GENETICS AND GENOMICS

Association between ACTA1 candidate gene and performance, organs

and carcass traits in broilers

G. C. Venturini,∗ N. B. Stafuzza,∗ D. F. Cardoso,∗ F. Baldi,∗ M. C. Ledur,† J. O. Peixoto,†

L. El Faro,‡ and D. P. Munari∗,1
∗
UNESP São Paulo State University, College of Agriculture and Veterinary Sciences, 14884-900, Jaboticabal
(SP), Brazil; † Embrapa Suı́nos e Aves, 89700-000, Concórdia (SC), Brazil; and ‡ Agencia Paulista de Tecnologia
dos Agronegócios (APTA) Centro Leste/Secretaria de Agricultura e Abastecimento (SAA), 14001-970, Ribeirão
Preto (SP), Brazil

ABSTRACT This study investigates the genetic asso-
ciation of the SNP present in the ACTA1 gene with
performance traits, organs and carcass of broilers to
help marker-assisted selection of a paternal broiler line
(TT) from EMBRAPA Swine and Poultry, Brazil. Ge-
netic and phenotypic data of 1,400 broilers for 68 traits
related to body performance, organ weights, weight
of carcass parts, and yields as a percentage of organs
and carcass parts were used. The maximum likelihood
method, considering 4 analytical models, was used to
analyze the genetic association between the SNP and
these important economic traits. The association anal-
ysis was performed using a mixed animal model in-
cluding the random effect of the animal (polygenic),
and the fixed effects of sex (2 levels), hatch (5 lev-
els) and SNP (3 levels), besides the random error.
The traits significantly associated (P < 0.05) with the
SNP were analyzed, along with body weight at 42 days
of age (BW42), by the restricted maximum likelihood
Key words: drumstick yield, genetic association, Qxpak, SNP, wing weight
method using the multi-trait animal model to estimate
genetic parameters. The analysis included the residual
and additive genetic random effects and the sex-hatch
fixed effect. The additive effects of the SNP were as-
sociated with breast meat (BMY), liver yield (LIVY),
body weight at 35 days of age (BW35); drumstick skin
(DSW), drumstick (DW) and breast (BW) weights. The
heritability estimates for these traits, in addition to
BW42, ranged from 0.24 ± 0.06 to 0.45 ± 0.08 for LIVY
and BW35, respectively. The genetic correlation ranged
from 0.02 ± 0.18 for LIVY and BMY to 0.97 ± 0.01 for
BW35 and BW42. Based on the results of this study, it
can be concluded that ACTA1 gene is associated with
performance traits BW35, LIV and BMY, DW, BW
and DW adjusted for body weight at 42 days of age.
Therefore, the ACTA1 gene is an important molecular
marker that could be used together with others already
described to increase the economically important traits
in broilers.
2015 Poultry Science 94:2863–2869
http://dx.doi.org/10.3382/ps/pev285

INTRODUCTION Candidate genes that are in linkage disequilibrium

Molecular genetics-related studies can be potentially
applied to evaluate animals in a breeding program to
detect genes that can influence traits of economic inter-
est. Traditional selection based on phenotypic values
has resulted in major gains in growth rates and per-
centage of meat in the carcass (Sato et al., 2012). How-
ever, marker-assisted selection (MAS) can be used to in-
crease selection efficiency in traits considered polygenic
(Amirinia et al., 2011). According to Li et al. (2005), the
broiler selection process becomes more accurate when
traditional and molecular genetics are combined.

C 2015 Poultry Science Association Inc.
can be used as genetic markers in broiler breeding pro-
grams to select traits that are either difficult to measure
or with low heritability (Lande and Thompson, 1990).
Zhao et al. (2009), Aliabad et al. (2011), and Sato et al.
(2012) observed genetic association of molecular mark-
ers with important economic traits in broilers. These
genetic association studies are important as they show
marker assisted selection of economic traits is possible.
The Gallus gallus genome consists of 38 pairs of
autosomal chromosomes plus Z and W (sex chromo-
somes), with a genome size estimated to be 1,200
Mb. The chicken chromosome 3 (GGA3) has a size
of 110 Mb with approximately 1,545 genes placed
according to the genome annotation Gallus gallus-

Received March 27, 2015.

4.0 (http://www.ncbi.nlm.nih.gov/mapview/). The
Accepted August 10, 2015. ACTA1 (actin, alpha1, skeletal muscle) candidate
1
Corresponding author: danisio@fcav.unesp.br gene called is placed at 39,337,939–39,339,803 bp of

2863
2864 VENTURINI ET AL.
GGA3 (accession number NC 006090.3) and consists
of 6 exons and 5 introns, totaling 1,865 bp. This gene
is related to genes responsible for skeletal muscle,
which associates with myosin to form the myofibers.
These fibers are specific to muscle tissue that plays
an essential role in muscle contraction and cell mor-
phology (Pollard and Cooper, 1986). According to
Fronwald et al. (1982), actin is a prevalent protein
component in muscle cell contraction mechanism,
and therefore, a major component of the cytoskele-
ton. To date, there are 30 SNPs in the ACTA1
gene of chicken deposited in the dbSNP database
(http://www.ncbi.nlm.nih.gov/snp).
The ACTA1 gene was previously analyzed by Peixoto
et al. (2008) in a cross-F2 population developed by Em-
brapa Swine and Poultry (Concordia, SC, Brazil) by
crossing the TT (of this study) and CC populations.
The TT population results from a male line of Cornish,
Hampshire and White Plymouth Rock broilers, selected
for improved body weight, feed conversion, cut yields,
breast weight, viability, fertility, hatchability and re-
duced abdominal fat. The CC line originates from a
pure White Leghorn line selected for egg production;
weight and quality; feed conversion; hatchability; sex-
ual maturation; fertility; viability; and reduced body
weight (Nunes et al., 2011). No studies evaluating the
association between the ACTA1 gene and the econom-
ically important traits in broilers were found in the lit-
erature.
There are several studies with broilers and layers that
scan the genome to search for QTL regions (Campos
et al., 2009; (Rosário et al., 2009; 2010; Baron et al.,
2011; Silva et al., 2011). Thus, studying the association
of the SNP identified in the ACTA1 gene with traits of
economic interest can provide a basis for the molecular
marker assisted selection (MAS). The objective of this
study was to evaluate the genetic association of the SNP
in the ACTA1 gene with performance traits, organs and
carcass on a paternal line of broilers, and identify if a
possible genetic marker could be used for selection.
MATERIALS AND METHODS
Experimental Population
Data was obtained from a paternal line of pure broil-
ers, from the breeding program developed by Embrapa
Swine and Poultry, Concordia, Santa Catarina, Brazil.
This line (TT) has been maintained under selection for
multiple traits, particularly body weight at 42 days,
since 1992. The TT Reference Population originated
from 20 males and 92 females with an approximate mat-
ing ratio of 1:5 producing approximately 1,600 progeny.
The broilers were reared following the vaccination and
nutritional management programs for broilers, recom-
mended by Embrapa. The chicks (males and females)
that originated from 5 hatches were analyzed at inter-
vals of 15 d. The broilers were kept in collective pens
until 35 days of age and housed in individual cages to
evaluate feed conversion from 35 to 41 days of age. At
42 days of age, a total of 1,400 broilers were slaugh-
tered and genotyped. The experimental procedures fol-
lowed the ethical principles for animal experimenta-
tion, adopted by the Brazilian College of Animal Ex-
perimentation (COBEA - Protocol no.: 010/2012). This
reference population has genomic DNA bank, pedigree
records for each individual and phenotypic data for sev-
eral traits of interest to the poultry industry.
Phenotypic Data
A total of 68 traits related to broiler body perfor-
mance, organs and carcass were studied. These traits
are described in Table 1 together with their abbrevia-
tions.
DNA Extraction, PCR Amplification
and Genotyping of Broilers
Approximately 2 mL blood samples were collected
at slaughter from the jugular and stored in 2-mL
microtubes containing 100 μL (10% v/v) of 0.5 M
EDTA anticoagulant. DNA was extracted using the
DNAzol reagent (Invitrogen, Thermo Fisher Scientific,
Portsmouth, NH) following the protocol recommended
by the manufacturer. DNA samples were quantified
by BioPhotometerTM (Eppendorf, Hamburg, Germany)
spectrophotometer and their concentrations adjusted to
a concentration of 25 ng/mL.
PCR primers for amplification of the ACTA1
gene were designed from the sequence deposited
in the GenBank database (accession num-
ber V01507.1) using the Primer3Plus software
(www.bioinformatics.nl/primer3plus/). The amplified
region encompassed the partial sequence of exon 2,
intron 2, exon 3, intron 3 and partial sequence of
exon 4. The region containing the polymorphism was
amplified with the following primer set: forward -
5 ACTGGGACGAGATGGAGAAG3 and reverse -
5 TCCAGAGCCACATAGCACAG3 .
PCR reactions were performed in a 25-μL reaction
volume including: 75 ng DNA, 10 mM Tris-HCl; 1.5
mM MgCl2 ; 10 mM dNTPs; 2 pmol/μL of each primer
and 1.5 U of TaqDNA polymerase (Invitrogen). The
amplifications were carried out under the following con-
ditions: initial denaturation at 95◦ C for 5 min, followed
by 29 cycles at 95◦ C for 1 min (denaturation), 59◦ C
for 1 min (annealing), extension at 72◦ C for 1 min, and
a final extension at 72◦ C for 7 min. The PCR prod-
ucts were electrophoresed through 1% agarose gels in
1X TBE buffer containing ethidium bromide at 90 V
for 50 min prior to RFLP studies to verify the quality
and specificity of DNA fragment amplification. Molec-
ular weight marker of 1 Kb (Invitrogen) was used to
identify the DNA fragments on the agarose gel.
To identify the SNPs, DNA samples from 15 ani-
mals were amplified by PCR and sequenced on ABI
3130xl equipment (Applied Biosystems, Thermo Fisher
 CANDIDATE GENE FOR PRODUCTION TRAITS IN BROILERS 2865
Table 1. Description of the traits studded with their respective abbreviations.

Traits Description
Body performance in grams (g)

BW Body weights at birth

BW21 Body weights at 21 days of age
BW35 Body weights at 35 days of age
BW41 Body weights at 41 days of age
BW42 Body weights at 42 days of age
FI35 41 Feed intake from 35 to 41 days of age
WG35 41 Weight gain from 35 to 41 days of age
FC35 41 Feed conversion from 35 to 41 days of age
Organs and Carcass in grams (g) and yields (%)

BFW and BFY Blood and feather weight and yield

AFW and AFY Abdominal fat weight and yield
LIVW and LIVY Liver weight and yield
HEAW and HEAY Heart weight and yield
GIZW and GIZY Gizzard weight and yield
LUNW and LUNY Lungs weight and yield
PPCW and PPCY Carcass post-bleeding and plucking weight and yield
CCW and CCY Chilled carcass weight and yield
HEADW and HEADY Head weight and yield
FEEW and FEEY Feet weight and yield
TWW and TWY Thing wing weight and yield
WDW and WDY Wing drumette weight and yield
WTW and WTY Wing tip weight and yield
WW and WY Wing weight and yield
TIBW and TIBY Tibia weight and yield
TSW and TSY Thing skin weight and yield
TMW and TMY Thing meat weight and yield
TW and TY Thigh weight and yield
FEMW and FEMY Femur weight and yield
DSW Drumstick skin weight
DMW Drumstick meat weight
DW and DY Drumstick weight and yield
BSW and BSY Breast skin weight and yield
BMW and BMY Breast meat weight and yield
BFW and BFY Breast fillet weight and yield
BBW and BBY Breast bone weight and yield
BREW and BREY Breast weight and yield
BACW and BACY Back weight and yield
NECW and NECY Neck weight and yield
BONW and BONY Bone weight and yield
SW and SY Skins weight and yield

Scientific). The sequencing reactions were carried out
following the protocol of the BigDyeR Terminator Cy-
cle Sequencing Ready Reaction (Applied Biosystems)
kit. Each sequencing reaction was carried out in both
directions using 2 μL Save Money buffer (200 mM Tris
pH 9.0, 0.5 mM MgCl2 ), 1 μL primer (2.5 pmol/μL),
2 μL BigDye Kit and 50 ng DNA were used. The se-
quencing reaction comprised denaturation at 95◦ C for
20 seconds, annealing at 59◦ C for 15 seconds and ex-
tension at 60◦ C for one minute, totaling 25 cycles.
DNA sequences were analyzed using the
Phred/Phrap/Consed/PolyPhred software (Ewing
and Green, 1998; Gordon et al., 1998; Nickerson
et al., 1997). Only DNA sequences with quality
(Phred) greater than or equal to 20 were selected.
Subsequently, the SNP identified were genotyped in
the broilers population by PCR-RFLP. For the RFLP
analysis, a total of 12.5 μL of the PCR products were
digested with 0.15 μL (10U/μL) BsrI (ACTGGN↓)
restriction enzyme (New England Biolabs, Hitchin,
UK) in a final volume of 15 μL at 65◦ C overnight.
Detection of restriction fragment length polymorphism
was carried out by electrophoresis on 1% agarose gels
in 1X TBE buffer stained with ethidium bromide
at 100 V for 50 min. Molecular weight marker of
100 bp (Invitrogen) was used to identify the size of the
restriction fragments on the agarose gel. The agarose
gels were analyzed under UV light and the allele
frequencies were obtained by direct counting.
Statistical Analysis
Calculation of Allele and Genotype Frequen-
cies. The allele frequencies of the genotyped SNP
were counted (Falconer and Mackay, 1996) using the
PROC FREQ function (SAS 9.1, SAS Institute, Cary,
NC). Possible deviations from the genotypic and al-
lelic frequencies were tested using the chi-square test, to
verify whether the genotyped population was in Hardy-
Weinberg equilibrium. The allele and genotype frequen-
cies of 7% of the animals with high genetic values for
BW42 were also calculated to find the highest allele
proportion that would be favored by selection.
2866 VENTURINI ET AL.
Association Analysis. The analysis of the associ-
ation between the SNP and the traits of interest was
performed by the maximum likelihood method using
the QxPak software (Pérez-Enciso and Misztal, 2004)
through a mixed model that included the random ef-
fects of polygenes and error and the fixed effects of sex
(2 levels), hatch (5 levels) and SNP (3 levels).
Four models were adjusted for the study of genetic as-
sociation between the SNP and phenotypic traits. The
first model (M1) was adjusted using only the SNP addi-
tive effect. The second (M2) was adjusted considering
both additive and dominance effects. Models 3 (M3)
and 4 (M4) were adjusted to additive effect, and domi-
nance and addictive effects within sex, respectively. The
objective in M3 and M4 was to verify whether the SNP
was affected by the sex. The 4 models (M1, M2, M3,
M4) were also tested for the covariate body weight at
42 days of age (BW42), except for yields, which had
already been factored into BW42. The statistics of the
likelihood ratio test obtained for each model was used
to compare the models M1 and M2, and M3 and M4
using the χ2 test for one degree of freedom at 5% sig-
nificance level.
Estimation of Genetic and Phenotypic Parame-
ters. Analysis by the least squares method was per-
formed previously using the GLM procedure of SAS
(SAS 9.1, SAS Institute) to verify the influence of the
fixed effect of hatch (5 levels) and sex (2 levels) and
the hatch/sex interaction. The hatch/sex interaction
was significant (P < 0.05) and this fixed effect totaled
10 sex-hatch groups. Descriptive statistics of the per-
formance traits, carcass parts and organs studied were
performed using PROC MEANS of SAS (SAS 9.1, SAS
Institute). The variance components of traits geneti-
cally associated with ACTA1 and, in addition, to BW42
trait were estimated by the Restricted Maximum Like-
lihood method for multi-trait animal model, using the
software developed by WOMBAT Meyer (2007). The
general model included the direct and residual additive
random effects and the fixed effect of sex-hatch. The
BW42 was included in the analysis because it is the
main selection criteria for the studied population.
RESULTS
Genotyping of Animals
PCR reactions amplified a 792-bp fragment compris-
ing exon 2 (216 bp), intron 2 (134 bp), exon 3 (162
bp), intron 3 (225 bp), and exon 4 (55 bp). The SNP
evaluated in this work is characterized by a cytosine for
guanine substitution (C > G) in intron 2, in the 950-
bp position in relation to the complete ACTA1 gene
sequence (GenBank accession number V01507.1). The
PCR-RFLP reactions with the BsrI restriction enzyme
revealed 3 genotypes: homozygous CC (792 bp), ho-
mozygous GG (466 and 326 bp) and heterozygous CG
(792, 466, and 326 bp).
Allele and Genotype Frequencies
The allele frequencies of 1,400 genotyped animals
were 34% and 66% for C and G alleles, respectively.
The genotype frequencies of CC, CG and GG were, re-
spectively, 10.45% (58), 44.68% (248) and 44.86% (249)
in males and 10.49% (66), 49.12% (309) and 40.38%
(254) in females. The Chi-square test χ2 = 3.37; P
> 0.05) results indicated that the differences between
the genotype quantities observed and those expected
for the Hardy-Weinberg equilibrium were random and
therefore, the studied population is in Hardy-Weinberg
equilibrium. Of the 7% of animals with higher genetic
values for BW42, the genotype frequency followed by
the number of individuals were 3.66% (3); 36.59% (30)
and 24.39% (20) for males; and 1.22% (1); 25.61% (21)
and 8.54% (7) for females, for CC, CG and GG, respec-
tively. Therefore, the selection of these animals would
favor a higher ratio of G allele (64%).
Association of the ACTA1
with Traits Studied.
Among the 68 traits studied, only 6 (BW35, BMY,
LIVY, DSW, BREW BW42 and DW BW42) were ge-
netically associated with the SNP g.950C>G (Table 2).
Cytosine by guanine allelic substitution resulted in neg-
ative estimates of the additive effect for BMY in the
models M1, M2, M3 and M4 (Table 2). Positive esti-
mates of the additive effect, for both males and females,
were observed for LIVY (model 3), DSW (model 3) and
DW BW42 (model 3). BW35 (model 3) and DW BW42
(model 4) estimates signal changed between sexes for
the same effect. The LIVY estimates for males changed
from positive to negative, from model 3 to model 4.
Dominance effects were observed for 3 (BMY, LIVY
and DW BW42) of the 6 traits, being different for males
and females.
The comparison of the models (M1, M2, M3 and M4)
by the likelihood ratio test, which were significant (P <
0.05) for each trait, showed significant difference (P <
0.05) only for the DW trait adjusted for the covariate
BW42 using the most complete model (M4). Therefore,
the model indicated for the other traits (BMY, BW35,
LIVY, DSW and BREW adjusted to BW42) should
consider only the additive effect since there were no
significant differences (P > 0.05) between models.
Genetic Parameters
After the association of ACTA1 with the traits stud-
ied were performed, the descriptive statistics (Table 3)
and estimates of genetic and phenotypic parameters
(Table 4) were calculated for BW42 (because this
trait is considered as selection criteria in this popula-
tion) and BW35, BMY, LIVY, DSW, BREW BW42
and DW BW42 (traits associated with the SNP
g.950C>G). The heritability estimates for these 7 traits
 CANDIDATE GENE FOR PRODUCTION TRAITS IN BROILERS 2867
Table 2. Results of association analyses of SNP g.950C > G with body performance traits,
organs and carcass for the models M1 (additive effect); M2 (additive and dominance effects);
M3 (additive effect within sex); M4 (additive effect of dominance deviations within sex) and
standard errors (SE).

Trait Model P-value A SE D SE LR

BMY (%) M1 < 0.01 − 0.1440 0.05 6.73
M2 < 0.01 − 0.1891 0.05 .1288 .0740 9.54
M3 < 0.05 (M) − 0.1450 0.07 6.75
(F) − 0.1430 0.07
M4 < 0.05 (M) − 0.2133 0.08 .1897 .1082 10.11
(F) − 0.1697 0.07 0.0788 .0984
BW35 (g) M3 < 0.05 (M) 21.6132 10.36 6.12
(F) − 11.1051 9.90
LIVY (%) M3 < 0.01 (M) 0.0039 0.02 33.63
(F) 0.0262 0.02
M4 < 0.01 (M) − 0.0064 0.02 0.0284 0.0328 36.26
(F) 0.0403 0.024 − 0.0404 0.0301
DSW (g) M3 < 0.05 (M) 0.7730 0.30 6.25
(F) 0.0264 0.29
BREW BW42 (g) M1 < 0.05 − 0.1510 0.05 4.94
DW BW42 (g) M1 < 0.01 0.8522 0.50 14.88
M2 < 0.01 0.6659 0.56 0.5743 0.7290 17.79
M3 < 0.01 (M) 0.2695 0.72 19.72
(F) 1.4070 0.69
M4 < 0.01 (M) − 0.1947 0.82 1.3726 1.0709 25.17∗
(F) 1.4698 0.77 − 0.1015 0.9820
M = male; F = female; BMY = breast meat yield; BW35 = weight at 35 days of age; LIVY = liver
yield; DSW = drumstick skin weight; BREW BW42 = breast weight adjusted for body weight at 42
days of age; DW BW42 = drumstick weight adjusted for body weight at 42 days of age; a = additive
effect and d = dominance effect, LR = likelihood ratio test statistics. ∗ P < 0.05 by the χ 2 distribution.

Table 3. Number of animals (N), means (M), standard deviation (SD), minimum (MIN)
and maximum (MAX) values, and coefficient of variation in percentage (CV) of the traits
genetically associated with ACTA1 and body weight at 42 days of age in broilers.

Trait N M SD MIN MAX CV

Body weight at 35 days of age (g) 1390 1732.41 197.31 1022.00 2444.00 11.39
Body weight at 42 days of age (g) 1393 2224.40 253.55 1276.00 2971.00 11.40
Breast meat yield (%) 1393 13.22 1.23 5.14 18.46 9.30
Liver yield (%) 1393 2.37 0.34 1.29 4.30 14.34
Drumstick skin weight (g) 1390 23.10 4.85 6.70 43.80 21.00
Breast weight (g) 1393 500.94 62.17 281.80 670.60 12.43
Drumstick weight (g) 1389 155.10 23.07 31.70 232.20 14.87

Table 4. Heritability estimates (diagonal), genetic correlation (upper diagonal) and phenotypic correlation (below diagonal) with
their standard errors (in parentheses) of the traits associated with ACTA1 and body weight at 42 days of age in broilers.

Body Weight Body Weight

at 35 Days of at 42 Days of Breast Meat Liver Drumstick Skin Breast Drumstick
Age (g) Age (g) Yield (%) Yield (%) Weight (g) Weight (g) Weight (g)
Body weight at 35 days of age (g) 0.45(0.08) 0.97(0.01) 0.30(0.15) 0.04(0.17) 0.70(0.09) 0.89(0.04) 0.89(0.04)
Body weight at 42 days of age (g) 0.87(0.01) 0.41(0.07) 0.20(0.16) 0.17(0.17) 0.70(0.09) 0.86(0.04) 0.88(0.04)
Breast meat yield (%) 0.21(0.04) 0.16(0.04) 0.30(0.07) 0.02(0.18) 0.13(0.17) 0.64(0.10) 0.22(0.17)
Liver yield (%) 0.03 (0.04) 0.01(0.03) 0.13(0.03) 0.24(0.06) 0.05(0.18) 0.02(0.18) 0.02(0.18)
Drumstick skin weight (g) 0.43(0.04) 0.49(0.03) 0.02(0.03) 0.01(0.03) 0.31(0.06) 0.59(0.12) 0.81(0.07)
Breast weight (g) 0.78 (0.01) 0.84(0.01) 0.61(0.02) 0.11(0.04) 0.36(0.03) 0.40(0.07) 0.77(0.07)
Drumstick weight (g) 0.69 (0.02) 0.79(0.01) 0.12(0.03) 0.10(0.03) 0.62(0.02) 0.68(0.02) 0.31(0.06)

ranged from 0.24 ± 0.06 to 0.45 ± 0.08, for LIVY and
BW35, respectively (Table 4).
Positive genetic correlation estimates between the
traits (Table 4) ranged from 0.02 ± 0.18 for LIVY
and BMY to 0.97 ± 0.01 for BW35 and BW42. The
high estimate for the genetic correlation between BW42
and BW35 indicated that both are strongly influenced
by the same genes. Genetic correlations between LIVY
with other traits and between BMY and DSW were
low, with standard errors higher than the estimates.
Although not higher than the estimated genetic corre-
lation, the standard error between BMY and DW (0.22
± 0.17) was still considered high. Genetic correlations
above 0.55 were observed between BREW and DSW;
2868 VENTURINI ET AL.
BMY and BREW; BW35 and DSW; BREW and DW;
DSW and DW; BW35 and BREW; BW35 and DW;
BW42 and DSW; BW42 and BW42; and, BREW and
DW. Given that the selection occurs mainly for the
BW42, the traits DSW, BREW and DW should have
indirect genetic gains due to the high genetic correlation
observed with BW42 (Table 4). Phenotypic correlation
estimates (Table 4) ranged from 0.01 ± 0.03 for LIVY
and DSW to 0.87 ± 0.01 for BW35 and BW42.
DISCUSSION
The magnitudes of the additive and dominance ef-
fects, expressed in units of the traits represent the av-
erage change expected by substitution of the C allele by
G allele (Table 2). The allelic substitution was evalu-
ated as favorable to G allele since its frequency is higher
than the C allele. Among the 6 traits significantly in-
fluenced by the additive and dominance effects of the
studied marker, 4 (BMY, BW35, BREW, and DW) di-
rectly express muscle development, which can be con-
trolled by ACTA1 gene (Pollard and Cooper, 1986).
The genetic parameters estimated for the traits associ-
ated with the marker indicated additive large enough
genetic variability to be used in selection.
Since the selection for BW42 may favor BW35,
BREW, DW, and BMY, in descending order accord-
ing to the genetic association magnitude, it was ob-
served that the additive effect of allelic substitution of
ACTA1 gene favors in the same direction (positive) the
BW35 of males, DW BW42 of females, and DSW of
both sexes. The gene additive effect affects in the op-
posite direction (negative) BW35 of both males and
females, DW BW42 of males, and BREW and BMY
of both sexes. Sato et al. (2012) indicated the impor-
tance of finding genetic association of molecular mark-
ers with traits of economic importance. These authors
showed that identifying and using QTL promotes faster
genetic gain in animal breeding programs while selec-
tion for traits that are evaluated post-mortem can be
done without killing broilers.
The association between BMY and BREW traits and
other markers can be found in the literature in the stud-
ies by Aliabad et al. (2011) and Sato et al. (2012) for
the factor 1 gene (growth); Amirinia et al. (2011) for
the factor-β 3 gene (growth); Yin et al. (2011) for the
MyF5, MyF6, and MyOG genes. From these studies,
only in the work by Yin et al. (2011), the BMY has
not been genetically associated with the genes studied
by the authors. In the present study, the model (M4),
which includes sex, showed different effect of the gene
for BMY depending on sex. The genetic association ob-
served between ACTA1 and BREW was expected, since
this gene is related to muscle development. Thus, the
substitution of G by C allele would be indicated for
selection given the economic importance of this muscle.
Body weight at various ages, especially BW42, are
traits intensely selected in broiler breeding programs
because they display a high positive genetic correlation
with carcass (Gaya et al., 2006) and most parts, as ob-
served in this study. Other studies also found genetic as-
sociation between other markers and performance traits
(Nie et al., 2008; Yin et al., 2011).
There was a high genetic correlation between DW
and the performance traits. In this study, a signifi-
cant association (P < 0.05) was observed between the
ACTA1 gene and DW. This trait has been studied by
other authors and associated genetically with several
other molecular markers (Zhao et al., 2009; Yin et al.,
2011, and Nassar et al., 2012). Nassar et al. (2012)
studying 7 microsatellite markers, observed that one
(c5-4999025) showed significant genetic association (P
< 0.05) with leg weight. However, Yin et al. (2011) did
not observe significant genetic association (P > 0.05)
of the analyzed markers with the leg muscle weight.
Direct genetic association between the ACTA1 gene
and DSW is possible, since this trait is genetically cor-
related to the drumstick weight (0.81), as shown in Ta-
ble 4. In males, the association indicated that the in-
creased frequency of the G allele can increase the weight
of drumstick skin. Considering that the selection tends
to increase the important parts of chicken carcass as
breast, drumsticks and drumsticks, this association be-
tween SNP and DSW would be interesting since this
trait is intended to protect the meat during processing
in slaughterhouses.
The genetic association between ACTA1 gene with
LIVY was significant (P < 0.05), but the influence of
the marker additive effect on this characteristic is small,
close to zero. The study of chickens’ organs in breeding
programs is needed since they are indirectly influenced
by the traits used as selection criteria. Based on the
results of this study, it can be concluded that ACTA1
gene is associated with performance traits (body weight
at 35 days of age), organ (liver yield) and carcass (yield
of breast meat, drumstick skin weight, breast and drum-
stick weight adjusted for body weight at 42 days of age).
Therefore, the ACTA1 gene is an important molecular
marker, which could be used together with others al-
ready described to increase the economically important
traits in broilers.
ACKNOWLEDGMENTS
Financial support was provided by the Brazilian
Agricultural Research Corporation (Embrapa; Empresa
Brasileira de Pesquisa Agropecuária). G.C. Venturini
was awarded a scholarship from the Coordination
for the Improvement of Higher Education Personnel
(CAPES) in conjunction with the Postgraduate Pro-
gram on Genetics and Animal Breeding, Faculdade de
Ciências Agrárias e Veterinárias, Universidade Estadual
Paulista (FCAV - UNESP). D.F. Cardoso was granted
scholarships by the São Paulo Research Foundation
(FAPESP). The CNPq (National Counsel of Techno-
logical and Scientific Development) funded the post-
doctoral fellowship to N.B. Stafuzza and productivity
 CANDIDATE GENE FOR PRODUCTION TRAITS IN BROILERS
research fellowships to L. El Faro, D.P. Munari and F.
Baldi.
REFERENCES
Aliabad, A. J., H. Seyedabadi, and B. T. Dezfuli. 2011. Association
of insulin-like growth factor-I gene with body composition traits
in Iranian commercial broiler lines. World Appl. Sci. J. 14:71–76.
Amirinia, C., H. R. Seyedabadi, N. Amirmozafari, R. V. Torshizi, M.
Chamani, A. J. Aliabad, and M. A. Abbasi. 2011. Association of
transforming growth factor-ß3 gene polymorphism with growth
and body composition traits in Iranian commercial broiler lines.
African J. Biotec. 10:1784–1788.
Baron, E. E., A. S. A. M. T. Moura, M. C. Ledur, L. F. Pinto, C.
Boschiero, D. C. Ruy, K. Nones, E. L. Zanella, M. F. Rosário,
D. W. Burt, and L. L. Coutinho. 2011. QTL for percentage of
carcass and carcass parts in a broiler x layer cross. Anim. Genet.
42:117–124.
Campos, R. L. R., K. Nones, M. C. Ledur, A. S. A. M. T. Moura, L.
F. Pinto, M. Ambo, C. Boschiero, D. C. Ruy, E. E. Baron, K. Ni-
nov, C. A. B. Altenhofen, R. A. M. S. Silva, M. F. Rosário, D. W.
Burt, and L. L. Coutinho. 2009. Quantitative trait loci associated
with fatness in a broiler-layer cross. Anim. Genet. 40:729–736.
Ewing, B., and P. Green. 1998. Base-calling of automated sequencer
traces using Phred. II. Error probabilities. Genome Res. 8:186–
194.
Falconer, D. S., and T. F. C. Mackay. 1996. Genetic constitution of a
population. Pages 1–20, in Introduction to quantitative genetics.
4th ed. Longman: Essex, Edinburgh, UK.
Fronwald, J. A., G. Kuncio, I. Peng, and C. P. Ordahl. 1982. The
complete nucleotide sequence of the chick a-actin gene and its
evolutionary relationship to the actin gene family. Nucl. Acids
Res. 10:3861–3876.
Gaya, L. G., G. B. Mourão, and J. B. S. Ferraz. 2006. Genetic-
quantitative aspects of performance, carcass and body composi-
tion traits in broilers. Cienc. Rural. 36:709–716.
Gordon, D., C. Abajian, and P. Green. 1998. Consed: A graphical
tool for sequence finishing. Genome Res. 8:195–202.
Lande, R., and R. Thompson. 1990. Efficiency of marker-assisted
selection in the improvement of quantitative traits. Genetics.
124:743–756.
Li, H., N. Deeb, H. Zhou, C. M. Ashwell, and S. J. Lamont. 2005.
Chicken quantitative trait loci for growth and body composi-
tion associated with the very low density apolipoprotein-II gene.
Poult. Sci. 84:697–703.
Meyer, K. 2007. WOMBAT: a tool for mixed model analyses in quan-
titative genetics by restricted maximum likelihood (REML). J.
Zhejiang Univ. Sci. B. 8:815–821.
Nassar, F. S., R. E. A. Moghaieb, A. M. Abdou, and F. K. R.
Stino. 2012. Microsatellite markers associated with body and
2869
carcass weights in broiler breeders. African J. Biotec. 11:3514–
3521.
Nickerson, D. A., V. O. Tobe, and S. L. Taylor. 1997. PolyPhred:
automating the detection and genotyping of single nucleotide sub-
stitutions using fluorescence-based resequencing. Nucl. Acids Res.
25:2745–2751.
Nie, Q., M. Fang, L. Xie, M. Zhou, Z. Liang, Z. Luo, G. Wang, W.
Bi, C. Liang, W. Zhang, and X. Zhang. 2008. The PIT1 gene
polymorphisms were associated with chicken growth traits. BMC
Genet. 9:20.
Nunes, B. N., S. B. Ramos, R. P. Savegnago, M. C. Ledur, K. Nones,
C. H. Klein, and D. P. Munari. 2011. Genetic parameters for
body weight, carcass chemical composition and yield in a broiler-
layer cross developed for QTL mapping. Genet. Mol. Biol. 34:
429–434.
Peixoto, J. O., S. N. Jardim, E. A. Amazonas, H. J. Alves, L. L.
Coutinho, and M. C. Ledur. 2008. Associação entre polimorfismo
no gene da alfa actina e caracterı́sticas produtivas em galinha.
Anais da Conferência Apinco de Ciência e Tecnologia Avı́colas.
(Abstr.) p. 212.
Pérez-Enciso, M., and I. Misztal. 2004. QxPak: a versatile mixed
model application for genetical genomics and QTL analyses.
Bioinformat. 20:2792–2798.
Pollard, T. D., and J. A. Cooper. 1986. Actin and actin-binding pro-
teins. A critical evaluation of mechanisms and functions. Annual
Rev. Biochem. 55:987–1035.
Rosário, M. F., M. C. Ledur, A. S. A. M. T. Moura, L. L. Coutinho,
and A. A. F. Garcia. 2009. Genotypic characterization of mi-
crosatellite markers in broiler and layer selected chicken lines and
their reciprocal F1s. Sci. Agric. 66:150–158.
Rosário, M. F., G. R. A. Margarido, C. Boschiero, A. S. A. M. T.
Moura, M. C. Ledur, L. L. Coutinho, and A. A. F. Garcia. 2010.
Precision of distances and ordering of microsatellite markers in
consensus linkage maps of chromosomes 1, 3 and 4 from two re-
ciprocal chicken populations using bootstrap sampling. Genet.
Molec. Res. 9:1357–1376.
Sato, S., T. Ohtake, Y. Uemoto, Y. Okumura, and E. Kobayashi.
2012. Polymorphism of insulin-like growth factor 1 gene is associ-
ated with breast muscle yields in chickens. Anim. Sci. J. 83:1–6.
Silva, F. E. J., L. N. Guido, R. Gazaffi, A. A. F. Garcia, M. C.
Ledur, L. L. Coutinho, and M. F. Rosário. 2011. Genomic re-
gions associated with performance and carcass traits on chromo-
some 5 of Brazilian chicken lines. Pesqui. Agropecu. Bras. 46:229–
238.
Yin, H., Z. Zhang, X. Lan, X. Zhao, Y. Wang, and Z. Qing. 2011. As-
sociation of MyF5, MyF6 and MyOG gene polymorphisms with
carcass traits in Chinese Meat Type Quality chicken populations.
J. Anim. Vet. Adv. 10:704–708.
Zhao, X., Y. Liu, X. Jiang, H. Du, and Q. Zhu. 2009. Association of
polymorphisms of chicken adipose differentiation-related protein
gene with carcass traits. J. Poult. Sci. 46:87–94.