 July 2007 The FASEB Journal SONG AND CONE
 signaling also causes a significant increase in lean mass
and linear growth (17). We examined linear growth in
clutches of transgenic and wild-type fish, cultured as
described above for measurement of triglyceride mass,
by carefully measuring fish from the tip to the end of
the tail fin. Genotyping was once again performed after
measurements were taken. An increase in linear growth,
measured to the nearest mM, was observed from ⬃5%
in 1-year-old males from founder 127 (3.8cM vs. 4.0cM,
Fig. 6A) to almost 14% in 6-month-old females from
founder 221 (3.6 cM vs. 4.1 cM, Fig. 6B).

DISCUSSION

Data suggest that the central melanocortin system acts

like a rheostat on energy storage, and genetic models in
the mouse demonstrate that a multitude of different
lesions in the system, including deletion of either
MC4-R (17) or MC3-R (25), deletion of the POMC gene
(26), the source of melanocortin agonist, or overex-
pression of either agouti or AgRP (27, 28), endogenous

Figure 5. Overexpression of zAgRP causes visceral adipocyte

hypertrophy in representative transgenic and wild-type ze-
brafish tank mates. Zebrafish adipocytes are found in A)
visceral, B) intermuscle, and C) subcutaneous depots, but not
in D) liver of wild-type zebrafish. Overexpression of zAgRP
caused a significant increase of visceral adipocyte cell size in
strains 284 and 221 (E, left and right pair of bars, respec-
tively), and increased visceral adipocyte cell number in strain
221 but not strain 284 (F, right and left pair of bars,
respectively). A) Bar ⫽ 50 ␮m. Results are expressed as
mean ⫾ sem, and statistical analyses were done by unpaired t
test. **P ⬍ 0.01.

just behind the operculum to the urogenital opening.

Similar to salmonids, zebrafish were found to store
triglycerides in visceral, intramuscular, and subcutane-
ous adipocyte depots (Fig. 5A–C, representative images
from a wild-type fish) but not in liver (Fig. 5D). A
quantitative analysis of visceral adipocytes across the
entire region examined showed that the AgRP trans-
genic fish derived from either strain 284 or 221 had
significantly larger visceral adipocytes than the wild-
type tank mate (Fig. 5E). A significant increase in the
number of visceral adipocytes was detected in strain 221
but not strain 284 (Fig. 5F).
Figure 6. Overexpression of AgRP causes increased linear
Increased linear growth in transgenic zebrafish with growth in the zebrafish. Length of A) 1-year-old males,
constitutive ectopic expression of AgRP founder AgRP-127 (WT n⫽22, TG (⫹/–) n⫽11), and B)
6-month-old females, founder AgRP-221 (WT n⫽5, TG (⫹/–)
n⫽8). Length of zebrafish was measured from tip to end of
The increase in triglycerides shown in Fig. 4 cannot tail. Results are expressed as mean ⫾ sem, and statistical
account for the entirety of the weight gain in the AgRP analyses were done by unpaired t test. *P ⬍ 0.05; **P ⬍ 0.01;
transgenic fish. In mice and humans, defective MC4-R ***P ⬍ 0.001.

GENETIC MODEL OF OBESITY IN A TELEOST 2047

antagonists of both central melanocortin receptors,
leads to obesity. Evidence that the melanocortin obesity
syndrome can occur in humans was first demonstrated
by the discovery of null mutations in the proopiomela-
nocortin (POMC) gene (29). These data demonstrated
for the first time that the central melanocortin circuitry
regulates energy homeostasis in humans much as it
does in the mouse. Shortly thereafter, two laboratories
published the first reports of heterozygous mutations in
MC4R (both frameshifts) associated with nonsyndromic
obesity in two separate families (18, 19). Additional
reports (30 –32) show that haploinsufficiency of the
MC4-R in humans is the most common monogenic
cause of severe obesity at the present time, accounting
for up to 5% of cases. Remarkably, the syndrome is
virtually identical to that reported for the mouse (17,
33, 34), with increased adipose mass, increased linear
growth and lean mass, hyperinsulinemia greater than
that seen in matched obese controls, and severe hy-
perphagia.
While the data above suggest that this central circuit
is highly functionally conserved from mice to humans,
previous data have demonstrated acute effects of mela-
nocortin agonists and antagonists on feeding behavior
in the fish, but have not proved functional conservation
of this component of the adipostat in regulating energy
homeostasis in nonmammalian vertebrates. We showed
previously that POMC and AgRP circuits are neuroana-
tomically conserved in the zebrafish and that AgRP
mRNA is significantly up-regulated by fasting (16). We
demonstrate here that the mouse AgRP protein is a
competitive antagonist of the central zebrafish MC3-R,
MC4-R, and MC5b-R. Furthermore, as is the case in
mammals, prolonged blockade of melanocortin signal-
ing in the fish causes an obesity syndrome characterized
by an early onset of increased weight gain, increased
total triglycerides, and increased linear growth. We
presume, as is the case in mammals, that blockade of
melanocortin signaling in the central nervous system
(CNS) is the most salient feature of the transgenic
obesity model characterized here, although tissue-spe-
cific overexpression of AgRP in the CNS of the ze-
brafish would be necessary to formally prove this point.
These data demonstrate that several functional roles of
the central melanocortin system are conserved in te-
leosts and thus are probably important to energy ho-
meostasis throughout all vertebrates. Our preliminary
analysis of adipocyte size and distribution in two repre-
sentative weight and transgenic fish suggests that lipid
storage in visceral adipocytes, a hallmark of mammalian
obesity, may also be seen in this teleost obesity model.
Additional work is needed to validate this finding in
both sexes and across different founder strains. It will
also be of interest to quantitate adipocyte size and
number in the subcutaneous and muscle depots as well.
We also note some possible sexual dimorphism in the
effects of central melanocortin blockade in the fish.
This has also been noted in the mouse (17), but
appears to be more exaggerated in the zebrafish.
However, additional work is required to determine
2048 Vol. 21 July 2007 The FASEB Journal
whether the differences in weight gain in the offspring
of the three founders characterized here are truly due
to sexually dimorphic effects of AgRP. They may also be
due to integration site effects on the transgene or to the
inherent variability in founders resulting from the fact
that the laboratory strains of zebrafish are not inbred.
Finally, a demonstration that AgRP is regulated by
metabolic state in the zebrafish (16) and that pro-
longed overexpression increases energy storage and
lean mass argues that mechanisms by which energy
availability is signaled to the CNS are highly conserved
across vertebrates. While a leptin-like molecule has only
recently been identified in fish (5), we suggest that this
molecule is likely to access the teleost CNS and signal
energy state in part by controlling AgRP levels, as in
mammals (35). In light of the likely conservation of
adipostatic function in the zebrafish, the development
of a melanocortin obesity model in the zebrafish pro-
vides a valuable tool for suppressor analysis to identify
genes downstream of AgRP required for function of the
adipostat.
This work was supported by a Freedom to Discover Grant
from the Bristol-Myers Squibb Foundation and by NIH
R56DK075721 (R.D.C.). The authors would like to thank Dr.
Wenbiao Chen (Vollum Institute) for advice, Dr. Anda Cor-
nea for the advice about adipocyte cell sizing, and Rob
Duncan for technical assistance.
REFERENCES
1. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., and
Friedman, J. M. (1994) Positional cloning of the mouse obese
gene and its human homologue. Nature 372, 425– 432
2. Kojima, M., Hosoda, H., Date, Y., Nakazato, M., Matsuo, H., and
Kangawa, K. (1999) Ghrelin is a growth-hormone-releasing
acylated peptide from stomach. Nature 402, 656 – 660
3. Wren, A. M., Small, C. J., Ward, H. L., Murphy, K. G., Dakin,
C. L., Taheri, S., Kennedy, A. R., Roberts, G. H., Morgan, D. G.,
Ghatei, M. A., and Bloom, S. R. (2000) The novel hypothalamic
peptide ghrelin stimulates food intake and growth hormone
secretion. Endocrinology 141, 4325– 4328
4. Tschop, M., Smiley, D. L., and Heiman, M. L. (2000) Ghrelin
induces adiposity in rodents. Nature 407, 908 –913
5. Kurokawa, T., Uji, S., and Suzuki, T. (2005) Identification of
cDNA coding for a homologue to mammalian leptin from
pufferfish, Takifugu rubripes. Peptides 26, 745–750
6. Akiyoshi, H., and Inoue, A. (2004) Comparative histological
study of teleost livers in relation to phylogeny. Zool. Sci. 21,
841– 850
7. Volfoff, H., Eykelbosh, A. J., and Peter, R. E. (2003) Role of
leptin in the control of feeding of goldfish Carassius auratus:
interactions with cholecystokinin, neuropeptide Y and orexin A,
and modulation by fasting. Brain Res. 972, 90 –109
8. Takahashi, A., Amemiya, Y., Sarashi, M., Sower, S. A., and
Kawauchi, H. (1995) Melanotropin and corticotropin are en-
coded on two distinct genes in the lamprey, the earliest evolved
extant vertebrate. Biochem. Biophys. Res. Commun. 213, 490 – 498
9. Dores, R. M. (1990) The proopiomelanocortin family. Prog. Clin.
Biol. Res. 342, 22–27
10. Hansen, I. A., To, T. T., Wortmann, S., Burmester, T., Winkler,
C., Meyer, S. R., Neuner, C., Fassnacht, M., and Allolio, B.
(2003) The pro-opiomelanocortin gene of the zebrafish (Danio
rerio). Biochem. Biophys. Res. Commun. 303, 1121–1128
11. Chiba, A. (2001) Marked distributional difference of alpha-
melanocyte-stimulating hormone (alpha-MSH) -like immunore-
activity in the brain between two elasmobranchs (Scyliorhinus
SONG AND CONE
 torazame and Etmopterus brachyurus): an immunohistochem-
ical study. Gen. Comp. Endocrinol. 122, 287–295
12. Logan, D. W., Bryson-Richardson, R. J., Pagan, K. E., Taylor,
M. S., Currie, P. D., and Jackson, I. J. (2003) The structure and
evolution of the melanocortin and MCH receptors in fish and
mammals. Genomics 81, 184 –191
13. Ringholm, A., Fredriksson, R., Poliakova, N., Yan, Y. L., Postleth-
wait, J. H., Larhammar, D., and Schioth, H. B. (2002) One
melanocortin 4 and two melanocortin 5 receptors from ze-
brafish show remarkable conservation in structure and pharma-
cology. J. Neurochem. 82, 6 –18
14. Cerda-Reverter, J. M., Ringholm, A., Schioth, H. B., and Peter,
R. E. (2003) Molecular cloning, pharmacological characteriza-
tion, and brain mapping of the melanocortin 4 receptor in the
goldfish: involvement in the control of food intake. Endocrinology
144, 2336 –2349
15. Cerda-Reverter, J. M., and Peter, R. E. (2003) Endogenous
melanocortin antagonist in fish: structure, brain mapping, and
regulation by fasting of the goldfish agouti-related protein gene.
Endocrinology 144,:4552– 4561
16. Song, Y., Golling, G., Thacker, T. L., and Cone, R. D. (2003)
Agouti-related protein (AGRP) is conserved and regulated by
metabolic state in the zebrafish, Danio rerio. Endocrine 22,
257–265
17. Huszar, D., Lynch, C. A., Fairchild-Huntress, V., Dunmore, J. H.,
Fang, Q., Berkemeier, L. R., Gu, W., Kesterson, R. A., Boston,
B. A., Cone, R. D., et al. (1997) Targeted disruption of the
melanocortin-4 receptor results in obesity in mice. Cell 88,
131–141
18. Yeo, G. S. H., Farooqi, I. S., Aminian, S., Halsall, D. J., Stanhope,
R. G., and O’Rahilly, S. (1998) A frameshift mutation in MC4R
associated with dominantly inherited human obesity. Nat. Genet.
20, 111–112
19. Vaisse, C., Clement, K., Guy-Grand, B., and Froguel, P. (1998) A
frameshift mutation in human MC4R is associated with a
dominant form of obesity. Nat. Genet. 20, 113–114
20. Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., and
Schilling, T. F. (1995) Stages of embryonic development of the
zebrafish. Dev. Dyn. 203, 253–310
21. Higashijima, S., Okamoto, H., Ueno, N., Hotta, Y., and Eguchi,
G. (1997) High-frequency generation of transgenic zebrafish
which reliably express GFP in whole muscles or the whole body
by using promoters of zebrafish origin. Dev. Biol. 192, 289 –299
22. Westerfield, M. (2000). The Zebrafish Book. A Guide for the
Laboratory Use of Zebrafish (Danio rerio), 4th Ed, University of
Oregon Press, Eugene
23. Howard, V., and Reed, M. G. (2005) Unbiased Stereology: Three-
Dimensional Measurement in Microscopy, BIOS Scientific Publisher,
Abingdon
24. Nagele, U., Hagele, E. O., Sauer, G., Wiedemann, E., Lehmann,
P., Wahlefeld, A. W., and Gruber, W. (1984) Reagent for the
GENETIC MODEL OF OBESITY IN A TELEOST
enzymatic detection of serum total triglycerides with improved
lipolytic efficiency. J. Clin. Chem. Clin. Biochem. 22, 165–174
25. Butler, A. A., Kesterson, R. A., Khong, K., Cullen, M. J.,
Pelleymounter, M. A., Dekoning, J., Baetscher, M., and Cone,
R. D. (2000) A unique metabolic syndrome causes obesity in the
melanocortin-3 receptor-deficient mouse. Endocrinology 141,
3518 –3521
26. Yaswen, L., Diehl, N., Brennan, M. B., and Hochgeschwender,
U. (1999) Obesity in the mouse model of pro-opiomelanocortin
deficiency responds to peripheral melanocortin. Nat. Med. 5,
1066 –1017
27. Ollmann, M. M., Wilson, B. D., Yang, Y.-K., Kerns, J. A., Chen, Y.,
Gantz, I., and Barsh, G. S. (1997) Antagonism of central
melanocortin receptors in vitro and in vivo by agouti-related
protein. Science 278, 135–137
28. Graham, M., Shuttre, J. R., Sarmiento, U., Sarosi, I., and Stark,
K. L. (1997) Overexpression of Agrt leads to obesity in trans-
genic mice. Nat. Genet. 17, 273–274
29. Krude, H., Biebermann, H., Luck, W., Horn, R., Brabant, G.,
and Gruters, A. (1998) Severe early-onset obesity, adrenal
insufficiency and red hair pigmentation caused by POMC
mutations in humans. Nat. Genet. 19, 155–157
30. Hinney, A., Schmidt, A., Nottebom, K., Heibult, O., Becker, I.,
Ziegler, A., Gerber, G., Sina, M., Gorg, T., Mayer, H., et al.
(1999) Several mutations in the melanocortin-4 receptor gene
including a nonsense and a frameshift mutation associated with
dominantly inherited obesity in humans. J. Clin. Endocrinol.
Metab. 84, 1483–1486
31. Farooqi, I. S., Yeo, G. S., Keogh, J. M., Aminian, S., Jebb, S. A.,
Butler, G., Cheetham, T., and O’Rahilly, S. (2000) Dominant
and recessive inheritance of morbid obesity associated with
melanocortin 4 receptor deficiency. J. Clin. Invest. 106, 271–279
32. Vaisse, C., Clement, K., Durand, E., Hercberg, S., Guy-Grand, B.,
and Froguel, P. (2000) Melanocortin-4 receptor mutations are a
frequent and heterogenous cause of morbid obesity. J. Clin.
Invest. 106, 253–262.
33. Butler, A. A., Marks, D. L., Fan, W., Kuhn, C. M., Bartolome, M.,
and Cone, R. D. (2001) Melanocortin-4 receptor is required for
acute homeostatic responses to increased dietary fat. Nat. Neu-
rosci. 4, 605– 611
34. Fan, W., Dinulescu, D. M., Butler, A. A., Zhou, J., Marks, D. L.,
and Cone, R. D. (2000) The central melanocortin system can
directly regulate serum insulin levels. Endocrinology 141, 3072–
3079
35. Mizuno, T. M., and Mobbs, C. V. (1999) Hypothalamic agouti-
related protein messenger ribonucleic acid is inhibited by leptin
and stimulated by fasting. Endocrinology 140, 814 – 817
Received for publication October 6, 2006.
Accepted for publication January 25, 2007.
2049