Plant Gene Silencing

Methods in
Molecular Biology 2408
Kirankumar S. Mysore
Muthappa Senthil-Kumar Editors
Plant Gene
Silencing
Methods and Protocols
Second Edition
METHODS IN MOLECULAR BIOLOGY
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, UK
For further volumes:

http://www.springer.com/series/7651
For over 35 years, biological scientists have come to rely on the research protocols and
methodologies in the critically acclaimed Methods in Molecular Biology series. The series was
the first to introduce the step-by-step protocols approach that has become the standard in all
biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by-
step fashion, opening with an introductory overview, a list of the materials and reagents
needed to complete the experiment, and followed by a detailed procedure that is supported
with a helpful notes section offering tips and tricks of the trade as well as troubleshooting
advice. These hallmark features were introduced by series editor Dr. John Walker and
constitute the key ingredient in each and every volume of the Methods in Molecular Biology
series. Tested and trusted, comprehensive and reliable, all protocols from the series are
indexed in PubMed.
Plant Gene Silencing
Methods and Protocols
Second Edition
Edited by
Kirankumar S. Mysore
Institute for Agricultural Biosciences, Oklahoma State University, Ardmore, OK, USA
Muthappa Senthil-Kumar
National Institute of Plant Genome Research, New Delhi, India
Editors
Kirankumar S. Mysore Muthappa Senthil-Kumar
Institute for Agricultural Biosciences National Institute of Plant Genome Research
Oklahoma State University New Delhi, India
Ardmore, OK, USA
ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-0716-1874-5 ISBN 978-1-0716-1875-2 (eBook)
https://doi.org/10.1007/978-1-0716-1875-2
© Springer Science+Business Media, LLC, part of Springer Nature 2022

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply,
even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been
made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer
Nature.
The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.
Preface
Gene silencing is a widely used approach for studying the plant gene function. Further, the
methods based on gene silencing are also used for plant genetic engineering to produce
better crop varieties. In the recent past, several new tools have been developed, in addition
to improving existing techniques. This book covers newly developed techniques and also
provides the latest updates on the previously used techniques. We anticipate that the
literature review chapters presented at the beginning of the book and the extensive chapters
describing the methods for performing a wide range of techniques will not only provide
advancements in basic science by revealing gene function but also contribute to develop
commercial plant varieties in future. This book is the second edition under the title Plant
Gene Silencing: Methods and Protocols published in the Methods in Molecular Biology series.
In this edition, we covered 22 chapters written by well-known experts from labs working in
the area of plant gene silencing. Like the success of the previous edition, this is also expected
to provide knowledge base and handy protocols for researchers for better gene manipulation
and utilization of the gene silencing technology for crop improvement.
Transcriptional and post-transcriptional gene silencing are two major ways for achieving
target gene downregulation in plants. Among these, the latter is popularly used for gene
function analyses. Virus-induced gene silencing (VIGS) and RNA interference (RNAi) are
two prominent gene silencing tools. The first chapter of this book provides a comprehensive
overview of the basic knowledge emerged in this area and also enumerates the tools available
to date for genetic manipulation and crop improvement. The other review chapters cover
the tools related to RNAi-based gene silencing for trait discovery and genome editing, the
recent tool available for developing designer crops. Subsequently, a batch of method
chapters present up to date protocols for implementing VIGS using popular vectors in
different plant species, both monocots and dicots. These chapters also present tips for
increasing VIGS efficiency and uniformity in silencing and thereby will facilitate the wider
utility for these VIGS vectors. A chapter is dedicated to describing the steps for using RNAi
for virus resistance. Further chapters provide protocols for in silico analysis for finding virus-
RNA derived small interfering RNAs, trans-kingdom RNA silencing, bioinformatics
approach for miRNA validation, ligation-independent cloning strategy for RNAi,
lox-based site-specific integration for multi-gene transformation, hairy root
transformation-based downstream method for effective silencing in roots for target trait
analysis, and an important chapter on the method to reduce off-target silencing in gene-
edited plants.
The salient areas covered in this book include VIGS, designing and delivery of double-
stranded RNAs, identification of virus-derived siRNAs, application of dsRNAs for disease
control, miRNAs, Cre-lox system, and gene editing by CRISPR/Cas9 system.
Ardmore, OK, USA Kirankumar S. Mysore

New Delhi, India Muthappa Senthil-Kumar
v
Contents
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
1 Recent Advances in Plant Gene Silencing Methods. . . . . . . . . . . . . . . . . . . . . . . . . . 1
Prachi Pandey, Kirankumar S. Mysore, and Muthappa Senthil-Kumar
2 Strategies for Efficient RNAi-Based Gene Silencing of Viral Genes
for Disease Resistance in Plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23
Krish K. Kumar, Shanmugam Varanavasiappan, Loganathan Arul,
Easwaran Kokiladevi, and Duraialagaraja Sudhakar
3 Genome Editing and Designer Crops for the Future . . . . . . . . . . . . . . . . . . . . . . . . 37
Sumi Rana, Pooja Rani Aggarwal, Varsa Shukla, Urmi Giri,
Shubham Verma, and Mehanathan Muthamilarasan
4 In Silico Methods for the Identification of Viral-Derived Small
Interfering RNAs (vsiRNAs) and Their Application in Plant Genomics . . . . . . . . 71
Aditya Narayan, Shafaque Zahra, Ajeet Singh, and Shailesh Kumar
5 Barley Stripe Mosaic Virus (BSMV)-Based Virus-Induced Gene Silencing
to Functionally Characterize Genes in Wheat and Barley . . . . . . . . . . . . . . . . . . . . . 85
Harvinder Bennypaul and Upinder S. Gill
6 Virus-Induced Gene Silencing in Wheat and Related Monocot Species . . . . . . . . 95
Vinay Panwar and Kostya Kanyuka
7 Virus-Induced Gene Silencing in Sorghum Using Brome Mosaic Virus . . . . . . . . . 109
Dharmendra K. Singh and Kirankumar S. Mysore
8 RTBV-Based VIGS Vector for Functional Genomics in Rice:
Methodology, Advances, Challenges, and Future Implications . . . . . . . . . . . . . . . . 117
Gaurav Kumar, Kamlesh Kumari, and Indranil Dasgupta
9 Optimization of Tobacco Rattle Virus (TRV)-Based Virus-Induced
Gene Silencing (VIGS) in Tomato . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 133
Ashish Kumar Singh, Dibyendu Ghosh, and Supriya Chakraborty
10 Virus-Induced Gene Silencing for Functional Genomics of Specialized
Metabolism in Medicinal Plants. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 147
Dikki Pedenla Bomzan, Krishna Kumar, Sarma Rajeev Kumar,
Seema Meena, and Dinesh A. Nagegowda
11 VIGS-Based Gene Silencing for Assessing Mineral Nutrient Acquisition . . . . . . . 165
Akash, Rajat Srivastava, and Rahul Kumar
12 High-Throughput Analysis of Gene Function under Multiple Abiotic
Stresses Using Leaf Disks from Silenced Plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181
Ramegowda Yamunarani, Venkategowda Ramegowda,
Muthappa Senthil-Kumar, and Kirankumar S. Mysore
13 A Method for Developing RNAi-Derived Resistance in Cowpea
Against Geminiviruses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191
Sanjeev Kumar, Sunil Kumar Mukherjee, and Lingaraj Sahoo
vii
viii Contents
14 In Vitro Method for Synthesis of Large-Scale dsRNA Molecule

as a Novel Plant Protection Strategy. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 211
Siddappa Sundaresha, Aarti Bairwa, Maharishi Tomar, Ravinder Kumar,
E. P. Venkatasalam, Vinay Sagar, Vinay Bhardwaj, and Sanjeev Sharma
15 Fine-Tuning Plant Gene Expression with Synthetic Trans-Acting
Small Interfering RNAs. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 227
Lucio Lo pez-Dolz, Maria Spada, José-Antonio Daròs, and Alberto Carbonell
16 Trans-Kingdom RNA Silencing in Plant-Fungal Disease Control . . . . . . . . . . . . . 243
Tao Zhang, Fei Wang, Hui-Shan Guo, and Yun Jin
17 An Integrated Bioinformatics and Functional Approach for miRNA
Validation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 253
Sombir Rao, Sonia Balyan, Chandni Bansal, and Saloni Mathur
18 Development of a Ligation-Independent Cloning-Based Dual Vector
System for RNA Interference in Plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 283
Jinping Zhao, Carlos Garcia Rios, Jingjing Xu,
Ijaz Ahmad, and Junqi Song
19 Multigene Transformation Through Cre-lox Mediated Site-Specific
Integration in Rice . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 293
Bhuvan Pathak, Soumen Nandy, and Vibha Srivastava
20 An Improvised Hairy Root Transformation Method for Efficient
Gene Silencing in Roots and Nodules of Arachis hypogaea . . . . . . . . . . . . . . . . . . . 303
Bikash Raul and Senjuti Sinharoy
21 A Method to Reduce off-Targets in CRISPR/Cas9 System in Plants . . . . . . . . . . 317
Ali Movahedi, Zahra Hajiahmadi, Hui Wei, Liming Yang,
Honghua Ruan, and Qiang Zhuge
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 325
Contributors
POOJA RANI AGGARWAL • Department of Plant Sciences, School of Life Sciences, University of
Hyderabad, Hyderabad, Telangana, India
IJAZ AHMAD • Texas A&M AgriLife Research Center at Dallas, Texas A&M University,
College Station, TX, USA
AKASH • Department of Plant Sciences, School of Life Sciences, University of Hyderabad,
Hyderabad, Telangana, India
LOGANATHAN ARUL • Department of Plant Biotechnology, Centre for Plant Molecular Biology
and Biotechnology, Tamil Nadu Agricultural University, Coimbatore, Tamil Nadu, India
AARTI BAIRAVA • Central Potato Research Institute, Shimla, Himachal Pradesh, India
SONIA BALYAN • National Institute of Plant Genome Research, New Delhi, India
CHANDNI BANSAL • National Institute of Plant Genome Research, New Delhi, India
HARVINDER BENNYPAUL • Centre for Plant Health, Canadian Food Inspection Agency, North
Saanich, BC, Canada
VINAY BHARDWAJ • Central Potato Research Institute, Shimla, Himachal Pradesh, India
DIKKI PEDENLA BOMZAN • Molecular Plant Biology and Biotechnology Lab, CSIR-Central
Institute of Medicinal and Aromatic Plants, Research Centre, Bengaluru, Karnataka,
India; Academy of Scientific and Innovative Research (AcSIR), Ghaziabad, Uttar
Pradesh, India
ALBERTO CARBONELL • Instituto de Biologı́a Molecular y Celular de Plantas (Consejo
Superior de Investigaciones Cientı́ficas-Universidad Politécnica de Valencia), Valencia,
Spain
SUPRIYA CHAKRABORTY • Molecular Virology Laboratory, School of Life Sciences, Jawaharlal
Nehru University, New Delhi, India
JOSÉ-ANTONIO DARÒS • Instituto de Biologı́a Molecular y Celular de Plantas (Consejo
Superior de Investigaciones Cientı́ficas-Universidad Politécnica de Valencia), Valencia,
Spain
INDRANIL DASGUPTA • Department of Plant Molecular Biology, University of Delhi South
Campus, New Delhi, India
DIBYENDU GHOSH • Molecular Virology Laboratory, School of Life Sciences, Jawaharlal
UPINDER S. GILL • Department of Plant Pathology, North Dakota State University, Fargo,
ND, USA
URMI GIRI • Department of Plant Sciences, School of Life Sciences, University of Hyderabad,
HUI-SHAN GUO • State Key Laboratory of Plant Genomics, Institute of Microbiology, Chinese
Academy of Sciences, Beijing, China; CAS Center for Excellence in Biotic Interactions,
University of the Chinese Academy of Sciences, Beijing, China
ZAHRA HAJIAHMADI • Department of Biotechnology, Faculty of Agricultural Sciences,
University of Guilan, Rasht, Iran
YUN JIN • State Key Laboratory of Plant Genomics, Institute of Microbiology, Chinese
Academy of Sciences, Beijing, China
KOSTYA KANYUKA • Department of Biointeractions and Crop Protection, Rothamsted
Research, Harpenden, UK
ix
x Contributors
EASWARAN KOKILADEVI • Department of Plant Biotechnology, Centre for Plant Molecular

Biology and Biotechnology, Tamil Nadu Agricultural University, Coimbatore, Tamil
Nadu, India
GAURAV KUMAR • Department of Plant Molecular Biology, University of Delhi South
KAMLESH KUMARI • Department of Plant Molecular Biology, University of Delhi South
KRISH K. KUMAR • Department of Plant Biotechnology, Centre for Plant Molecular Biology
and Biotechnology, Tamil Nadu Agricultural University, Coimbatore, Tamil Nadu, India
KRISHNA KUMAR • Molecular Plant Biology and Biotechnology Lab, CSIR-Central Institute
of Medicinal and Aromatic Plants, Research Centre, Bengaluru, India
RAHUL KUMAR • Department of Plant Sciences, School of Life Sciences, University of
RAVINDER KUMAR • Central Potato Research Institute, Shimla, Himachal Pradesh, India
SANJEEV KUMAR • Department of Biosciences and Bioengineering, Indian Institute of
Technology Guwahati, Guwahati, India
SARMA RAJEEV KUMAR • Molecular Plant Biology and Biotechnology Lab, CSIR-Central
Institute of Medicinal and Aromatic Plants, Research Centre, Bengaluru, India
SHAILESH KUMAR • Bioinformatics Laboratory, National Institute of Plant Genome
Research, Aruna Asaf Ali Marg, New Delhi, India
LUCIO LÓPEZ-DOLZ • Instituto de Biologı́a Molecular y Celular de Plantas (Consejo Superior
de Investigaciones Cientı́ficas-Universidad Politécnica de Valencia), Valencia, Spain
SALONI MATHUR • National Institute of Plant Genome Research, New Delhi, India
SEEMA MEENA • Molecular Plant Biology and Biotechnology Lab, CSIR-Central Institute of
Medicinal and Aromatic Plants, Research Centre, Bengaluru, India
ALI MOVAHEDI • Co-Innovation Center for Sustainable Forestry in Southern China, Key
Laboratory of Forest Genetics and Biotechnology, Ministry of Education, Nanjing Forestry
University, Nanjing, China
SUNIL KUMAR MUKHERJEE • Division of Plant Pathology, Indian Agricultural Research
Institute, New Delhi, India
MEHANATHAN MUTHAMILARASAN • Department of Plant Sciences, School of Life Sciences,
University of Hyderabad, Hyderabad, Telangana, India
KIRANKUMAR S. MYSORE • Institute for Agricultural Biosciences, Oklahoma State University,
Ardmore, OK, USA
DINESH A. NAGEGOWDA • Molecular Plant Biology and Biotechnology Lab, CSIR-Central
Institute of Medicinal and Aromatic Plants, Research Centre, Bengaluru, India; Academy
of Scientific and Innovative Research (AcSIR), Ghaziabad, Uttar Pradesh, India
SOUMEN NANDY • Department of Crop, Soil and Environmental Sciences, University of
Arkansas, Fayetteville, AR, USA
ADITYA NARAYAN • University of Virginia, Charlottesville, VA, USA
PRACHI PANDEY • National Institute of Plant Genome Research, Aruna Asaf Ali Marg, New
Delhi, India
VINAY PANWAR • Department of Biointeractions and Crop Protection, Rothamsted Research,
Harpenden, UK
BHUVAN PATHAK • Department of Crop, Soil and Environmental Sciences, University of
Arkansas, Fayetteville, AR, USA
VENKATEGOWDA RAMEGOWDA • Department of Crop Physiology, University of Agricultural
Sciences, GKVK, Bengaluru, Karnataka, India
Contributors xi
SUMI RANA • Department of Plant Sciences, School of Life Sciences, University of Hyderabad,
SOMBIR RAO • National Institute of Plant Genome Research, New Delhi, India
BIKASH RAUL • National Institute of Plant Genome Research, New Delhi, India
CARLOS GARCIA RIOS • Texas A&M AgriLife Research Center at Dallas, Texas A&M
University, College Station, TX, USA
HONGHUA RUAN • Co-Innovation Center for Sustainable Forestry in Southern China, Key
VINAY SAGAR • Central Potato Research Institute, Shimla, Himachal Pradesh, India
LINGARAJ SAHOO • Department of Biosciences and Bioengineering, Indian Institute of
Technology Guwahati, Guwahati, India
MUTHAPPA SENTHIL-KUMAR • National Institute of Plant Genome Research, New Delhi,
India
SANJEEV SHARMA • Central Potato Research Institute, Shimla, Himachal Pradesh, India
VARSA SHUKLA • Department of Plant Sciences, School of Life Sciences, University of
AJEET SINGH • Bioinformatics Laboratory, National Institute of Plant Genome Research,
Aruna Asaf Ali Marg, New Delhi, India
ASHISH KUMAR SINGH • Molecular Virology Laboratory, School of Life Sciences, Jawaharlal
DHARMENDRA K. SINGH • Institute for Agricultural Biosciences, Oklahoma State University,
Ardmore, OK, USA
SENJUTI SINHAROY • National Institute of Plant Genome Research, New Delhi, India
JUNQI SONG • Department of Plant Pathology and Microbiology, Texas A&M University,
College Station, TX, USA; Texas A&M AgriLife Research Center at Dallas, Texas A&M
University System, Dallas, TX, USA
MARIA SPADA • Instituto de Biologı́a Molecular y Celular de Plantas (Consejo Superior de
Investigaciones Cientı́ficas-Universidad Politécnica de Valencia), Valencia, Spain;
Department of Agriculture, Food and Environment, University of Pisa, Pisa, Italy
RAJAT SRIVASTAVA • Department of Plant Sciences, School of Life Sciences, University of
VIBHA SRIVASTAVA • Department of Crop, Soil and Environmental Sciences, University of
Arkansas, Fayetteville, AR, USA; Department of Horticulture, University of Arkansas,
Fayetteville, AR, USA
DURAIALAGARAJA SUDHAKAR • Department of Plant Biotechnology, Centre for Plant
Molecular Biology and Biotechnology, Tamil Nadu Agricultural University, Coimbatore,
Tamil Nadu, India
SIDDAPPA SUNDARESHA • Central Potato Research Institute, Shimla, Himachal Pradesh,
India
MAHARISHI TOMAR • Central Potato Research Institute, Shimla, Himachal Pradesh, India
SHANMUGAM VARANAVASIAPPAN • Department of Plant Biotechnology, Centre for Plant
Molecular Biology and Biotechnology, Tamil Nadu Agricultural University, Coimbatore,
Tamil Nadu, India
E. P. VENKATASALAM • Central Potato Research Institute, Shimla, Himachal Pradesh, India
SHUBHAM VERMA • Department of Plant Sciences, School of Life Sciences, University of
xii Contributors
FEI WANG • State Key Laboratory of Plant Genomics, Institute of Microbiology, Chinese
HUI WEI • Co-Innovation Center for Sustainable Forestry in Southern China, Key
JINGJING XU • Zhejiang Academy of Agricultural Sciences, Hangzhou, China
RAMEGOWDA YAMUNARANI • Department of Crop Physiology, University of Agricultural
Sciences, GKVK, Bengaluru, Karnataka, India
LIMING YANG • Co-Innovation Center for Sustainable Forestry in Southern China, Key
SHAFAQUE ZAHRA • Bioinformatics Laboratory, National Institute of Plant Genome
Research, Aruna Asaf Ali Marg, New Delhi, India
TAO ZHANG • State Key Laboratory of Plant Genomics, Institute of Microbiology, Chinese
JINPING ZHAO • Texas A&M AgriLife Research Center at Dallas, Texas A&M University,
College Station, TX, USA
QIANG ZHUGE • Co-Innovation Center for Sustainable Forestry in Southern China, Key
Chapter 1
Recent Advances in Plant Gene Silencing Methods

Prachi Pandey, Kirankumar S. Mysore, and Muthappa Senthil-Kumar
Abstract
With the increasing understanding of fundamentals of gene silencing pathways in plants, various tools and
techniques for downregulating the expression of a target gene have been developed across multiple plant
species. This chapter provides an insight into the molecular mechanisms of gene silencing and highlights the
advancements in various gene silencing approaches. The prominent aspects of different gene silencing
methods, their advantages and disadvantages have been discussed. A succinct discussion on the newly
emerged microRNA-based technologies like microRNA-induced gene silencing (MIGS) and microRNA-
mediated virus-induced gene silencing (MIR-VIGS) are also presented. We have also discussed the gene-
editing system like CRISPR-Cas. The prominent bottlenecks in gene silencing methods are the off-target
effects and lack of universal applicability. However, the tremendous growth in understanding of this field
reflects the potentials for improvements in the currently available approaches and the development of new
widely applicable methods for easy, fast, and efficient functional characterization of plant genes.
Key words Gene silencing methods, Transcriptional gene silencing, Posttranscriptional gene silenc-
ing, Gene editing
1 Introduction
The field of functional genomics is expanding with new tools and

technologies being introduced at a rapid scale. Understanding gene
functions through “knocking-out” or “knocking-down” using
approaches like T-DNA insertion mutagenesis, transposon-
tagging, recombination, RNA interference (RNAi), virus-induced
gene silencing (VIGS) and clustered regularly interspaced short
palindromic repeats (CRISPR)-associated proteins 9 (CRISPR-
Cas9) have been successfully employed in various organisms.
Among all the tools and technologies of functional genomics,
gene silencing is one of the most popular approaches for studying
the function of genes. Gene silencing involves suppressing gene
expression in an organism by either repressing its transcription
(transcriptional gene silencing or TGS) or by degrading its
corresponding mRNA after transcription (the process is known as
Kirankumar S. Mysore and Muthappa Senthil-Kumar (eds.), Plant Gene Silencing: Methods and Protocols,
Methods in Molecular Biology, vol. 2408, https://doi.org/10.1007/978-1-0716-1875-2_1,
1
2 Prachi Pandey et al.
posttranscriptional gene silencing or PTGS) [1–3]. Few examples

of TGS are RIP (Repeat-Induced Point mutation) [4] and MIP
(Methylation Induced Premeiotically) [5] in fungi, silencing of
transgenes in plants and co-suppression in animals [2]. The charac-
teristic examples of PTGS are quelling in Neurospora crassa [6],
RNA interference (RNAi), and VIGS in plants. Recently tools like
CRISPR [7] and Transcription activator-like Effector Nucleases
(TALENS) [8] for knocking out a gene in an organism have also
been developed. This chapter highlights the mechanism of TGS
and PTGS and provides an overview of the currently available gene
silencing methods utilized for understanding their function and
regulations. A brief discussion on the newly emerged gene-editing
tools such as CRISPR and TALENS have also been provided. In
addition, we also provide a comparison of the various gene silenc-
ing/editing tools highlighting their merits, demerits, and applica-
bility in plant science.
2 Posttranscriptional and Transcriptional Gene Silencing
TGS occurs by chromatin re-modeling and DNA methylation [9].

PTGS, on the other hand, occurs either by the degradation of
mRNA or translational inhibition. Both TGS and PTGS have
been reported to be mechanistically related [10–12]. For example,
both PTGS and TGS produce small interfering RNAs (siRNAs)
that play a major in gene silencing. In the section below, we discuss
the mechanism and components of TGS and PTGS pathways in
plants.
2.1 Components The basic components of PTGS consist of the small regulatory
and Mechanism RNAs, Dicers and Argonaute (AGO) proteins. Small RNAs are
of Posttranscriptional 18–24 nucleotide long double-stranded RNAs which are either
Gene Silencing (PTGS) produced endogenously from their longer precursors or can be
triggered in response to exogenous signals like transgenes or viral
double-stranded RNAs (dsRNAs). Dicers are RNase III type endo-
nucleases required for the biogenesis of small RNAs and the RNA-
induced silencing complex (RISC) assembly. AGO proteins are
highly specialized small RNA-binding proteins having a variable
N-terminal and a PIWI/Argonaute/Zwille (PAZ), Mid and P-
element-induced whimpy tested (PIWI) domain with RNAse H
like endonuclease activity at the carboxy terminal [13].
PTGS is characterized by some core steps of “slicing and dic-
ing,” the first step being the generation of small RNA precursors.
The pre-siRNAs transcribed via RNA polymerases (II/IV) are
recognized by Dicers that specifically cleave pre-siRNAs into
shorter dsRNA with a 50 phosphate and a 2 nucleotides
(nt) overhang at the 30 end. These 2 nt overhangs are recognized
by PAZ domain of AGO proteins and loaded onto the RISC
Recent Advances in Plant Gene Silencing Methods 3
complex following the ATP dependent unwinding of the RNA

duplex and degradation of one of the strands (i.e., passenger
strand). The RISC complex, which contains the remaining strand
(i.e., guide strand) and the RNA-binding AGO protein, targets the
siRNA and is responsible for the cleavage of target mRNA. All the
different small RNAs, though they have the same mechanism of
biogenesis and silencing, require different Dicer and AGO proteins.
The section below provides a brief outline of the different types of
small RNAs and their roles in plants.
2.1.1 siRNAs Although initially plant siRNAs were only associated with defense
against viruses and transgenes [13–15], further research showed
the endogenous production of siRNAs [16–19]. The endogenous
siRNAs are primarily derived from repetitive DNA sequences in
heterochromatic regions, centromeres, transposons, and expressed
pseudogenes [20], whereas the exogenous siRNA production is
known to be triggered by either a transgene or a viral infection.
The different subtypes of siRNAs are discussed here.
Endogenous siRNA Till date, several forms of endogenous siRNAs like trans-acting
siRNAs (tasiRNAs), natural antisense siRNAs (nat-siRNAs),
endogenous inverted repeat siRNAs (endoIR-siRNAs), cis-acting
siRNAs (casiRNAs), and DNA double-strand break-induced small
RNAs (diRNAs) have been identified [21]. Nat-siRNAs are pro-
duced from dsRNA precursors originating from overlapping
regions of antisense transcript pairs. The nat-siRNAs are further
subdivided into two categories: cis-nat-siRNAs and trans-nat-siR-
NAs. The cis-nat-siRNAs are derived from natural antisense tran-
scripts present on the opposite strands of the same DNA locus. The
classic example of cis-nat-siRNAs are 24 nt siRNAs generated by
the antisense overlapping of Delta (1)-pyrroline-5-carboxylate dehy-
drogenase (P5CDH) and Similar to Radical-induced cell death
(RCD) One 5 (SRO5) gene pairs [17]. Trans-nat-siRNA, on the
other hand, are produced from two overlapping transcripts in two
different genomic loci. The biogenesis and processing of both cis
and trans-nat-siRNAs employ dicer like 1 (DCL1) and/or DCL3
[22], RNA dependent RNA polymerase (RDR6), and Polymerase
IV (PolIV) proteins. Nat-siRNAs are known to be involved in
development [23, 24] and in defense against abiotic and biotic
stresses [17, 18, 25].
EndoIR-siRNAs are derived from single-stranded hairpin
RNAs (hpRNAs) that are transcribed from different genomic loca-
tions. These precursors form duplexes with perfect or near-perfect
complementarity and are processed by DCL 2, 3, and 4 proteins to
generate 21, 22, and 24 nt endoIR-siRNAs [26] that can induce
local and systemic RNA silencing.
tasiRNAs belong to the category of secondary siRNAs, which

are generated from noncoding trans-acting siRNA (TAS) tran-
scripts. The generation of tasiRNAs is triggered by miRNAs that
bind on specific miRNA-binding sites in the TAS transcripts
[27, 28]. A. thaliana has four types of TAS loci (TAS1–4) targeted
by different miRNAs. For example, miR173 targets TAS1a/b/c
and TAS2 loci. TAS3a/b/c and TAS4 loci are targeted by miR390
and miR828, respectively [29]. Cleaved transcripts act as templates
for RDR6-mediated dsRNA synthesis and the subsequent genera-
tion of 21- and 22-nucleotide siRNAs by DCL4 and DCL2, respec-
tively. These siRNAs can function in trans to silence other
transcripts. These secondary siRNAs are generated in a “phased”
pattern so that the cleavage occurs after every 21 or 22 nucleotides
from the miRNA-directed cleavage site. RNA Pol II transcribes the
TAS genes into long noncoding RNAs, which are then transferred
to miRNA-AGO (mir390/AGO7; mir173/828-AGO1) complex
by transcription export (TREX) protein complex [30–32] and
cleaved. The RNA-binding suppressor of gene silencing 3 (SGS3)
protein stabilizes the cleaved pre-tasiRNA transcripts by inhibiting
them from degradation and facilitating the recruitment of proteins
like RDR6 that in conjunction with RNA export factor and silenc-
ing defective 5 (SDE5) catalyzes the formation of double-stranded
pre-tasiRNAs [28, 33, 34]. This is followed by the recruitment of
double-stranded RNA-binding protein 4 (DRB4), and DCL4
mediated processing of the cleaved dsRNA into 21 nt secondary
siRNAs in a phased manner [35–37]. The tasiRNAs, which are then
loaded onto the RISC complex, target the corresponding mRNAs
and cleave them. The silencing via these phased tasiRNAs forms the
basis of the recently developed miRNA-induced gene silencing
(MIGS) approach [38].
Interestingly double-stranded breaks (DSB) also induce small
RNA production from the sequences near the DSB sites [39]. The
biogenesis of diRNAs requires RNA pol IV, Ataxia telangiectasia-
mutated and Rad3-related (ATR) phosphatidylinositol 3 kinase-like
(PI3K), and DCL2, 3 and 4 proteins. The diRNAs are recruited by
AGO2 and affect events downstream of Histone 2A variant
(H2AX) phosphorylation [39].
siRNAs Induced by The production of siRNAs in plants is also induced by foreign

Foreign DNA molecules like viral RNAs or transgenes. Both the exogenously
induced and endogenous siRNAs follow the same basic mechanism
of silencing. PTGS mediated by virus-induced siRNAs forms the
basis of VIGS wherein some parts of the viral genome are replaced
with the gene to be silenced, and the engineered virus is infiltrated
into plants to activate PTGS and silence the target gene [40–43,
50].
2.1.2 miRNA miRNAs are 20–23-nt small endogenous RNAs that are known to
regulate the expression of many genes. The first step of miRNA
biogenesis is the generation of the long primary miRNA
(pri-miRNA) transcript by RNA polymerase II or III. The
pri-mRNAs are capped and polyadenylated and have an imperfectly
paired stem and terminal loop [44, 45]. The pri-mRNAs are
cleaved by “microprocessor complex,” constituted by proteins
named Drosha and DiGeorge Syndrome Critical Region
8 (DGCR8) to generate the precursor-miRNA (pre-miRNA).
This is followed by migration of the pre-miRNA in a Ras-related
nuclear GTP (RanGTP) dependent manner by Exportin 5 into the
cytoplasm where they are processed into 22 nt mature miRNA
duplex after excision of their stem and terminal loop by DCL1-
dsRNA-binding (dsRBD) protein complex and RNase III enzyme
[45]. Thereafter, one of the strands of the miRNA is loaded onto
AGO proteins to form the “miRNA-induced silencing complex”
(miRISC). The miRISC binds to the target mRNAs having
sequence complementarity with the miRNAs. This is followed by
removal of the m7G cap on target mRNA that is caused by proteins
namely poly(A)-deadenylases, poly-A nuclease 2/3 (PAN2/3), and
carbon catabolite repression 4-negative on TATA-less (CCR4-
NOT) proteins that are recruited by Glycine-tryptophan
182 (GW182) family proteins bound to AGO2. Finally, the dec-
apped mRNA undergoes 50 to 30 degradation by exoribonuclease
1 (XRN1) [46]. PTGS based on miRNAs forms the basis of artifi-
cial miRNA-mediated gene silencing [47].
2.2 Components The triggers of TGS are aberrant dsRNAs that are generated either
and Mechanisms by RNA dependent RNA polymerase 2 (RDR2) mediated replica-
of Transcriptional tion of single-stranded RNAs or transcription of inverted repeats by
Gene Silencing (TGS) RNA Pol II dsRNA [48–50, 60]. The dsRNAs are processed into
24-nt siRNAs by DCL3 [48, 50, 51] and stabilized by Hua (mean-
ing flower in Chinese) Enhancer 1 (HEN1) by 30 -terminal ribose
methylation [52]. The siRNAs are then loaded on the AGO4/6
complex for recognition of complementary scaffold RNA, which
are the characteristic features of TGS. This is followed by the
recruitment of DNA methyltransferases to the target loci that
causes DNA methylation [53]. In plants, domain rearranged
methyltransferase 2 (DRM2) is the primary DNA methylation
protein [53, 54]. The dense methylation of promoters and trans-
genic regions induces heterochromatin formation and TGS
[54, 55]. An example of TGS is the local hypermethylation of
cytosines and di methylation of Histone 3(H3) at the ninth lysine
(H3K9me2) that shifts chromatin into a repressive state [50].
3 Methods of Gene Silencing
Numerous methods have been developed for PTGS and TGS based
on tasiRNAs, miRNAs, and hpRNAs. The different methods of
gene silencing are discussed below.
3.1 Post- Gene silencing based on hairpin (hp) is currently the most popular
transcriptional Gene among all gene silencing techniques. The hp. constructs are devel-
Silencing (PTGS) oped by annealing sense and antisense fragments of the target gene
Based Approaches separated by a “spacer” sequence that folds back to form an hp-like
structure. After cloning into a suitable vector, and transforming
3.1.1 Hairpin RNAi into plants, these constructs are known to induce effective gene
silencing. A classic example of hpRNAi-based vector is pHANNI-
BAL, which has a hpRNA encoding sequence downstream to which
the target sequence can be cloned to achieve the specific silencing of
the target genes [56]. With time, series of improvements were
introduced to the vector one of which consisted of introducing a
functional intron between the RNA arms to enhance the stability of
the hpRNA (intron spliced hpRNAi; ihpRNAi) [68]. As a further
advancement to facilitate large scale cloning, GATEWAY compati-
ble hpRNA vectors like pIPK (pIPK006–0010), p HELLSGATE (p
HELLSGATE 4, 8, 12), and pANDA have been developed
[57]. Since the development of hpRNAi constructs was still
tedious, vectors employing one-step ligation independent cloning
(pRNAi-LIC) [58] and type II restriction enzyme-based cloning
(pRNAi-golden gate; pRNAi-GG) [59] were developed. Another
advancement to this method is the development of inducible
hpRNAi vectors. An example of this is the pOpOff family of induc-
ible vectors, which consist of LhGR/pOp6 components intro-
duced in p HELLSGATE hpRNAi vectors. The dexamethasone
inducible pOpOff2 vector was reported to efficiently silence Acetyl-
CoA carboxylase gene in Medicago truncatula roots [60].
The knocking down of gene expression using the hpRNAi
vectors employs the following basic steps. The first step of hpRNAi
involves target gene primer designing with suitable restriction sites.
The second step employs PCR amplification of the target gene
using the primers followed by cloning of the amplified inserts
(200–350 bp) into hpRNAi vectors. The construct is then mobi-
lized and transformed into plants. This is followed by screening the
transgenics based on phenotype and reduction in transcript
abundance.
3.1.2 Virus-Induced Gene VIGS employs plant’s antiviral defense mechanisms characterized
Silencing (VIGS) by siRNA mediated PTGS. In VIGS, a modified virus containing a
fragment of the gene to be silenced is introduced into the plant that
leads to the production of dsRNAs complementary to the gene,
subsequently triggering PTGS. Since the development of the first
viral vectors based on Potato Virus X (PVX), Tobacco mosaic virus

(TMV), and Tobacco rattle virus (TRV) [47, 61], many different
DNA and RNA virus vectors suitable for several monocots and
dicots have been used for demonstrating VIGS-mediated targeted
plant gene silencing [42].
TRV-VIGS has been employed in a number of plant species,
although it has been shown to function most efficiently in Solana-
ceae species, especially in Nicotiana benthamiana [43, 62]. The
primary step in TRV-VIGS is selecting a region from the candidate
gene that produces minimum off-targets. The chosen gene frag-
ments are cloned into a suitable viral vector. The viral vector can be
introduced into the plants by a number of methods like rub inocu-
lation, agroinfiltration, and syringe inoculation [43]. After
15–20 days, the plants are analyzed phenotypically and at molecular
levels for downregulation of target genes by measuring the viral
titer and the transcript expression using RT-qPCR.
With numerous advantages over the other gene silencing meth-
ods, VIGS has been utilized to perform high throughput forward
genetics screenings [23, 42, 63]. VIGS can be used to silence a
specific gene or a gene family by carefully selecting regions for gene
silencing. While unique regions of a gene can be targeted for highly
specific silencing, downregulation of a family of genes can be
achieved by targeting conserved domains of the gene to overcome
functional redundancy [63, 64]. Moreover, VIGS can be employed
for functional characterization of physiologically important genes
whose loss of function can be lethal to plants. Since full-length gene
sequence is not needed for VIGS, even sequence information from
ESTs can be utilized for silencing endogenous genes [65]. Another
advantage of VIGS is the avoidance of positional effects that are
generated by mutants. Moreover, multiple gene interactions can be
easily studied by performing VIGS in mutants and over-expressing
lines [66].
3.1.3 MicroRNA-induced MicroRNA-induced gene silencing (MIGS) is a newly developed

Gene Silencing (MIGS) method that silences the target genes via tasiRNAs triggered by
miR173 [38, 67] using specially developed GATEWAY ready plant
transformation MIGS vectors (MIGS1–5) [38]. For MIGS in a
plant, gene fragments of size 200–500 bases are used. For efficient
gene silencing, it is advisable to use fragments from non-conserved
regions of the gene such that they produce the least number of
off-targets. The next step is to clone the gene in the MIGS vector
and transform them into plants by suitable plant transformation
methods. The primary transformants selected are thereafter sub-
jected to molecular screening. miR173 is exclusively found in
A. thaliana and its close relatives, which implies that the successful
establishment of MIGS needs co-expression along with target
genes in other plants. Several vectors are created for inducing
MIGS in different systems. For example, miR173 co-expressing

MIGS vectors (MIGS2–4) for plants lacking endogenous miR173
are available [38]. Also, a promoter-less and completely customiz-
able MIGS5 vector which can be used for silencing in cases where
constitutive gene downregulation leads to lethal effects are available
[38]. Cloning a tissue-specific or an inducible promoter upstream
to miR173 expression, as well as target gene cassette, can be helpful
in such cases [38]. MIGS has been employed in plant species like
A. thaliana [68], Nicotiana benthamiana [38], Cardamine flex-
uosa [69], Capsella grandiflora [70], Petunia hybrida [71], and
Oryza sativa [72] to downregulate the expression of different
genes.
Since miR173 induced tasiRNAs are generated in a phased
manner, the tasiRNAs can be predicted using in silico tools like
pssRNAMINER (http://bioinfo3.noble.org/pssRNAMiner/)
[73], tasiRNAdb (http://bioinfo.jit.edu.cn/tasiRNADatabase/)
[74] and SoMART (http://somart.ist.berkeley.edu/) [75]. This
gives MIGS an added advantage over other RNAi methods in
lowering off-target silencing. Moreover, this method can be used
to downregulate the expression of multiple genes cloned next to
each other in the same vector. These added advantages expand the
usefulness and applicability of MIGS.
3.1.4 Artificial Also called “miRNA shuttles,” artificial microRNAs (amiRNA) are
microRNAs small RNAs that mimic the pri-miRNA. These miRNAs are engi-
neered by replacing the miRNA/miRNA* (* refers to the antisense
strand) sequences in the hairpin stem-loop duplex with artificial
sequences. Due to the ease of introducing base changes in stem-
loop precursor, miRNA families like A. thaliana mir159a,
miR167b, miR169d, miR171a, miR172a, Oryza sativa miR528,
and miR395 have been preferentially used for amiRNA-mediated
gene silencing. Examples of vectors constructed for amiRNA-
mediated gene silencing are pAMIR319a and pAMIR395a based
on miR319a and miR395a, respectively [76]. New improved vec-
tors like AtMIR390a-B/c that employ positive insert selection are
suitable for handling high throughput libraries [77].
amiRNA-based gene silencing protocol consists of a few funda-
mental steps, the first one being the identification and prediction of
precursor amiRNAs. Thereafter, bioinformatics tools like WMD3
(www.wmd3.weigelworld.org/cgi-bin/webapp.cgi) [78] and
miR-Synth (microrna.osumc.edu/mir-synth) [79] can be used to
generate the candidate miRNAs with minimal off-targets. The
miRNA candidate is inserted into the miRNA precursor and cloned
into suitable vectors and transformed or transfected into plants
[47, 80]. amiRNA-mediated silencing has been successfully used
in a number of cases. For example, the approach has been applied to
decipher the mechanism of flowering and associated genes in
A. thaliana wherein silencing of Flowering time (FT) gene was

achieved by transforming the plants with amiRNA corresponding
to the gene. Since their discovery, amiRNAs have found tremen-
dous application in crop biotechnology and have been used to
engineer plants with improved traits and resistance against patho-
gens [81–83].
3.1.5 VIGS Using Artificial MIR-VIGS, a conjunction of amiRNA and VIGS is a newly devel-
miRNAs (MIR-VIGS) oped gene silencing technique wherein silencing is achieved by viral
vectors that deliver amiRNAs into plants [84, 85]. The selection of
the plant miRNA that targets the gene to be silenced is the first step
of MIR-VIGS. In cases where endogenous miRNA is not present,
amiRNA can be designed. Bioinformatic tools like WMD3 can be
employed to design amiRNA precursor sequences. The designed
amiRNA precursors can then be cloned into suitable MIR-VIGS
vectors. Two Cabbage leaf curl virus-based vectors, namely
pCPCbLCVA.007 and pCPCbLCVB.002 have been developed
for MIR-VIGS [84]. These vectors can be transformed into plants
by syringe infiltration. After being introduced into plants, the
amiRNA precursors are processed into mature amiRNAs that
silence the endogenous target genes. The transformants are then
screened phenotypically and physiologically. At molecular levels,
the presence of mature miRNAs is checked by techniques like
stem-loop PCR.
MIR-VIGS has been used to silence Salicylic acid glucosyltrans-
ferase (SGT), and Sulfur desaturase (SU) genes in N. benthamiana
[85]. The advantages of MIR-VIGS over the traditional siRNA
based VIGS are more specificity and less off-target effects.
Additionally, the Cabbage leaf curl geminivirus (CbLCV)-based
MIR-VIGS methods do not require the tedious plant
transformation-based protocols and can be used to knockdown
genes through simpler methods like agro-inoculation [84].
3.1.6 Host-induced Gene Host-induced gene silencing (HIGS) is a cross-kingdom RNAi

Silencing (HIGS) strategy developed to silence the conserved pathogen genes by
the host plants. This silencing method is based on the transitivity
of sRNA, which can move from host plants to pathogen cells and
silence their corresponding targets [86, 87]. siRNAs derived from
host plants have been successfully used to silence fungal [86–89],
viral [90], nematode, and insect pest-specific genes [91–95,
97]. The mechanism of HIGS has been demonstrated in
A. thaliana–Botrytis cinerea pathosystem wherein it was demon-
strated that the delivery of host plant sRNAs into the fungal cells
occurs via exosome-like vesicles. The vesicles containing siRNAs
aggregate at the infection sites and are taken up by the fungi. These
siRNAs thereafter induce silencing of their corresponding target
genes [96].
The preliminary step for HIGS consists of the identification of

the target pathogen gene. The targets suitable for HIGS are the
native pathogen genes that are not homologous to plant gene.
Once identified, the genes or gene fragments are cloned in VIGS
or ihpRNA vectors and then transformed into plants. Transfor-
mants are later screened and analyzed by various molecular and
physiological methods.
HIGS have been successfully demonstrated in several plant
pathosystems. For example, HIGS-based expression of a dsRNA
targeting nematode specific gene 16D1 in A. thaliana made the
plants resistant to four root-knot nematode species [91]. HIGS can
also be used to silence multiple pathogen genes in the host plant.
For example, 16 out of the 76 RNAi constructs harboring Blu-
meria graminis (causal agent of powdery mildew) genes when
introduced in barley, resulted in reduced pathogen growth in the
host plant [86]. VIGS-mediated expression of dsRNA
corresponding to Puccinia striiformis f. sp. tritici transcript
(PSTha12J12) in wheat led to the silencing of the corresponding
gene in haustoria of P. striiformis f. sp. tritici [98]. Ghag et al. [89]
used ihpRNAi vectors to show that ihpRNA-mediated silencing of
two fungal genes lead to resistance against Fusarium oxysporum
f. sp. cubense (causal agent of Fusarium wilt in banana).
3.1.7 Other Methods In addition to RNAi, DNA interference or DNAi has also emerged
as a tool for gene silencing. DNAi in plants involves sequence-
specific gene downregulation induced by promoter-less dsDNA
[99–102]. Silencing of genes by DNAi follows simple steps of
PCR amplification of the target followed by cloning and introduc-
tion of plasmid harboring the promoter-less, full-length
corresponding to the target gene into plants by suitable transfor-
mation method. The transgenic plants are then screened and ana-
lyzed for the silencing effect. Tsuboi et al. used DNAi to deliver
dsDNA sequence of Adiantum capillus-veneris Phototropin2
(AcPHOT2) gene into gametophytic cells of the fern by particle
bombardment to induce sequence-specific gene silencing
[101]. Similar to RNAi, DNAi-mediated gene silencing is systemic,
and leads to heritable gene silencing.
Several other methods of gene downregulation have been tried
and tested in various plants. Silencing of target genes via direct
delivery of sRNA using infiltration (spray induced gene silencing)
and biolistic delivery has also been also reported in some cases
[102]. To overcome the challenges of conventional plant transfor-
mation methods, a lot of other new methods of gene delivery in
plants have emerged. Synthetic peptides have emerged as potential
carriers of dsRNA into plants because of their ability to efficiently
bind the DNA and RNA molecules, to penetrate the cells and
escape endosomes. Numata et al. used a fusion peptide consisting
of an 18 amino acid copolymer of histidine and lysine (HK9) and

cell-penetrating peptide (CPP) named as Bp100 to deliver dsRNA
carrier into A. thaliana [103]. The peptide-based protocol involves
the synthesis of peptide carrier by solid-phase peptide synthesis and
dsRNA by in vitro transcription. The mixture of the peptide and
dsRNA are incubated to form the dsRNA-peptide complex, which
after secondary structure examination by techniques like atomic
force microscopy and circular dichroism, is introduced into plants
by a suitable gene delivery method (e.g., syringe infiltration). The
plants transformed with the peptide-dsRNA complex are screened
for the silenced phenotypes. The HK9_BP100-dsRNA complex
was successfully infiltrated into A. thaliana leaves to induce silenc-
ing of marker genes [103]. This method can be used to induce
tissue-specific silencing to study the function of genes whose down-
regulation is lethal to the plants.
Another newly emerged method of silencing in plants is the
delivery of dsRNA in plants using nanoparticles or carbon nano-
tubes. Silva et al. reported that “conjugated polymer nanoparticles”
can effectively deliver siRNAs into BY2 protoplasts and silence
tobacco Cellulase synthase 1 (CesA-1) gene thus reducing cell wall
biosynthesis during the early stages of protoplast formation
[104]. Another major step in the field of nanoparticle-mediated
delivery of siRNAs in plants is the development of single-walled
carbon nanotubes (SWNTs). Demirer et al. used SWNT-based
siRNA delivery for the silencing of Recognition of XopQ 1
(ROQ1), an endogenous gene of N. benthamiana. The use of
SWNT-based method also helped in fluorescent tracking of the
small RNA molecules in plant tissues [105].
3.2 Transcriptional sRNAs triggered from viral vectors or inverted repeat sequences in
Gene Silencing the plant genome have also been shown to induce gene silencing at
Methods the transcriptional level by causing sequence-specific methylation of
DNA. Virus-induced transcriptional gene silencing (VITGS) has
been observed in plants using viral RNA vectors like Cucumber
mosaic virus (CMV), Potato virus X (PVX), TRV, Apple latent
spherical virus (ALSV) and satellite DNA vector-like Tomato yellow
leaf curl China virus (TYLCCV) [106–108]. The protocol involves
the cloning of a fragment of the promoter (~500 bp) of the target
gene into the viral vector and introducing this construct into plants
via agroinfiltration. Otagaki et al. developed a CMV vector that
targets the coding and promoter regions of the transgene and
rapidly induces sequence-specific gene silencing of the
transgene [106].
Additionally, inverted repeats homologous to promoter
sequences of the target genes can also induce TGS [109]. This
method involves cloning of genomic fragment (~500 bp) of gene
promoter as inverted repeats (IR) in a plant transformation vector.
After transformation of plants with this construct, the transgenic
plants are analyzed for DNA methylation. Mette et al. [109] intro-
duced a construct containing inverted repeat (IR) of Nopaline
synthase (nptII) promoter (NOSpro) downstream to CaMV 35S
promoter in tobacco lines containing NOSpro-npt II cassette and
observed methylation of the promoter and the subsequent silenc-
ing of the downstream nptII gene [109]. IR constructs containing
different regions of the Granule bound starch synthase I (GBSSI)
promoter were also shown to induce TGS of the corresponding
gene [110]. Similarly, transcriptional silencing of Male-sterile 45
(Ms45) gene was found to be induced by IR of its promoter
sequences [111]. Deng et al. showed silencing of four
A. thaliana genes using inverted repeat regions and antisense
single-stranded silencers targeting promoter sequence of Too
Many Mouth (TMM) gene [112]. Wakasa et al. [113] also success-
fully induced RNA-directed DNA methylation and subsequently
TGS of several rice endogenous genes by expressing dsRNA of the
corresponding promoters in rice plants.
4 Limitations of the Gene Silencing Methods
All the currently available PTGS and TGS methods have their own
advantages and limitations (Table 1). Among all the other limita-
tions, off-target silencing is the most common. Off-target silencing
may result in undesirable phenotypes that greatly decrease the
efficiency of the gene silencing methods. A number of factors
contribute to the silencing of the “off-target,” the significant ones
being the size of the dsRNA [114], the concentration of dsRNA
[115] and the nature of promoter driving the expression of the
siRNAs, especially the hpRNAs [116]. Careful selection of the
trigger sequence and having a regulated expression of the siRNAs
of suitable lengths can help in minimizing the off-target silencing.
With the advent of in silico technologies in biology, a number of
prediction tools have been developed that aid in selecting suitable
regions of target genes that minimum off-targets [116, 117]. Some
other limitations associated with PTGS and TGS methods are the
dependence of the majority of these methods on plant transforma-
tion for the introduction siRNAs into plants. Although, this limita-
tion is being overcome by the development of alternate delivery
methods like particle bombardment, infiltration, petiole absorp-
tion, trunk injection, and high-pressure spraying in various plants
(reviewed in [118]). The other disadvantage with PTGS is the
partial loss of function of the gene and virus-associated alterations
in the metabolism of plants in the case of VIGS [41]. However,
these limitations can be overcome by using proper controls.
Table 1
List of various gene silencing methodsa
Size of Method of
Mechanism of sRNAs trigger delivery in Off- Specific
Methods action involved (bp) plants targets advantages Short comings References
hpRNAi PTGS siRNAs 250–350 Vector More Efficient Off-targets, dependence on plant [56, 58]
mediated/ transformation
plant
transformation
Artificial PTGS miRNAs – Vector Less Specificity, Time consuming, dependence on [47, 81]
miRNAs mediated/ heritable, tissue- plant transformation
plant specific
transformation expression
VIGS PTGS siRNAs 200–500 Virus-mediated More Quick Off-targets, transient, virus [40, 42,
TGS siRNAs vacuum interference with plant metabolism 132]
infiltration
MIGS PTGS tasiRNAs 200–500 Vector Less Heritable Depends on plant transformation, [38]
mediated/ miR173 overexpression needed
plant
transformation
atasiRNA PTGS tasiRNAs – Vector Less Specificity Dependence on plant transformation [133]
mediated/
plant
transformation
MIR- PTGS miRNAs – Virus-mediated Less Heritable Virus interference with plant [84]
VIGS and vacuum metabolism
siRNAs infiltration
HIGS PTGS siRNAs – Infiltration/ No off- Specificity Tedious, silencing efficiency [86–91]
plant targets
Recent Advances in Plant Gene Silencing Methods
transformation in host
(continued)
13
14
Table 1
Prachi Pandey et al.
(continued)
Size of Method of
Mechanism of sRNAs trigger delivery in Off- Specific
Methods action involved (bp) plants targets advantages Short comings References
Carrier PTGS siRNAs <100 Using carrier Relatively No transformation Stability [103]
peptide- peptide more
dsRNA
DNAi TGS DNA ~500 Particle – – [101]
bombardment
CRISPR- Genome – Vector Present Convenient and Off-target effects, dependence on [119, 121]
Cas editing and mediated/ easy, wide plant transformation, packaging in
gene plant applicability viral vectors difficult
regulation transformation
a
This table is modified from Pandey et al. [134]
4.1 Gene Editing Since its discovery in 2012 [7], the technique of CRISPR-Cas has
Using CRISPR-Cas revolutionized both agricultural and biomedical research. CRISPR
refers to Clustered Regularly Interspaced Palindromic Repeats that
were first reported in Escherichia coli isoenzyme of Alkaline phos-
phate (IAP) gene [119]. CRISPR is based on homology dependent
cleavage and consists of two major components namely, a 20 nt
guide RNA (gRNA) that bind to DNA and a CAS9 endonuclease
protein. The gRNA directs Cas9 to target sequence complementary
to the 20 nt present upstream to the protospacer-associated motif
(PAM) “NGG.” The double-strand breaks induced by Cas-9 are
repaired predominantly by non-homologous end joining (NHEJ).
NHEJ is a highly efficient but an error prone repair pathway and
generates high frequency of insertion or deletion mutations.
This CRISPR-Cas9 based gene-editing system was first demon-
strated in mammalian cells in 2012 [7]. Since then, there have been
more than 300 reports of CRISPR-Cas9 based gene editing in
A. thaliana and more than 5000 reports in all organisms which
indicates its enormous applicability [120]. According to a recent
classification, CRISPR-Cas system is divided into two classes, six
types, and 33 subtypes [121]. Genome editing in plants is based on
type II CRISPR/Cas system and has been successfully used to edit
genomes in several plants (reviewed in [122]).
CRISPR gene-editing system follows the following fundamen-
tal steps [122], the first being designing the gRNAs to target the
gene of interest. This involves choosing the target sites and design-
ing the gDNA spacer sequence. Specific databases like CRISPR-
PLANT database [123] (http://www.genome.arizona.edu/crispr)
can be helpful for designing the gRNA for many plants. Some
considerations should be followed while designing the spacer
sequence like the introduction of double-strand breaks close to
the 50 end of the coding region by the gRNAs. Moreover, the
gRNAs should be highly specific to avoid the silencing of
off-target genes. This is followed by designing oligos for the
gRNAs with proper adapter sites (50 -AAAC-30 for reverse and
50 -GGCA-30 for forward primers). The second step is the construc-
tion of gRNA-Cas9 plasmid, which involves digesting a suitable
CRISPR vector (for example, pRGEB31) with appropriate restric-
tion enzymes, preparation of DNA-oligo duplex and ligation of the
duplex into the vector. The vector is then transformed into E. coli
and subsequently into Agrobacterium. The third step is the trans-
formation of plants with the construct using Agrobacterium-
mediated transformation. The fourth and the last step is genotyp-
ing or screening and validation of the transformed plants.
The major advantage of this gene-editing system is its tremen-
dous applicability. To date, this method has been used for targeted
mutagenesis, multiplex gene editing, gene regulation, epigenetic
modifications, and gene knock-in and replacements (reviewed in
[122]). Additionally, catalytically inactive Cas9 protein
(endonuclease dead Cas9; dCas9) still capable of forming

DNA-binding complex with guide RNA (gRNA) to recognize
target DNA sequence in genome can be used for targeted
genome-regulation tool instead of genome-editing tool [124–
126]. Chimeras of dCas9 fused to transcription activation domains
and targeted to promoter sequences of a gene has been shown to
activate gene expression [127]. Alternatively, dCas9 fused to tran-
scription repression domains can be used to repress or silence gene
expression. Gene activation through dCas9 has also been recently
demonstrated in plants [128].
Amongst the several advantages few limitations of this method
include the associated off-target effects, dependence on Agrobac-
terium-mediated plant transformation and the large size of Cas9
protein that makes it difficult for packaging in viral vectors. The
other limitation is the high frequency of NHEJ and low incidence
of homology dependent repair stimulated by Cas9 that makes
precise insertional mutagenesis using CRISPR/Cas9 a challenge.
5 Conclusions and Future Perspectives
The various PTGS and TGS based gene silencing methods have
been successfully applied in various sectors of agricultural biotech-
nology. These methods have been utilized to understand the func-
tions of genes involved in plant’s tolerance to biotic and abiotic
stresses and to improve the nutritional quality of plants
[129, 130]. Although gene-editing system like CRISPR-Cas is
rapidly gaining popularity, RNAi and VIGS are still widely used in
the laboratories for plant species with standardized transformation
protocols. VIGS is preferentially used for quick and transient gene
silencing in some plants. Various useful in silico tools have been
developed with enhanced efficiency and accuracy to predict the
targets for siRNAs. Furthermore, research efforts toward uncover-
ing the unsolved aspects of siRNA- and the miRNA-mediated gene
silencing pathways are paving the way for the development of new
and better gene silencing methods. The emergence of various
improved methods for sRNA delivery offers a promising strategy
for efficient, convenient, and rapid gene silencing in plants.
There is an increasing need to focus on addressing the
off-target effects in various gene silencing and CRISPR based-
editing methods. This has been partially achieved by the develop-
ment of better in silico tools that can handle large datasets and
accurately predict the off-targets [131]. Moreover, identification
and development of viral vectors with enhanced infectivity, broad
host range, and reduced adverse effects on the plants can help in
expanding the application of VIGS. Since the number of gene
silencing methods is dependent on plant transformation, develop-
ment of easy, less time taking, and efficient plant transformation
tools with wide applicability is needed. Alternate and widely appli-

cable methods of delivering the silencing agents should be explored
for easy, fast, high throughput, and efficient silencing of genes.
References
1. Fire A, Xu S, Montgomery MK, Kostas SA, 14. Napoli C, Lemieux C, Jorgensen R (1990)
Driver SE, Mello CC (1998) Potent and spe- Introduction of a chimeric chalcone synthase
cific genetic interference by double-stranded gene into petunia results in reversible
RNA in Caenorhabditis elegans. Nature 391 co-suppression of homologous genes in
(6669):806–811 trans. Plant Cell 2:279–289
2. Vaucheret H, Fagard M (2001) Transcrip- 15. Baulcombe DC (1996) RNA as a target and
tional gene silencing in plants: targets, indu- an initiator of post-transcriptional gene silenc-
cers and regulators. Trends Genet 17:29–35 ing in transgenic plants. Plant Mol Biol 32:
3. Baulcombe DC (2004) RNA silencing in 79–88
plants. Nature 431:356–363 16. Sunkar R, Zhu JK (2004) Novel and stress-
4. Selker EU (2002) Repeat-induced gene regulated microRNAs and other small RNAs
silencing in fungi. Adv Genet 46:439–450 from Arabidopsis. Plant Cell 16:2001–2019
5. Barry C, Faugeron G, Rossignol J-L (1993) 17. Borsani O, Zhu JH, Verslues PE, Sunkar R,
Methylation induced premeiotically in Ascobo- Zhu JK (2005) Endogenous siRNAs derived
lus: coextension with DNA repeat lengths and from a pair of natural cis-antisense transcripts
effect on transcript elongation. Proc Natl regulate salt tolerance in Arabidopsis. Cell
Acad Sci USA 90:4557–4561 123:1279–1291
6. Selker EU (1997) Epigenetic phenomena in 18. Katiyar-Agarwal S, Morgan R, Dahlbeck D,
filamentous fungi: useful paradigms or repeat Borsani O, Villegas A, Zhu JK, Staskawicz BJ,
induced confusion? Trends Genet 13: Jin HL (2006) A pathogen-inducible endog-
296–301 enous siRNA in plant immunity. Proc Natl
7. Jinek M, Chylinski K, Fonfara I, Hauer M, Acad Sci U S A 103:18002–18007
Doudna JA, Charpentier E (2012) A pro- 19. Wu H, Li B, Iwakawa H et al (2020) Plant
grammable dual-RNA-guided DNA endonu- 22-nt siRNAs mediate translational repression
clease in adaptive bacterial immunity. Science and stress adaptation. Nature 581:89–93
337(6096):816–821 20. Kasschau KD, Fahlgren N, Chapman EJ, Sul-
8. Joung JK, Sander JD (2013) TALENs: a livan CM, Cumbie JS, Givan SA (2007)
widely applicable technology for targeted Genome-wide profiling and analysis of Arabi-
genome editing. Nat Rev Mol Cell Biol 14 dopsis siRNAs. PLoS Biol 5:e57
(1):49–55 21. Liu YX, Wang M, Wang XJ (2014) Endoge-
9. Waterhouse PM, Wang MB, Lough T (2001) nous small RNA clusters in plants. Genomics
Gene silencing as an adaptive defence against Proteomics Bioinformatics 12(2):64–71
viruses. Nature 411(6839):834–842 22. Quintero A, Pérez-Quintero AL, López C
10. Sijen T, Vijn I, Rebocho A, van Blokland R, (2013) Identification of ta-siRNAs and Cis-
Roelofs D, Mol JN, Kooter JM (2001) Tran- nat-siRNAs in cassava and their roles in
scriptional and post-transcriptional gene response to cassava bacterial blight. Genomics
silencing are mechanistically related. Curr Proteomics Bioinformatics 11(3):172–181
Biol 11(6):436–440 23. Zubko E, Meyer P (2007) A natural antisense
11. Chan SWL, Zilberman D, Xie Z, Johansen transcript of the Petunia hybrida Sho gene
LK, Carrington JC, Jacobsen SE (2004) suggests a role for an antisense mechanism in
RNA silencing genes control de novo DNA cytokinin regulation. Plant J 52:1131–1139
methylation. Science 303:1336 24. Ron M, Saez MA, Williams LE, Fletcher JC,
12. Xie Z, Johansen LK, Gustafson AM, Kasschau McCormick S (2010) Proper regulation of a
KD, Lellis AD, Zilberman D, Jacobsen SE, sperm-specific cis-nat-siRNA is essential for
Carrington JC (2004) Genetic and functional double fertilization in Arabidopsis. Genes
diversification of small RNA pathways in Dev 24:1010–1021
plants. PLoS Biol 2:E104 25. Jin H, Vacic V, Girke T, Lonardi S, Zhu JK
13. Axtell MJ (2013) Classification and compari- (2008) Small RNAs and the regulation of
son of small RNAs from plants. Annu Rev cis-natural antisense transcripts in Arabidop-
Plant Biol 64:137–159 sis. BMC Mol Biol 9:6
26. Montavon T, Kwon Y, Zimmermann A, acting siRNA pathway. Plant Mol Biol 63:
Hammann P, Vincent T, Cognat V, 777–785
Michel F, Dunoyer P (2017) A specific 37. de Alba AEM, Elvira-Matelot E, Vaucheret H
dsRNA-binding protein complex selectively (2013) Gene silencing in plants: a diversity of
sequesters endogenous inverted-repeat pathways. Biochim Biophys Acta 1829:
siRNA precursors and inhibits their proces- 1300–1308
sing. Nucleic Acids Res 45(3):1330–1344 38. de Felippes FF, Wang JW, Weigel D (2012)
27. Allen E, Xie Z, Gustafson AM, Carrington JC MIGS: miRNA induced gene silencing. Plant
(2005) microRNA-directed phasing during J 70:541–547
trans-acting siRNA biogenesis in plants. Cell 39. Wei W, Ba Z, Gao M, Wu Y, Ma Y, Amiard S,
121:207–221 White CI, Danielsen JMR, Yang Y-G, Qi Y
28. Yoshikawa M, Peragine A, Park MY, Poethig (2012) A role for Small RNAs in DNA
RS (2005) A pathway for the biogenesis of double-strand break repair. Cell 149
trans-acting siRNAs in Arabidopsis. Genes (1):101–112
Dev 19:2164–2175 40. Robertson D (2004) VIGS vectors for gene
29. Borges F, Martienssen RA (2015) The silencing, many targets, many tools. Ann Rev
expanding world of small RNAs in plants. Plant Biol 55:495–519
Nat Rev Mol Cell Biol 16(12):727–741 41. Senthil-Kumar M, Mysore KS (2010) RNAi
30. Yelina NE, Smith LM, Jones AM, Patel K, in plants: recent developments and applica-
Kelly KA, Baulcombe DC (2010) Putative tions in agriculture. In: Catalano AJ
Arabidopsis THO/TREX mRNA export (ed) Gene silencing: theory, techniques and
complex is involved in transgene and endoge- applications. Nova Science Publishers
nous siRNA biosynthesis. Proc Natl Acad Sci 42. Senthil-Kumar M, Mysore KS (2011) New
U S A 107:13948–13953 dimensions for VIGS in plant functional
31. Montgomery TA, Yoo SJ, Fahlgren N, Gilbert genomics. Trends Plant Sci 16:656–665
SD, Howell MD, Sullivan CM, Alexander A, 43. Senthil-Kumar M, Mysore KS (2014)
Nguyen G, Allen E, Ahn JH, Carrington JC Tobacco rattle virus-based virus-induced
(2008) AGO1-miR173 complex initiates gene silencing in Nicotiana benthamiana.
phased siRNA formation in plants. Proc Natl Nat Protoc 9(7):1549–1562
Acad Sci U S A 105:20055–20062
44. Filipowicz W, Jaskiewicz L, Kolb FA, Pillai RS
32. Montgomery TA, Howell MD, Cuperus JT, (2005) Posttranscriptional gene silencing by
Li D, Hansen JE, Alexander AL, Chapman EJ, siRNAs and miRNAs. Curr Opin Struct Biol 5
Fahlgren N, Allen E, Carrington JC (2008) (3):331–341
Specificity of ARGONAUTE7-miR390 inter-
action and dual functionality in TAS3 trans- 45. Bartel DP (2004) MicroRNAs: genomics,
acting siRNA formation. Cell 133:128–141 biogenesis, mechanism, and function. Cell
116:281–297
33. Elmayan T, Adenot X, Gissot L,
Lauressergues D, Gy I, Vaucheret H (2009) 46. O’Brien J, Hayder H, Zayed Y, Peng C
A neomorphic sgs3 allele stabilizing miRNA (2018) Overview of MicroRNA biogenesis,
cleavage products reveals that SGS3 acts as a mechanisms of actions, and circulation.
homodimer. FEBS J 276:835–844 Front Endocrinol 9:402
34. Hernandez-Pinzon N, Schwach F, Studholme 47. Schwab R, Ossowski S, Riester M,
DJ, Baulcombe D, Dalmay T (2007) SDE5 Warthmann N, Weigel D (2006) Highly spe-
the putative homologue of a human mRNA cific gene silencing by artificial MicroRNAs in
export factor, is required for transgene silenc- Arabidopsis. Plant Cell 18:1121–1133
ing and accumulation of trans-acting endoge- 48. Matzke M, Kanno T, Huettel B, Daxinger L,
nous siRNA. Plant J 50:140–148 Matzke AJ (2007) Targets of RNA-directed
35. Gasciolli V, Mallory AC, Bartel DP, Vaucheret DNA methylation. Curr Opin Plant Biol 10:
H (2005) Partially redundant functions of 512–519
Arabidopsis DICER-like enzymes and a role 49. Pikaard CS, Haag JR, Ream T, Wierzbicki AT
for DCL4 in producing trans-acting siRNAs. (2008) Roles of RNA polymerase IV in gene
Curr Biol 15:1494–1500 silencing. Trends Plant Sci 13:390–397
36. Nakazawa Y, Hiraguri A, Moriyama H, Fuku- 50. Law JA, Jacobsen SE (2010) Establishing,
hara T (2007) The dsRNA-binding protein maintaining and modifying DNA methylation
DRB4 interacts with the Dicer-like protein patterns in plants and animals. Nat Rev Genet
DCL4 in vivo and functions in the trans- 1:204–220
51. Hamilton A, Voinnet O, Chappell L, Baul- 64. Carrillo-Tripp J, Shimada-Beltrán H, Rivera-

combe D (2002) Two classes of short inter- Bustamante R (2006) Use of geminiviral vec-
fering RNA in RNA silencing. EMBO J 21: tors for functional genomics. Curr Opin Plant
4671–4679 Biol 9(2):209–215
52. Yang Z, Ebright YW, Yu B, Chen X (2006) 65. Ruiz MT, Voinnet O, Baulcombe DC (1998)
HEN1 recognizes 21-24 nt small RNA Initiation and maintenance of virus-induced
duplexes and deposits a methyl group onto gene silencing. Plant Cell 10:937–946
the 2’ OH of the 30 terminal nucleotide. 66. Ramegowda V, Mysore KS, Senthil-Kumar M
Nucleic Acids Res 34:667–675 (2014) Virus-induced gene silencing is a ver-
53. Zhang H, Zhu J-K (2011) RNA directed satile tool for unraveling the functional rele-
DNA methylation. Curr Opin Plant Biol 14 vance of multiple abiotic-stress-responsive
(2):142–147 genes in crop plants. Front Plant Sci 5:323
54. Cao X, Jacobsen SE (2002) Role of the Ara- 67. de Felippes FF (2013) Downregulation of
bidopsis DRM methyltransferases in de novo plant genes with miRNA-induced gene silenc-
DNA methylation and gene silencing. Curr ing. Methods Mol Biol 942:379–387
Biol 12:1138–1144 68. Wulfert S, Krueger S (2018) Phosphoserine
55. Wassenegger M (2000) RNA-directed DNA Aminotransferase1 is part of the phosphory-
methylation. Plant Mol Biol 43:203–220 lated pathways for serine biosynthesis and
56. Wesley SV, Helliwell CA, Smith NA, Wang M, essential for light and sugar-dependent
Rouse DT, Liu Q, Gooding PS, Singh SP growth promotion. Front Plant Sci 9:1712
(2001) Construct design for efficient, effec- 69. Zhou C-M, Zhang T-Q, Wang X, Yu S,
tive and high-throughput gene silencing in Lian H, Tang H, Feng Z-Y, Zozomova-
plants. Plant J 27:581–590 Lihova J, Wang J-W (2013) Molecular basis
57. Himmelbach A, Zierold U, Hensel G, of age-dependent vernalization in Cardamine
Riechen J, Douchkov D, Schweizer P, Kum- flexuosa. Science 340(6136):1097–1100
lehn J (2007) A set of modular binary vectors 70. Sicard A, Kappel C, Josephs EB, Lee YW,
for transformation of cereals. Plant Physiol Marona C, Stinchcombe JR, Wright SI, Len-
145:1192–1200 hard M (2015) Divergent sorting of a bal-
58. Xu G, Sui N, Tang Y, Xie K, Lai Y, Liu Y anced ancestral polymorphism underlies the
(2010) One-step, zero-background ligation- establishment of gene-flow barriers in Cap-
independent cloning intron-containing hair- sella. Nat Commun 6:7960
pin RNA constructs for RNAi in plants. New 71. Han Y, Zhang B, Qin X, Li M, Guo Y (2015)
Phytol 187:240–250 Investigation of a miRNA-induced gene
59. Yan P, Shen W, Gao X, Li X, Zhou P, Duan J silencing technique in petunia reveals altera-
(2012) High-throughput construction of tions in miR173 precursor processing and the
intron-containing hairpin RNA vectors for accumulation of secondary siRNAs from
RNAi in plants. PLoS One 7(5):e38186 endogenous genes. PLoS One 10(12):
60. Liu S, Yoder J (2016) Chemical induction of e0144909
hairpin RNAi molecules to silence vital genes 72. Zheng X, Yang L, Li Q, Ji L, Tang A, Zang L,
in plant roots. Sci Rep 6:37711 Deng K, Zhou J, Zhang Y (2018) MIGS as a
61. Burch-Smith TM, Anderson JC, Martin GB, simple and efficient method for gene silencing
Dinesh-Kumar SP (2004) Applications and in rice. Front Plant Sci 9:662
advantages of virus-induced gene silencing 73. Dai X, Zhao PX (2008) pssRNAMiner: a plant
for gene function studies in plants. Plant J short small RNA regulatory cascade analysis
39:734–746 server. Nucleic Acids Res 1:36
62. Senthil-Kumar M, Hema R, Anand A, 74. Zhang C, Li G, Zhu S, Zhang S, Fang J
Kang L, Udayakumar M, Mysore KS (2007) (2014) tasiRNAdb: a database of ta-siRNA
A systematic study to determine the extent of regulatory pathways. Bioinformatics 30
gene silencing in Nicotiana benthamiana and (7):1045–1046
other Solanaceae species when heterologous 75. Li F, Orban R, Baker B (2012) SoMART: a
gene sequences are used for virus-induced web server for plant miRNA, tasiRNA and
gene silencing. New Phytol 176:791–882 target gene analysis. Plant J 70(5):891–901
63. Senthil-Kumar M, Lee HK, Mysore KS 76. Liang G, He H, Li Y, Yu D (2012) A new
(2013) VIGS-mediated forward genetics strategy for construction of artificial miRNA
screening for identification of genes involved vectors in Arabidopsis. Planta 235
in nonhost resistance. J Vis Exp 78:e51033. (6):1421–1429
https://doi.org/10.3791/51033
77. Carbonell A, Takeda A, Fahlgren N, Johnson specific gene silencing in fungal cells by in
SC, Cuperus JT, Carrington JC (2014) New planta expression of a double-stranded
generation of artificial MicroRNA and syn- RNA. BMC Biol 8:1–11
thetic trans-acting small interfering RNA vec- 89. Ghag SB, Shekhawat UK, Ganapathi TR
tors for efficient gene silencing in Arabidopsis. (2014) Host-induced post-transcriptional
Plant Physiol 165(1):15–29 hairpin RNA-mediated gene silencing of vital
78. Ossowski S, Schwab R, Weigel D (2008) fungal genes confers efficient resistance
Gene silencing in plants using artificial micro- against Fusarium wilt in banana. Plant Bio-
RNAs and other small RNAs. Plant J 53 technol J 12(5):541–553
(4):674–690 90. Qi T, Guo J, Peng H, Liu P, Kang Z, Guo J
79. Laganà A, Acunzo M, Romano G, (2019) Host-induced gene silencing: a pow-
Pulvirenti A, Veneziano D, Cascione L, erful strategy to control diseases of wheat and
Giugno R, Gasparini P, Shasha D, Ferro AC, barley. Int J Mol Sci 20(1):206
Croce M (2014) miR-Synth: a computational 91. Huang G, Allen R, Davis EL, Baum TJ, Hus-
resource for the design of multi-site multi- sey RS (2006) Engineering broad root-knot
target synthetic miRNAs. Nucleic Acids Res resistance in transgenic plants by RNAi silenc-
42(9):5416–5425. https://doi.org/10. ing of a conserved and essential root-knot
1093/nar/gku202 nematode parasitism gene. Proc Natl Acad
80. Alvarez JP, Pekker I, Goldshmidt A, Blum E, Sci U S A 103(14):302–306
Amsellem Z, Eshed Y (2006) Endogenous 92. Mao YB, Cai WJ, Wang JW, Hong GJ, Tao
and synthetic microRNAs stimulate simulta- XY, Wang LJ, Huang YP, Chen XY (2007)
neous, efficient, and localized regulation of Silencing a cotton bollworm P450 monoox-
multiple targets in diverse species. Plant Cell ygenase gene by plant-mediated RNAi impairs
18:1134–1151 larval tolerance of gossypol. Nat Biotechnol
81. Niu QW, Lin SS, Reyes JL, Chen KC, Wu 25:1307–1313
HW, Yeh SD, Chua NH (2006) Expression 93. Tomilov AA, Tomilova NB, Wroblewski T,
of artificial microRNAs in transgenic Arabi- Michelmore R, Yoder JI (2008) Trans-specific
dopsis thaliana confers virus resistance. Nat gene silencing between host and parasitic
Biotechnol 24:1420–1428 plants. Plant J 56:389–397
82. Qu J, Ye J, Fang R (2007) Artificial 94. Westwood JH, Roney JK, Khatibi PA, Strom-
microRNA-mediated virus resistance in berg VK (2009) RNA translocation between
plants. J Virol 81:6690–6699 parasitic plants and their hosts. Pest Manag Sci
83. Molesini B, Pii Y, Pandolfini T (2011) Fruit 65:533–539
improvement using intra-genesis and artificial 95. Urwin PE, Lilley CJ, Atkinson HJ (2002)
microRNA. Trends Biotech 30:80–88 Ingestion of double-stranded RNA by prepar-
84. Tang Y, Wang F, Zhao J, Xie K, Hong Y, Liu Y asitic juvenile cyst nematodes leads to RNA
(2010) Virus-based microRNA expression for interference. Mol Plant-Microbe Interact 15:
gene functional analysis in plants. Plant 747–752
Physiol 153(2):632–641 96. Cai Q, Qiao L, Wang M, He B, Lin FM,
85. Tang Y, Lai Y, Liu Y (2013) Virus-induced Palmquist J, Huang SD, Jin H (2018) Plants
gene silencing using artificial miRNAs in send small RNAs in extracellular vesicles to
Nicotiana benthamiana. Methods Mol Biol fungal pathogen to silence virulence genes.
975:99–107 Science 360(6393):1126–1129
86. Nowara D, Gay A, Lacomme C, Shaw J, 97. Baum JA, Bogaert T, Clinton W, Heck GR,
Ridout C, Douchkov D, Hensel G, Feldmann P, Ilagan O, Johnson S,
Kumlehn J, Schweizer P (2010) HIGS: host- Plaetinck G, Munyikwa T, Pleau M,
induced gene silencing in the obligate bio- Vaughn T, Roberts J (2007) Control of cole-
trophic fungal pathogen Blumeria graminis. opteran insect pests through RNA interfer-
Plant Cell 22:3130–3141 ence. Nat Biotechnol 25:1322–1326
87. Nunes CC, Gowda M, Sailsbery J, Xue M, 98. Yin C, Jurgenson J, Hulbert S (2010) Devel-
Chen F, Brown D, Oh Y, Mitchell TM, opment of a host-induced RNAi system in the
Dean RA (2011) Diverse and tissue-enriched wheat stripe rust fungus Puccinia striiformis
small RNAs in the plant pathogenic fungus f. sp. tritici. Mol Plant-Microbe Interact 24:
Magnaporthe oryzae. BMC Genomics 12: 554–561
1–20 99. Voinnet O, Vain P, Angell S, Baulcombe DC
88. Tinoco ML, Dias BB, Dall’Astta RC, Pam- (1998) Systemic spread of sequence-specific
phile JA, Aragao FJ (2010) In vivo trans- transgene RNA degradation in plants is
initiated by localized introduction of ectopic depends on the promoter region that is used
promoterless DNA. Cell 95:177–187 in an inverted repeat. Mol Gen Genomics
100. Rutherford G, Tanurdzic M, Hasebe M, 275:437–449
Banks JA (2004) A systemic gene silencing 111. Cigan AM, Unger-Wallace E, Haug-Collet K
method suitable for high throughput, reverse (2005) Transcriptional gene silencing as a
genetic analyses of gene function in fern tool for uncovering gene function in maize.
gametophytes. BMC Plant Biol 4:6 Plant J 43:929–940
101. Tsuboi H, Sutoh K, Wada M (2012) Epige- 112. Deng S, Dai H, Arenas C, Wang H, Niu QW,
netic memory of DNAi associated with cyto- Chua NH (2014) Transcriptional silencing of
sine methylation and histone modification in Arabidopsis endogenes by single-stranded
fern. Plant Signal Behav 7(11):1477–1483 RNAs targeting the promoter region. Plant
102. Klahre U, Crete P, Leuenberger SA, Iglesias Cell Physiol 55(4):823–833
VA, Meins F Jr (2002) High molecular 113. Wakasa Y, Kawakatsu T, Harada T, Takaiwa F
weight RNAs and small interfering RNAs (2018) Transgene-independent heredity of
induce systemic post-transcriptional gene RdDM-mediated transcriptional gene silenc-
silencing in plants. Proc Natl Acad Sci U S A ing of endogenous genes in rice. Plant Bio-
99:11981–11986 technol J 16:2007–2015
103. Numata K, Ohtani M, Yoshizumi T, 114. Qiu S, Adema CM, Lane T (2005) A compu-
Demura T, Kodama Y (2014) Local gene tational study of off-target effects of RNA
silencing in plants via synthetic dsRNAand interference. Nucleic Acids Res 33:
carrier peptide. Plant Biotechnol J 12: 1834–1847
1027–1034. https://doi.org/10.1111/pbi. 115. Jackson AL, Linsley PS (2004) Noise amidst
12208 the silence: off-target effects of siRNAs?
104. Silva AT, Nguyen A, Ye C, Verchot J, Moon Trends Genet 20:521–524
JH (2010) Conjugated polymer nanoparticles 116. Senthil-Kumar M, Mysore KS (2011) Caveat
for effective siRNA delivery to tobacco BY-2 of RNAi in plants: the off-target effect. Meth-
protoplasts. BMC Plant Biol 10:291 ods Mol Biol 744:13–25
105. Demirer GS, Zhang H, Goh NS, Pinals RL, 117. Xu P, Zhang Y, Kang L, Roossinck MJ,
Chang R, Landry MP (2020) Carbon nano- Mysore KS (2006) Computational estimation
carriers deliver siRNA to intact plant cells for and experimental verification of off-target
efficient gene knockdown. Sci Adv 6(26): silencing during posttranscriptional gene
eaaz0495 silencing in plants. Plant Physiol 142:
106. Otagaki S, Arai M, Takahashi A, Goto K, 429–440
Hong JS, Masuta C, Kazazawa A (2006) 118. Das PR, Sherif SM (2020) Application of
Rapid induction of transcriptional and post- exogenous dsRNAs-induced RNAi in agricul-
transcriptional gene silencing using a novel ture: challenges and triumphs. Front Plant Sci
Cucumber mosaic virus vector. Plant Biotech- 11:946
nol 23:259–265 119. Ishino Y, Shinagawa H, Makino K,
107. Kon T, Yoshikawa N (2014) Induction and Amemura M, Nakata A (1987) Nucleotide
maintenance of DNA methylation in plant sequence of the IAP gene, responsible for
promoter sequences by apple latent spherical alkaline phosphatase isozyme conversion in
virus-induced transcriptional gene silencing. Escherichia coli, and identification of the
Front Microbiol 5:595 gene product. J Bacteriol 169:5429–5433
108. Ju Z, Wang L, Cao D, Zuo J, Zhu H, Fu D, 120. Jaganathan D, Ramasamy K, Sellamuthu G,
Luo Y, Zhu B (2016) A viral satellite DNA Jayabalan S, Venkataraman G (2018) CRISPR
vector-induced transcriptional gene silencing for crop improvement: an update review.
via DNA methylation of gene promoter in Front Plant Sci 9:985
Nicotiana benthamiana. Virus Res 223: 121. Makarova KS, Wolf YI, Iranzo J, Shmakov SA,
99–107. Alkhnbashi OS, Brouns SJJ, Charpentier E,
109. Mette MF, Aufsatz W, van der Winden J, Cheng D, Haft DH, Horvath P, Moineau S,
Matzke MA, Matzke AJ (2000) Transcrip- Mojica FJM, Scott D, Shah SA, Siksnys V,
tional silencing and promoter methylation Terns MP, Venclovas C, White MF, Yakunin
triggered by double-stranded RNA. EMBO AF, Yan W, Zhang F, Garrett RA, Backofen R,
J 19:5194–5201 van der Oost J, Barrangou R, Koonin EV
110. Heilersig BH, Loonen AE, Janssen EM, Wol- (2020) Evolutionary classification of
ters AM, Visser RG (2006) Efficiency of tran- CRISPR-Cas systems: a burst of class 2 and
scriptional gene silencing of GBSSI in potato
derived variants. Nat Rev Microbiol 18 regulation in planta via synthetic dCas9-
(2):67–83 based transcription factors. Plant Biotechnol
122. Manghwar H, Lindsey K, Zhang X, Jin S J 13:578–589
(2019) CRISPR/Cas system: recent advances 129. Wang Y, Beaith M, Chalifoux M, Ying J,
and future prospects for genome editing. Uchacz T, Sarvas C, Griffiths R, Kuzma M,
Trends Plant Sci 24(12):1102–1125 Wan J, Huang Y (2009) Shoot-specific down-
123. Xie K, Minkenberg B, Yang Y (2014) Tar- regulation of protein farnesyltransferase
geted gene mutation in rice using a (a-subunit) for yield protection against
CRISPR-Cas9 system. Bio-protocol 4(17): drought in canola. Mol Plant 2:191–200
e1225 130. Senthil-Kumar M, Udayakumar M (2010)
124. Bikard D, Jiang W, Samai P, Hochschild A, Post transcriptional gene silencing methods
Zhang F, Marraffini LA (2013) Programma- for functional characterization of abiotic
ble repression and activation of bacterial gene stress responsive genes in plants. In: Catalano
expression using an engineered CRISPR-Cas AJ (ed) Gene silencing: theory, techniques
system. Nucleic Acids Res 41 and applications. Nova Science Publishers,
(15):7429–7437 New York, NY
125. Qi LS, Larson MH, Gilbert LA, Doudna JA, 131. Ahmed F, Senthil-Kumar M, Dai X, Ramu
Weissman JS, Arkin AP, Lim WA (2013) VS, Lee S, Mysore KS, Zhao PX (2020)
Repurposing CRISPR as an RNA-guided pssRNAit—a web server for designing effec-
platform for sequence-specific control of tive and specific plant siRNAs with genome-
gene expression. Cell 152(5):1173–1183 wide off-target assessment. Plant Physiol 184
126. Konermann S, Brigham MD, Trevino AE, (1):65–81
Joung J, Abudayyeh OO, Barcena C, Hsu 132. Kanazawa A, Inaba J, Shimura H, Otagaki S,
PD, Habib N, Gootenberg JS, Nishimasu H, Tsukahara S, Matsuzawa A, Kim BM, Goto K,
Nureki O (2015) Genome-scale transcrip- Masuta C (2011) Virus-mediated efficient
tional activation by an engineered CRISPR- induction of epigenetic modifications of
Cas9 complex. Nature 517(7536):583–588 endogenous genes with phenotypic changes
127. Perez-Pinera P, Kocak DD, Vockley CM, in plants. Plant J 65:156–168
Adler AF, Kabadi AM, Polstein LR, Thakore 133. Zhang ZJ (2014) Artificial trans-acting small
PI, Glass KA, Ousterout DG, Leong KW, interfering RNA: a tool for plant biology
Guilak F (2013) RNA-guided gene activation study and crop improvements. Planta 239:
by CRISPR-Cas9–based transcription factors. 1139–1146
Nat Methods 10(10):973–976 134. Pandey P, Senthil-Kumar M, Mysore KS
128. Piatek A, Ali Z, Baazim H, Li L, Abulfaraj A, (2015) Advances in plant gene silencing
Al-Shareef S, Aouida M, Mahfouz MM methods. Methods Mol Biol 1287:3–23
(2015) RNA-guided transcriptional
Chapter 2
Strategies for Efficient RNAi-Based Gene Silencing of Viral

Genes for Disease Resistance in Plants
Krish K. Kumar, Shanmugam Varanavasiappan, Loganathan Arul,
Easwaran Kokiladevi, and Duraialagaraja Sudhakar
Abstract
RNA interference (RNAi) is an evolutionarily conserved gene silencing mechanism in eukaryotes including
fungi, plants, and animals. In plants, gene silencing regulates gene expression, provides genome stability,
and protect against invading viruses. During plant virus interaction, viral genome derived siRNAs (vsiRNA)
are produced to mediate gene silencing of viral genes to prevent virus multiplication. After the discovery of
RNAi phenomenon in eukaryotes, it is used as a powerful tool to engineer plant viral disease resistance
against both RNA and DNA viruses. Despite several successful reports on employing RNA silencing
methods to engineer plant for viral disease resistance, only a few of them have reached the commercial
stage owing to lack of complete protection against the intended virus. Based on the knowledge accumulated
over the years on genetic engineering for viral disease resistance, there is scope for effective viral disease
control through careful design of RNAi gene construct. The selection of target viral gene(s) for developing
the hairpin RNAi (hp-RNAi) construct is very critical for effective protection against the viral disease.
Different approaches and bioinformatics tools which can be employed for effective target selection are
discussed. The selection of suitable target regions for RNAi vector construction can help to achieve a high
level of transgenic virus resistance.
Key words Plant virus resistance, RNA interference, DNA virus, RNA virus, Strategies for vector
design, Off-target silencing
1 Introduction
RNA silencing, also known as posttranscriptional gene silencing

(PTGS) or RNA interference (RNAi) is a small RNA-mediated
gene regulation mechanism in eukaryotes including plants. RNAi
is a highly conserved process of sequence-specific RNA degrada-
tion, translational inhibition, and DNA methylation. Plant immune
systems defend plants against invading viruses using a different
mechanism that includes antiviral RNA silencing mediated by
small interfering RNA (siRNA), the resistance gene (R)-conferred
defence response, and ubiquitination-mediated protein
23
24 Krish K. Kumar et al.
degradation [1]. In plants, RNAi acts as a major natural defence

mechanism against viruses. Thus, RNA silencing plays an important
role in suppressing viral infections in plants [2].The accumulation
of virus-derived small RNAs (vsRNAs) in infected tissues and their
contribution to antiviral silencing has been proven for many plant
viruses [3]. Profiling of small RNA molecules in a plant infected
with the virus through next-generation sequencing (NGS) helps to
identify the vsiRNA generated in the plant against the virus [4].
Because of the lack of genetic resistance in plants for most
viruses, imparting virus resistance through transgenic technology
is the only option available. Among the various approaches for
engineering virus resistance, RNAi is the most promising method
in giving specific and robust resistance against viruses. Virus-
resistant transgenic squash, papayas, and potatoes were first com-
mercialized in the United States in the mid-1990s [5, 6]. Transgenic
peppers and tomatoes with resistance to Cucumber mosaic virus
(CMV) were deregulated in China. Beans against Bean golden
mosaic virus (BGMV) were deregulated in Brazil [7]. However,
RNAi technology has certain limitations. One of the major limita-
tions of RNAi method is that for many virus diseases, a high level of
resistance suitable for commercial release is not achieved. Another
limitation is the disruption of RNAi-mediated silencing process by
untargeted mixed virus infections [8]. A recent report shows that at
least one rapidly evolving variant of Tomato yellow leaf curl virus
(TYLCV) escaped sequence-specific recognition of RNAi in tomato
during field assessment of RNAi-mediated resistance against
TYLCV [9]. Application of selection pressure to genome-edited
cassava plants resistant to ACMV also developed a mutant virus
strain that overcomes CRISPR-Cas9 cleavage during glasshouse
inoculations [10]. Thus it is essential to prevent the rapid evolution
of viral variants that may escape recognition by RNAi and the
CRISPR/Cas9 system for a long-term durable transgenic virus
resistance in field conditions. The full potential of RNAi method
for engineering resistance against plant viruses has not yet been
exploited. Here we describe the various strategies for enhancing
RNAi-mediated virus resistance in plants.
2 Antiviral Plant Defence Responses
Plant RNAi pathway is well established in the model plant species

Arabidopsis thaliana. RNA silencing is activated on sensing the
long double-stranded RNA (dsRNA), which acts as a trigger mole-
cule to induce the RNAi pathway in plants and other eukaryotes.
The dsRNA precursor is either derived endogenously by expression
of certain plant genomic elements or exogenously due to virus
infection. The ribonuclease-III, Dicer-like (DCL) enzyme recog-
nizes the long dsRNA molecule and cleaves them into siRNA
Strategies for Efficient RNAi-Based Gene Silencing of Viral Genes. . . 25
fragments of 21–26 nucleotides (nt). The non-coding RNAs

(21–26-nt) induce gene silencing through homologous base pair-
ing. Viral multiplication inside the plant depends on the host
cellular mechanism that supports the replication of the viral gen-
omes, systemic movement of the virus via plasmodesmata, and the
connected phloem [11]. For RNA viruses, the dsRNA trigger can
result from dsRNA replication intermediates, highly structured
regions in genomic RNA or imperfect hairpins of viral transcripts,
or from viral RNA converted to dsRNA by RNA-dependent RNA
polymerase 6 (RDR6) [12]. For DNA virus, secondary structures
in the viral transcripts may also direct the processing of vsiRNAs,
although the best-understood mechanism of vsiRNA generation
from DNA viruses involves bi-directional transcription of the viral
genome giving rise to overlapping fragments forming dsRNAs
[13].Once viral dsRNAs accumulate in the plant cell, they are
processed into vsiRNAs by Dicer-like proteins [14]. All four
DCLs have been associated with viral RNA silencing, although for
several RNA viruses DCL4 and DCL2 are the most important ones
[15–18]. Upon DNA virus infection, the production of 24 nt
vsiRNA by DCL3 is also sufficient for virus-induced gene silencing
[15]. The vsiRNAs can be 21-nt, 22-nt, or 24-nt in length and
associate predominantly with AGO1, AGO2, and AGO7 [18–20]
which silence the viral genome either by endonucleolytic cleavage
or, for DNA viruses, by DNA methylation [21]. RDR1, RDR2, and
RDR6 have been most frequently associated with the amplification
of vsiRNAs from RNA viruses [19]. The vsiRNAs are then loaded
into argonaute (AGO) proteins AGO1- and AGO2-containing
complexes to target viral RNA for cleavage [22]. Then, vsiRNA’s
single-stranded guide sequences are incorporated into
AGO-containing RNA-induced silencing complexes (RISCs) and
then targeted to degrade viral RNA in a sequence-specific manner
causing posttranscriptional gene silencing [23–25].However, siR-
NAs possess an extra feature of RNA-directed DNA methylation.
The 24-nt vsiRNAs are then loaded into AGO-containing RNA-in-
duced transcriptional silencing complexes (RITS) to target comple-
mentary DNA sequences for methylation. The vsiRNAs can move
from cell to cell [26, 27], presumably symplastically through plas-
modesmata, and it has been proposed that vsiRNAs can move
ahead of the front of the infection, leading to the spread of silencing
and immunizing plant tissues before the arrival of the virus.
3 Engineering Based on Pathogen-Derived Resistance
The concept of pathogen-derived resistance (PDR) or parasite-

derived resistance was put forward by Sanford and Johnston
[28]. This concept basically states that plants can be transformed
with gene(s) sequences derived from pathogens to protect plants
against invasion by the same pathogen. The seminal work by

Beachy and colleagues [29] demonstrated Tobacco mosaic virus
(TMV) resistance in tobacco through the introduction of gene
constructs expressing the TMV viral coat protein (CP) and
CP-mediated resistance (CPMR) was used to describe the resulting
phenotypes. However, Lindbo and coworkers [30] showed that
antivirus resistance to Tobacco etch virus (TEV) in tobacco plants
engineered with TEV cDNA sequences was due to the viral RNA
sequence. Many of the strategies used for PDR were shown to be
mediated by RNA, rather than protein, and led directly to the
identification of PTGS—a phenomenon that was believed to be a
form of antiviral defence [31, 32].
3.1 Engineering Although plant gene silencing is a natural cellular defence system
RNAi-Based Virus against plant viruses, viruses are able to cause disease in plants due
Resistance to the fact that the virus is able to suppress the plant RNAi pathway.
However, antiviral RNAi methods can be used rationally to
pre-activate RNA silencing machinery by transgenic expression of
dsRNA cognate to a target virus and inhibit the expression of
specific viral genes to generate resistance against the target plant
virus. Such dsRNA is processed into siRNAs, similar to natural
dsRNA precursors of viral siRNAs, to confer PTGS and/or
TGS-mediated resistance against the target virus. RNAi has been
effectively used to engineer virus resistance to RNA and DNA
viruses in a number of crop plants [33]. Although dsRNA as well
as hairpin RNAi (hp-RNAi) which represent the intermediate forms
of viral replication are the key triggers of RNA silencing machinery
[34–36]. A more amenable approach has been to clone both sense
and antisense sequences, separated by an intron, under the same
promoter. Upon transcription, these sequences form a hairpin RNA
(hpRNA) molecule that triggers gene silencing [37]. Transcription
of inverted repeat (IR) sequences leads to the formation of perfect
fold-back dsRNA structures, which can lead to TGS and PTGS by
the same mechanisms as operating in nature. The silencing effi-
ciency of hpRNA and antisense RNA in a range of plant species has
been compared: the hpRNA strategy generally increases gene
silencing by 90–100% [36] and is now the most widely used system
for silencing genes in plants. The effectiveness of RNAi technology
for generating virus resistance in plants was first demonstrated in
1998 in plants [35]. They obtained strong resistance against the
Potato virus Y (PVY) by simultaneous expression of the sense and
antisense RNA of the helper-component protease (HC-Pro) gene
of PVY in tobacco, which resulted in resistant transgenic lines. The
originally designed hairpin RNAs contained a spacer DNA between
the inverted repeats, which was later replaced with an intron to
increase antiviral immunity. This was demonstrated by Smith and
coworkers [37], who proved that gene constructs encoding intron-
spliced RNA with a hairpin structure could induce PTGS with
almost 100% efficiency when directed against virus or endogenous

genes. The intron sequence provides stability to the DNA, but is
spliced out during pre-mRNA processing to produce loopless
intron-spliced hairpin RNA (ihp-RNA). The application of
ihp-RNAi strategy has resulted in genetically modified plants with
resistance against many plant viruses, including potyviruses, ipo-
moviruses, and geminiviruses [38, 39].
In general, RNAi-mediated resistance in transgenic plants is
more effective against RNA viruses than DNA viruses. However,
several examples are showing that DNA viruses can also be con-
trolled by employing the RNAi method, leading to suppression of
the DNA viruses at both transcriptional level and post-
transcriptional level. First successful TGS was demonstrated in
geminiviruses such as tomato leaf curl virus (TLCV) and Vigna
mungo yellow mosaic virus (VMYMV), by methylation of the viral
promoter sequences [40, 41]. Furthermore, Aragăo and Faria [42]
reported PTGS in another geminivirus, Bean golden mosaic virus
(BGMV).
4 Designing Effective Antiviral hp-RNAi Construct
4.1 Selection A key step in developing a successful RNA silencing strategy is the
of Suitable Target Viral identification of suitable target genes in the virus. Plant viruses
Sequence(s) normally have a small genome with limited coding capacity
(4–20 kb, encoding 5–10 proteins). However, many of the plant
virus proteins have multifunctional characteristics and some of
them play role in suppressing RNA silencing pathways in plants.
For example, HC-Pro is a protease, an aphid transmission factor,
and a suppressor of RNA silencing [43]. P6 is a translational trans-
activator, a silencing suppressor, and a facilitator of cell-to-cell
movement [44]. Among the viral genes, coat protein, replicase,
movement protein and rep protein are the most frequently used
gene target employed for engineering plant virus resistance. Out-
line of designing RNAi constructs for silencing multiple viral genes
is given in Fig. 1.
4.1.1 RNA Virus Genes Transgenic tobacco plants that express dsRNA homologous to the
CP gene of TMV and CMV were proven to trigger RNA silencing
of the corresponding viral genes [45, 46]. To develop RNAi-based
resistance to cassava brown streak disease (CBSD), Beyene and
colleagues created hairpin constructs, including fused sequences
of the CP coding regions of both Cassava brown streak virus
(CBSV) and Ugandan cassava brown streak virus (UCBSV), and
generated transgenic cassava resistant to CBSD [47]. Transgenic
cassava plants mounted effective RNAi responses to both viruses,
and in field trials at three locations under conditions of natural
disease pressure, several lines showed very good resistance, whereas
Identification of viral genes: Retrieve sequence from NCBI nucleotide database
NCBI BLAST search: Viral gene 1 Viral gene 2 Viral gene 3

Conserved region identified
Off-target search: Blast search Gene 1 Gene 2 Gene 3

selecting host plant specific Reference (100- 200 bp)
RNA sequence database (100- 200 bp) (100- 200 bp)
RE 3
RE 1
RE 2
RE 4
Gene synthesis:
With restriction sites added for cloning Gene 1 Gene 2 Gene 3
Clone sense – RE 1 & 2

Clone anti-sense – RE 3 & 4
RNAi construct with multiple viral genes silencing
Fig. 1 Schematic diagram for construction of RNAi vector silencing multiple viral genes
non-transgenic controls were 96–100% symptomatic [48]. Trans-

genic potato lines expressing fused viral coat protein-coding
sequences from Potato virus X (PVX), Potato virus Y (PVY), and
Potato virus S (PVS) as 600-bp inverted repeats provided nearly
100% resistance against all three viruses [49]. For this purpose, a
total of 600 bp of genomic sequences derived from the coat protein
regions of three viruses (PVX: 180 bp; PVY: 240 bp; and PVS:
180 bp) were selected. This is an example of engineering broad-
spectrum resistance to three RNA viruses using a chimeric RNAi
vector. In wheat, dual resistance to RNA viruses, Wheat streak
mosaic virus (WSMV) and Triticum mosaic virus (TriMV) was
obtained by employing an hp-RNAi construct comprising a
202-bp (404-bp in total) stem sequence of the NIb (replicase)
gene from each of WSMV and TriMV in tandem [50].
4.1.2 DNA Virus Genes For geminiviruses control, the Rep protein, has been used as a
prominent target for pathogen-mediated resistance. A common
bean line transformed with hp-RNAi construct expressing dsRNA
of Rep gene of Bean golden mosaic virus (BGMV) showed immu-
nity [42]. Likewise, transgenic tomato designed to generate siRNA
cognate to a Rep gene fragment from Tomato yellow leaf curl
(TYLCV) is immune to this begomovirus under field conditions
[9]. In contrast, RNAi-mediated resistance against Tomato yellow
leaf curl Sardinia virus, by targeting Rep sequences, resulted in
either no or limited resistance [51]. This suggests that RNAi-
mediated resistance might not work well against all geminiviruses.
In general, RNAi constructs targeting multiple viral genes
imparted a higher level of resistance in plants. A DNA construct
harboring a stack of conserved regions (IR, V1-V2, and C1-C2)
from TYLCV generated resistant tomato lines, displaying a high
level of transgene-derived siRNA accumulation with dominant

sizes of 21 nt and 22 nt [52]. Expression of a siRNA construct
designed to target the AC1 gene of Cotton leaf curl Kokhran virus-
Burewala (CLCuKoV-Bu) and the βC1 from conserved satellite
regions of the Cotton leaf curl Multan betasatellite (CLCuMB)
resulted in leaf curl resistant plants with a significant reduction in
viral load and betasatelite accumulation [53]. Transgenic cowpea
plants, which harbors hairpin RNAi constructs, containing the AC2
and fusion of AC2 and AC4(AC2 + AC4) displayed 100% resistance
against Mungbean yellow mosaic India virus (MYMIV) infection
[54]. Transgenic tomato harboring a hp-RNAi construct consisting
of 341 bp overlapping regions of the C1, C2, and C3 genes of
Ageratum yellow vein Malaysia virus (AYVMV) displayed resistance
against AYVMV [55]. Furthermore, as AYVMV has a betasatellite,
this indicates that transgenic plants not specifically targeting the
AYVMV betasatellite were still able to resist this form of the virus.
The intergenic region (IR) of TYLCV has a 25-nt segment that
is almost perfectly complementary with tomato long non-coding
RNA (lncRNA), termed as SlLNR1 [56]. They showed that vsiR-
NAs derived from the 25-nt IR sequence induce silencing of
SlLNR1 and this SlLNR1 downregulation is associated with
stunted and curled leaf phenotypes reminiscent of TYLCV symp-
toms. While selecting the target region, it is essential to avoid such a
region for RNAi vector construction. Some of the transgenic
banana lines expressing BBTV movement protein hairpin RNA
displayed a high level of resistance to Banana bunchy top virus
(BBTV) [57].
4.2 Size of Target RNAi constructs expressing the different lengths of the viral target
Gene Sequences sequence have been successfully tested in various plants [58]. A
hairpin construct expressing both a short sequence of 50–150 bp
and a longer sequence up to 2.5 kbp were protective [59]. However,
the longer viral sequence may also cause off-target silencing of host
genes causing a negative impact on plant development or physiol-
ogy. RNAi technique was also successfully applied to silencing the
gusA reporter gene expression in banana using the ihp-RNA vector
containing 299-nt gusA gene sequence [60], while banana trans-
formed with ihp-RNAi vector expressing small 28 bp and 21 bp
RNA duplexes, respectively did not cause any silencing. Hairpin
construct with 250–500 bp of viral sequence can be the ideal size
for antiviral RNA vector construction.
4.3 Selection Many isolates exist for a particular plant viral pathogen. Usually, the
of Conserved Gene virus isolates show significant nucleotide sequence variation among
Sequences them. As the RNAi method is dependent on sequence homology, it
is essential to identify conserved gene region among the virus
isolates and use it for hairpin RNA vector construction to confer
durable virus resistance. Viruses containing 10% nucleotide diver-
gence are insensitive to this form of resistance.
4.4 Selection of Viral Plant’s RNA silencing machinery in response to viral infection
Genomic Regions produces a huge number of vsiRNAs covering almost the entire
Producing the Desired viral genomic region. However, successful induction of antiviral
Level of siRNAs RNA silencing depends on the capability of vsiRNA molecules to
interfere specially and effectively with viral protein translation or
viral replication. Previous studies suggested that among the bulk of
vsiRNAs, only a small subset of them referred to as esiRNAs (effec-
tive siRNAs) act antivirally and support RNA silencing by interfer-
ing with viral transcription or replication [61, 62]. The bulk of
these non-effective siRNAs may function as decoys that saturate or
mislead the silencing machinery and thus benefit the pathogen
[63]. For example, during Cauliflower mosaic virus (CaMV) infec-
tion of Arabidopsis, the majority of vsiRNAs were produced from
the highly structured 600 nt leader sequence of 35S RNA viral
transcript [63]. However, the massive amount of siRNA from the
leader sequence does not restrict viral multiplication and these
siRNAs are proposed to engage the plant silencing machinery
fully to prevent gene silencing of another important region of the
virus genome [63]. Such a decoy strategy would protect other viral
regions from silencing at both transcriptional and posttranscrip-
tional levels.
To support this hypothesis, mutations in the siRNA hotspot
sequences within an RNAi target region did not break RNAi-
mediated antiviral immunity [52], indicating that the transgenic
siRNAs targeting non-hotspot viral sequences are sufficiently pro-
tective. Zhao and Song [64] reported that RNAi-transgenic cherry
plants resistant to an RNA ilarvirus accumulated siRNAs of low
abundance (0.2% of total sRNAs), but still due to the predomi-
nance of 24-nt and 21-nt classes with a strong bias to 50 A and 50 U,
respectively, could explain the protectiveness of low abundance
siRNAs. It is becoming more evident that viral genomic regions
that produce fewer siRNAs in plants are ideal targets for gene
silencing than viral siRNA hotspot regions which might deliberately
produce siRNA decoys [63, 65]. Small RNA sequencing of virus-
infected plants will help identify the low abundance non-hotspot
viral gene regions for RNAi vector construction and thereby hot-
spot region in the viral genome can be avoided.
4.5 Identification A major drawback in the identification of antiviral effective siRNAs

of Viral Target Region (esiRNAs) is the lack of suitable molecular techniques or bioinfor-
Producing Antiviral matics tools. However, recently, Gago-Zachert and coworkers [66]
Effective siRNAs developed a novel in vitro based screening approach to enable rapid
functional identification of esiRNAs and also proved its effective-
ness by expressing the target esiRNAs identified using microRNA
based vector. The functionality of esiRNAs depends crucially on
two properties: the binding affinity to Argonaute endonucleases
and the ability to access the target RNA. Thus one promising
approach to attain antiviral resistance in a plant is to especially
stimulate RNA silencing.
5 Approaches for Reducing Off-Target Silencing
Apart from vsiRNAs targeting viral transcripts/genome, vsiRNAs

also regulate host gene targets that may favor viral infection. In
silico target-prediction analyses have proposed many host genes
that could be potentially regulated by vsiRNAs. Silencing of host
genes will occur when there is near-perfect complementarity
between a viral siRNA and the host genes [67, 68]. Yang and
coworkers [69] identified 273 rice genes that were significantly
downregulated during rice stripe virus (RSV) infection, in that
192 (70.3%) were potential targets of vsiRNAs based on sequence
complementarity. Cucumber mosaic virus (CMV) Y-satellite RNA
(Y-sat) is a non-coding subviral RNA molecule that modifies typical
bright yellow mosaic symptoms induced by CMV in its natural host
Nicotiana tabacum. They showed that chlorophyll biosynthetic
gene, CHLI mRNA contains a 22-nt complementary sequence to
the Cucumber mosaic virus (CMV) Y-satellite RNA (Y-Sat), and in
Y-Sat-infected plants, CHLI expression is dramatically downregu-
lated due to Y-Sat derived siRNAs [68]. Tomato spotted wilt virus
(TSWV)-derived vsiRNAs is known to mediate downregulation of
several tomato genes [70]. Tomato spotted wilt virus-derived siRNA
was found to potentially target a gamut of host genes involved in
basal cellular activities, transcription factors, membrane transpor-
ters, and cytoskeletal proteins [71]. qRT-PCR validation of target
gene expression showed that none of the selected transcripts from
tomato cv. Marglobe showed up-regulation, and all were down-
regulated even upto 20-folds. Finally, using siRNA and degradome
data, a recent study performed in Vitis vinifera showed that several
host transcripts were subjected to cleavage by vsiRNAs of the
Grapevine fleck virus (GFkV) and the Grapevine rupestris stem
pitting-associated virus (GRSPaV) [62].
One of the limitations of RNAi technique is the off-target
effects of siRNA that might silence non-target host genes
[71]. Thus, for developing an antiviral RNAi construct, it is essen-
tial to select the target viral gene sequence (in silico generated
potential siRNAs) is not having significant sequence similarity to
host plant genes. Through DNA sequence homology search will
help to identify the specific viral gene sequence suitable for hairpin
RNA vector construction.
The RNAi-mediated strategy offers selective gene silencing,
but not absolute specificity. Off-site targeting risks, where
transgene-derived siRNAs silence host genes based on sufficient
nucleotide sequence complementarity, can occur [72]. The effects
of this off-target silencing may be unexpected phenotypic changes
that can significantly impact agronomic performance or have other
adverse effects on host genes [73]. Viral-derived siRNAs triggered
antiviral defence hijack the host RNA silencing system to target
complementary host transcripts. The vsiRNA were shown to target

host genes with weak base pairings as a match pattern [68]. PsRobot
is a web-based tool that is easy to use and is dedicated to the
identification of the target for miRNAs [74]. Profiles of siRNAs
from Cotton leaf curl Multan virus (CLCuMV) and CLCuMB
(Cotton leaf curl Multan betasatellite) infected upland cotton (Gos-
sypium hirsutum) plants by deep sequencing were done by Wang
and coworkers [75]. They used this software to identify cotton
mRNAs targeted by vsiRNAs derived from CLCuD. Hundreds of
host transcripts targeted by vsiRNAs were predicted, many of which
encode transcription factors associated with biotic and abiotic stres-
ses. The RNAi construct must be capable of producing one or more
efficient siRNA for each viral gene targeted for silencing. There are
a number of siRNA design tool on the Web. An advanced web
server named pssRNAit (plant-specific small non-coding RNAi
tool) that can be used to find off-target genes in plants [76]. In
the case of using about 200 bp long sequence for silencing will
produce a number of siRNAs and the chance to have highly efficient
among them is quite high. However, this would also increase the
chance of matching off-targets that need to be taken into
consideration.
6 Conclusion
RNAi-based technology was successfully used for the control of

both DNA and RNA viruses in many crop plants. However, the
level of resistance in many cases is not sufficient for field cultivation.
Several factors influence the effectiveness of RNAi-based method
for virus disease control. Most often one or two coding regions of
the virus is silenced for engineering disease resistance in plants
leading to a moderate level of resistance. It is possible to enhance
the level of virus resistance by including more than two coding
regions of the virus for RNAi vector construction. Often host genes
are silenced by the vsiRNA thereby weakening the plant defence
system. While selecting the target region for gene silencing, it is
essential to avoid such a region to prevent off-target silencing.
Selection of suitable target regions for RNAi vector construction
can help to achieve a high level of transgenic virus resistance.
Acknowledgments
Support from DBT-BIRAC, DBT-NER and ICAR-NPFGGM are

acknowledged.
References
1. Duan C-G, Wang C-H, Guo H-S (2012) 14. Moissiard G, Voinnet O (2006) RNA silencing
Application of RNA silencing to plant disease of host transcripts by cauliflower mosaic virus
resistance. Silence 3:5 requires coordinated action of the four Arabi-
2. Pumplin N, Voinnet O (2013) RNA silencing dopsis Dicer-like proteins. Proc Natl Acad Sci
suppression by plant pathogens: defence, U S A 103:19593–19598
counter-defence and counter-counter-defence. 15. Blevins T, Rajeswaran R, Shivaprasad PV et al
Nat Rev Microbiol 11:745–760 (2006) Four plant Dicers mediate viral small
3. Llave C, Kasschau KD, Carrington JC (2000) RNA biogenesis and DNA virus induced
Virus-encoded suppressor of posttranscrip- silencing. Nucleic Acids Res 34:6233–6246
tional gene silencing targets a maintenance 16. Deleris A, Gallego-Bartolome J, Bao J et al
step in the silencing pathway. Proc Natl Acad (2006) Hierarchical action and inhibition of
Sci U S A 97:13401–13406 plant Dicer-like proteins in antiviral defense.
4. Head SR, Komori HK, LaMere SA et al (2014) Science 313:68–71
Library construction for next-generation 17. Garcia-Ruiz H, Takeda A, Chapman EJ et al
sequencing: overviews and challenges. Bio- (2010) Arabidopsis RNA-dependent RNA
Techniques 56:61–77 polymerases and dicer-like proteins in antiviral
5. Gonsalves D (2006) Transgenic papaya: devel- defense and small interfering RNA biogenesis
opment, release, impact and challenges. Adv during Turnip Mosaic Virus infection. Plant
Virus Res 67:317–354 Cell 22:481–496
6. Lindbo JA, Falk BW (2017) The impact of 18. Qu F, Ye X, Morris TJ (2008) Arabidopsis
“coat protein-mediated virus resistance” in DRB4, AGO1, AGO7, and RDR6 participate
applied plant pathology and basic research. in a DCL4-initiated antiviral RNA silencing
Phytopathology 107:624–634 pathway negatively regulated by DCL1. Proc
7. De Faria JC, Aragão FJL, Souza T et al (2016) Natl Acad Sci U S A 105:14732–14737
Golden mosaic of common beans in Brazil: 19. Wang M-B, Masuta C, Smith NA, Shimura H
management with a transgenic approach. (2012) RNA silencing and plant viral diseases.
EmbrapaArroz e Feijão- Mol Plant-Microbe Interact 25:1275–1285
Artigoemperiódicoindexado 20. Carbonell A, Fahlgren N, Garcia-Ruiz H et al
8. Kung Y-J, You B-J, Raja JAJ et al (2015) (2012) Functional analysis of three Arabidopsis
Nucleotide sequence-homology-independent ARGONAUTES using slicer-defective
breakdown of transgenic resistance by more mutants. Plant Cell 24:3613–3629
virulent virus strains and a potential solution. 21. Wassenegger M (2000) RNA-directed DNA
Sci Rep 5:9804 methylation. In: Plant gene silencing. Springer,
9. Fuentes A, Carlos N, Ruiz Y et al (2016) Field pp 83–100
trial and molecular characterization of RNAi- 22. Borges F, Martienssen RA (2015) The expand-
transgenic tomato plants that exhibit resistance ing world of small RNAs in plants. Nat Rev
to tomato yellow leaf curl geminivirus. Mol Mol Cell Biol 16:727–741
Plant-Microbe Interact 29:197–209 23. Incarbone M, Dunoyer P (2013) RNA silenc-
10. Mehta D, Stürchler A, Anjanappa RB et al ing and its suppression: novel insights from in
(2019) Linking CRISPR-Cas9 interference in planta analyses. Trends Plant Sci 18:382–392
cassava to the evolution of editing-resistant 24. Jagtap UB, Gurav RG, Bapat VA (2011) Role
geminiviruses. Genome Biol 20:80 of RNA interference in plant improvement.
11. Pitzalis N, Heinlein M (2018) The roles of Naturwissenschaften 98:473–492
membranes and associated cytoskeleton in 25. Wieczorek P, Obre˛palska-Ste˛plowska A (2015)
plant virus replication and cell-to-cell move- Suppress to survive—implication of plant
ment. J Exp Bot 69:117–132 viruses in PTGS. Plant Mol Biol Report 33:
12. Molnár A, Csorba T, Lakatos L et al (2005) 335–346
Plant virus-derived small interfering RNAs 26. Himber C, Dunoyer P, Moissiard G et al
originate predominantly from highly (2003) Transitivity-dependent and-indepen-
structured single-stranded viral RNAs. J Virol dent cell-to-cell movement of RNA silencing.
79:7812–7818 EMBO J 22:4523–4533
13. Pooggin MM (2013) How can plant DNA 27. Dunoyer P, Himber C, Ruiz-Ferrer V et al
viruses evade siRNA-directed DNA methyla- (2007) Intra-and intercellular RNA interfer-
tion and silencing? Int J Mol Sci 14: ence in Arabidopsis thaliana requires
15233–15259
components of the microRNA and heterochro- 41. Pooggin M, Shivaprasad PV, Veluthambi K,
matic silencing pathways. Nat Genet 39: Hohn T (2003) RNAi targeting of DNA virus
848–856 in plants. Nat Biotechnol 21:131–132
28. Sanford JC, Johnston SA (1985) The concept 42. Aragão FJL, Faria JC (2009) First transgenic
of parasite-derived resistance—deriving resis- geminivirus-resistant plant in the field. Nat
tance genes from the parasite’s own genome. Biotechnol 27:1086–1088
J Theor Biol 113:395–405 43. Valli AA, Gallo A, Rodamilans B et al (2018)
29. Abel PP, Nelson RS, De B et al (1986) Delay of The HCPro from the Potyviridae family: an
disease development in transgenic plants that enviable multitasking Helper Component that
express the tobacco mosaic virus coat protein every virus would like to have. Mol Plant
gene. Science 232:738–743 Pathol 19:744–763
30. Lindbo JA, Dougherty WG (1992) Untrans- 44. Schoelz JE, Angel CA, Nelson RS, Leisner SM
latable transcripts of the tobacco etch virus coat (2016) A model for intracellular movement of
protein gene sequence can interfere with Cauliflower mosaic virus: the concept of the
tobacco etch virus replication in transgenic mobile virion factory. J Exp Bot 67:2039–2048
plants and protoplasts. Virology 189:725–733 45. Kalantidis K, Psaradakis S, Tabler M, Tsagris M
31. Voinnet O (2001) RNA silencing as a plant (2002) The occurrence of CMV-specific short
immune system against viruses. Trends Genet RNAs in transgenic tobacco expressing virus-
17:449–459 derived double-stranded RNA is indicative of
32. Goldbach R, Bucher E, Prins M (2003) Resis- resistance to the virus. Mol Plant-Microbe
tance mechanisms to plant viruses: an overview. Interact 15:826–833
Virus Res 92:207–212 46. Dalakouras A, Tzanopoulou M, Tsagris M et al
33. Pooggin MM (2017) RNAi-mediated resis- (2011) Hairpin transcription does not neces-
tance to viruses: a critical assessment of meth- sarily lead to efficient triggering of the RNAi
odologies. Curr Opin Virol 26:28–35 pathway. Transgenic Res 20:293–304
34. Hamilton AJ, Brown S, Yuanhai H et al (1998) 47. Beyene G, Chauhan RD, Ilyas M et al (2017) A
A transgene with repeated DNA causes high virus-derived stacked RNAi construct confers
frequency, post-transcriptional suppression of robust resistance to cassava brown streak dis-
ACC-oxidase gene expression in tomato. ease. Front Plant Sci 7:2052
Plant J 15:737–746 48. Wagaba H, Beyene G, Aleu J et al (2017) Field
35. Waterhouse PM, Graham MW, Wang M-B level RNAi-mediated resistance to Cassava
(1998) Virus resistance and gene silencing in brown streak disease across multiple cropping
plants can be induced by simultaneous expres- cycles and diverse East African agro-ecological
sion of sense and antisense RNA. Proc Natl locations. Front Plant Sci 7:2060
Acad Sci U S A 95:13959–13964 49. Hameed A, Tahir MN, Asad S et al (2017)
36. Wesley SV, Helliwell CA, Smith NA et al RNAi-mediated simultaneous resistance
(2001) Construct design for efficient, effective against three RNA viruses in potato. Mol Bio-
and high-throughput gene silencing in plants. technol 59:73–83
Plant J 27:581–590 50. Tatineni S, Sato S, Nersesian N et al (2020)
37. Smith NA et al (2000) Gene expression—total Transgenic wheat harboring an RNAi element
silencing by intron-spliced hairpin RNAs. confers dual resistance against synergistically
Nature 407:319320 interacting wheat streak mosaic virus and triti-
38. Chen Y-K, Lohuis D, Goldbach R, Prins M cum mosaic virus. Mol Plant-Microbe Interact
(2004) High frequency induction of 33:108–122
RNA-mediated resistance against Cucumber 51. Noris E, Lucioli A, Tavazza R et al (2004)
mosaic virus using inverted repeat constructs. Tomato yellow leaf curl Sardinia virus can over-
Mol Breed 14:215–226 come transgene-mediated RNA silencing of
39. Ramesh SV, Mishra AK, Praveen S (2007) two essential viral genes. J Gen Virol 85:
Hairpin RNA-mediated strategies for silencing 1745–1749
of tomato leaf curl virus AC1 and AC4 genes 52. Leibman D, Wolf D, Saharan V et al (2011) A
for effective resistance in plants. Oligonucleo- high level of transgenic viral small RNA is asso-
tides 17:251–257 ciated with broad potyvirus resistance in cucur-
40. Seemanpillai M, Dry I, Randles J, Rezaian A bits. Mol Plant-Microbe Interact 24:
(2003) Transcriptional silencing of geminiviral 1220–1238
promoter-driven transgenes following homol- 53. Ahmad A, Zia-Ur-Rehman M, Hameed U et al
ogous virus infection. Mol Plant-Microbe (2017) Engineered disease resistance in cotton
Interact 16:429–438 using RNA-interference to knock down
Cotton leaf curl Kokhran virus-Burewala and 65. Rajeswaran R, Golyaev V, Seguin J et al (2014)
Cotton leaf curl Multan betasatellite expres- Interactions of Rice tungro bacilliform parare-
sion. Viruses 9:257 trovirus and its protein P4 with plant
54. Kumar S, Tanti B, Patil BL et al (2017) RNAi- RNA-silencing machinery. Mol Plant-Microbe
derived transgenic resistance to Mungbean yel- Interact 27:1370–1378
low mosaic India virus in cowpea. PLoS One 66. Gago-Zachert S, Schuck J, Weinholdt C et al
12:e0186786 (2019) Highly efficacious antiviral protection
55. Mahmoudieh M, Noor MRM, Harikrishna JA, of plants by small interfering RNAs identified
Othman RY (2019) Tomato Solanumlycoper- in vitro. Nucleic Acids Res 47:9343–9357
sicum expressing the overlapping regions of 67. Addo-Quaye C, Eshoo TW, Bartel DP, Axtell
three begomovirus genes exhibit resistance to MJ (2008) Endogenous siRNA and miRNA
Ageratum yellow vein Malaysia virus. Physiol targets identified by sequencing of the Arabi-
Mol Plant Pathol 108:101425 dopsis degradome. Curr Biol 18:758–762
56. Yang Y, Liu T, Shen D et al (2019) Tomato 68. Smith NA, Eamens AL, Wang M-B (2011)
yellow leaf curl virus intergenic siRNAs target a Viral small interfering RNAs target host genes
host long noncoding RNA to modulate disease to mediate disease symptoms in plants. PLoS
symptoms. PLoS Pathog 15:e1007534 Pathog 7:e1002022
57. Debbarma R (2019) Studies on genetic trans- 69. Yang M, Xu Z, Zhao W et al (2018) Rice stripe
formation of banana for imparting banana virus-derived siRNAs play different regulatory
bunchy top virus resistance. Dissertation, roles in rice and in the insect vector Laodelphax
Tamil Nadu Agricultural University, striatellus. BMC Plant Biol 18:219
Coimbatore 70. Ramesh SV, Williams S, Kappagantu M et al
58. Cillo F, Palukaitis P (2014) Transgenic resis- (2017) Transcriptome-wide identification of
tance. In: Advances in virus research. Elsevier, host genes targeted by tomato spotted wilt
pp 35–146 virus-derived small interfering RNAs. Virus
59. Liu YP, Haasnoot J, Berkhout B (2007) Design Res 238:13–23
of extended short hairpin RNAs for HIV-1 71. Malik I, Garrido M, B€ahr M et al (2006) Com-
inhibition. Nucleic Acids Res 35:5683–5693 parison of test systems for RNA interference.
60. Dang TVT, Windelinckx S, Henry IM et al Biochem Biophys Res Commun 341:245–253
(2014) Assessment of RNAi-induced silencing 72. Casacuberta JM, Devos Y, Du Jardin P et al
in banana (Musa spp.). BMC Res Notes 7:655 (2015) Biotechnological uses of RNAi in
61. Szittya G, Moxon S, Pantaleo V et al (2010) plants: risk assessment considerations. Trends
Structural and functional analysis of viral siR- Biotechnol 33:145–147
NAs. PLoS Pathog 6:e1000838 73. Jackson AL, Linsley PS (2010) Recognizing
62. Miozzi L, Gambino G, Burgyan J, Pantaleo V and avoiding siRNA off-target effects for target
(2013) Genome-wide identification of viral identification and therapeutic application. Nat
and host transcripts targeted by viral siRNAs Rev Drug Discov 9:57–67
in Vitis vinifera. Mol Plant Pathol 14:30–43 74. Wu H-J, Ma Y-K, Chen T et al (2012) PsRo-
63. Blevins T, Rajeswaran R, Aregger M et al bot: a web-based plant small RNA meta-
(2011) Massive production of small RNAs analysis toolbox. Nucleic Acids Res 40:
from a non-coding region of Cauliflower W22–W28
mosaic virus in plant defense and viral 75. Wang J, Tang Y, Yang Y et al (2016) Cotton
counter-defense. Nucleic Acids Res 39: leaf curl Multan virus-derived viral small RNAs
5003–5014 can target cotton genes to promote viral infec-
64. Zhao D, Song G (2014) Rootstock-to-scion tion. Front Plant Sci 7:1162
transfer of transgene-derived small interfering 76. Ahmed F, Senthil-Kumar M, Dai X et al (2020)
RNA s and their effect on virus resistance in pssRNAit-a web server for designing effective
nontransgenic sweet cherry. Plant Biotechnol J and specific plant siRNAs with genome-wide
12:1319–1328 off-target assessment. Plant Physiol 184:65–81
Chapter 3
Genome Editing and Designer Crops for the Future

Sumi Rana, Pooja Rani Aggarwal, Varsa Shukla, Urmi Giri,
Shubham Verma, and Mehanathan Muthamilarasan
Abstract
Domestication spanning over thousands of years led to the evolution of crops that are being cultivated in
recent times. Later, selective breeding methods were practiced by human to produce improved cultivars/
germplasm. Classical breeding was further transformed into molecular- and genomics-assisted breeding
strategies, however, these approaches are labor-intensive and time-consuming. The advent of omics
technologies has facilitated the identification of genes and genetic determinants that regulate particular
traits allowing the direct manipulation of target genes and genomic regions to achieve desirable phenotype.
Recently, genome editing technologies such as meganucleases (MN), zinc-finger nucleases (ZFNs), tran-
scription activator-like effector nucleases (TALENs), and CRISPR (clustered regularly interspaced short
palindromic repeats)/CRISPR-Associated protein 9 (Cas9) have gained popularity for precise editing of
genes to develop crop varieties with superior agronomic, physiological, climate-resilient, and nutritional
traits. Owing to the efficiency and precision, genome editing approaches have been widely used to design
the crops that can survive the challenges posed by changing climate, and also cater the food and nutritional
requirements for ever-growing population. Here, we briefly review different genome editing technologies
deployed for crop improvement, and the fundamental differences between GE technology and transgene-
based approach. We also summarize the recent advances in genome editing and how this radical expansion
can complement the previously established technologies along with breeding for creating designer crops.
Key words Genome editing, Crop improvement, Meganucleases, Zinc-finger nucleases, Transcrip-
tion activator-like effector nucleases (TALENs), CRISPR/Cas9, Synthetic biology
1 Introduction
Agriculture and food security have emerged as a subject of global

attention, since the population is increasing exponentially and esti-
mated to exceed nine billion by the end of 2050. In addition to the
population, the world is also witnessing the challenges such as
extreme weather changes, contraction and degradation of agrarian
land, and reduced availability of water. Several alterations are
required in the conventional agricultural practices to produce
high yielding, nutritive, safe, and low-cost food crops. Although
37
38 Sumi Rana et al.
conventional breeding has been expedited to a great extent in past

few decades, it is still not attainable to meet the requirement of
growing population. Classical breeding method for crop improve-
ment is based on the crossing of two elite cultivars with desired
agronomic traits, followed by germplasm selection that is tedious
and time-consuming [1]. Therefore, advanced technologies are
incorporated in agricultural practice to enhance the quantity and
quality of crops wherein techniques such as genetic engineering and
gene/genome editing serve the purpose by targeted editing of the
genomic region for improved traits in less time. Also, manipulation
of crops with complex genome is one of the major challenges faced
by conventional breeding that can be effectively achieved by
genome editing [2]. With genome editing, endogenous gene
(s) of a crop is edited using various molecular tools, whereas
using genetic engineering, transgene(s) or gene elements with
desired traits are expressed or endogenous genes are silenced in a
crop. Expression multiple transgenes is also feasible in a crop using
the method called gene stacking [3]. Despite the assurance
provided by genetically modified (GM) crops for global food secu-
rity, use of these crops is associated with undetermined health and
environmental safety concerns. As a result, genome editing is con-
templated as a collection of techniques having potential to modify
the targeted genomic region with efficiency and precision.
One of the major advancements in genome editing was the
discovery of programmed sequence-specific nucleases (SSNs) that
produces double-stranded breaks (DSBs) in the desired location of
a gene, which further activates DNA repair mechanism by either
non-homologous end joining (NHEJ) or homology-directed
recombination (HDR) pathway. Homologous template is required
to repair the double-stranded break using the HDR pathway,
whereas in NHEJ pathway, double-stranded breaks are directly
joined that might produce undesirable mutations by deletion, inte-
gration, replacement, substitution, and insertion. Since HDR path-
way utilizes a homologous template to join the DSBs, it was found
more reliable and efficient in targeted alteration of the genome
[4]. Use of zinc-finger nuclease (ZFNs), transcription activator-
like effector nucleases (TALENs), programmed homing nuclease
(Meganucleases), transposons, recombinant Adeno-Associated virus
(rAAV) or CRISPR/Cas9 is proven most effective to generate
targeted DSBs in the past [5]. In 2011, genome alteration using
engineered nucleases was declared as the “Method of the year” by
“Nature Methods.” Further, it was selected as the “Breakthrough
of the year” by “Science” for utilizing TALENs in genome editing
in 2012.
The scope of genome editing tools is further expanded from
the first-generation genome editing tools viz. MNs, ZFNs, and
TALENs to the second-generation editing tools such as CRISPR
(clustered regularly interspaced short palindromic repeats)/
Genome Editing and Designer Crops for the Future 39
CRISPR Associated protein 9 (Cas9). CRISPR/Cas9 is more pre-

cise as it uses Cas9 nickase for base editing along with the enzyme
aiding base conversion. For instance, cytidine deaminase that forms
uracil from cytosine, also causes substitution from C-G to T-A
[6]. In addition, an efficient system was developed for base editing
using adenine deaminase by protein engineering and directed evo-
lution [7]. It is evident that gene disruption and gene knockout can
be performed using base editing as it generates nonsense as well as
point mutation [8]. One of the limitations of genome editing tools
was off-target modification, due to the abundance of nucleases in
plants. Thus, DNA-free genome editing was employed for creating
specific and targeted modification in the genomic regions.
CRISPR-Cas9 ribonucleoproteins have shown higher editing effi-
ciency as compared to DNA cassettes [9]. CRISPR/Cas9 has been
widely used in crop improvement in the past decade. In this chap-
ter, we discuss the techniques used for genome editing and com-
pare the use of genome editing tools with transgene-based
approach for crop improvement.
2 Genome Editing Approaches in Plants and Their Application in Crop Improvement
2.1 Meganucleases MNs were the first homing endonucleases among all the SSNs
(MN) employed for genome editing in model plant, Arabidopsis
[10, 11] and crops such as maize [12–14], rice [15, 16], soybean
[17], and wheat [18]. MNs are classified into multiple endonucle-
ase families, of these, the LAGLIDADG family was found to be the
most potent for genetic engineering [19]. Homing endonucleases
function as homodimer that forms two compact active sites facil-
itating the breakage of double-stranded DNA [20], which recruits
the HDR machinery. MNs also use NHEJ pathway as an alternate
for repairing DSBs (Fig. 1). However, the NHEJ method is error-
prone resulting in gene inactivation [21].
Endonuclease 1 (Sce1) and its isoforms derived from yeast
(Saccharomyces cerevisiae) is predominantly used among all homing
endonucleases and it participates in DSB repair mechanism
[22]. MNs report the direct interaction between DNA and protein
side chains and are able to identify up to 18 base pair (bp) long
sequences. These homing endonucleases are sequence-specific,
thus, any alteration in the amino acid sequence leads to the modifi-
cation in their sequence specificity [23] (Fig. 1). MNs were consid-
ered as programmable nucleases and potential candidates for crop
improvement [19]. However, these homing endonucleases have
some disadvantages: (1) DNA binding domain and nuclease
domain overlap each other, therefore, it becomes challenging to
engineer these domains, and (2) the nuclease recognition site has to
be introduced in the plant genome that doesn’t occur naturally
40 Sumi Rana et al.
Fig. 1 Mechanism of meganucleases-mediated gene editing. Meganucleases, the first homing endonu-
cleases, cut at specific site at dsDNA and generates double-stranded breakage. When a double-strand
break is targeted between two direct repeats, it may result in (a) insertions or deletions of various sizes,
leading to gene inactivation, (b) homologous recombination leading to deletion of one repeat together with the
intervening sequence, (c) gene insertion, or (d) correction can be achieved by the introduction of a DNA repair
matrix containing sequences homologous to the endogenous sequence surrounding the DNA break
[19, 24]. Altogether, these limitations impose restrictions to use

MNs for plant genome editing.
2.2 Zinc-Finger The basic structure of ZFNs consists of the fusion of zinc-finger-
Nuclease (ZFN) based DNA recognition modules with a DNA cleavage domain
derived from the restriction enzyme Fok1. The fusion takes place
between individual zinc fingers with assigned nucleotide triplets.
These fingers are often clustered into groups and bind to specific
DNA sequences. ZFNs introduce site-specific, double-strand DNA
break into the locus of interest, which is often repaired using HDR
Fig. 2 Mode of action of zinc finger nucleases in genome editing. A ZFN designed to create a DNA double-
strand break (DSB) in the target locus is composed of two monomer subunits. Each subunit encompasses
three zinc-fingers (gray boxes 1-2-3), which recognizes 9 base pairs within the full target site, and the
Nuclease Domain endonuclease (pink). FokI (yellow) is an endonuclease that gets activated upon dimerization
and cleaves DNA. A short linker (black curved arrow) connects the two domains. After dimerization the
nuclease is activated and cuts the DNA in the spacer sequence, separating the two target half sites i.e., left
and right half target sites. When a DSB is targeted between two direct repeats, it may result in (a) insertions or
deletions of various sizes, leading to gene inactivation, (b) homologous recombination leading to deletion of
one repeat together with the intervening sequence, (c) gene insertion, or (d) correction can be achieved by the
introduction of a DNA repair matrix containing sequences homologous to the endogenous sequence surround-
ing the DNA break
42 Sumi Rana et al.
or NHEJ repair (Fig. 2). NHEJ can disrupt a gene structure as it

induces small insertion or deletion at the site of the DNA breakage.
Alternatively, through HDR, gene correction can be accomplished
if an investigator-designed homologous donor DNA is provided in
conjugation with the ZFNs, which can be used as a template to
repair the DSB [25]. ZFNs were initially exploited as site-specific
mutagens in Arabidopsis and tailored for carrying a semi-
palindromic domain for typical QQR ZFN [26, 27]. These QQR
ZFN were reported to be induced by heat, due to the presence of
heat-shock promoter upstream to the QQR region. The expression
of QQR ZFN during heat ensured its regulated expression at
different developmental stages in transgenic Arabidopsis
[28]. The first classical example of ZFN’s application to crop
improvement was the generation of herbicide-tolerant maize. The
editing was accomplished by insertion of PAT (phosphinothricin
acetyl transferase) gene cassettes into the endogenous maize
ZmIPK1 (inositol-pentakisphosphate 2-kinase) leading to altera-
tions in the inositol phosphate profile of developing maize seedlings
[12]. Maize was considered as the model plant for combining more
than one desirable trait using the stacking approach, thereby
providing new goals to improved agricultural trait [29]. ZFNs
have also been utilized for the identification of target domains for
desired gene introduction in rice [30].
Till date, ZFNs have successfully shown genetic modification in
plant species viz. Arabidopsis, tobacco, soybean, rice, apple, fig,
maize, and Petunia [31, 32]. Single nucleotide replacement at
break site can be easily located due to the accuracy of ZFNs in
plants [33]. Although ZFNs can deal with any sequence virtually
[34], their efficiency was low due to the ambiguous design and
large structure of ZFNs [35].
2.3 Transcription TALENs are the combination of the transcriptional activator-like

Activator-Like Effector effector (TALE) repeats and the restriction enzyme Fok1. It is
Nucleases (TALENs) conceptually similar to the ZFNs. TALE repeat has a single nucleo-
tide repeat making it more specific and efficient than ZFNs (Fig. 3).
TALEN-mediated gene-editing tool has been used to modify the
nutritional profiles, shelf life and stress tolerance of numerous food
crops. The knockdown of vacuolar invertase (VInv) gene led to the
reduction in cold-induced sweetening in potato [36]. In rice,
blight-resistant mutants were generated by disrupting the bacterial
blight susceptibility gene SWEET14 using TALEN [37]. TALENs
were used to generate Brassica oleracea with a mutation in FRI
(FRIGIDA) gene, which regulates vernalization [38]. Further,
TALEN was applied to knock down three MLO (mildew-resistance
locus O) homologs in hexaploid bread wheat that increased herita-
ble resistance to powdery mildew disease [18]. It was also used to
produce maize mutant exhibiting improved glossy (gl) phenotype
by inducing stable and heritable mutation in GLOSSY2 (GL2) locus
Fig. 3 Genome editing using transcription activator-like effector nuclease. The target site of TALEN (blue) is
recognized by the “left” and “right” half monomer, each consisting of a tandem repeat of TALE. Each TALE
repeat comprises a 34 amino acids unit that differs at two hypervariable amino acid located at the 12th and
13th position, known as Repeat Variable Diresidue (RVD), which determines the recognition specificity of each
repeat. The TALEN monomer consists of an N-terminal domain containing a nuclear localization signal (NLS,
red), a recognition domain typically composed of tandem TALE repeats (in boxes), and a C-terminal function
domain that comprises the endonuclease (FokI). Simultaneous bindings of the left and right TALE enable
dimerization (blue) of the endonuclease (FokI; yellow) cleavage domain. Activation of FokI post dimerization
results in double-strand breaks of the target DNA. Induced DSBs of the target DNA is repaired, as illustrated in
Fig. 1
[13]. In tomato, copy number and efficiency of homologous

recombination have been increased by the fusion of TALENs and
donor DNA into geminivirus replicons. By inserting a strong pro-
moter in the upstream of gene regulating anthocyanin biosynthesis,
high anthocyanin containing purple tomatoes were generated
[39]. Sequence-specific knockout mutations were created in two
fatty acid desaturase genes (FAD2-1A and FAD2-1B) in soybean.
Further, the mutations in FAD2-1A and FAD2-1B were stacked
with mutation in FAD3A that altogether produced increased levels
of monounsaturated oleic acid and decreased level of linolenic acid
[40, 41]. Haploid maize was produced through TALENs by gen-
erating frame-shift mutations in MATRILINEAL (MTL) gene that
inherits essential genes from a single parent [42]. Further,
44 Sumi Rana et al.
improved quality of sugarcane was generated by TALEN-mediated

targeted mutagenesis of COMT (caffeic acid O-methyltransferase)
alleles that led to the modification in cell wall composition and
saccharification efficiency [43].
TAL effector nucleases were used to mutate the endogenous
promoter of primary barley transformants [44]. Further,
Gurushidze et al. [45] used a moderately different protocol to
knockdown GFP (green fluorescent protein) in transgenic barley,
which each carry a single copy of gfp, and reported a frequency of
20% mutation induction in the transgenic barley lines. TALEN-
mediated mutation was generated in the PRO (PORCERA) gene in
tomato using estrogen inducible promoter. The engineered
TALEN construct was disappeared by segregation in successive
generations [46]. A breakthrough study highlighted the possibility
of the introducing MNs and TALENs into the plant cells as purified
protein. The transported nuclease protein was found to be success-
ful in cleaving the host DNA at their targeted endogenous locus,
which was followed by NHEJ repair of the induced DSB. The
nuclease also led to detectable mutations that can be easily detected
by DNA sequencing. However, the mutagenesis frequency of the
technique was lower as compared to genetic transformation which
highlights the need to increase the transformation efficiency. Pro-
duction of plants carrying targeted genome permutations and
combinations would be possible by the novel non-transgenic
genome editing using TALEN [47].
2.4 Clustered CRISPR-Cas9 technology has gained popularity in the scientific

Regularly Interspaced community in recent years due to its accuracy and efficiency as
Short Palindromic compared to the existing technologies used for genome editing.
Repeat (CRISPR) and CRISPR is conserved family of DNA sequences found in prokary-
CRISPR-Associated otic genome such as bacteria and archaea. CRISPRs were originally
Protein 9 (Cas9) discovered in Escherichia coli in 1987 as a part of bacterial genome
editing system that recruit adaptive immune response against for-
eign DNA and induce RNA-guided DNA cleavage [48, 49]. In the
upstream region of the CRISPR loci, a conserved leader sequence is
present which was also found to be well conserved. Cas gene is an
additional feature of CRISPR array which codes for Cas protein.
Cas protein is the endonuclease and a helicase protein that is guided
by a guide RNA (gRNA) that recognizes the complementary target
sequence in the DNA and cleaves the viral genome or plasmids
[50]. These two components together are termed as CRISPR-Cas
system (Fig. 4). Based on the phylogeny, sequence, locus organiza-
tion and content, CRISPR-Cas system is divided into three types,
viz., type I (which has six subtypes, Type I-A to Type I-F), type II
(Subtypes, Type II-A and Type II-B) and type III (Defined by
signature protein Cas10) (Table 1). Among these three types of
CRISPR/Cas 9 systems, type II is the basis of currently used
CRISPR/Cas technology for gene editing. The Cas9 enzyme has
Fig. 4 Schematics of a general CRISPR locus indicating the incorporation of viral protospacer into the spacer of
CRISPR array. CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) has highly conserved short
repeat sequence (23–47 bp) which are separated by short spacer sequences (21–72 bp). In the upstream
region of the CRISPR loci, a conserved leader sequence is present. Another feature of this CRISPR array is the
Cas (CRISPR-associated protein) gene which codes for Cas protein, an endonuclease and helicase protein that
is guided by sgRNA and cleave the viral genome or plasmids. These two components are together called as
CRISPR-Cas system
Table 1
Classification of CRISPR/Cas system
Degradation of
Components of target genetic
Class Type Subtype(s) CRISPR/Cas Sources(s) material
I Type Type I-A, I-B, Cas1, Cas2, Cas3, Pseudomonas aeruginosa, DNA
I I-C, I-U, I-D, Cas5, Cas4, Cas6 Escherichia coli
I-E, I-F and Cas7
Type Type III-A, Cas1, Cas2, Cas6, Lactococcus lactis, DNA/RNA
III III-B, III-C, and Cas10 Staphylococcus epidermidis,
III-D Pyrococcus furiosus
Type Putative Csf1 and Csf4, Cas5, Acidithiobacillus Not known
IV and Cas7 ferrooxidans
II Type Type II-A, II-B, Cas1, Cas2, Cas4/ Neisseria lactamica, DNA
II II-C Csn2, and Cas9 Streptococcus thermophilus
Type Putative Cpf1, Cas1, Cas2, Francisella sp. DNA
V and Cas4
two catalytic centers that can produce breaks in the double-

stranded DNA by acting as a molecular scissor. CRISPR-Cas9 can
be used to generate knockout mutants by co-expressing Cas9 and a
single guide RNA (sgRNA) specific to the target gene present
adjacent to a motif called Protospacer Adjacent Motif (PAM),
which is the binding signal for the Cas9 endonuclease. The
46 Sumi Rana et al.
Fig. 5 Mode of action of CRISPR/Cas9 in facilitating gene editing. Cas9 nuclease acts as genetic scissors
which cuts both the strands of target DNA to introduce mutations. The knock-in mutation is repaired by the
Homology Directed Repair (HDR) mechanism that is used for the repair of targeted DNA. This HDR mechanism
uses exogenous DNA as a repair template and introduces it at the damaged target site. On the other hand,
knockout mutations created by CRISPR/Cas9 are repaired by the mechanism of Non-Homologous End Joining
(NHEJ) that is used to repair the double-strand breaks employing random insertions or deletions at the
targeted site that can alter or abolish gene expression
sgRNA is a complex structure consisting of a dual RNA sequence of

which one is taken from the CRISPR RNA and a separate transcript
(tracrRNA), which binds and stabilizes the Cas9 protein (Fig. 5).
The Cas9-sgRNA complex generates a blunt double-stranded
break by cleaving the DNA resulting in the initiation of a response
from the repair enzyme to replace or disrupt DNA sequences
present at or in the vicinity of the cleavage site [51].
The CRISPR/Cas9 technology generates transgenic lines that
contain CRISPR/Cas9 expression cassette integrated into the
genome. The Cas9 nuclease used for genome editing was obtained
from Streptococcus pyogenes [52]. Earlier, the machinery was used
against geminivirus (single-stranded DNA virus), where the
CRISPR-Cas9 system targeted the viral DNA during its replication
stage. CRISPR/Cas9 system was integrated into the plant genome
to provide resistance against several viruses, including gemini-
viruses. Engineered sgRNA, which targets the ORFs encoding
replication (Rep) and coat protein (CP) of the geminivirus and
the conserved non-coding intergenic region (IR). The engineered
sgRNA which targets the IR region was shown to sharply decrease
the viral quantity of Tomato yellow leaf curl virus (TYLCV) very
efficiently [53]. Further, a cumulative reducing effect on the viral
copy number was achieved by co-expressing two sgRNAs in plant
[54, 55]. Tables 2 and 3 enumerates the studies done to develop
biotic and abiotic stress tolerance in crops using CRISPR/Cas9
approach. Another major concern while targeting plant viruses
using CRISPR was that RNA viruses are more devastating for
crop yield than DNA viruses. Therefore, technologies had to be
developed against RNA viruses. Several Cas protein variants were
developed from other bacterial strains that targets RNA in vivo such
as Cas9 from Francisella novicida (FnCas9), Cas13a from Leptotri-
chia shahii (LshCas13a), and Cas13a from Leptotrichia wadei (Lwa-
Cas13a). In FnCas9, the RNA binding capacity is required for virus
inhibition rather than cleavage capacity. Therefore, FnCas9 and its
sgRNA were engineered against Cucumber mosaic virus (CMV)
and Tobacco mosaic virus (TMV), which resulted in reduced virus
accumulation and disease symptoms in tobacco and
Arabidopsis [35].
The CRISPR/Cas9 system was first deployed in the animal
system which was further adopted by plant community for genome
editing. Researchers had shown targeted editing of polyphenol
oxidase (PPO) gene in the mushroom (Agaricus bisporus) increases
the shelf life [83]. The approach was successfully used for genome
editing in lettuce, followed by maize and wheat [84]. In barley
(Hordeum vulgare) and mustard (Brassica oleracea), CRISPR/
Cas9 mediated genome editing was performed by targeting multi-
copy genes [85]. After targeting two copies of HvPM19 (plasma
membrane proteins) in barley, Cas9 induced mutation was
observed in 23% and 10% lines in the F1 generation, while in
B. oleracea targeting the BolC.GA4.a (ortholog of Arabidopsis
thaliana gibberellin 3 beta-hydroxylase 1) gene led to mutation
in 10% lines of T1 generation [85] (Table 4). Rodrı́guez-Leal et al.
[113] upgraded a useful and simple genetic scheme focusing on the
property of trans-generational transmission of Cas9 activity in het-
erozygous mutants to determine the produced phenotypic effect
due to variation in tomato genes governing fruit size, inflorescence
branching, and plant architecture. The improvement of male fertil-
ity in japonica-indica hybrids has been made by decreasing the
48
Table 2
Genome editing using CRISPR/Cas9 approach for enhancing biotic stress tolerance in plant species
Phytopathology Phytopathology Phytopathology Phytopathology Phytopathology Phytopathology

Arabidopsis Beet severe curly top virus BSCTV coding/non-coding Agrobacterium- Knockout of replication [56]
thaliana (BSCTV) sequences; transient expression mediated mechanism related genes
assays of 43 candidate sites in the using Cas9/
genome; two were selected for gRNA
Sumi Rana et al.
induction of transgenics
Turnip mosaic virus eIF(iso)4E (Eukaryotic translation Agrobacterium- Knockout of genes [57]
initiation factor 4E-1) mediated
using Cas9/
gRNA
Cauliflower mosaic virus CP gene Agrobacterium- Knockout of gene [58]
mediated with
Cas9/sgRNA
Citrus spp. Citrus canker Type I CsLOB1 promoter Agrobacterium- Knockout of target which is a [59]
(Xanthomonas citri (EBEPthA4-CsLOBP) mediated pathogenicity agent
subsp. citri) using Cas9/
gRNA
Citrus canker Promoter of CsLOB1 (Lateral Agrobacterium- Knockout of target gene [60]
(Xanthomonas citri organ boundaries 1) mediated susceptible to disease in citrus
subsp. citri) using Cas9/
gRNA
Cucumis sativus Zucchini yellow mosaic eIF4E (eukaryotic translation Agrobacterium- Knockout of eIF4E that aids in [61]
virus, Ipomovirus, initiation factor 4E) mediated replication of virus in host
Papaya ring spot mosaic using Cas9/
virus-W gRNA
Gossypium Verticillium wilt Gh14-3-3d (14-3-3 protein 6-like) Agrobacterium- Knockout of gene responsible for [62]
hirsutum (Verticillium dahlia) mediated negative regulation against
transformation disease resistance
Nicotiana Cymbidium ringspot virus, AGO2 (Argonaute) Agrobacterium- Knockout of antiviral immunity [63]
benthamiana Carnation Italian mediated gene
ringspot virus, Turnip using Cas9/
crinkle virus gRNA
Tomato yellow leaf curl virus Coding sequences as well as Agrobacterium- Knockout of gene responsible for [53]
non-coding DNA sequences like mediated replication of the virus
CP and IR using Cas9/
gRNA
Cotton leaf curl Multan C1 Rep and IR Agrobacterium- Knockout of gene [64]
virus mediated with
Cas9/sgRNA
Oryza sativa Bacterial blight OsSWEET13 (Bidirectional sugar Agrobacterium- Knockout of gene susceptible [65]
(Xanthomonas oryzae transporter SWEET13-like) mediated PthXo2
pv. oryzae) using Cas9/
gRNA vector
Blast disease (Magnaporthe OsERF922 (Ethylene-responsive Agrobacterium- Knockout of single and multiplex [66]
oryzae) gene) mediated ethylene-responsive
using Cas9/ transcription factors that
gRNA regulates tolerance
Rice tungro spherical virus eIF4G (Translation initiation factor Agrobacterium- Knockout of gene [67]
4 gamma gene) mediated
transformation
Solanum Powdery mildew (Oidium SlMLO (mildew-resistance locus O) Agrobacterium- Knockout of SlMLO gene [68]
lycopersicum neolycopersici) mediated responsible for disease
using Cas9/ susceptibility
gRNA
Triticum Powdery mildew (Blumeria TaMLO-A1 Allele Particle Knockout of target that had role [18]
aestivum graminis f. sp. Triticum) bombardment in subsiding defence
using Cas9/ mechanism
gRNA
49
Table 3
50
Genome editing using CRISPR/Cas9 approach for enhancing abiotic stress tolerance in plant species
Plant Target phenotype Targeted region(s) Transformation method Molecular function(s) References
Arabidopsis Tolerance against salt, drought UGT79B3 as well as Agrobacterium-mediated Knockout of gene [69]
thaliana and cold stress UGT79B2 transformation using
(UDP-glycosyltransferases) Cas9/gRNA and floral dip
Glufosinate resistance and BAR gene: resistance to Agrobacterium-mediated Knockout of gene [70]
Sumi Rana et al.
reduced formation of glufosinate GL1 gene: using Cas9/gRNA

trichomes formation of trichome
Glycine max Salt and drought tolerance Drb2a, Drb2b (dsRNA- Agrobacterium rhizogenes- Stress responsive genes [71]
binding protein) mediated
Linum Tolerance to Glyphosate EPSPS Protoplast transfection with Replacement of gene [72]
usitatissimum (5-enolpyruvylshikimate-3- ssODN and CRISPR-Cas9
phosphate synthase) plasmid
Lotus japonicas Intracellular accommodation of LjLb1, LjLb2, LjLb3: Co-transformation using Knockout of gene [73]
nitrogen-fixing bacteria to leghemoglobin loci SNF Agrobacterium rhizogenes
increase bioavailability of soil genes: Single and multiple and A. tumefaciens
organic nitrogen symbiotic nitrogen fixation
SYMRK: symbiosis receptor-
like kinase
Oryza sativa Tolerance to Salt stress GT-1 element (hexameric Agrobacterium-mediated Knockout of gene [74]
DNA sequence, GAAAAA) with Cas9/sgRNA promoter regulatory
of salt induced OsRAV2 region
Resistance to Herbicide C287 Agrobacterium-mediated Multiplex editing of [75]
genome
Tolerance to Glyphosate EPSPS Co-transformation using Insertion and [76]
(5-enolpyruvylshikimate-3- particle bombardment and replacement using
phosphate synthase) Cas9/gRNA and donor donor template
plasmid
Tolerance to Herbicide Acetolactate synthase (ALS) Calli co-transformation using Replacement of gene [77]
for amino acid biosynthesis particle bombardment and with the donor
Cas9/gRNA with donor oligonucleotide
oligonucleotide
Salinity tolerance OsNAC041(NAM, ATAF, and Agrobacterium-mediated NAC transcription [78]
CUC) transformation factors are responsible
for salinity tolerance
Salinity tolerance OsOTS1 (Overly tolerant to Agrobacterium-mediated Confers salt tolerance [79]
salt) transformation
Solanum Cold tolerance SlCBF1 (C-repeat-binding Agrobacterium-mediated Confers cold tolerance [80]
lycopersicum factor) transformation
Drought tolerance SlNPR1 (Nonexpressor of Agrobacterium-mediated Stress regulation [81]
pathogenesis-related) transformation
Solanum Decreased susceptibility against Acetolactate synthase 1 (ALS1) Agrobacterium-mediated Knockout and [82]
tuberosum ALS-inhibiting herbicides using a geminivirus replacement of gene
replicon for delivery of
CRISPR–Cas9 and donor
Zea mays Increased grain yield when ARGOS8 (Aluminum-induced Co-transformation Using Insertion/replacement [14]
exposed to drought stress protein superfamily) particle bombardment with of gene related to
template of Cas9-sgRNA negative regulation of
ethylene responses
51
Table 4
52
Genome editing using CRISPR/Cas9 approach for enhancing yield contributing agronomic traits in plant species
Plant Phenotype Target regions(s) Transformation method Alterations References
Brassica Pod shatter and control of dormancy HvPM19 BolC.GA4.a Agrobacterium-mediated transformation Knockout [85]
oleracea and of gene
Hordeum
vulgare
Hordeum Modification of N-glycans N-glycan Co-bombardment and co-infection of Multiplex [86]
Sumi Rana et al.
vulgare biosynthesis gene: ENGase sgRNA and wild-type cas9 combinations editing
using different cultures of Agrobacterium of
tumefaciens genome
Camelina Decreased polyunsaturated fatty acid Fatty acid desaturase 2 (FAD2) Agrobacterium-mediated using Cas9/ Knockout [87]
sativa and increased accumulation of gRNA followed by floral dip of gene
oleic acid in oil seed
Increased fatty acid content in seeds Fatty acid desaturase 2 (FAD2) genes Agrobacterium-mediated Using Cas9/ Knockout [88]
gRNA followed by floral dip of gene
Seed oil biosynthesis TAG synthesizing homeologous genes in seed: Floral vacuum infiltration with Multiplex [89]
CsDGAT1/CsPDAT1 transformation using Agrobacterium editing
of
genome
Dendrobium Biosynthesis of lignocellulose Lignocellulose biosynthetic pathway genes: Agrobacterium-mediated Knockout [90]
officinale 4CL, C3H CCR, IRX and C4H of genes
Nicotiana Biotherapeutic protein production Glycan biosynthesis genes viz., FucT: α (1,3) Agrobacterium-mediated Multiplex [91]
tabacum fucosyltransferase and XylT: β (1,2)- editing
xylosyltransferase of
genome
Biotherapeutic protein production XylT and FucT Agrobacterium-mediated Knockout [92]
of gene
Oryza sativa Breeding of early maturing rice Suppressors of flowering heading date (Hd) Agrobacterium-mediated Knockout [93]
cultivar genes: Hd2, Hd4, Hd5 genes of genes
Developing marker free transgenic GUS (β-glucuronidase) gene Agrobacterium-mediated/gene gun and Knockout [94]
plants expression of Cas9 along with two of gene
gRNAs
Development of better quality rice Rice developmental genes MPK1 (mitogen- Rice callus transformation, Agrobacterium- Knockout [95]
activated protein kinase 1), MPK6 gene mediated of gene
Stomatal development [96]
EPFL9 gene: positive regulator of stomata Agrobacterium-mediated along using Knockout
development pathway CRISPR– of gene
Cas9/Cpf1 system
Generation of high-amylose rice Starch branching enzymes: SBEI/SBEIIb Agrobacterium-mediated Knockout [97]
genes of genes
Grain yield OsAAP3 (Amino acid permease 3) Agrobacterium-mediated transformation Knock-in of [98]
followed by NHEJ gene
Grain yield Gn1a: Grain number 1a, GS3: Grain size3 Agrobacterium-mediated using Cas9/ Knockout [99]
gRNA of gene
Increase in number and size of grain, IPA1: squamosa promoter binding Protein, Agrobacterium-mediated using Cas9/ Knockout [100]
dense and straight panicles DEP1: γ-subunit of G protein, GS3: gRNA of genes
γ-subunit of G protein, Gn1a: Cytokinin
dehydrogenase2
Starch synthesis pathway Plastific large subunit Agrobacterium-mediated Knockout [101]
in rice pollen of OsAGPL4 (i.e., ADP-glucose using Cas9/gRNA of gene
Pyrophosphorylase)
Weight of grain TGW6: thousand-grain Agrobacterium-mediated using Cas9/ Multiplex [102]
weight, GW2: grain width gRNAs editing
2, GW5: grain width 5 of
genome
Pollen tube integrity and RUPO: ruptured pollen tube, mCrRLK1LS: Agrobacterium-mediated using Cas9/ Knockout [103]
growth regulation rice member of plant-specific receptor-like gRNA of gene
kinase
Papaver Biosynthesis of Benzylisoquinoline Benzylisoquinoline alkaloids Agrobacterium-mediated along Knockout [104]
somniferum alkaloids (BIAs): biosynthesis regulators: with gRNA/Cas9 in TRV-based of gene
medical biomolecules 40-O-methyltransferase isoform synthetic plasmids
2 (40 OMT2 gene),
30-hydroxyl-N-methylcoclaurine
Salvia diterpene synthase SmCPS1: diterpene synthase gene Agrobacterium rhizogenes-mediated Knockout [105]
miltiorrhiza gene knockout (Tanshinone biosynthesis) transformation of gene
Solanum Generation of parthenocarpic SlIAA9 (Amino acid permease) Agrobacterium-mediated Knockout [106]
lycopersicum tomato plants gene: controls parthenocarpy of gene
Increased lycopene SGR1 (Senescence-inducible Agrobacterium-mediated Knockout [107]
chloroplast stay-green protein 1), LCY-E of genes
(Lycopene cyclase E), Blc, LCY-B1
(Lycopene cyclase B1)

Solanum Amylopectin potato starch Granule-bound starch synthase Protoplast transfection using PEG Knockout [108]
tuberosum (GBSS) targeted at three sites along with CRISPR-Cas9 constructs of gene
53
(continued)
54
Sumi Rana et al.
Table 4
(continued)
Plant Phenotype Target regions(s) Transformation method Alterations References
Triticum Grain weight TaGW2 (Ubiquitin protein ligase) Particle bombardment Knockout [109]
aestivum followed by HR repair of gene
Kernel weight GASR7 (GA induced protein) Particle bombardment Knockout [110]
followed by HDR of gene
Low gluten α-gliadin Particle bombardment followed by HDR Knockout [111]
of gene
Zea mays Decreased linkage drag LG1 (Liguleless 1) gene Agrobacterium-mediated Knockout [10]
in breeding methods of gene
Targeted mutagenesis Anthocyaninless (a1 and a4) Agrobacterium-mediated transformation Knockout [112]
of high-frequency genes, ZmAgo18a/ZmAgo18b of gene
or dihydroflavonol 4-reductase
number of tandem-repeated gene copy number in the rice indica

variety (allele Sc-i) by CRISPR-Cas9 system [114]. The CRISPR-
Cas9 technology was also shown for genome editing in the flower
color of Japanese morning glory, Ipomoea nil [115]. Further, Li
et al. [107] designed a bidirectional strategy involving enhance-
ment of lycopene content in tomato and blocking the conversion of
lycopene to alpha- and beta- carotene. CRISPR/Cas9 mediated
gene-editing tool followed by Agrobacterium tumefaciens-
mediated transformation was used to edit five candidate genes
regulating the carotenoid metabolic pathway and approximately
5.1-fold increase in the lycopene content was achieved in tomato
[107] (Table 4).
The limitation of type II CRISPR/Cas9 is that it could only
identify the upstream DNA sequences from 50 -NGG-30 PAMs.
Therefore, different Cas9 alternates were designed parallelly. Sub-
sequently, CRISPR systems with a single effector nuclease like
Cpf1, C2c1, C2c2, C2c have been evolved and diversified in the
genome editing toolbox. Other than a few significant features, the
CRISPR-Cpf1 is different than CRISPR-Cas9. This gene-editing
tool has the ability to edit the AT-rich regions like the 50 and 30
UTRs and promoter domains. Cpf1 which produces cohesive ends
with overhangs of four to five nucleotides by recognizing the T-rich
PAMs was chosen as an alternative to Cas9 [116]. A combination of
CRISPR/Cas9 or CRISPR/Cpf1, along with base editing as well as
DNA-free genome editing, could yield great results. Using the
concept, DNA-free genome editing was performed combined
with CRISPR/Cpf1 in rice [117]. Cpf1 crRNA is shorter than
the spCas9 sgRNA by 60 nucleotides. Also, it does not need
trans-acting crRNA (tracrRNA), thus, it can facilitate multiplex
gene editing providing an advantage over Cas9. Among the two
modified variants of LbCpf (a Cpf derived from Lachnospiraceae
bacterium), the LbCpf1 (RR) variant exhibited multiplex editing of
target genes possessing non-canonical TYCV PAMs in rice suggest-
ing the expanded horizons of LbCpf1-mediated editing in plants
[118]. The utilization of CRISPR-Cas ribonucleoproteins (RNPs)
for selection-free site-directed mutagenesis by embryo bombard-
ment was well established in maize [119] and in bread wheat
[9]. Briefly, active Cas9-gRNA complexes embedded on gold par-
ticles were delivered into maize cells with the recovery of mutant
plants without selection, making this method highly desirable to
edit the genome in important crops such as rice, wheat, barley,
soybean, sorghum, which are acquiescent to biolistic delivery.
Plant regeneration by protoplast culture has always been a signifi-
cant challenge in a variety of crop species, specifically in the mono-
cots. In this view, genome editing method was optimized in
hexaploid bread wheat (Triticum aestivum) through the
CRISPR/Cas9 system that can be used further as basis for GE in
major monocots [9].
56 Sumi Rana et al.
2.5 Cas9 has the ability to recognize the target DNA sequence irre-
CRISPR/Nuclease spective of its endonuclease nature. Inducing point mutations in
Dead Cas9 (dCas9) the nuclease domain of Cas9 at H840A and D10A results in endo-
nuclease dead cas9 (dCas9) [120], and dCas9 can alter targeted
expression of single or multiple genes using transcriptional effector
domains, without changing the DNA sequence. dCas9 recruited
with transcriptional regulators could bind in the proximity of pro-
moter region and change expression levels of genes. Herpes simplex
viral protein 16 (VP16), a tetramer, fused with dCas9 (dCas9-
VP64) can be used for transcriptional activation. In Arabidopsis,
CpG methylation causes the transcriptional silencing of Fertiliza-
tion Independent Seed2 (FIS2) gene and dCas9-VP64 attachment to
the methylated region has been shown to activate FIS2 gene
[121]. Lowder et al. [122, 123] used CRISPR-Act2.0 system to
activate multiple genes in plants. They chose three endogenous
genes, namely Os04g39780, Os03g01240, and Os11g35410, and
checked the efficiency of CRISPR-Act2.0 system in activating
these genes simultaneously. Their study suggested that the
CRISPR-Act2.0 system is more efficient than the dCas9-VP64
system [124, 125]. EDLL, an amino acid motif that contained
24 residues of glutamic acid (E), aspartic acid (D), and leucine
(L), can be used along with sCas9 tandemly for transcriptional
activation. For example, a series of four ERF2m-EDLL motif
fused with dCas9-VP128 increased the transcriptional activity of
luciferase (LUC) gene in protoplast of Arabidopsis by 12.6-fold
[126]. CRISPR interference (CRISPRi) is a technique where
dCas9 used to achieve transcriptional repression where dCas9
probably interferes with binding of RNA polymerase and TFs, or
transcriptional elongation [127]. In a study in Nicotiana benthami-
ana, dCas9 fused with a repressor domain, SRDX, was used to act
as a repressor in modulating the transcription of endogenous Phy-
toene desaturase (PDS) gene [128]. Base editing, as the name
suggests, can alter a single base and with the use of dCas9 or
nCas9 (D10A nickase), it can give perfectly edited products with
significantly reduced off-target indels [128]. Shimatani et al. [129]
used this multiplexed base editing technique in rice to derive point
mutation for herbicide resistance. They also developed marker free
tomato plants using DNA substitutions which were
heritable [129].
In another study, Zong et al. [130] used a fusion of CRISPR/
nCas9 cytidine deaminase with a promoter from maize, Ubiquitin-
1 (Ubi-1). They suggested that in wheat, maize and rice, nCas9
plant base editor is efficient in changing cytosine to thiamine and
did not produce any significant indel mutations [130]. dCas9 could
also help in targeting and manipulation of DNA loop formation
and chromatin structure. To establish chromatin loops, Morgan
et al. [131] developed a strategy named chromatin loop reorgani-
zation using CRISPR-dCas9 (CLOuD9). In N. benthamiana,
fusion of eGFP/mRuby2-dCas9 was used for live picturing of

telomere repeats [132]. In Arabidopsis, it was observed that
dCas9-FokI gave precise mutagenesis but the mutation efficiency
and frequency was compromised [133]. Hence, CRISPR/dCas9
has proved to be a robust technique in studying not only the
transcriptional regulators but also in screening of favorable agro-
nomic traits as well as studying chromatin structure and
modification.
3 Cis-Regulatory Elements Mediated Genome Editing: A Breakthrough
Besides popular genome editing tools, synthetic promoters were

also found to be useful in editing the gene regulatory circuits as
they comprise of multiple cis-acting elements [134]. Also, these
promoters constitute multiple on/off switches which may be trig-
gered by numerous signaling pathways such as salicylic acid, jasmo-
nic acid, ethylene, etc. [134]. Synthetic promoter approach was
further explored to develop full-length transcript promoters
derived from Horseradish latent virus [135] and Arabidopsis
rd-29A promoter [136, 137]. These synthetic promoters served
as bona fide template for constructing several stress-responsive
promoters. Further, activation of target genes in Arabidopsis thali-
ana was achieved using synthetic zinc-finger protein transcription
factors (ZFP-TFs) encompassing trans-activation domains
[138]. The former concept was employed in the down-regulation
of target gene expression in transgenic Arabidopsis using the rice
bacilliform virus promoter [139]. Mutations in the coding
sequences, which determines the protein structure, are more pleio-
tropic than cis-regulatory variants. Cis-regulatory variants bring
out phenotypic variations by modifying the patterns and levels of
gene expression [140]. Therefore, based on the prevalent informa-
tion available on cis-regulatory genome editing, it was assumed that
numerous elements of CRISPR-Cas9 could be exploited to harbor
the plethora of cis-regulatory mutations of different types and
strengths [141–143].
Generation of transgene-free mutants is another topic of
research that has always fascinated a large group of scientific com-
munity. Woo et al. [84] optimized the method to produce
transgene-free mutants by delivering pre-assembled CRISPR-
Cas9 ribonucleoproteins (RNPs) into lettuce protoplasts. Further,
editing in wheat callus cells was performed with CRISPR/Cas9
in vitro transcripts and plant cells were regenerated without antibi-
otic or herbicide selection [110]. Also, RNP-mediated editing was
established as a modification of CRISPR-Cas9 system to deliver the
crops without “GMO” tag [7, 118].
58 Sumi Rana et al.
4 Comparing the Transgene-Based and Genome Editing Approaches
Even after holding the promise to ensure global food security and
optimum nutrition, GM crops are always a matter of debate for
raising health and biosafety concerns. Due to the difference of
opinions, two ideological interest groups were evolved, one is the
anti-GM group and the other one is pro-GM group, leading to the
termination of the production and import-export of food items
under GMO tag, particularly in the European countries. Due to the
ability of direct DNA manipulation, the initial genome editing tools
like ZFNs, TALENs, and the recent technology of CRISPR/
Cas12a (Cpf1, CRISPR from Prevotella and Francisella 1), and
the base editors derived from Cas9 is progressing positively. These
genome editing techniques are more precise and faster than con-
ventional breeding. Unlike GMOs, the chances of controversies are
less in the case of genome editing technologies. However, the
intervention of TALENs and other SSNs have also suffered several
complications over the past few years, and lately their scope under
GMO biosafety regulation has become questionable [144]. The
techniques like ZFN1 and ZFN2 could not be categorized under
the title “GMO,” since these techniques do not require the intro-
duction of any recombinant DNA into the host plant.
The ZFN-1 employs NHEJ repair mechanism when DSB is
induced by SSN which constitutes only point mutations and small
insertions/deletions without the involvement of any recombinant
DNA. ZFN-2, on the other hand, shares several similarities with
ZFN-1 with only difference in the presence of non-integrated
template DNA, which induces repair in a specific direction followed
by required nucleotide. Therefore, the resulting organism is similar
to those which are generated using native mutagenesis protocol
using chemicals and irradiation [145, 146]. ZFN-3, however,
employs homologous recombination, which leads to directed and
specific gene insertion/exchange, which made the scientific com-
munity believe that the plants generated through this technique
should be labeled under GMO [145, 146]. Besides the genetically
modified, genome-edited crops, the method of cis-editing has
gained much popularity in the recent past. Transcriptional unit
encompassing the transcription factors and their cognate
cis-elements constitutes several signal transmitters and receivers
similar to a multicomponent cellular network [147]. Alteration in
the target bases in conserved core domain for the generation of
degenerate cis-element is the basis of cis-engineering. Moreover,
synthetic promoters, designed to mitigate multiple stress signals
have now evolved as efficient tools to circumvent various environ-
mental factors that disrupt overall gene expression.
5 Applications and Prospects of Genome Editing and Bottlenecks
Using genome editing techniques, Single Nucleotide Polymor-

phism (SNPs) has also been generated to study diverse agronomic
traits. A gain of function phenotype was produced by inducing
point mutation in the target domain, which was facilitated by
modified Cas9 protein (dCas9/Cas9n), fused with a deaminase
[148]. The primary “programmable base editor module” compris-
ing of Cas9n (D10A nickase) conjugated with a cytosine deaminase
[rat APOBEC1 (Apolipoprotein B mRNA editing enzyme catalytic
polypeptide 1) or human AID (Activation-induced cytidine deami-
nase) that changes cytidine to thymidine] and uracil DNA glycosy-
lase inhibitor was altogether referred as the “rice base-editor (rBE)
system.” The point mutation in the target domain was mediated by
a small guide RNA molecule (sgRNA), which guides the rBE
UNIT to its assigned target site [148]. Highly precise base editing
was induced on DNA by the derivatives of tRNA adenosine deami-
nase (TAD; TadA) that can convert adenine to inosine
[149, 150]. The approach was also used parallelly for base editing
in rice [114]. In addition, forest tree genomics can be mitigated
using CRISPR-Cas9 technology enabling the elucidation of
detailed gene function, thereby revealing the adaptations of trees
to their environment [151].
Genome editing technology has been exploited for editing in a
wide variety of crops. Knock down the Stylar ribonuclease gene
(S-RNase) was done by genome editing in diploid potato to over-
come gametophytic self-incompatibility [152]. Plant with a long-
life cycle that follows vegetative propagation, viz. grapevine, apple,
and potato, are difficult to be backcrossed, therefore, genome
editing might be proven as potential tool in such crops
[153, 154]. With the advent of next-generation sequencing plat-
forms, the genomic information of several agronomically important
crops has become available. The common approaches to analyze the
function of a target gene identified from a large-scale study are
knockdown and knockout that can be efficiently achieved by these
gene-editing tools. Lately, CRISPR/Cas9 has become very popular
and is found to be more advantageous over other genome editing
techniques, due to its capability of multiplexing and trait stacking
[155]. In crops with low transformation efficiency, editing of a
single gene could be done by multiple sgRNAs to improve the
editing rate. Lu et al. [156] developed 99,004 loss-of-function
targeted mutants by designing 88,541 sgRNAs for 43,234 target
genes of rice. In a parallel study, around 25,604 sgRNAs analogous
to 12,802 genes were designed and 14,000 transgenic lines were
developed in rice [157]. This study would pave the way for
inspiring researchers to create mutant libraries of crops with eco-
nomic significance.
60 Sumi Rana et al.
Despite having several advantages over transgene-based

approach, CRISPR/Cas9 has few limitations that need to be
addressed such as efficient delivery system, off-target editing, and
Cas9 function optimization. Cas protein packaging in vectors
resists the efficient delivery of CRISPR/Cas9 system. Therefore,
development of an efficient delivery system is needed for the
CRISPR/Cas9 system, since the currently available methods are
applicable to certain tissues and crops. To increase the efficiency of
the delivery system, nano-products like layered double hydroxides
as well as mesoporous silica nanoparticles are being used. Next, for
reduction in the off-target effects, a strategy has to be designed
since it raises several safety issues regarding the use of CRISPR/
Cas9 based products. The possible solution could be the selection
of Cas9 requiring lengthy PAMs and sgRNAs which are designed to
possess high affinity toward the desired target sequence [158]. Sev-
eral efforts are being made to overcome these limitations and to
explore the efficient and versatile usage of the genome/gene-
editing system.
6 Conclusions
Over the years, conventional breeding has made remarkable contri-

bution in enhancing agricultural production. However, use of tra-
ditional breeding for the generation of improved crop varieties has
certain limitations. Conventional breeding exploits variability in the
germplasm caused either by spontaneous mutation or induced
mutation, which might or might not produce an elite variety.
Improvement of cultivars for improved agronomic traits can be
expedited using the genome editing technology. Genome editing
tools along with molecular breeding, help researchers in targeting
and editing desired genes precisely that in turn aids in developing
cultivars with high productivity, nutritional value, and tolerance to
biotic and abiotic stresses. In this chapter, we have described the
fundamentals and application of different genome editing tools.
Selection of suitable editing system for a particular crop is impera-
tive to attain desirable results. After selection, target sequence is
designed and introduced in appropriate vectors, which is further
introduced in the plant cells for target modification [35]. Compre-
hensive analysis and integration of outcomes resulted from next-
generation sequencing, system and synthetic biology, advanced
genome editing tools along with breeding may lead to the genera-
tion of climate-resilient smart crops with improved nutritive value.
Speed breeding with CRISPR/Cas9 technology is being implied to
safeguard global food security and agricultural production
[158]. Thus, genome editing tools are aiding in accelerating the
breeding process of crops and consequently might help in meeting
the food demands of increasing population. Despite the promising
outcomes of genome editing technology, the regulation imposed

by the government on genome-edited crops and acceptance by the
consumer remains debatable. Awareness regarding the concept of
genome editing technology could amend the mindset and perspec-
tives of the anti-GM groups [159]. Demarcation of crops derived
from “mutation” and one derived with the introduction of “recom-
binant DNA” has to be done meticulously. With due course of
time, Genome editing is establishing a separate niche for itself in
the scientific community as it overrules all the perils and limitations
associated with GM technology. Therefore, it can be assumed that
genome editing might be preferred by consumers worldwide rein-
forcing better agriculture and food security in the future.
Acknowledgements
Authors’ research in the area of genome editing for trait improve-

ment is funded by Science and Engineering Research Board,
Department of Science and Technology, Government of India
(Project file no. ECR/2017/001526).
References
1. Abdelrahman M, Sawada Y, Nakabayashi R, 7. Gaudelli NM, Komor AC, Rees HA, Packer
Sato S, Hirakawa H, El-Sayed M, Hirai MY, MS, Badran AH, Bryson DI, Liu DR (2017)
Saito K, Yamauchi N, Shigyo M (2015) Inte- Programmable base editing of AlT to GlC in
grating transcriptome and target metabolome genomic DNA without DNA cleavage.
variability in doubled haploids of Allium cepa Nature 551:464–471
for abiotic stress protection. Mol Breed 35: 8. Rees HA, Liu DR (2018) Base editing: preci-
195 sion chemistry on the genome and transcrip-
2. Feng Z, Zhang B, Ding W, Liu X, Yang DL, tome of living cells. Nat Rev Genet 19:
Wei P, Cao F, Zhu S, Zhang F, Mao Y et al 770–788
(2013) Efficient genome editing in plants 9. Liang Z, Chen K, Li T, Zhang Y, Wang Y,
using a CRISPR/Cas system. Cell Res 23: Zhao Q, Gao C (2017) Efficient DNA-free
1229–1232 genome editing of bread wheat using
3. Que Q, Chilton M, de Fontes C, He C, CRISPR/Cas9 ribonucleoprotein complexes.
Nuccio M, Hu Z et al (2010) Trait stacking Nat Commun 8:14261. https://doi.org/10.
in transgenic plants—challenges and opportu- 1038/ncomms14261
nities. GM Crops 1:220–229 10. Gao H, Smith J, Yang M, Jones S,
4. Puchta H (2005) The repair of double-strand Djukanovic V, Nicholson MG, West A,
breaks in plants: mechanisms and conse- Bidney D, Falco SC, Jantz D, Lyznik A
quences for genome evolution. J Exp Bot (2010) Heritable targeted mutagenesis in
56:1–14 maize using a designed endonuclease. Plant J
5. Puchta H, Fauser F (2014) Synthetic 61:176–187. https://doi.org/10.1111/j.
nucleases for genome engineering in plants: 1365-313x.2009.04041.x
prospects for a bright future. Plant J 78(5): 11. Antunes MS, Smith J, Jantz D, Medford J
727–741. https://doi.org/10.1111/tpj. (2012) Targeted DNA excision in Arabidopsis
12338 by a re-engineered homing endonuclease.
6. Nishida K, Arazoe T, Yachie N, Banno S, BMC Biotechnol 12:86
Kakimoto M, Tabata M et al (2016) Targeted 12. Shukla K, Doyon Y, Miller JC, DeKelver R,
nucleotide editing using hybrid prokaryotic Moehle RE, Worden SE, Mitchell JC et al
and vertebrate adaptive immune systems. Sci- (2009) Precise genome modification in the
ence 353(6305):aaf8729
62 Sumi Rana et al.
crop species Zea mays using zinc finger 24. Smith J, Grizot S, Arnould S, Duclert A, Epi-
nucleases. Nature 459:437–443 nat JC, Chames P, Prieto J, Redondo P et al
13. Char SN, Unger-Wallace E, Frame B, Briggs (2006) A combinatorial approach to create
SA, Main M, Spalding MH, Vollbrecht E, artificial homing endonucleases cleaving cho-
Wang K, Yang B (2015) Heritable site-specific sen sequences. Nucleic Acids Res 34:1–12
mutagenesis using TALENs in maize. Plant 25. Urnov FD, Rebar EJ, Holmes MC, Zhang
Biotechnol J 13(7):1002–1010. https://doi. HS, Gregory PD (2010) Genome editing
org/10.1111/pbi.12344 with engineered zinc finger nucleases. Nat
14. Shi J, Gao H, Wang H, Lafitte R, Archibald Rev Genet 11:636–646
LR, Yang M, Hakimi SM, Mo H, Habben E 26. Bibikova M, Carroll D, Segal DJ, Trautman
(2017) ARGOS8 variants generated by JK, Smith J, Kim YG, Chandrasegaran S
CRISPR-Cas9 improve maize grain yield (2001) Stimulation of homologous recombi-
under field drought stress conditions. Plant nation through targeted cleavage by chimeric
Biotechnol J 15:207–216 nucleases. Mol Cell Biol 21:289–297
15. Chen W, Qian Y, Wu X, Sun Y, Wu X, Cheng 27. Lloyd A, Plaisier CL, Carroll D, Drews GN
X (2014) Inhibiting replication of begomo- (2005) Targeted mutagenesis using zinc-
viruses using artificial zinc finger nucleases finger nucleases in Arabidopsis. Proc Natl
that target viral-conserved nucleotide motif. Acad Sci U S A 102:2232–2237
Virus Genes 48:494–501 28. Weinthal D, Tovkach A, Zeevi V, Tzfira T
16. Miao J, Guo D, Zhang J, Huang Q, Qin G, (2010) Genome editing in plant cells by zinc
Zhang X, Wan J, Gu H, Qu LJ (2013) Tar- finger nucleases. Trends Plant Sci 15:
geted mutagenesis in rice using CRISPR-Cas 308–321
system. Cell Res 23:1233–1236 29. Ainley WM, Sastry-Dent L, Welter ME, Mur-
17. Du H, Zeng X, Zhao M, Cui X, Wang Q, ray MG, Zeitler B, Amora R, Corbin DR et al
Yang H, Yu D (2016) Efficient targeted muta- (2013) Trait stacking via targeted genome
genesis in soybean by TALENs and CRISPR/ editing. Plant Biotechnol J 11:1126–1134
Cas9. J Biotechnol 217:90–97. https://doi. 30. Cantos C, Francisco P, Trijatmiko KR,
org/10.1016/j.jbiotec.2015.11.005 Slamet-Loedin I, Chadha-Mohanty PK
18. Wang Y, Cheng X, Shan Q, Zhang Y, Liu J, (2014) Identification of acœsafe harbora loci
Gao C, Qiu JL (2014) Simultaneous editing in Indica rice genome by harnessing the prop-
of three homoeoalleles in hexaploid bread erty of zinc-finger nucleases to induce DNA
wheat confers heritable resistance to powdery damage and repair. Front Plant Sci 5:302.
mildew. Nat Biotech 32:947–952. https:// https://doi.org/10.3389/fpls.2014.00302
doi.org/10.1038/nbt.2969 31. Martı́nez-Fortún J, Phillips DW, Jones HD
19. Townson J (2017) Recent developments in (2017) Potential impact of genome editing
genome editing for potential use in plants. in world agriculture. Emerg Top Life Sci
Bioscience Horizons 10:hzx016. https:// 1(2):117–133. https://doi.org/10.1042/
doi.org/10.1093/biohorizons/hzx016 etls20170010
20. Monnat RJ, Hackmann AF, Cantrell MA 32. Ran Y, Liang Z, Gao C (2017) Current and
(1999) Generation of highly site-specific future editing reagent delivery systems for
DNA double-strand breaks in human cells by plant genome editing. Sci China Life Sci 60:
the homing endonucleases I-PpoI and I-CreI. 490–505. https://doi.org/10.1007/
Biochem Biophys Res Commun 255:88–93 s11427017-9022-1
21. Boulton SJ, Jackson SP (1996) Saccharomy- 33. Tovkach A, Zeevi V, Tzfira T (2009) A tool-
ces cerevisiae Ku70 potentiates illegitimate box and procedural notes for characterizing
DNA double-strand break repair and serves novel zinc finger nucleases for genome editing
as a barrier to error-prone DNA repair path- in plant cells. Plant J 57:747–757
ways. EMBO J 15:5093–5103 34. Gaj T, Gersbach CA, Barbas CF (2013) ZFN,
22. Pâques F, Duchateau P (2007) Meganu- TALEN, and CRISPR/Cas-based methods
cleases and DNA double-strand break- for genome engineering. Trends Biotechnol
induced recombination perspectives for gene 31:397–405
therapy. Curr Gene Ther 7:49–66 35. Zhang T, Zheng Q, Yi X, An H, Zhao Y,
23. Seligman LM, Chisholm KM, Chevalier BS, Ma S, Zhou G (2018) Establishing RNA
Chadsey SM, Edwards S et al (2002) Muta- virus resistance in plants by harnessing
tions altering the cleavage specificity of a hom- CRISPR immune system. Plant Biotechnol J
ing endonuclease. Nucleic Acids Res 30: 16:1415–1423. https://doi.org/10.1111/
3870–3879 pbi.12881
36. Bhaskar PB, Wu L, Busse JS, Whitty BR, 46. Lor VS, Starker CG, Voytas DF, Weiss D,
Hamernik AJ, Jansky SH, Buell CR et al Olszewski NE (2014) Targeted mutagenesis
(2010) Suppression of the vacuolar invertase of the tomato PROCERA gene using tran-
gene prevents cold-induced sweetening in scription activator-like effector nucleases.
potato. Plant Physiol 154(2):939–948 Plant Physiol 166(3):1288–1291. https://
37. Li T, Liu B, Spalding MH, Weeks DP, Yang B doi.org/10.1104/pp.114.247593
(2012) High-efficiency TALEN-based gene 47. Luo S, Li J, Stoddard TJ, Baltes NJ, Demorest
editing produces disease-resistant rice. Nat ZL, Clasen BM, Zhang F (2015)
Biotechnol 30(5):390–392. https://doi. Non-transgenic plant genome editing using
org/10.1038/nbt.2199 purified sequence-specific nucleases. Mol
38. Sun Z, Li N, Huang G, Xu J, Pan Y, Wang Z, Plant 8(9):1425–1427. https://doi.org/10.
Wang X (2013) Site-specific gene targeting 1016/j.molp.2015.05.012
using transcription activator-like effector 48. Ishino Y, Shinagawa H, Makino K,
(TALE)-based nuclease in Brassica oleracea. J Amemura M, Nakata A (1987) Nucleotide
Integr Plant Biol 55(11):1092–1103. sequence of the iap gene, responsible for alka-
https://doi.org/10.1111/jipb.12091 line phosphatase isozyme conversion in
39. Čermák T, Baltes NJ, Čegan R et al (2015) Escherichia coli, and identification of the
High-frequency, precise modification of the gene product. J Bacteriol 169:5429–5433
tomato genome. Genome Biol 16:232. 49. Jinek M, Chylinski K, Fonfara I, Hauer M,
https://doi.org/10.1186/s13059-015- Doudna JA, Charpentier E (2012) A pro-
0796-9 grammable dual-RNA-guided DNA endonu-
40. Haun W, Coffman A, Clasen BM, Demorest clease in adaptivebacterial immunity. Science
ZL et al (2014) Improved soybean oil quality 337:816–821
by targeted mutagenesis of the fatty acid desa- 50. Zhang F, Wen Y, Guo X (2014) CRISPR/
turase 2 gene family. Plant Biotechnol J 12(7): Cas9 for genome editing: progress, implica-
934–940. https://doi.org/10.1111/pbi. tions, and challenges. Hum Mol Genet 23
12201 (R1):R40–R46. https://doi.org/10.1093/
41. Demorest ZL, Coffman A, Baltes NJ et al hmg/ddu125
(2016) Direct stacking of sequence-specific 51. Li H, Yang Y, Hong W et al (2020) Applica-
nuclease-induced mutations to produce high tions of genome editing technology in the
oleic and low linolenic soybean oil. BMC targeted therapy of human diseases: mechan-
Plant Biol 16:225. https://doi.org/10. isms, advances and prospects. Sig Transduct
1186/s12870-016-0906-1 Target Ther 5:1. https://doi.org/10.1038/
42. Kelliher T, Starr D, Richbourg L et al (2017) s41392-019-0089-y
MATRILINEAL, a sperm-specific phospholi- 52. Pennisi E (2013) The CRISPR craze. Science
pase, triggers maize haploid induction. 341(6148):833–836
Nature 542(7639):105–109 53. Ali Z, Abulfaraj A, Idris A, Ali S, Tashkandi M,
43. Kannan B, Jung JH, Moxley GW, Lee SM, Mahfouz MM (2015) CRISPR/Cas9-
Altpeter F (2017) TALEN-mediated targeted mediated viral interference in plants. Genome
mutagenesis of more than 100 COMT cop- Biol 16:238. https://doi.org/10.1186/
ies/alleles in highly polyploid sugarcane s13059-015-0799-6
improves saccharification efficiency without 54. Ali Z, Ali S, Tashkandi M, Zaidi SS, Mahfouz
compromising biomass yield. Plant Biotech- MM (2016) CRISPR/Cas9-mediated immu-
nol J 16(4):856–866. https://doi.org/10. nity to geminiviruses: differential interference
1111/pbi.12833 and evasion. Sci Rep 6:26912. https://doi.
44. Wendt T, Holm PB, Starker CG, Christian M, org/10.1038/srep30223
Voytas DF et al (2013) TAL effector nucleases 55. Baltes NJ, Hummel AW, Konecna E,
induce mutations at a pre-selected location in Cegan R, Bruns AN, Bisaro DM, Voytas DF
the genome of primary barley transformants. (2015) Conferring resistance to geminiviruses
Plant Mol Biol 83:279–285. https://doi.org/ with the CRISPR–Cas prokaryotic immune
10.1007/s11103-013-0078-4 system. Nat Plants 1(10):15145. https://
45. Gurushidze M, Hensel G, Hiekel S, doi.org/10.1038/nplants.2015.145
Schedel S, Valkov V, Kumlehn J (2014) 56. Ji X, Zhang H, Zhang Y, Wang Y, Gao C
True-breeding targeted gene knock-out in (2015) Establishing a CRISPR-Cas-like
barley using designer TALE-nuclease in hap- immune system conferring DNA virus resis-
loid cells. PLoS One 9(3):e92046. https:// tance in plants. Nat Plants 1:15144. https://
doi.org/10.1371/journal.pone.0092046 doi.org/10.1038/nplants.2015.144
64 Sumi Rana et al.
57. Pyott DE, Sheehan E, Molnar A (2016) Engi- PLoS One 11(4):e0154027. https://doi.
neering of CRISPR/Cas9-mediated potyvirus org/10.1371/journal.pone.0154027
resistance in transgene-free Arabidopsis 67. Macovei A, Sevilla NR, Cantos C, Jonson GB,
plants. Mol Plant Pathol 17(8):1276–1288. Slamet-Loedin I, Čermák T et al (2018)
https://doi.org/10.1111/mpp.12417 Novel alleles of rice eIF4G generated by
58. Liu H, Soyars C, Li J, Fei Q, He G, CRISPR/Cas9 targeted mutagenesis confer
Peterson B, Meyers B, Nimchuk Z, Wang X resistance to Rice tungro spherical virus.
(2018) CRISPR/Cas9-mediated resistance to Plant Biotechnol J 16:1918–1927. https://
cauliflower mosaic virus. Plant Direct 2: doi.org/10.1111/pbi.12927
e00047. https://doi.org/10.1002/pld3.47 68. Nekrasov V, Wang C, Win J, Lanz C,
59. Jia H, Zhang Y, Orbović V, Xu J et al (2017) Weigel D, Kamoun S (2017) Rapid genera-
Genome editing of the disease susceptibility tion of a transgene-free powdery mildew resis-
gene CsLOB1 in citrus confers resistance to tant tomato by genome deletion. Sci Rep 7:
citrus canker. Plant Biotechnol J 15(7): 482. https://doi.org/10.1038/s41598-017-
817–823. https://doi.org/10.1111/pbi. 00578-x
12677 69. Li P, Li YJ, Zhang FJ, Zhang GZ, Jiang XY,
60. Peng A, Chen S, Lei T, Xu L, He Y et al Yu HM, Hou BK (2017) The Arabidopsis
(2017) Engineering canker-resistant plants UDP-glycosyltransferases UGT79B2 and
through CRISPR/Cas9-targeted editing of UGT79B3, contribute to cold, salt and
the susceptibility gene CsLOB1 promoter in drought stress tolerance via modulating
citrus. Plant Biotechnol J 15(12):1509–1519. anthocyanin accumulation. Plant J 89(1):
https://doi.org/10.1111/pbi.12733 85–103. https://doi.org/10.1111/tpj.
61. Chandrasekaran J, Brumin M, Wolf D, Leib- 13324
man D et al (2016) Development of broad 70. Hahn F, Eisenhut M, Mantegazza O, Weber
virus resistance in non-transgenic cucumber APM (2018) Homology-directed repair of a
using CRISPR/Cas9 technology. Mol Plant defective glabrous gene in Arabidopsis with
Pathol 17:1140–1153. https://doi.org/10. Cas9-based gene targeting. Front Plant Sci
1111/mpp.12375 9:424. https://doi.org/10.3389/fpls.2018.
62. Zhang Z, Ge X, Luo X, Wang P, Fan Q, Hu G, 00424
Xiao J, Li F, Wu J (2018) Simultaneous edit- 71. Curtin SJ, Xiong Y, Michno JM, Campbell
ing of two copies of Gh14-3-3d confers BW, Stec AO, Čermák T et al (2018)
enhanced transgene-clean plant defense CRISPR/Cas9 and TALENs generate herita-
against Verticillium dahliae in allotetraploid ble mutations for genes involved in small
upland cotton. Front Plant Sci 9:842. RNA processing of Glycine max and Medi-
https://doi.org/10.3389/fpls.2018.00842 cago truncatula. Plant Biotechnol J 16:
63. Ludman M, Burgyán J, Fátyol K (2017) 1125–1137
Crispr/Cas9 mediated inactivation of Argo- 72. Sauer N, Narváez-Vásquez J, Mozoruk J,
naute 2 reveals its differential involvement in Miller R, Warburg Z, Woodward M et al
antiviral responses. Sci Rep 7(1):1010. (2016) Oligonucleotide-mediated genome
https://doi.org/10.1038/s41598-017- editing provides precision and function to
01050-6 engineered nucleases and antibiotics in plants.
64. Yin K, Han T, Xie K, Zhao J, Song J, Liu Y Plant Physiol 170:01696.2015. https://doi.
(2019) Engineer complete resistance to cot- org/10.1104/pp.15.01696
ton leaf curl multan virus by the CRISPR/ 73. Wang L, Wang L, Tan Q, Fan Q, Zhu H,
Cas9 system in Nicotiana benthamiana. Phy- Hong Z, Zhang Z, Duanmu D (2016) Effi-
topathol Res 1:9. https://doi.org/10.1186/ cient inactivation of symbiotic nitrogen fixa-
s42483-019-0017-7 tion related genes in Lotus japonicus using
65. Zhou J, Peng Z, Long J, Sosso D, Liu B, Eom CRISPR-Cas9. Front Plant Sci 7:1333.
JS, Huang S, Liu S et al (2015) Gene target- https://doi.org/10.3389/fpls.2016.01333
ing by the TAL effector PthXo2 reveals cryp- 74. Duan Y, Li J, Qin R, Xu R, Li H, Yang Y,
tic resistance gene for bacterial blight of rice. Ma H, Li L, Wei P, Yang J (2016) Identifica-
Plant J 82(4):632–643. https://doi.org/10. tion of a regulatory element responsible for
1111/tpj.12838 salt induction of rice OsRAV2 through ex situ
66. Wang F, Wang C, Liu P, Lei C, Hao W et al and in situ promoter analysis. Plant Mol Biol
(2016) Enhanced rice blast resistance by 90:49–62. https://doi.org/10.1007/
CRISPR/Cas9-targeted mutagenesis of the s11103-015-0393-z
ERF transcription factor gene OsERF922. 75. Shimatani Z, Kashojiya S, Takayama M,
Terada R, Arazoe T, Ishii H et al (2017)
Targeted base editing in rice and tomato using RNA-guided Cas9 nuclease. Genome Biol
a CRISPR-Cas9 cytidine deaminase fusion. 16:258. https://doi.org/10.1186/s13059-
Nat Biotechnol 35:441–443. https://doi. 015-0826-7
org/10.1038/nbt.3833 86. Kapusi E, Corcuera-Gómez M, Melnik S, Sto-
76. Li J, Meng X, Zong Y, Chen K, Zhang H, ger E (2017) Heritable genomic fragment
Liu J, Li J, Gao C (2016) Gene replacements deletions and small indels in the putative
and insertions in rice by intron targeting using ENGase gene induced by CRISPR/Cas9 in
CRISPR-Cas9. Nat Plants 2:16139. https:// barley. Front Plant Sci 8:540. https://doi.
doi.org/10.1038/nplants.2016.139 org/10.3389/fpls.2017.00540
77. Sun Y, Zhang X, Wu C, He Y, Ma Y, Hou H, 87. Morineau C, Bellec Y, Tellier F, Gissot L,
Guo X, Du W, Zhao Y, Xia L (2016) Engi- Kelemen Z, Nogue F, Faure JD (2017) Selec-
neering herbicide-resistant rice plants tive gene dosage by CRISPR-Cas9 genome
through CRISPR/Cas9-mediated homolo- editing in hexaploid Camelina sativa. Plant
gous recombination of acetolactate synthase. Biotechnol J 15(6):729–739. https://doi.
Mol Plant 9(4):628–631. https://doi.org/ org/10.1111/pbi.12671
10.1016/j.molp.2016.01.001 88. Jiang WZ, Henry IM, Lynagh PG, Comai L,
78. Bo W, Zhaohui Z, Huanhuan Z, Xia W, Cahoon EB, Weeks DP (2017) Significant
Binglin L, Lijia Y, Xiangyan H et al (2019) enhancement of fatty acid composition in
Targeted mutagenesis of NAC transcription seeds of the allohexaploid, Camelina sativa,
factor gene, OsNAC041, leading to salt sensi- using CRISPR/Cas9 gene editing. Plant Bio-
tivity in rice. Rice Sci 26:98–108 technol J 15:648–657. https://doi.org/10.
79. Sadanandom A, Srivastava AK, Zhang C 1111/pbi.12663
(2019) Targeted mutagenesis of the SUMO 89. Aznar-Moreno JA, Durrett TP (2017) Simul-
protease, overly tolerant to Salt1 in rice taneous targeting of multiple gene homeologs
through CRISPR/Cas9-mediated genome to alter seed oil production in Camelina sativa.
editing reveals a major role of this SUMO Plant Cell Physiol 58(7):1260–1267. https://
protease in salt tolerance. BioRxiv:555706 doi.org/10.1093/pcp/pcx058
80. Li R, Zhang L, Wang L, Chen L, Zhao R, 90. Kui L, Chen H, Zhang W, He S, Xiong Z,
Sheng J, Shen L (2018) Reduction of Zhang Y, Yan L, Zhong C et al (2017) Build-
tomato-plant chilling tolerance by CRISPR- ing a genetic manipulation tool box for orchid
Cas9-mediated SlCBF1 mutagenesis. J Agric biology: identification of constitutive promo-
Food Chem 66:9042–9051 ters and application of CRISPR/Cas9 in the
81. Li R, Liu C, Zhao R, Wang L, Chen L, Yu W, Orchid, Dendrobium officinale. Front Plant
Zhang S, Sheng J, Shen L (2019) CRISPR/ Sci 7:2036. https://doi.org/10.3389/fpls.
Cas9-mediated SlNPR1 mutagenesis reduces 2016.02036
tomato plant drought tolerance. BMC Plant 91. Mercx S, Smargiasso N, Chaumont F, De
Biol 19:38 Pauw E, Boutry M, Navarre C (2017) Inacti-
82. Butler N, Baltes N, Voytas D, Douches D vation of the β(1,2)-xylosyltransferase and the
(2016) Geminivirus-mediated genome edit- α(1,3)-fucosyltransferase genes in Nicotiana
ing in potato (Solanum tuberosum L.) using tabacum BY-2 cells by a multiplex CRISPR/
sequence-specific nucleases. Front Plant Sci 7: Cas9 strategy results in glycoproteins without
1–13. https://doi.org/10.3389/fpls.2016. plant-specific glycans. Front Plant Sci 8:403.
01045 https://doi.org/10.3389/fpls.2017.00403
83. Waltz E (2016) CRISPR-edited crops free to 92. Hanania U, Ariel T, Tekoah Y, Fux L,
enter market, skip regulation. Nat Biotechnol Sheva M, Gubbay Y, Weiss M et al (2017)
34:582. https://doi.org/10.1038/ Establishment of a tobacco BY2 cell line
nbt0616-582 devoid of plant-specific xylose and fucose as a
84. Woo JW, Kim J, Kwon SI, Corvalán C, Cho platform for the production of biotherapeutic
SW, Kim H et al (2015) DNA-free genome proteins. Plant Biotechnol J 15(9):
editing in plants with preassembled CRISPR- 1120–1129. https://doi.org/10.1111/pbi.
Cas9 ribonucleoproteins. Nat Biotechnol 12702
33(11):1162–1164. https://doi.org/10. 93. Li X, Zhou W, Ren Y, Tian X, Lv T, Wang Z,
1038/nbt.3389 Fang J, Chu C, Yang J, Bu Q (2017) High-
85. Lawrenson T, Shorinola O, Stacey N, Li C, efficiency breeding of early-maturing rice cul-
Ostergaard L, Patron N, Uauy C et al (2015) tivars via CRISPR/Cas9-mediated genome
Induction of targeted, heritable mutations in editing. J Genet Genomics 44(3):175–178.
barley and Brassica oleracea using https://doi.org/10.1016/j.jgg.2017.02.001
66 Sumi Rana et al.
94. Srivastava V, Underwood JL, Zhao S (2017) 103. Liu L, Zheng C, Kuang B, Wei L, Yan L,
Dual-targeting by CRISPR/Cas9 for precise Wang T (2016) Receptor-like kinase RUPO
excision of transgene from rice genome. Plant interacts with potassium transporters to regu-
Cell Tissue Organ Cult 129:153–160. late pollen tube growth and integrity in rice.
https://doi.org/10.1007/s11240-016- PLoS Genet 12:e1006085. https://doi.org/
1166-3 10.1371/journal.pgen.1006085
95. Minkenberg B, Xie K, Yang Y (2016) Discov- 104. Alagoz Y, Gurko T, Zhang B, Unver T (2016)
ery of rice essential genes by characterizing a Manipulating the biosynthesis of bioactive
CRISPR-edited mutation of closely related compound alkaloids for next-generation met-
rice MAP kinase genes. Plant J 89(3): abolic engineering in opium poppy using
636–648 CRISPR-Cas 9 genome editing technology.
96. Yin X, Biswal AK, Dionora J, Perdigon KM, Sci Rep 6:30910
Balahadia CP, Mazumdar S, Chater C et al 105. Li B, Cui G, Shen G, Zhan Z, Huang L,
(2017) CRISPR-Cas9 and CRISPR-Cpf1 Chen J, Qi X (2017) Targeted mutagenesis
mediated targeting of a stomatal developmen- in the medicinal plant Salvia miltiorrhiza. Sci
tal gene EPFL9 in rice. Plant Cell Rep 36(5): Rep 7:43320. https://doi.org/10.1038/
745–757. https://doi.org/10.1007/ srep43320
s00299-017-2118-z 106. Ueta R, Abe C, Watanabe T, Sugano SS,
97. Sun C, Hu Z, Zheng T, Lu K, Zhao Y, Ishihara R, Ezura H et al (2017) Rapid breed-
Wang W, Shi J, Wang C, Lu J, Zhang D, ing of parthenocarpic tomato plants using
Li Z, Wei C (2017) RPAN: rice pan-genome CRISPR/Cas9. Sci Rep 7:507. https://doi.
browser for 3000 rice genomes. Nucleic org/10.1038/s41598-017-00501-4
Acids Res 45(2):597–605. https://doi.org/ 107. Li X, Wang Y, Chen S, Tian H, Fu D, Zhu B,
10.1093/nar/gkw958 Luo Y, Zhu H (2018) Lycopene is enriched in
98. Lu K, Wu B, Wang J, Zhu W, Nie H, Qian J, tomato fruit by CRISPR/Cas9-mediated
Huang W, Fang Z (2018) Blocking amino multiplex genome editing. Front Plant Sci 9:
acid transporter OsAAP3 improves grain 559
yield by promoting outgrowth buds and 108. Andersson M, Turesson H, Olsson N, Falt
increasing tiller number in rice. Plant Biotech- A-S, Ohlsson P, Gonzalez MN,
nol J 16:1710–1722. https://doi.org/10. Samuelsson M, Hofvander P (2018) Genome
1111/pbi.12907 editing in potato via CRISPR-Cas9 ribonu-
99. Shen L, Wang C, Fu Y, Wang J, Liu Q, cleoprotein delivery. Physiol Plant 164(4):
Zhang X, Yan C, Qian Q, Wang K (2018) 378–384. https://doi.org/10.1111/ppl.
QTL editing confers opposing yield perfor- 12731
mance in different rice varieties. J Integr 109. Zhang Y, Li D, Zhang D, Zhao X, Cao X,
Plant Biol 60(2):89–93. https://doi.org/10. Dong L, Liu J, Chen K, Zhang H, Gao C,
1111/jipb.12501 Wang D (2018) Analysis of the functions of
100. Li M, Li X, Zhou Z, Wu P, Fang M, Pan X, TaGW2 homoeologs in wheat grain weight
Lin Q, Luo W, Wu G, Li H (2016) Reassess- and protein content traits. Plant J 94:
ment of the four yield-related genes Gn1a, 857–866. https://doi.org/10.1111/tpj.
DEP1, GS3, and IPA1 in rice using a 13903
CRISPR/Cas9 system. Front Plant Sci 7: 110. Zhang Y, Liang Z, Zong Y, Wang Y, Liu J,
377. https://doi.org/10.3389/fpls.2016. Chen K, Gao C (2016) Efficient and
00377 transgene-free genome editing in wheat
101. Lee SK, Eom JS, Hwang SK, Shin D, An G, through transient expression of CRISPR/
Okita TW, Jeon JS (2016) Plastidic phospho- Cas9 DNA or RNA. Nat Commun 7:12617.
glucomutase and ADP-glucose pyropho- https://doi.org/10.1038/ncomms12617
sphorylase mutants impair starch synthesis in 111. Sánchez-León S, Gil-Humanes J, Ozuna CV,
rice pollen grains and cause male sterility. J Giménez MJ, Sousa C, Voytas DF, Barro F
Exp Bot 67(18):5557–5569. https://doi. (2018) Low-gluten, nontransgenic wheat
org/10.1093/jxb/erw324 engineered with CRISPR/Cas9. Plant Bio-
102. Xu R, Yang Y, Qin R, Li H, Qiu C, Li L, Wei technol J 2018(16):902–910. https://doi.
PC, Yang J (2016) Rapid improvement of org/10.1111/pbi.12837
grain weight via highly efficient CRISPR/ 112. Char SN, Neelakandan AK, Nahampun H,
Cas9-mediated multiplex genome editing in Frame B, Main M, Spalding MH et al
rice. J Genet Genomics 43(8):529–532. (2017) An Agrobacterium-delivered
https://doi.org/10.1016/j.jgg.2016. CRISPR/Cas9 system for high-frequency tar-
07.003 geted mutagenesis in maize. Plant Biotechnol
J 15(2):257–268. https://doi.org/10.1111/ 123. Lowder LG, Paul JW, Qi Y (2017) Multi-

pbi.12611 plexed transcriptional activation or repression
113. Rodrı́guez-Leal D, Lemmon ZH, Man J, in plants using CRISPR-dCas9-based sys-
Bartlett ME, Lippman ZB (2017) Engineer- tems. Plant gene regulatory networks.
ing quantitative trait variation for crop Humana Press, New York, NY, pp 167–184
improvement by genome editing. Cell 124. Li Z, Zhang D, Xiong X, Yan B, Xie W,
171(2):470–480.e8. https://doi.org/10. Sheen J, Li JF (2017) A potent Cas9-derived
1016/j.cell.2017.08.030 gene activator for plant and mammalian cells.
114. Shen R, Wang L, Liu X, Wu J, Jin W, Zhao X, Nat Plants 3:930
Xie X, Zhu Q, Tang H, Li Q, Chen L, Liu Y-G 125. Khatodia S, Bhatotia K, Passricha N, Khurana
(2017) Genomic structural variation- SMP, Tuteja N (2016) The CRISPR/Cas
mediated allelic suppression causes hybrid genome-editing tool: application in improve-
male sterility in rice. Nat Commun 8(1): ment of crops. Front Plant Sci 7:1–13
1310. https://doi.org/10.1038/s41467- 126. Piatek A, Ali Z, Baazim H, Li L, Abulfaraj A,
017-01400-y Al-Shareef S, Aouida M et al (2015)
115. Watanabe K, Kobayashi A, Endo M et al RNA-guided transcriptional regulation in
(2017) CRISPR/Cas9-mediated mutagene- planta via synthetic dCas9-based transcription
sis of the dihydroflavonol-4-reductase-B factors. Plant Biotechnol J 13:578–589
(DFR-B) locus in the Japanese morning 127. Bortesi L, Fischer R (2015) The CRISPR/
glory Ipomoea (Pharbitis) nil. Sci Rep 7: Cas9 system for plant genome editing and
10028. https://doi.org/10.1038/s41598- beyond. Biotechnol Adv 33:41–52
017-10715-1 128. Komor AC, Kim YB, Gaudelli NM, Water-
116. Zetsche B, Gootenberg JS, Abudayyeh OO, bury AL, Zhao KT, Packer MS, Kim YB et al
Slaymaker IM, Makarova KS, Essletzbichler P (2017) Improved base excision repair inhibi-
et al (2015) Cpf1 is a single RNA-guided tion and bacteriophage Mu Gam protein
endonuclease of a class 2 CRISPR-Cas sys- yields C:G-to-T: a base editors with higher
tem. Cell 163:759–771 efficiency and product purity. Sci Adv 3:
117. Kim H, Kim ST, Ryu J, Kang BC, Kim JS, eaao4774
Kim SG (2017) CRISPR/Cpf1-mediated 129. Shimatani Z, Kashojiya S, Takayama M,
DNA-free plant genome editing. Nat Com- Terada R, Arazoe T, Ishii H, Teramura H
mun 8:14406 et al (2017) Targeted base editing in rice
118. Li S, Zhang X, Wang W, Guo X, Wu Z, Du W and tomato using a CRISPR-Cas9 cytidine
et al (2018) Expanding the scope of deaminase fusion. Nat Biotechnol 35(5):
CRISPR/Cpf1-mediated genome editing in 441–443
rice. Mol Plant 11:995–998. https://doi. 130. Zong Y, Wang Y, Li C, Zhang R, Chen K,
org/10.1016/j.molp.2018.03.009 Ran Y, Qiu JL et al (2017) Precise base edit-
119. Svitashev S, Young JK, Schwartz C, Gao H, ing in rice, wheat and maize with a Cas9-
Falco SC, Cigan AM (2015) Targeted muta- cytidine deaminase fusion. Nat Biotechnol
genesis, precise gene editing, and site-specific 35:438–440
gene insertion in maize using Cas9 and guide 131. Morgan SL, Mariano NC, Bermudez A,
RNA. Plant Physiol 169:931–945. https:// Arruda NL, Wu F, Luo Y, Shankar G et al
doi.org/10.1104/pp.15.00793 (2017) Manipulation of nuclear architecture
120. Qi LS, Larson MH, Gilbert LA, Doudna JA, through CRISPR-mediated chromosomal
Weissman JS, Arkin AP, Lim WA (2013) looping. Nat Commun 8:1–9
Repurposing CRISPR as an RNA-cuided 132. Dreissig S, Schiml S, Schindele P, Weiss O,
platform for sequence-specific control of Rutten T, Schubert V, Gladilin E et al (2017)
gene expression. Cell 152:1173–1183 Live-cell CRISPR imaging in plants reveals
121. Lowder LG, Zhang D, Baltes NJ, Paul JW, dynamic telomere movements. Plant J 91:
Tang X, Zheng X, Voytas DF et al (2015) A 565–573
CRISPR/Cas9 toolbox for multiplexed plant 133. Aouida M, Eid A, Ali Z, Cradick T, Lee C,
genome editing and transcriptional regula- Deshmukh H, Atef A, AbuSamra D et al
tion. Plant Physiol 169:971–985 (2015) Efficient fdCas9 synthetic endonucle-
122. Lowder LG, Zhou J, Zhang Y, Malzahn A, ase with improved specificity for precise
Zhong Z, Hsieh T-F et al (2017a) Robust genome engineering. PLoS One 10(7):
transcriptional activation in plants using mul- e0133373. https://doi.org/10.1371/jour
tiplexed CRISPR-Act2.0 and mTALE-Act nal.pone.0133373. PMID: 26225561;
systems. Mol Plant 11:245–256 PMCID: PMC4520497
68 Sumi Rana et al.
134. Rushton PJ, Reinstadler A, Lipka V, 144. Hartung F, Schiemann J, Quedlinburg D

Lippok B, Somssich E (2002) Synthetic (2014) Precise plant breeding using new
plant promoters containing defined regu- genome editing techniques: opportunities,
latory elements provide novel insights into safety and regulation in the EU. Plant J 78:
pathogen- and wound-induced signaling. 742–752. https://doi.org/10.1111/tpj.
Plant Cell 14(4):749–762. https://doi.org/ 12413
10.1105/tpc.010412 145. Lusser M, Davies HV (2013) Comparative
135. Khan A, Shrestha A, Bhuyan K, Maiti IB, Dey regulatory approaches for groups of new
N (2018) Structural characterization of a plant breeding techniques. New Biotechnol
novel full-length transcript promoter from 30:437–446
Horseradish Latent Virus (HRLV) and its 146. Pauwels K, Podevin N, Breyer D, Carroll D,
transcriptional regulation by multiple stress Herman P (2014) Engineering nucleases for
responsive transcription factors. Plant Mol gene targeting: safety and regulatory consid-
Biol 96(1–2):179–196. https://doi.org/10. erations. New Biotechnol 31:18–27
1007/s11103-017-0693-6 147. Shrestha A, Khan A, Dey N (2018) Cis-trans
136. Yamaguchi-Shinozaki K, Shinozaki K (1993) engineering advances and perspectives on cus-
Characterization of the expression of a tomized transcriptional regulation in plants.
desiccation-responsive rd29 gene of Arabi- Mol Plant 11:886–898
dopsis thaliana and analysis of its promoter 148. Ren B, Yan F, Kuang Y, Li N, Zhang D,
in transgenic plants. Mol Gen Genet 236(2): Lin H, Zhou H (2017) A CRISPR/Cas9
331–340 toolkit for efficient targeted base editing to
137. Narusaka Y, Nakashima K, Shinwari ZK, induce genetic variations in rice. Sci China
Sakuma Y, Furihata T, Abe H, Narusaka M, Life Sci 60:516–519. https://doi.org/10.
Shinozaki K, Yamaguchi Shinozaki K (2003) 1007/s11427-016-0406-x
Interaction between two cis acting elements, 149. Hua K, Tao X, Zhu JK (2018) Expanding the
ABRE and DRE, in ABA dependent expres- base editing scope in rice by using Cas9 var-
sion of Arabidopsis rd29A gene in response to iants. Plant Biotechnol J 17:499–504.
dehydration and high salinity stresses. Plant J https://doi.org/10.1111/pbi.12993
34:137–148
150. Yan F, Kuang Y, Ren B, Wang J, Zhang D, Lin
138. Holmes-Davis R, Li G, Jamieson AC, Rebar H (2018) Highly efficient AlT to GlC base
EJ, Liu Q, Kong Y et al (2005) Gene regula- editing by Cas9n guided tRNA adenosine
tion in planta by plant-derived engineered deaminase in rice. Mol Plant 11:631–634
zinc finger protein transcription factors.
Plant Mol Biol 57:411–423 151. Fernandez M, Dodd RS (2018) Using
CRISPR as a gene editing tool for validating
139. Yang J, Ordiz MI, Semenyuk EG, Kelly B, adaptive gene function in tree landscape
Beachy RN (2012) A safe and effective plant genomics. Front Ecol Evol 6:76. https://
gene switch system for tissue-specific induc- doi.org/10.3389/fevo.2018.00076
tion of gene expression in Arabidopsis thali-
ana and Brassica juncea. Transgenic Res 21: 152. Ye M, Peng Z, Tang D et al (2018) Genera-
879–883 tion of self-compatible diploid potato by
knockout of S-RNase. Nat Plants 4:
140. Wittkopp PJ, Kalay G (2012) Cis-regulatory 651–654. https://doi.org/10.1038/
elements: molecular mechanisms and evolu- s41477-018-0218-6
tionary processes underlying divergence. Nat
Rev Genet 13:59–69 153. Metje-Sprink J, Menz J, Modrzejewski D,
Sprink T (2019) DNA-free genome editing:
141. Cermak T, Curtin SJ, Gil-Humanes J, past, present and future. Front Plant Sci 9:
Čegan R, Kono TJY, Konečná JJ et al 1065–1080
(2017) A multi-purpose toolkit to enable
advanced genome engineering in plants. 154. Malnoy M, Viola R, Jung MH, Koo OJ,
Plant Cell 29:1196–1217 Kim S, Kim JS et al (2016) DNA-free geneti-
cally edited grapevine and apple protoplast
142. Soyk S, Lemmon ZH, Oved M, Fisher J, Lib- using CRISPR/Cas9 ribonucleoproteins.
eratore KL, Park SJ et al (2017) Bypassing Front Plant Sci 7:1904. pmid:28066464
negative epistasis on yield in tomato imposed
by a domestication gene. Plant Cell 169: 155. Cong L, Ran FA, Cox D, Lin S, Barretto R,
1142–1155.e12 Habib N et al (2013) Multiplex genome engi-
neering using CRISPR/Cas systems. Science
143. Swinnen G, Goossens A, Pauwels L (2016) 339:819–823
Lessons from domestication: targeting
Cis-regulatory elements for crop improve- 156. Lu Y, Ye X, Guo R, Huang J, Wang W, Tang J
ment. Trends Plant Sci 21:506–515 et al (2017) Genome-wide targeted
mutagenesis in rice using the CRISPR/Cas9 158. Razzaq A, Saleem F, Kanwal M, Mustafa G,
system. Mol Plant 10:1242–1245. https:// Yousaf S et al (2019) Modern trends in plant
doi.org/10.1016/j.molp.2017.06.007 genome editing: an inclusive review of the
157. Meng X, Yu H, Zhang Y, Zhuang F, Song X, CRISPR/Cas9 toolbox. Int J Mol Sci
Gao S et al (2017) Construction of a genome- 2019(20):4045
wide mutant library in rice using CRISPR/ 159. Georges F, Ray H (2017) Genome editing of
Cas9. Mol Plant 10:1238–1241. https://doi. crops: a renewed opportunity for food secu-
org/10.1016/j.molp.2017.06.006 rity. GM Crops Food 8:1–12. https://doi.
org/10.1080/21645698.2016.1271856
Chapter 4
In Silico Methods for the Identification of Viral-Derived

Small Interfering RNAs (vsiRNAs) and Their Application
in Plant Genomics
Aditya Narayan, Shafaque Zahra, Ajeet Singh, and Shailesh Kumar
Abstract
The current era of high-throughput sequencing (HTS) technology has expedited the detection and
diagnosis of viruses and viroids in the living system including plants. HTS data has become vital to study
the etiology of the infection caused by both known as well as novel viral elements in planta, and their impact
on overall crop health and productivity. Viral-derived small interfering RNAs are generated as a result of
defence response by the host via RNAi machinery. They are immensely exploited for performing exhaustive
viral investigations in plants using bioinformatics as well as experimental approaches.
This chapter briefly presents the basics of virus-derived small interfering RNAs (vsiRNAs) biology in
plants and their applications in plant genomics and highlights in silico strategies exploited for virus/viroid
detection. It gives a systematic pipeline for vsiRNAs identification using currently available bioinformatics
tools and databases. This will surely work as a quick beginner’s recipe for the in silico revelation of plant
vsiRNAs as well as virus/viroid diagnosis using high-throughput sequencing data.
Key words Detection, Diagnostics, In silico tools, Plant virus, Viroid, vsiRNAs
1 Introduction
RNA interference is a critical component in antiviral immune

responses in plants and recent developments in Next Generation
Sequencing (NGS) methods offer high-throughput, rapid, and
low-cost data generation. Specifically, this has enormously facili-
tated the study of small non-coding RNA, which are recently
deciphered to play a vital role in RNA silencing mechanisms.
RNA silencing-based plant responses to virus infection is a well-
studied domain. These RNA silencing mechanisms, in turn, play a
key role in defense from pathogen infection and are often referred
to as virus-induced gene silencing (VIGS).
71
72 Aditya Narayan et al.
1.1 What Are Plant virology is a century-old field, with investigations of viruses
Virus-Derived Small capable of infecting tobacco plants dating back to the late 1800s.
Interfering RNAs? From that initial discovery, an enormous range of viruses has been
discovered with over 1000 known plant viruses [1]. These viruses
are generally smaller than other types of microbes though they
function through similar machinery as with other virus types.
They are obligate parasites that depend on the machinery of the
host for reproductive purposes, and in that process, may cause host
cell destruction and a range of negative effects. The infection leads
to the production of vsiRNAs.
Viral infection in plants is associated with the generation of
exogenous virus-derived small interfering RNA (vsiRNAs) which
function by sequence-specific degradation of viral DNA
[2, 3]. More specifically, they serve to guide the RNA-induced
silencing complex (RISC) to viral genomes and induce sequence-
specific inactivation of mRNA [4, 5]. This process has also been
associated with chromatin modification and gene translation
related to viral defence mechanisms [6]. This particular pathway is
of interest to scientists given that such infections have the potential
to dramatically alter crop yields in addition to the medicinal proper-
ties, physiology, and nutritional value of plants. This, in turn, holds
great significance for population health and the economy [7–9].
1.2 Why Study Despite the demonstrated significance of understanding plant

vsiRNAs? viruses for their impact on crops and other plants, there remain
great difficulties determining the causative agent of a viral disease
given the lack of ability to easily distinguish between symptoms as a
result of variable and competing effects as well as the potential for
latency in the display of symptoms which may allow viruses to go
undetected [10, 11]. Detection of vsiRNAs in plants will help in the
characterization of the number of novel viruses as well as searching
for new diseases of unrecognized etiology.
For example, it helped in the characterization of the Raspberry
leaf blotch virus and in revealing the existence of many novel viruses
in carrots such as the carrot yellow leaf virus [12, 13].
This merely speaks to an ongoing need to advance virus and
viroid detection methods to more rapidly detect, treat, or prevent
the spread of viruses through vulnerable plant populations. A range
of methods has recently surfaced due to the aforementioned tech-
nical advancements in-omics-based approaches that take advantage
of RNA interference-mediated (RNAi) antiviral mechanisms that
lead to the production of vsiRNAs. Such pipelines will be discussed
in this chapter. Besides, vsiRNAs function as a homology-
dependent gene silencing technology and therefore may be
manipulated for research purposes. Using hairpin constructs,
dsRNA may be expressed in plants and thus may silence key endog-
enous genes to influence plant metabolic pathways to create new
health or environmental benefits. Thereby, tissue-specific or induc-
ible gene silencing may allow for the manipulation of plant traits.
In Silico Methods for the Identification of Viral-Derived Small. . . 73
1.3 Biogenesis Broadly, it has been found that vsiRNAs may be produced from
of vsiRNAs RNA and DNA viruses, as well as from double-stranded or single-
stranded RNA (dsRNA and ssRNA respectively) through RNAse
III-like enzymes like DICER [14]. Specifically, vsiRNAs may be
formed from ssRNA with a hairpin structure, dsRNA given prefer-
ence for RNA sense strands or dsDNA intermediates for DNA
viruses [15, 16]. They range in length from 21 to 24 nucleotides
(nt) and possess a 50 and 30 overhang of 2–3 nt [17].
Dicer-like enzymes (DCL) process viral genomes and the vari-
ety of potential homologs (DCL-2, 3, and 4) each of which provide
distinct functions in the process of vsiRNAs production. DCL-4,
DCL-2, and DCL-3 generate vsiRNAs which are 21, 22, and 24 nt
in length respectively [18]. vsiRNAs which are 21 nt in length is the
most abundant, followed by 24 nt and 22 nt in RNA viruses though
all are capable of inducing RNAi viral defense [2, 19]. Minimal
studies have explored the role of DCLs in plant DNA viruses due to
dsDNA intermediates through Deleris et al. and Blevins et al. have
explored the potential for hierarchical interactions between DCLs
in their action against such viruses [2, 20, 21]. Following the action
of DCLs on viral genomes, primary vsiRNAs are produced which
subsequently interact with Argonaute proteins to create the afore-
mentioned RISC complex. The RISC complex in turn interacts
with RNA-dependent RNA polymerases to target the viral genome
[20]. It acts in a homologous sequence on the viral RNA or DNA
to silence expression. The vsiRNAs-Argonaute complex may also
associate with RNA-induced transcriptional silencing complexes to
methylate viral DNA and thereby operate via epigenetic modifica-
tion [22]. The viral genome is rapidly degraded into small dsRNA
fragments and RNA-dependent RNA polymerases, in turn, gener-
ate secondary siRNA via amplification—thereby illustrating a
biphasic response [23, 24]. The diagrammatic illusion of vsiRNAs
biogenesis is presented in Fig. 1.
1.4 vsiRNAs Also, vsiRNAs have been found to target host mRNA transcripts
Influence and down-regulate the production of functional proteins through
on the Host Plant the sequestration of argonaute proteins [25]. This interferes with
the capacity of the virus to influence host cell mechanisms.
Although some reports have shown that the length of vsiRNAs, as
well as type of DCL, involved affect their defence function in plants.
For example, 21 and 22 nt vsiRNAs show varied functions in
antiviral activity through Argonaute association [26]. However, it
seems interesting that viruses are not defenseless in the face of the
RNAi pathway as Csorba et al. found that viruses produce suppres-
sors capable of interfering with multiple steps in the host
pathway [27].
Fig. 1 Diagrammatic illustration of the biogenesis of virus-derived small interfering RNAs (vsiRNAs) in the plant
cell, their molecular function and impact in the plant cell milieu, and their applications in different domains of
plant biology
2 Current Status of vsiRNAs Study in Plants and Current Databases
In the past 5 years alone there has been enormous progress in both
the number of studies seeking to explore vsiRNAs generation,
pvsiRNAs generation, and small nuclear RNA (snRNA) applica-
tions in addition to a range of related fields. The accessibility of
this knowledge base is anticipated to facilitate the research commu-
nity’s exploration of these underexplored entities in various con-
texts. Several databases currently exist for this field of study
including siRNAdb, HIVsirDB, VIRsiRNAdb, and PVsiRNAsdb
[28–31]. These databases span a range of content including siRNA
and vsiRNAs with an emphasis on viral diseases that infect humans.
Of note, PVsiRNAsdb is specific to plant vsiRNAs, thereby facil-
itating study specifically in this space. While vsiRNAs impact
genetic regulation in plants in a variety of ways, there is still a lack
of knowledge base in the field. A brief outline of current scholarly
progress in the space is presented in Table 1.
Table 1
Overview of statistics related to different information collected for plant vsiRNAs
Plant vsiRNAs information Metric

Publications regarding vsiRNAs ~85
The approximate number of vsiRNAs sequences ~322,000
published
The approximate number of unique vsiRNAs sequences ~283,000
published
Distribution of vsiRNAs sequences in tissues Roots: ~154,000
Leaves: ~146,000
Other: ~200
vsiRNAs length range Range encompassing the majority of vsiRNAs:
19–24 nt
Mode: 21 nt
2.1 Role Given that this RNA derived from the viral RNA/DNA, which in
of Bioinformatics turn derives from the entirety of the viral genome, it becomes
in the Detection possible to reconstruct a viral genome through analysis of the viral
of vsiRNAs siRNA population via sequencing and de novo assembly [32–
34]. Deep sequencing stands as a natural path forward as it has
led to numerous breakthrough innovations in biomedical science.
In effect, siRNAs may be synthesized via in silico and in-vitro
methods to induce knockdown or knockouts of key genes to
explore various research aims [35].
In the following sections, we examined the steps leading to the
generation of vsiRNAs as well as their applications in viral
diagnostics.
2.2 In Silico Methods vsiRNAs detection begins with the generation of raw sRNA reads,
for vsiRNAs Detection after which sample preparation must take place to facilitate down-
stream bioinformatics analysis. Following filtration of the reads,
they are aligned to the host plant and suspect plant genomes. De
novo assembly of these unmapped reads leads to the creation of
contigs and these are subsequently searched against databases using
tools such as BLAST. This may yield viral genome contigs which are
then aligned with sRNA reads and the siRNA reads distribution on
the virus genome can be used to detect a known virus. Alternatively,
the process may lead to the detection of novel viruses. This pipeline
is presented in Fig. 2.
2.2.1 Raw sRNA Read The process for generation of vsiRNAs begins with infecting host
Generation plants with a virus or viroid, after which RNA is isolated from lysed
cells which may then be stored or used immediately. Small RNA
libraries may be prepared using commercial kits, keeping in mind
ligation bias. At this stage, it is possible to perform next generation
Fig. 2 Flow chart depicting the in silico identification of virus-derived small interfering RNAs (vsiRNAs) using
different bioinformatics tools: quality control tools, mapping, and assembly tools, database search tools;
useful databases as well as important pipelines available for virus/viroid identification
sequencing (NGS) analysis of the collected sequences with the

potential for a variety of applications including viral diagnostics
and transgenic or virus-resistant plant generation.
This method was first applied by Kreuze et al. who reported the
first profiling based on small RNA of plant viruses using parallel
sRNA sequencing of infected and non-infected plants [36]. His
method offered unique advantages including high specificity rela-
tive to PCR/ELISA, the ability to detect viruses of various families,
tissues, those with variance in intracellular replication sites. How-
ever, the process is still difficult to execute and to bridge this gap,
Wu et al. created the Progressive Filtering of Overlapping small
RNA (PFOR) methodology which holds advantages in that it does
not require viroid sequences. PFOR functions through the detec-
tion of siRNAs of viroid origin by eliminating those sRNA that does
not overlap as well as overlapping sequences produced from rolling-
circle replication of viroid RNA. This method has since been
updated to PFOR2 which examines long RNA reads from NGS
and offers correspondingly greater speed, despite the continued use
of PFOR for small RNA reads [37].
2.2.2 Read Preparation Raw reads are prepared first through examinations by applications
such as FastQC which generates quality control scores. Such pre-
processing requires an assessment of data quality, GC content, an
analysis of duplicated/repeated reads, and the like which may inter-
fere with alignment and thus must be removed. This is followed by
trimming of adaptors, barcodes, low-quality reads, and minimal

complexity sequences which may be done through applications
such as Trimmomatic and Cutadapt. It is necessary to eliminate
sequences created from cellular miRNA and human genetic mate-
rial contamination. This may be achieved through the application
of software such as Bowtie applied with a human reference genome
and miRNA sequences drawn from extant databases.
A summary of commonly applied applications for this purpose
are as follows:
FastQC: A Java-based tool that allows for quality control analysis on
raw sequence data from various pipelines that present rapid
visual insights, via summary tables and graphs, into issues
with the data. It can accept data from BAM, SAM, or FastQ
files and allows export to HTML reports. Additionally offers
the capacity to function offline (https://www.bioinformatics.
babraham.ac.uk/projects/fastqc/).
AfterQC: AfterQC extends beyond other quality control tools as it
offers the potential to also quantify and correct sequencing
errors found in raw data. It functions through analyzing the
overlap of paired sequences for pair-end sequencing data and
can correct bases in the overlap. Besides, it allows for the
detection of sequencer bubble effects, polyX filtering, and
trimming at the front and tail. It accepts FastQ files and outputs
HTML reports with figures for rapid visualization [38].
Trimmomatic: Trimmomatic is a Java-based NGS read preproces-
sing tool which provides additional flexibility and a specific
focus on paired-end data. It offers high efficacy for this data
type relative to other tools [39].
Cutadapt: This tool was designed to specifically remove adapter
sequences, primers, poly-A tails, and other sequences from
NGS sequencing reads. A 30 sequencing adapter is often pres-
ent in small RNA sequencing due to the read being longer than
the sequenced molecule and poly-A tails are often unnecessary
for analysis. It is also capable of filtering single and paired-end
reads and can demultiplex reads as well [40].
2.2.3 Read Alignment At this stage, filtered reads may be aligned to the host plant genome
as well as other suspected plant genomes and it becomes possible to
recreate and identify both known and, more significantly, unknown
viral genomes. Mapping reads to a host genome ultimately serves to
eliminate sequences originating from the host. To conserve time
and system memory, the genome should be indexed as well, which,
analogous to the index of a book, allows for more rapid identifica-
tion of sequence locations. A variety of de novo assembly tools then
function to create contiguous sequences (contigs) from overlap-
ping sRNA produced from deep sequencing. These contigs are
subsequently subjected to homology tools to analyze viral origins.

A variety of assemblers may be put to this task and are described
below.
Velvet: This is a de Bruijn graph-based tool that offers a broad range
of k-mers and is designed to build contigs and scaffolds from
short sequences. de Bruijn graph is one that represents the
homogenous overlap between sequences. The software accepts
single end reads through paired-end reads that are preferred.
Following the creation of the graph, it then removes errors
from the graph, resolves repeats, and outputs an assembly of
the reads as well as statistical analysis of the data [41].
Oases: Oases is a software package designed to accept RNA-seq
reads and perform de novo assembly without a reference
genome. It takes into account varying expression levels and
isoforms using hash lengths, noise filtration, resolution of alter-
native splicing, and assembly merging. The process takes inde-
pendent k-mer assemblies and in each, creates a de Bruijn graph
which is corrected for errors, organized, divided into loci,
analyzed for transcript assemblies, and assembled [42].
CLC genomics workbench: This is a software tool from Qiagen which
performs de novo transcriptome assembly from RNA-seq data.
It first creates a “word table” listing all subsequences in reads,
from which a de Bruijn graph is created. Reads and paired read
information is used to help improve graph resolution, after
which scaffolding is performed and the contigs and scaffolds
are presented.
BWA-assembler: BWA, or Burrows-Wheeler Aligner, employs the
most commonly employed algorithm (Burrows-Wheeler) for
mapping low divergence sequences against reference genomes.
It offers several algorithms within it including BWA-backtrack
(for Illumina reads up to 100 bp), BWA-SW, and BWA-MEM
(both SW and MEM are used for 70 bp to 1 Mbp sequences but
MEM is faster and more accurate) [43].
ABySS: Assembly By Short Sequences is a parallelized sequence
assembler designed for use with the output of high-throughput
DNA sequencing platforms. The algorithm functions by first
generating all possible k-mers from sequence reads which are
processed to remove errors and contigs are built based on these
reads. Mate-pair information is then used to resolve contig
overlaps and extend the contigs with the final output taking
the form of de Bruijn graphs [44].
2.2.4 Database Searches From contigs, it is possible to apply the Basic Local Alignment
Using Software Tools Search Tool (BLAST) to identify the association of the contig
with viral sequences. BLAST comparisons are sensitive and may
be used in place of read mappers for their tolerance for divergent

sequences [45]. There are a wide variety of BLAST tools which may
be applied to nucleotide and protein databases including BLASTN
(for searching nucleotide databases), BLASTP (for protein data-
bases with a protein query), BLASTX (for searching protein data-
bases with a translated nucleotide query), MegaBLAST (for
multiple nucleotide sequence queries), and TBLASTX (for compar-
ing all six-frame translations of nucleotide queries against data-
bases). Parameters such as e-value (the number of expected hits of
a similar quality which may be identified by chance) may be
adjusted to optimize results. Additionally, given that protein
sequences are more conserved than nucleotides, protein databases
may offer more effective distant viral sequence hits [34]. A well-
organized reference genome enormously aids research endeavors,
however, plant genome and virus databases are rare relative to the
human genome and human virus repositories. This leads to chal-
lenges with the detection of plant viruses.
Some databases which may be applied to this task are described
below:
GenBank: A comprehensive database with publicly available nucle-
otide sequences with several hundred thousand organisms
obtained through a publicly sourced submission from labora-
tories and large scale sequencing projects [46] GenBank is
accessible online and it is a simple task to query plant viruses
of interest. This database contains 9727 complete viral data-
bases, of which 1826 infect plants.
RefSeq: Refseq is a database that includes genome, nucleotide,
transcript, and protein sequences and was built by the National
Center for Biotechnology Information (NCBI). It is well
organized and similar to GenBank concerning interface. It
includes sequence features and bibliographic information
[47]. This database includes roughly 175,000 plant virus
sequences.
Pfam: A database consisting of protein families (roughly 18,000 in
2019) with each entry consisting of a seed alignment that is
used to build a hidden Markov model (a statistical representa-
tion that may be used to model sets of one-dimensional data).
This in turn is queried against a sequence database and full
alignment is generated from the alignment of the resultant
matches with the model [48]. A search for plant virus yields
738 unique protein sequences.
Conserved domain database: The CDD is a publically available
database with hierarchical classifications of protein families
that functions similarly to the aforementioned databases in
that it allows for the mapping of conserved sites onto user
queries. It contains 52,000+ protein and protein domain
models sourced from other databases including but not limited

to Pfam, SMART, and TIGRFAMS. It provides domain anno-
tations as well as searches for single nucleotide/protein queries
and large protein query sequences. The protein domain archi-
tectures which are used to classify proteins in the database may
be explored in the associated Subfamily Protein Architecture
Labeling Engine (SPARCLE) [49]. A search for “plant” and
“virus” yielded 61 entries.
2.2.5 Virus-Related Virus-Hostdb: This web-based database was created specifically to

Databases facilitate the exploration of environmental genomics which
includes cellular and viral organisms occupying a space. Such
analysis requires a reference database and so Virus-Hostdb was
created to provide a database of taxonomic links between
viruses and cellular hosts to better allow the analysis of organ-
ism interactions. The database organizes data as pairs of NCBI
taxonomy IDs for the viruses and their hosts with the inclusion
of viruses from NCBI/RefSeq and GenBank [50]. This data-
base specifically references 688 plant viruses and 3633
non-plant viruses from the other major kingdoms.
DPVweb: Offering further specificity, DPVweb provides a database
for viruses, viroids, and satellites of plants, fungi, and protozoa.
It includes taxonomic information and curated sequence data.
It also contains representative sequences of all other virus
species with an RNA or ssDNA genome. Sequence information
may be easily downloaded online [51]. The database provides
information on and descriptions of 422 plant viruses.
PvsiRNAsdb: Of particular interest for the study of vsiRNAs is the
PvsiRNAsdb database which contains a curated repository of
information on plant exclusive vsiRNAs found in virus-infected
plants. It offers 322,000+ entries and 280,000+ unique
sequences of vsiRNAs, derived from 20 viral strains in
12 plant species, with comprehensive information for each
including the plant, tissue, virus name, and vsiRNAs sequence
as well as the vsiRNAs map position, length, coordinates, pre-
dicted structure and so on. The database includes tools such as
BLAST, Smith-Waterman Align, and Mapping to aid in
searches [31].
2.2.6 Align sRNA Reads On mapping, reads and contigs will likely be presented with variable
to Contigs and Uses confidence aligned against known viral genomes and must be
to Detect Known and Novel examined for the number of contigs as well as the extent of the
Viruses genome covered to gauge the extent to which results should be
trusted. Beyond this, a variety of mechanisms may be employed to
more effectively identify plant viruses including searching for
unique mappers, the use of negative controls to observe unique
reads in infected plant samples, looking for features such as trans-

posons or open reading frames to distinguish between viral and
other sequences, and applying identity percentages in tandem with
background knowledge of virus/subviral agent taxonomy [34]. At
this stage, if the novel reads or contigs are generated, they are used
to detect a novel virus.
2.2.7 Putting It Together: A variety of tools exist which provide components of or whole
Pipelines pipelines for vsiRNAs detection. Several samples are briefly
described below.
VirusDetect: A software package that analyzes sRNA data sets for
the goal of virus identification. This program functions
through alignment of sRNA read to GenBank’s virus reference
database, performs de novo assembly with Velvet, compares the
contigs to reference sequences for viral identification and the
siRNA profile of contigs which were not hits are used to iden-
tify novel viruses [52].
VirFind: VirFind is a web-based front-end interface. Users com-
plete a sequence submission form and upload files via the
VirFind FTP server, at which point they can set their para-
meters. It functions by mapping to the reference genome and
was developed for virus detection and discovery. It functions by
mapping and filtering host reads, provides information on
reads, taxonomic information, as well as BLAST reports, and
searches for conserved domains for unknown origin reads [53].
PVsiRNAsPred: This predictive software extracts plant vsiRNAs
sequences from the PVsiRNAsdb database and applies a deep
convolutional neural network to develop a deep learning algo-
rithm to predict plant vsiRNAs. Based on vsiRNAs profiles in
plants, the neural network learns hierarchical representations of
vsiRNAs sequences and has thus far shown a 65.7% accuracy.
This tool, therefore, offers the potential of more rapidly gen-
erating predicted vsiRNAs sequences for subsequent analysis
and application [54].
3 Conclusion
3.1 Challenges As with any pipeline, it is always challenging to ensure perfect

quality in every step of the process. Much of quality control lies
on the back of the research scientist both in terms of execution of
each step, but also with choosing the correct tools for the job at
hand and applying proper study design. Beginning with read prep-
aration, discerning contaminants is important that may present
challenges in the bench setting. Within the bioinformatics pipeline
itself, many difficulties arise for the final stage of analyzing and
identifying plant viruses based on the mapping of contigs to the

genome. Removal of invalid sequences and understanding how to
discriminate between high and low potential virus identities
requires a baseline knowledge of taxonomy. Researchers may also
lack the technical training necessary to apply many of the described
tools and navigate the modular creation of pipelines to suit their
purposes. The authors hope this chapter has alleviated some of
these challenges by giving an overview of available tools and an
essential prescription for the exploration of vsiRNAs.
3.2 Limitations Despite the abundance of sequence data and tools, many are broad
in scope and the lack of specific, easily accessible data on the specific
populations of interest (for example plant viruses), remains some-
thing of a challenge. Databases and tools must also provide
all-inclusive references, standardized formats, and frequent updates
to work within the landscape of rapidly expanding tools and
sequence data. As such, cross-disciplinary collaboration is necessary
between virologists, researchers, geneticists, bioinformaticians, and
so on to create tools that minimize or eliminate the possibility of
user error and allow for more in-depth engagement with specific
sequences. Small RNA-omics offers enormous potential for gener-
ating and answer critical questions in viral genomics, plant viruses,
and ecology.
3.3 Future There has been breathtaking progress in research and the develop-
Perspectives ment of informatics tools that apply sRNA sequencing to detect
viruses as well as an understanding of the applications of such
knowledge toward public health, environmental genomics, the
creation of transgenic plants for particular purposes and the like.
This manuscript sought to democratize the workflow employed to
detect vsiRNAs and apply sRNAs to the task of viral detection and
facilitate future study in this space. Despite this workflow, the
process requires researchers to apply their knowledge for eliminat-
ing contaminants, performing quality assurance, and applying the
appropriate tools to their requisite tasks.
References
1. Gergerich RC, Dolja VV (2006) Introduction 4. Ding SW, Voinnet O (2007) Antiviral immu-
to plant viruses, the invisible foe. Plant Health nity directed by small RNAs. Cell 130:
Instructor. https://doi.org/10.1094/phi-i- 413–426
2006-0414-01 5. Hammond SM, Boettcher S, Caudy AA et al
2. Zhang C, Wu Z, Li Y, Wu J (2015) Biogenesis, (2001) Argonaute2, a link between genetic and
function, and applications of virus-derived biochemical analyses of RNAi. Science 293:
small RNAs in plants. Front Microbiol 6:1237 1146–1150. https://doi.org/10.1126/sci
3. Li ML, Weng KF, Shih SR, Brewer G (2016) ence.1064023
The evolving world of small RNAs from RNA 6. Zhu H, Guo HS (2012) The role of virus-
viruses. Wiley Interdiscip Rev RNA 7: derived small interfering RNAs in RNA silenc-
575–588. https://doi.org/10.1002/wrna. ing in plants. Sci China Life Sci 55:119–125
1351
7. Diener TO (1963) Physiology of virus-infected Science 313:68–71. https://doi.org/10.

plants. Annu Rev Phytopathol 1:197–218. 1126/science.1128214
https://doi.org/10.1146/annurev.py.01. 21. Blevins T, Rajeswaran R, Shivaprasad PV et al
090163.001213 (2006) Four plant Dicers mediate viral small
8. Garcia-Ruiz H (2019) When viruses infect RNA biogenesis and DNA virus induced
plants. Scientia 2019:40–43 silencing. Nucleic Acids Res 34:6233–6246.
9. Nicaise V (2014) Crop immunity against https://doi.org/10.1093/nar/gkl886
viruses: outcomes and future challenges. 22. Raja P, Sanville BC, Buchmann RC, Bisaro DM
Front Plant Sci 5:660 (2008) Viral genome methylation as an epige-
10. Syller J (2012) Facilitative and antagonistic netic defense against geminiviruses. J Virol 82:
interactions between plant viruses in mixed 8997–9007. https://doi.org/10.1128/jvi.
infections. Mol Plant Pathol 13:204–216 00719-08
11. Takahashi H, Fukuhara T, Kitazawa H, Korme- 23. Malpica-López N, Rajeswaran R, Beknazar-
link R (2019) Virus latency and the impact on iants D et al (2018) Revisiting the roles of
plants. Front Microbiol 10:2764 tobamovirus replicase complex proteins in
12. McGavin WJ, Mitchell C, Cock PJA et al viral replication and silencing suppression.
(2012) Raspberry leaf blotch virus, a putative Mol Plant-Microbe Interact 31:125–144.
new member of the genus Emaravirus, encodes https://doi.org/10.1094/MPMI-07-17-
a novel genomic RNA. J Gen Virol 93 0164-R
(Pt 2):430–437. https://doi.org/10.1099/ 24. Vazquez F, Hohn T (2013) Biogenesis and
vir.0.037937-0 biological activity of secondary siRNAs in
13. Adams IP, Skelton A, Macarthur R et al (2014) plants. Scientifica 2013:1–12. https://doi.
Carrot yellow leaf virus is associated with carrot org/10.1155/2013/783253
internal necrosis. PLoS One 9:e109125. 25. Miozzi L, Gambino G, Burgyan J, Pantaleo V
https://doi.org/10.1371/journal.pone. (2013) Genome-wide identification of viral
0109125 and host transcripts targeted by viral siRNAs
14. Xia Z, Zhao Z, Jiao Z et al (2018) Virus- in Vitis vinifera. Mol Plant Pathol 14:30–43.
derived small interfering rnas affect the accu- https://doi.org/10.1111/j.1364-3703.2012.
mulations of viral and host transcripts in maize. 00828.x
Viruses 10:664. https://doi.org/10.3390/ 26. Wang XB, Jovel J, Udomporn P et al (2011)
v10120664 The 21-nucleotide, but not 22-nucleotide,
15. Szittya G, Moxon S, Pantaleo V et al (2010) viral secondary small interfering rnas direct
Structural and functional analysis of viral siR- potent antiviral defense by two cooperative
NAs. PLoS Pathog 6:1–15. https://doi.org/ argonautes in Arabidopsis thaliana. Plant Cell
10.1371/journal.ppat.1000838 23:1625–1638. https://doi.org/10.1105/
tpc.110.082305
16. Donaire L, Wang Y, Gonzalez-Ibeas D et al
(2009) Deep-sequencing of plant viral small 27. Csorba T, Kontra L, Burgyán J (2015) Viral
RNAs reveals effective and widespread target- silencing suppressors: tools forged to fine-tune
ing of viral genomes. Virology 392:203–214. host-pathogen coexistence. Virology 479–480:
https://doi.org/10.1016/j.virol.2009. 85–103
07.005 28. Chalk AM, Warfinge RE, Georgii-Hemming P,
17. Llave C (2010) Virus-derived small interfering Sonnhammer ELL (2005) siRNAdb: a data-
RNAs at the core of plant-virus interactions. base of siRNA sequences. Nucleic Acids Res
Trends Plant Sci 15:701–707 33:D131–D134. https://doi.org/10.1093/
nar/gki136
18. Xie Z, Johansen LK, Gustafson AM et al
(2004) Genetic and functional diversification 29. Tyagi A, Ahmed F, Thakur N et al (2011)
of small RNA pathways in plants. PLoS Biol HIVsirDB: a database of HIV inhibiting siR-
2:E104. https://doi.org/10.1371/journal. NAs. PLoS One 6:e25917. https://doi.org/
pbio.0020104 10.1371/journal.pone.0025917
19. Akbergenov R, Si-Ammour A, Blevins T et al 30. Thakur N, Qureshi A, Kumar M (2012) VIR-
(2006) Molecular characterization of siRNAdb: a curated database of experimentally
geminivirus-derived small RNAs in different validated viral siRNA/shRNA. Nucleic Acids
plant species. Nucleic Acids Res 34:462–471. Res 40:D230–D236. https://doi.org/10.
https://doi.org/10.1093/nar/gkj447 1093/nar/gkr1147
20. Deleris A, Gallago-Bartolome J, Bao J et al 31. Gupta N, Zahra S, Singh A, Kumar S (2018)
(2006) Hierarchical action and inhibition of PVsiRNAdb: a database for plant exclusive
plant dicer-like proteins in antiviral defense. virus-derived small interfering RNAs. Database
2018:105. https://doi.org/10.1093/data https://doi.org/10.1093/bioinformatics/

base/bay105 bts094
32. Massart S, Chiumenti M, De Jonghe K et al 43. Li H, Durbin R (2009) Fast and accurate short
(2019) Virus detection by high-throughput read alignment with Burrows-Wheeler trans-
sequencing of small RNAs: large-scale perfor- form. Bioinformatics 25:1754–1760. https://
mance testing of sequence analysis strategies. doi.org/10.1093/bioinformatics/btp324
Phytopathology 109:488–497. https://doi. 44. Simpson JT, Wong K, Jackman SD et al (2009)
org/10.1094/PHYTO-02-18-0067-R ABySS: a parallel assembler for short read
33. Seguin J, Rajeswaran R, Malpica-López N et al sequence data. Genome Res 19:1117–1123.
(2014) De novo reconstruction of consensus https://doi.org/10.1101/gr.089532.108
master genomes of plant RNA and DNA 45. Altschul SF, Gish W, Miller W et al (1990)
viruses from siRNAs. PLoS One 9. https:// Basic local alignment search tool. J Mol Biol
doi.org/10.1371/journal.pone.0088513 215:403–410. https://doi.org/10.1016/
34. Vivek AT, Zahra S, Kumar S (2020) From S0022-2836(05)80360-2
current knowledge to best practice: a primer 46. Benson DA, Cavanaugh M, Clark K et al
on viral diagnostics using deep sequencing of (2013) GenBank. Nucleic Acids Res 41:
virus-derived small interfering RNAs (vsiR- D36–D42. https://doi.org/10.1093/nar/
NAs) in infected plants. Methods 183:30–37 gks1195
35. Stobbe AH, Roossinck MJ (2014) Plant virus 47. Pruitt KD, Tatusova T, Maglott DR (2007)
metagenomics: what we know and why we NCBI reference sequences (RefSeq): a curated
need to know more. Front Plant Sci 5:150. non-redundant sequence database of genomes,
https://doi.org/10.3389/fpls.2014.00150 transcripts and proteins. Nucleic Acids Res 35:
36. Kreuze JF, Perez A, Untiveros M et al (2009) D501–D504. https://doi.org/10.1093/nar/
Complete viral genome sequence and discovery gkl842
of novel viruses by deep sequencing of small 48. El-Gebali S, Mistry J, Bateman A et al (2019)
RNAs: a generic method for diagnosis, discov- The Pfam protein families database in 2019.
ery and sequencing of viruses. Virology 388: Nucleic Acids Res 47:D427–D432. https://
1–7. https://doi.org/10.1016/j.virol.2009. doi.org/10.1093/nar/gky995
03.024 49. Lu S, Wang J, Chitsaz F et al (2020)
37. Wu Q, Wang Y, Cao M et al (2012) CDD/SPARCLE: the conserved domain data-
Homology-independent discovery of replicat- base in 2020. Nucleic Acids Res 48:
ing pathogenic circular RNAs by deep sequenc- D265–D268. https://doi.org/10.1093/nar/
ing and a new computational algorithm. Proc gkz991
Natl Acad Sci U S A 109:3938–3943. https:// 50. Mihara T, Nishimura Y, Shimizu Y et al (2016)
doi.org/10.1073/pnas.1117815109 Linking virus genomes with host taxonomy.
38. Chen S, Huang T, Zhou Y et al (2017) Viruses 8:6. https://doi.org/10.3390/
AfterQC: automatic filtering, trimming, error v8030066
removing and quality control for fastq data. 51. Adams MJ (2006) DPVweb: a comprehensive
BMC Bioinformatics 18:80. https://doi.org/ database of plant and fungal virus genes and
10.1186/s12859-017-1469-3 genomes. Nucleic Acids Res 34:D382–D385.
39. Bolger AM, Lohse M, Usadel B (2014) Trim- https://doi.org/10.1093/nar/gkj023
momatic: a flexible trimmer for Illumina 52. Zheng Y, Gao S, Padmanabhan C et al (2017)
sequence data. Bioinformatics 30:2114–2120. VirusDetect: an automated pipeline for effi-
https://doi.org/10.1093/bioinformatics/ cient virus discovery using deep sequencing of
btu170 small RNAs. Virology 500:130–138. https://
40. Martin M (2011) Cutadapt removes adapter doi.org/10.1016/j.virol.2016.10.017
sequences from high-throughput sequencing 53. Ho T, Tzanetakis IE (2014) Development of a
reads. EMBnet J 17:10. https://doi.org/10. virus detection and discovery pipeline using
14806/ej.17.1.200 next generation sequencing. Virology
41. Zerbino DR, Birney E (2008) Velvet: algo- 471–473:54–60. https://doi.org/10.1016/j.
rithms for de novo short read assembly using virol.2014.09.019
de Bruijn graphs. Genome Res 18:821–829. 54. He B, Huang J, Chen H (2019) PVsiR-
https://doi.org/10.1101/gr.074492.107 NAPred: prediction of plant exclusive virus-
42. Schulz MH, Zerbino DR, Vingron M, Birney derived small interfering RNAs by deep convo-
E (2012) Oases: robust de novo RNA-seq lutional neural network. J Bioinforma Comput
assembly across the dynamic range of expres- Biol 17(6):1950039
sion levels. Bioinformatics 28:1086–1092.
Chapter 5
Barley Stripe Mosaic Virus (BSMV)-Based Virus-Induced

Gene Silencing to Functionally Characterize Genes in Wheat
and Barley
Harvinder Bennypaul and Upinder S. Gill
Abstract
Virus-induced gene silencing (VIGS) is an efficient method for functional characterization of genes in
monocot and dicot plants via transient silencing of gene(s) of interest. Among various virus vectors, Barley
stripe mosaic virus (BSMV) is established as a vector of choice to silence genes in wheat and barley. BSMV is
a single-stranded positive-sense RNA virus with a tripartite genome consisting of α, β, and γ RNAs. BSMV-
based VIGS has been used to silence both abiotic and biotic stress response genes in various growth stages
of plants. Here we describe an efficient and effective protocol to successfully silence wheat and barley genes
expressing in various tissues using this approach.
Key words Virus-induced gene silencing, VIGS, Barley stripe mosaic virus, Wheat, Barley
1 Introduction
Virus-induced gene silencing (VIGS) is an important technique to

conduct functional genomics studies in crop plants. VIGS is more
efficient and less time-consuming compared to stable genetic trans-
formation for functional characterization of candidate genes. The
transient silencing of gene-of-interest (GOI) is achieved via exploit-
ing the host’s posttranscriptional gene silencing (PTGS)-based
defense mechanism [1]. Use of VIGS using multiple virus-derived
vectors has been documented for multiple dicot and monocot plant
species [2, 3]. In wheat and barley, VIGS is achieved through the
use of Barley stripe mosaic virus (BSMV). BSMV is a single-stranded
positive-sense RNA virus with a tripartite genome consisting of α,
β, and γ RNAs [4, 5]. BSMV is a vector of choice for silencing of
both host and pathogen genes as well as expression of GOI in
various plant tissues, due to its easy mechanical transmission and
transmission via seed [6–8]. To use BSMV as a VIGS vector, it was
modified to have a deletion in the coat protein gene in β genome
85
86 Harvinder Bennypaul and Upinder S. Gill
Fig. 1 PDS silencing in leaf and spike of wheat cultivar Zak modified from Bennypaul et al. [9]. No
photobleaching symptoms appeared on the leaves and spikes of plants inoculated with FES as negative
control (a, d) and MCS (b, e) expressing vector pγ.MCS as positive virus control. Photobleaching on leaf (c) and
spike (f) of plants inoculated with vector pγ.PDS4 due to knockdown of Phytotene Desaturase gene
and an insertion of the stop codon in the γb protein-encoding

region [4]. We used the modified BSMV vector to conduct VIGS
in wheat and barley [9, 10]. In addition to a positive control pγ.
bPDS4, a negative control vector was designed by cloning a frag-
ment of multiple cloning sites of pBluescript K/S in γ genome
[10]. Using this approach, we have successfully silenced multiple
genes in various plant tissues, developmental stages, and plant
species [9, 10]. Here, we describe our VIGS protocol that can be
used to silence wheat and barley genes at various plant growth
stages including seedling leaves, and spikes (Fig. 1).
2 Materials
2.1 Multiplication 1. Glycerol stocks or stab cultures of plasmids pα, pβΔβa, PDS
of BSMV-Based VIGS (Phytotene Desaturase) gene target specific plasmid pγ.bPDS4,
Plasmids and “virus only” negative control plasmid pγ.MCS (contains
multiple cloning site of pBluescript K/S).
2. Agarose.
3. Plasmid DNA extraction kit (Zymo Research, # D4015) or
equivalent.
4. LB agar plates supplemented with ampicillin (100 mg/l).
Barley Stripe Mosaic Virus (BSMV)-Based Virus-Induced Gene. . . 87
5. LB broth supplemented with ampicillin (100 mg/l) (see Note

1).
6. 1 kb DNA ladder (New England Biolabs, # N3232S) or
equivalent.
7. 10 Tris–acetate–EDTA (TAE gel electrophoresis buffer) (see
Note 2).
8. QIAquick Gel Extraction Kit (Qiagen, # 28704) or equivalent.
9. TE buffer (10 mM Tris–HCl, 1 mM EDTA).
10. 37 C shaking and non-shaking incubators.
11. 6 gel loading buffer.
2.2 Construction 1. pγ.bPDS4 plasmid DNA.

of Gene-Specific VIGS 2. Restriction enzymes: PacI, NotI with CutSmart®Buffer (New
Plasmid England Biolabs).
3. One Shot® TOP10 Competent Cells (Thermo Fisher Scien-
tific, # C404010) or equivalent.
4. QIAquick PCR Purification Kit (Qiagen, # 28104) or
equivalent.
5. Agarose.
6. Plasmid DNA extraction kit (Zymo Research, # D4015).
7. LB agar plates supplemented with ampicillin (100 mg/l).
8. LB broth supplemented with ampicillin (100 mg/l).
9. 1 kb DNA ladder.
10. 1 TAE gel electrophoresis buffer.
11. QIAquick Gel Extraction Kit (Qiagen, # 28704).
12. TE buffer (10 mM Tris–HCl, 1 mM EDTA).
13. T4 DNA Ligase (New England Biolabs, # M0202S) or
equivalent.
14. 37 C shaking and non-shaking incubators.
15. Ice Bucket with ice.
16. 42 C water bath.
17. 6 gel loading buffer.
2.3 Preparation 1. plasmids pα, pβΔβa, pγ.GOI, and pγ.MCS.

of BSMV In Vitro 2. Restriction enzymes: MluI, SpeI, and BssHII or SwaI.
Transcription
3. mMESSAGE mMACHINE® High Yield Capped RNA Tran-
Reactions
scription Kit (Thermo Fisher Scientific, # AM1345).
4. RNase inhibitor (Thermo Fisher Scientific, # AM2682) or
equivalent.
2.4 Plant Inoculation 1. Healthy (free from biotic/abiotic stresses) wheat or barley
seeds.
2. Plastic Pots (4–600 ).
3. Sunshine #1 potting mix (SunGro Horticulture, Bellevue, WA,
USA) or equivalent supplemented with 14 g Nutricote 14–14-
14 (Plantco Inc., Brampton, ON, Canada) per liter of
sunshine mix.
4. Miracle-Gro Solution (Scotts, Port Washington, NY, USA) or
equivalent.
5. 10X Glycine Phosphate (GP) buffer: Dissolve 18.77 g Glycine
and 26.13 g of K2HPO4 (dipotassium phosphate) in 500 ml
dH2O and autoclave.
6. FES inoculation buffer: To prepare 250 ml FES: Dissolve 2.5 g
sodium pyrophosphate, 2.5 g Bentonite, 2.5 g Celite in 50 ml
of 10 ml GP buffer. Bring volume to 250 ml with ddH2O and
autoclave (see Note 3).
7. pα, pβΔβa, pγ.GOI, and pγ.MCS in vitro RNA transcripts.
3 Methods
3.1 Multiplication 1. Streak E. coli glycerol stocks carrying BSMV plasmids pα,
of BSMV Plasmids pα, pβΔβa, pγ.bPDS, and pγ.MCS on LB agar plates supplemented
pβΔβa, and pγ.MCS with ampicillin (100 mg/l) and culture overnight at 37 C.
2. Pick a single colony from each pα, pβΔβa, and pγ.MCS plasmid
plates and start individual 15–20 ml overnight LB cultures
containing Ampicillin (100 mg/l) at 37 C with constant
shaking (225–250 rpm).
3. Purify plasmids using a plasmid miniprep kit as per product
instructions. Avoid the use of RNase during plasmid purifica-
tion as this may interfere with in vitro transcription. Check the
quality of each plasmid via separation of 1 μL of plasmid on 1%
w/v agarose gel. Determine the concentration of each plasmid
using a spectrophotometer (e.g., NanoDrop).
3.2 Construction 1. Select a 120–500 bp sequence of your GOI. To avoid off-target

of Gene-of-Interest effects, make sure that the selected sequence is specific to the
Plasmid (pγGOI) GOI using either NCBI’s BLASTn tool or SI-FI software for
off-target prediction [11]. Attach sequences of restriction sites
PacI and NotI to 50 and 30 ends or vice versa for sense or
antisense orientation of the selected sequence. Synthesize the
DNA fragment (GOI sequence with flanking restriction sites)
commercially. Alternatively, GOI sequence can be
PCR-amplified using gene-specific forward and reverse primers
harboring PacI and NotI restriction sites, respectively.
2. Digest 4–5 μg of commercially synthesized or PCR-amplified

product of the target sequence with NotI and PacI enzymes in
a double digest using CutSmart® buffer. Clean restricted frag-
ments with QIAquick PCR Purification Kit. Alternatively, run
the contents of the digestion reaction on 1% agarose–TAE gel
then elute the DNA from the desired excised gel band using the
QIAquick gel extraction kit. Measure the concentration of the
eluted DNA using a spectrophotometer and check the integrity
by running (1–2 μl) on 1% agarose–TAE gel.
3. Similarly, digest pγ.bPDS4 plasmid with PacI and NotI restric-
tion enzymes for the cloning of the PacI and NotI digested
GOI fragment from step 2. Purify the linearized plasmid by
following the instructions given in step 2.
4. Set up ligation reaction to ligate digested pγ.b plasmid and
GOI fragment using T4 DNA Ligase by following the manu-
facturer’s protocol.
5. Transform competent cells with the ligation reaction as per the
manufacturer’s instructions. Incubate at 37 C for 1 h by
shaking at 225 rpm. Spread the transformation mixture
(20–200 μl) onto an LB agar plate supplemented with ampicil-
lin (100 mg/l), and incubate the plates at 37 C overnight.
6. Next day, pick 5–10 colonies and start 5 ml LB + ampicillin
(100 mg/l) cultures for 16 h at 37 C. Use 4 ml of the bacterial
culture to extract plasmid using a plasmid DNA extraction kit.
7. To identify recombinant plasmids containing the target
sequence, digest extracted plasmids (100–300 ng) with NotI
and PacI as mentioned in step 2. Run contents of the digestion
reaction on 1% agarose–TAE gel. Two bands, one the size of
your vector and another the size of your new insert, should
indicate successful cloning. For additional confirmation, elute
the DNA from the desired excised gel band using the gel DNA
extraction kit. Sequence the excised fragment to confirm that it
is the right target sequence.
8. After identifying the correct clone, use the remaining 1 ml
culture (from step 6) to inoculate LB + ampicillin (100 mg/
l) cultures to carry out a large-scale preparation of plasmid
DNA. Store the clone at 80 C as 20% glycerol stock follow-
ing standard molecular biology protocols.
3.3 Growing Plants 1. Grow wheat/barley (one seed in each pot) in Nutricote sup-
plemented Sunshine mix (see Note 4).
2. Plants should be grown at 22 C day and 18 C night, with
23–50% relative humidity and 16 h light at
500–700 μmol m2 s1.
3. Water plants with 0.94 g/l autoclaved Miracle-Gro solution as
needed, usually 3–4 times/week. In our opinion, any accept-
able alternate fertilizer regimen can be used.
3.4 Preparation of In 1. Linearize each plasmid with the following enzymes using
Vitro Transcripts restriction digestion conditions as per the manufacturer’s
recommendations:
(a) pα: use MluI,
(b) pβΔβa: use SpeI,
(c) pγ.GOI: use BssHII or SwaI,
(d) pγ.MCS: use BssHII or SwaI,
(e) pγ.bPDS4: use BssHII or SwaI (see Note 5).
2. Run 1 μl of each of the digested plasmids on a 1% agarose–TAE
gel to confirm that linearization is complete (linear pα migrates
at approximately 4000 bp, whereas linear pβ and pγ migrate at
approximately 6000 bp). After confirming complete digestion,
inactivate the reaction by heating at recommended tempera-
ture and duration as per restriction enzyme manufacturer’s
recommendations.
3. Adjust the volume so the final template concentration of each
linearized plasmid is about 125 ng/μl.
4. Treat each linearized plasmid reaction with RNAse inhibitor to
prepare for in vitro transcription. Use 40 units of RNAse
inhibitor per 20 μl linearized plasmid reaction.
5. Each VIGS experiment should consist of at least three treat-
ments, (a) treatment to silence GOI, (b) “virus only” control
(MCS) to differentiate the impact of virus multiplication from
silencing of the intended target, and (c) virus-free mock (FES
only) inoculated control. First treatment will consist of tran-
scription reactions involving linearized plasmids pα, pβΔβa, pγ.
GOI, whereas “virus only” control will consist of transcription
reactions involving linearized plasmids pα, pβΔβa, and pγ.
MCS.
6. Set up the in vitro transcription reaction using the mMES-
SAGE mMACHINE® High Yield Capped RNA Transcription
Kit. For each plant to be inoculated, 3 reactions (one for each
linearized plasmid) of 2.5 μl volume is the minimum needed.
However, you may want to do slightly more to allow for
pipetting error. Following is an example of a transcription
reaction using linearized plasmids. Set such reactions for each
of the three linearized plasmids depending upon the type of
treatment.
7. Set the transcription reaction using mMESSAGE mMA-
CHINE® Kit by mixing the following components (for inocu-
lating 8 plants):
(a) Linearized plasmid template (125 ng/μl) ¼ 5 μl.
(b) Nuclease free water ¼ 1 μl.
(c) 10 reaction buffer ¼ 2 μl
(d) 2 NTP/CAP ¼ 10 μl
(e) 10 enzyme mix ¼ 2 μl
(f) Total reaction volume ¼ 20 μl.
8. Reaction should proceed at 37 C for 1.5–2 h. After comple-
tion of the reaction, place reaction contents on ice or freeze at
80 C until ready to use. Do not freeze/thaw transcripts
more than 2 times.
9. Determine completion of transcription by running 1 μl of each
reaction with 9 μl of RNase-free H2O and 10 μl of loading dye
provided in the mMessage and mMachine transcription kit. A
successful in vitro transcription reaction should yield intact
bands. Any smearing of bands indicates degradation of the
RNA transcripts.
10. Combine three transcripts in equimolar ratio (1:1:1) i.e., com-
bine 19 μl transcription reaction from each of three plasmids
(pα, pβΔβa, and pγ.GS for treatment; pα, pβΔβa, and pγ.MCS
for “virus only” control). Add 343 μl of FES to make the total
volume 400 μl.
3.5 Plant Inoculation Inoculation can be done at the early stage or the late growth stage
with Viral Transcripts depending on the gene to be targeted e.g., for silencing resistance
genes involved in diseases such as rust and powdery mildew, inocu-
lation with transcripts can be done at the two-leaf stage; whereas,
for targeting genes expressed during flowering or seed formation,
inoculation can be done at the flag-leaf stage.
1. Label and water 10- to 14-days-old plants (two-leaf stage for
seedling inoculation) you intend to inoculate immediately
before inoculation.
2. Wearing gloves, place the tip of your forefinger and thumb
together.
3. Apply approximately 50 μl of the freshly mixed FES/ Tran-
script mix between your forefinger and thumb.
4. Place the forefinger and the thumb at the base on upper and
lower sides of the leaf to be inoculated.
5. Holding the stem of the plant with another hand, using light
pressure, rub the leaf with the inoculating hand from the base
to the tip in a single motion. Repeat the process one or two
times as required.
6. For inoculating thicker and harder leaves (e.g., flag leaf), injec-
tion with a needless syringe along the midrib produces better
results.
7. It is important to also include mock (FES) control in VIGS
experiments. Use 50 μl only FES buffer to inoculate plants in
this case.
8. When finished, lightly spray the plants with water and return
them back to the greenhouse. If possible cover the plant with a
plastic bag or dome overnight.
9. Symptoms (if the knockdown phenotype is observable) will
start appearing in 7–10 days and reach the peak between
15 and 18 days.
4 Notes
1. Luria-Bertani (LB) media (liquid and agar plates): To prepare

1 l of LB media: Add 10 g bacto tryptone, 5 g yeast extract, and
10 g NaCl to 800 ml of distilled H2O. Dissolve and adjust pH
to 7.0 with NaOH. Adjust volume to 1 l and sterilize by
autoclaving on a liquid cycle (15–20 min at 15 psi) at 121 C
. For solid media, add 15 g of Bacto agar per liter and autoclave.
2. Dissolve 48.5 g Tris base, 11.4 ml glacial acetic acid, and 3.7 g
EDTA in 800 ml of RNAse-free H2O. Makeup to 1 l and
autoclave. Dilute with sterile distilled H2O (dH2O) to make
1 working solution.
3. Bentonite and Celite will not dissolve in the FES buffer.
4. VIGS intensity induced by BSMV-based vector has been
reported to vary among different wheat cultivars e.g., cultivars
like Zak, Chinese Spring, and Eltan produced maximum VIGS
intensity among 12 cultivars tested by Bennypaul et al. [9]. The
cultivar of choice should be checked against cultivar known to
produce adequate VIGS response in initial experiments. Photo-
bleaching induced by silencing of the PDS gene can be used as
the marker. Treatment consisting of transcription reactions of
pα, pβΔβa, pγ.PDS4 can be used for silencing the PDS gene.
5. GOI fragment should be checked for restriction sites for
BssHII or SwaI. Only one of these two the enzyme, with no
restriction site in the GOI fragment, should be used at this step.
References
1. Vance V, Vaucheret H (2001) RNA silencing in gene silencing in a monocot plant. Plant J 30
plants - defense and counterdefense. Science (3):315–327
292:2277–2280 5. Palomar MK, Brakke MK, Jackson AO (1977)
2. Robertson D (2004) VIGS vectors for gene Base sequence homology in the RNAs of barley
silencing: many targets, many tools. Annu Rev stripe mosaic virus. Virology 77(2):471–480
Plant Biol 55(1):495–519 6. Cheuk A, Houde M (2018) A new barley stripe
3. Senthil-Kumar M, Mysore KS (2011) New mosaic virus allows large protein overexpres-
dimensions for VIGS in plant functional geno- sion for rapid function analysis. Plant Physiol
mics. Trends Plant Sci 16(12):656–665 176(3):1919–1931
4. Holzberg S, Brosio P, Gross C, Pogue GP 7. Jackson AO, Lim HS, Bragg J, Ganesan U, Lee
(2002) Barley stripe mosaic virus-induced MY (2009) Hordeivirus replication,
movement, and pathogenesis. Annu Rev Phy- 10. Brueggeman R, Druka A, Nirmala J,
topathol 47:385–422 Cavileer T, Drader T et al (2008) The stem
8. Panwar V, Bakkeren G (2017) Investigating rust resistance gene Rpg5 encodes a protein
gene function in cereal rust fungi by plant- with nucleotide-binding-site, leucine-rich, and
mediated virus-induced gene silencing. Meth- protein kinase domains. Proc Natl Acad Sci U S
ods Mol Biol 1659:115–124 A 105(39):14970–14975
9. Bennypaul HS, Mutti JS, Rustgi S, Kumar N, 11. Lück S, Kreszies T, Strickert M, Schweizer P,
Okubara PA, Gill KS (2012) Virus-induced Kuhlmann M, Douchkov D (2019) siRNA-
gene silencing (VIGS) of genes expressed in finder (si-fi) software for RNAi-target design
root, leaf, and meiotic tissues of wheat. Funct and off-target prediction. Front. Plant Sci 10:
Integr Genomics 12(1):143–156 1023
Chapter 6
Virus-Induced Gene Silencing in Wheat and Related

Monocot Species
Vinay Panwar and Kostya Kanyuka
Abstract
Advances made in genome sequencing projects and structural genomics are generating large repertoire of
candidate genes in plants associated with specific agronomic traits. Rapid and high-throughput functional
genomics approaches are therefore needed to validate the biological function of these genes especially for
agronomically important crops beyond the few model plant species. This can be achieved by utilizing
available gene knockout or transgenic methodologies, but these can take considerable time and effort
particularly in crops with large and complex genomes such as wheat. Therefore, any tool that expedites the
validation of gene function is of particular benefit especially in cereal crop plants that are genetically difficult
to transform. One such reverse genetics tool is virus-induced gene silencing (VIGS) which relies on the
plants’ natural antiviral RNA silencing defence mechanism. VIGS is used to downregulate target gene
expression in a transient manner which persists long enough to determine its effect on a specific trait. VIGS
based on Barley stripe mosaic virus (BSMV) is rapid, powerful, efficient, and relatively inexpensive tool for
the analysis of gene function in cereal species. Here we present detailed protocols for BSMV-mediated VIGS
for robust gene silencing in bread wheat and related species.
Key words VIGS, Gene silencing, BSMV, Cereals, Wheat, Functional genomics
1 Introduction
In recent years, virus-induced gene silencing (VIGS) has been

extensively applied as a reverse genetics tool for functional charac-
terization of plant genes, including those involved in the interac-
tions with pathogens, in a wide range of plant species [1–5]. This
high-throughput and relatively inexpensive biotechnological tool
allows rapid generation of transient gene knockdowns (i.e., down-
regulation of gene expression) and analysis of the resulting loss-of-
function phenotypes. VIGS offers several benefits over stable plant
transformation-based functional gene analysis, including speed and
ability to silence genes in different genetic backgrounds.
Principally, VIGS involves engineering plant virus-based vec-
tors into which segments of plant genes-of-interest under
95
96 Vinay Panwar and Kostya Kanyuka
investigation can be cloned and introduced into cells of intact plant

leaves using a variety of approaches where they induce a sequence-
specific homology-dependent degradation of target gene tran-
scripts. Both, viruses with DNA and RNA genomes, have been
successfully converted into vectors for VIGS, but those based on
plant viruses with positive-sense (+) single-strand (ss) RNA gen-
omes are by far the most commonly used. The viral (+) ssRNA
genome can be easily converted to double-stranded (ds) cDNA and
cloned into a plasmid vector under control of either a bacterial
promoter such as T7 or SP6, or under control of a plant-specific
promoter such as CaMV 35S. In the first case, viral RNA is tran-
scribed in vitro using T7 or SP6 RNA Polymerase and then inocu-
lated onto plant leaves using mechanical rub-inoculation. In the
second case, the VIGS constructs are delivered to plants either
through Agrobacterium tumefaciens-mediated transient expression
known as “agroinoculation” or “agroinfiltration” [6], or directly by
microprojectile bombardment.
Such genetically engineered delivery vectors are typically
designed to induce mild or no disease symptoms ensuring no or
minimal interference with the phenotypes specifically induced by
silencing of target gene(s). Plant (+) ssRNA viruses produce long
dsRNA replication intermediates during infection which activate
the plant RNA interference (RNAi)-based antiviral defence
response leading to the degradation of the host endogenous
mRNAs homologous to the target gene segment inserted in the
viral vector. VIGS-induced downregulation of gene expression is
rarely complete and therefore VIGS could be useful for functional
analysis of essential genes whose stable knockout might have been
lethal. This tool could also be particularly useful for screening a
pool of candidate genes (for example those originating from
map-based cloning or RNA sequencing projects) potentially
responsible for a particular trait/phenotype and delineating the
causal gene(s). Apart from silencing a single candidate gene,
VIGS also offers the potential to silence multiple members of a
gene family simultaneously to overcome functional redundancy
among gene family members [7]. Moreover, at least two sequence
unrelated genes could be silenced at once using specially designed
VIGS constructs carrying chimeric sequences composed of gene
fragments from more than one target transcript of interest [8].
An important factor for the success of VIGS is the ability of the
virus to systemically infect and spread in the host plant without
causing unwanted effects on plant growth and development
[9]. Beside this, when designing VIGS experiments it is also highly
desirable to incorporate appropriate positive control VIGS con-
structs targeting genes whose silencing induces obvious visual phe-
notypes as well as negative controls carrying heterologous
sequences with no known homologous gene targets in the plant
species under investigation.
Virus-Induced Gene Silencing in Wheat and Related Monocot Species 97
The number of plant species amenable to VIGS technique is

increasing with the development of new virus vectors. Several plant
DNA and RNA viruses have now been modified as viral vector
systems for characterization of genes in monocotyledonous plants
and include those based on Brome mosaic virus [10], Barley stripe
mosaic virus (BSMV) [11], Bamboo mosaic virus [12], Cymbidium
mosaic virus [13], Cucumber mosaic virus [14], Foxtail mosaic virus
[15, 16], Chinese wheat mosaic virus [17], and Rice tungro bacilli-
form virus [18]. Among these, BSMV-based vectors are most
widely used for functional genomics study in many cereal crop
plants important in agriculture such as wheat and barley [19, 20].
BSMV is a single stranded RNA virus of the genus Hordeivirus.
It has a tripartite (+) ssRNA genome, consisting of RNAs α, β, and γ
all of which are required for plant infection [21]. There are several
different BSMV-based VIGS vectors available and in nearly all of
them RNA γ is modified for cloning coding fragments of endoge-
nous genes for silencing [19]. The beauty of the BSMV VIGS
system is that it is not limited to seedlings but can be applied to
plants at different growth stages including to adult plants
[22, 23]. Moreover, BSMV VIGS could be combined with infec-
tion by different pathogens allowing identification of monocot
plant genes involved in various compatible and incompatible
plant–pathogen interactions [19].
Here we describe protocols for VIGS utilizing binary BSMV
vectors [24], which can be successfully applied to silence genes in
bread wheat (Triticum aestivum) but also in many related species.
The methodology described here outlines a simple and improved
procedure for introducing BSMV vectors using agroinfiltration
firstly into solanaceous plant species such as Nicotiana benthami-
ana (a laboratory host susceptible to both A. tumefaciens and
BSMV) for virus multiplication, and subsequently using the virulif-
erous sap from N. benthamiana leaves for mechanical inoculation
of wheat plants (Fig. 1).
2 Materials
2.1 Plants and Plant 1. Seeds of Nicotiana benthamiana.

Growth Materials 2. Seeds of hexaploid bread wheat (Triticum aestivum), tetraploid
durum wheat (T. durum), or diploid relatives of wheat e.g.,
Aegilops tauschii or T. monococcum.
3. Plant propagators with high dome and vent, and plastic pots
(5 cm 5 cm 8 cm for N. benthamiana, and
9 cm 9 cm 10 cm for wheat and related species).
4. Levington F2 + S compost (Everris Ltd., Ipswich, UK) for
growing N. benthamiana.
Fig. 1 Brief outline of the Agrobacterium-mediated Barley stripe mosaic virus (BSMV)-induced gene silencing
procedure in wheat and related monocot species. A short (150–350-bp) fragment of gene-of-interest (GOI) in
anti-sense orientation is cloned into a binary vector pCa-γbLIC containing a modified BSMV RNA γ genome
immediately downstream of the γb protein encoding cistron. Then, the binary vectors pCaBS-α, pCaBS-β
containing unmodified BSMV RNA α and RNA β and a recombinant pCa-γbLIC (RNA γ) vector are transformed
into A. tumefaciens and agroinfiltrated together into Nicotiana benthamiana leaves where all viral genomes
are transcribed and assembled into virus particles. The inoculum prepared from the directly agroinfiltrated
leaves of N. benthamiana containing the virus particles is then used for rub-inoculation of monocot plants.
Once infection sets in, the virus spreads in a systemic manner from the site of inoculation triggering RNAi—a
plant defence mechanism that targets for degradation both, the recombinant BSMV RNA γ and transcripts of
the endogenous plant gene targeted for silencing. Plants are subsequently scored for loss-of-function
phenotype associated with the silencing of the targeted gene
5. Standard soil mix for growing cereal species.

6. Plant labels and/or tags.
7. Growth chamber or a containment environment room
operating at the following conditions: photoperiod 16 h, tem-
perature 20 C (night) and 23 C (day), light intensity (at the
soil level) ~130 μmol m2 s1 for N. benthamiana and
~180–220 μmol m2 s1 for wheat and related species, and
relative humidity ~60%.
2.2 BSMV VIGS 1. siRNA-Finder (si-Fi) software for RNAi-target design and
Construct off-target prediction [25].
Development 2. A set of all transcripts coding sequences for wheat (or related
monocot species) in FASTA format.
3. pCaBS-α (plasmid for BSMV RNA α), pCaBS-β (plasmid for

BSMV RNA β), pCa-γbLIC (plasmid for BSMV RNA γ mod-
ified for insertion of plant gene fragments for VIGS) [24].
4. Restriction endonuclease ApaI and the corresponding reaction
buffer.
5. T4 DNA polymerase and the corresponding reaction buffer,
and dATP and dTTP.
6. Thermocycler and 0.2 mL PCR tubes.
7. Microfuge.
8. Sterile 1.5 mL microtubes.
9. Chemically competent Escherichia coli strain JM109 (Promega,
Southampton, UK).
10. SOC liquid medium.
11. LB-Miller agar plates supplemented with kanamycin (50 μg/
mL).
12. Incubator for Petri dishes, 37 C.
13. Shaking incubator for universal bottles, 37 C.
14. Gel extraction kit.
15. PCR materials and reagents: Taq DNA polymerase, reaction
buffer, dNTPs.
16. Primers for PCR amplification of target plant sequences
(should containing the appropriate 50 extensions required for
the ligation-independent cloning into pCa-γbLIC; see below).
17. Primers for colony-PCR and sequencing: 2235.F (50 - GAT
CAACTGCCAATCGTGAGTA-30 ) and 2615.R (50 -CCAATT
CAGGCATCGTTTTC-30 ).
18. Plasmid miniprep kit.
19. Spectrophotometer NanoDrop 2000 (Fisher Scientific—UK
Ltd., Loughborough, UK).
20. Sterile 28 mL glass universal (McCartney) bottles with rubber-
lined aluminum screw caps.
21. Sterile inoculation loops and spreaders.
22. Bench-top centrifuge for spinning universal bottles or Falcon
50 mL conical centrifuge tubes.
2.3 Transformation 1. Electroporation competent A. tumefaciens strain GV3101

of BSMV VIGS Vectors (pMP90) cells.
into A. tumefaciens 2. Binary BSMV vectors: pCaBS-α, pCaBS-β, and pCa-γbLIC
derivatives.
3. Electroporator MicroPulser (Bio-Rad Services UK Ltd.,
Watford, UK).
4. Electroporation cuvettes, 0.1 cm gap.

5. LB-Lennox agar plates supplemented with kanamycin (50 μg/
mL) and gentamicin (25 μg/mL).
6. Sterile Falcon round bottom 14 mL polypropylene tubes.
7. Sterile inoculation loops and spreaders.
8. Incubator, 28 C.
9. Shaking incubator for 14 mL polypropylene tubes, 28 C.
10. Materials and reagents for colony-PCR: PCR tubes, sterile
toothpicks, Taq DNA polymerase, PCR primers.
11. Thermocycler.
12. Agarose gel electrophoresis reagents: agarose, TBE buffer, 1 kb
DNA ladder.
13. Electrophoresis power supply.
14. Sterile 50% glycerol.
15. LB-Lennox broth supplemented with kanamycin (50 μg/mL)
and gentamicin (25 μg/mL).
16. Freezer, 80 C.
2.4 Agrobacterium- 1. Young 25–30 days old N. benthamiana plants.

Mediated Inoculation 2. A. tumefaciens strains carrying pCaBS-α, pCaBS-β, and
of N. benthamiana pCa-γbLIC derivatives.
Plants
3. Sterile inoculation loops.
4. Sterile 28 mL glass universal (McCartney) bottles with rubber-
lined aluminum screw caps.
5. LB-Lennox liquid medium supplemented with kanamycin
(50 μg/mL) and gentamicin (25 μg/mL).
6. Shaking incubator for universal (McCartney) bottles, 28 C.
7. Bench-top centrifuge for spinning universal bottles or Falcon
50 mL conical centrifuge tubes.
8. Infiltration medium: 10 mM MES (2-(N-morpholino) ethane-
sulfonic acid) buffer pH 5.6, 10 mM MgCl2, and 150 μM
acetosyringone (30 ,50 -Dimethoxy-40 -hydroxyacetophenone)
in sterile distilled water.
9. Spectrophotometer and disposable spectrophotometer
cuvettes.
10. Sterile disposable needleless 1 mL plastic syringes.
2.5 Mechanical 1. Wheat (or related monocot) plants.

(Rub)Inoculation 2. Pestles and mortars.
of Monocot Plants
3. Miracloth (VWR International Ltd., Lutterworth, UK).
4. 10 mM potassium phosphate buffer, pH 7.
5. Celite 545 AW (Merck Life Science UK Ltd., Gillingham, UK).

6. Water mist spray bottle.
7. Propagators, plastic boxes with leads, or large plastic bags.
3 Methods
3.1 BSMV VIGS 1. Select the target gene sequence (see Notes 1–3) for cloning
Vector Construction into pCa-γbLIC vector using the ligation-independent cloning
(LIC) method.
2. Amplify the selected gene fragment by RT-PCR using cDNA
prepared from RNA extracted from wheat tissue using
sequence-specific primers carrying the following 50 -extensions
permitting LIC into pCa-γbLIC: 50 -AGGAAGTTTAA-30 (for
the forward primer) and 5’- AACCACCACCACCGT-30 (for
the reverse primer) (see Note 4).
3. Purify the resulting RT-PCR product following an agarose gel
electrophoresis using any commercial gel extraction kit.
4. Digest the pCa-γbLIC with ApaI for at least 2 h at 25 C. For
setting optimal restriction digestion conditions follow the
manufacturer guidelines. Analyze a small aliquot of the reaction
using agarose gel electrophoresis to verify whether the restric-
tion digestion was complete. If there are no issues with the
digestion, incubate the remaining of the reaction at 65 C for
20 min to inactivate the enzyme.
5. Combine in one PCR tube 0.5 μg of ApaI-digested pCa-γb-
LIC with 3 U of T4 DNA Polymerase, 5 mM dTTP and
100 ng/μL bovine serum albumin (BSA) with T4 DNA poly-
merase reaction buffer adjusted to 1X concentration in a total
volume of 50 μL. Mix by pipetting and incubate in a thermo-
cycle for 30 min at 22 C. Heat-inactivate the T4 DNA poly-
merase enzyme by incubating the tube at 75 C for 15 min.
6. In another tube incubate 200–250 ng of the RT-PCR ampli-
fied and gel purified product of the targeted gene segment,
intended to be cloned in the linearized pCa-γbLIC vector, with
0.6 U of T4 DNA polymerase, 100 ng/μL BSA and 5 mM
dATP with T4 DNA Polymerase reaction buffer adjusted to 1
concentration in a total volume of 10 μL. Mix by pipetting and
incubate for 30 min at 22 C.
7. Mix together the T4 DNA polymerase-treated RT-PCR ampli-
fied target gene segment (10 μL) and the ApaI-linearized
pCa-ybLIC vector (2 μL) (see Note 5). Incubate the mixture
at 65 C for 2 min followed by 10 min extended incubation at
room temperature to allow the gene fragment and the vector to
anneal together (see Note 6).
8. Use 2–3 μL of the annealed products for transformation into

chemically competent E. coli JM109 as per the manufacturer
instructions. Spread the transformation mixture onto
LB-Miller agar plates supplemented with kanamycin (50 μg/
mL) and incubate at 37 C overnight.
9. Next day, pick 5–10 bacterial colonies and identify those carry-
ing the recombinant pCa-γbLIC containing the desired seg-
ment of plant gene intended for silencing using colony-PCR
with primers 2235.F and 2615.R flanking the LIC site in the
vector.
10. Select two independent transformants verified by colony-PCR
and grow them in 5 mL LB-Miller broth supplemented with
kanamycin (50 μg/mL).
11. Use overnight cultures for extracting the plasmid DNA using
any commercial plasmid miniprep kit.
12. Estimate concentration of plasmid DNA using spectropho-
tometer Nanodrop 2000.
13. Confirm the integrity of pCa-ybLIC-derived VIGS constructs
by Sanger sequencing using primers 2235.F and 2615.R.
3.2 Preparing 1. Use 10–20 ng of plasmid DNA (pCaBS-α, pCaBS-β, and

A. tumefaciens Strains pCa-γbLIC derivatives) for transformation of 25 μL electro-
for Agroinfiltration competent A. GV3101 (pMP90) cells using Electroporator
and 0.1 cm gap electroporation cuvettes pre-chilled on ice.
Immediately post transformation transfer bacterial cells to a
sterile Falcon 14 mL tube. Allow bacteria to grow for 1 h at
28 C on a shaker at 180 rpm.
2. Spread the transformation mixture onto LB-Lennox agar plates
supplemented with kanamycin (50 μg/mL) and gentamicin
(25 μg/mL) and incubate at 28 C for 3–4 days.
3. Pick 2–3 bacterial colonies using a sterile loop from the freshly
cultured plates and inoculate each into universal bottles con-
taining 5 mL LB-Lennox broth supplemented with antibiotics
kanamycin (50 μg/mL) and gentamicin (25 μg/mL) (see Note
7). Allow bacteria to grow overnight at 28 C on a shaker at
180 rpm.
4. Collect the bacterial cells by centrifugation at 2,500 g for
15–20 min at 15–17 C.
5. Carefully remove the supernatant and resuspend the bacterial
cells in the infiltration buffer supplemented with 150 μM acet-
osyringone (see Note 8) to a final OD600 of 1.5.
6. Combine equal volumes (1:1:1 ratio) of the three
A. tumefaciens suspensions containing pCaBS-α, pCaBS-β,
and a pCa-γbLIC derivative in a sterile universal bottle (see
Note 9) and mix gently by turning the tube upside down a
few times.
7. Incubate the bacterial suspensions at room temperature in the

dark or low light for at least 3 h without shaking (see Note 10).
3.3 Agroinfiltration 1. Use healthy 3–5 weeks old N. benthamiana plants for agroin-
of N. benthamiana filtration. To infiltrate the A. tumefaciens cells into plants,
Leaves gently nick the abaxial side of a leaf with a 10 μL pipette tip.
Load a 1 mL needleless syringe with the A. tumefaciens sus-
pension. Carefully hold the leaf to be infiltrated between the
gloved index finger and the syringe. Place the syringe tip
against the incision made and inject the A. tumefaciens suspen-
sion gently. Create a seal on the other side of the leaf by placing
a finger from the other gloved hand just beneath the incision.
Repeat this step until all fully expanded leaves on each plant
have been completely infiltrated (see Notes 11 and 12).
2. Transfer agroinfiltrated plants to a growth chamber maintained
at an ambient temperature of 23–25 C with 16 h light/8 h
dark cycle. Agroinfiltrated leaves will be ready for harvesting at
5–7 days post-agroinfiltration, at which stage the first signs of
virus infection (mild mosaic) may become visible on the young
upper developing leaves. The sampled leaves can be used for
preparing virus inoculum for inoculation of wheat plants either
fresh or can be flash frozen in liquid nitrogen and stored in
80 C for future use (see Notes 13 and 14).
3.4 Wheat 1. Pre-germinate seeds of wheat (or related monocot species) on a

Inoculation filter paper soaked in sterile distilled water for a few days. To
maximize growth uniformity among test plants, pot only the
healthy germinated seedlings: 1 seedling per pot. Grow plants
to the required growth stage (i.e., young 2–3 leaf-stage seed-
lings to adult plants) prior to virus inoculation.
2. Prepare virus inoculum by grinding agroinfiltrated
N. benthamiana leaves in 10 mM potassium phosphate buffer,
pH 7.0 using pre-chilled pestle and mortar. For each 1 g of leaf
tissue use 2.5–3 mL of buffer.
3. Squeeze the viruliferous sap through Miracloth and add 1–2%
(w/v) of Celite 545 AW to serve as an abrasive.
4. To inoculate wheat leaves, dip your gloved fingers in sap and
hold the base of the leaf with one hand, while gently scrubbing
the leaf between the thumb and index finger. You should hear a
slight squeaking sound as the wax is being scraped off of the
leaves (see Note 15). Repeat the step two to three times,
starting each stroke from the base of the leaf to the tip, until
the leaf appears fully wet in the inoculum (see Note 16).
5. Allow the inoculated plants to stand at room temperature for
5–10 min to adsorb the virus and then wash the excess inocu-
lum and residual Celite 545 AW off the inoculated leaves using
a water mist spray bottle.
6. Place the pots containing the inoculated plants on a plastic tray

and cover with a high dome. Taller plants could be covered
with the suitably sized plastic bags. Keep the plants overnight in
low light e.g., under a bench in a growth chamber or a con-
tainment environment room operating at 20 C (night) and
23 C (day) to allow them to recover from mechanical injury/
stress. Next day remove the plastic covers and place plants on a
bench to grow under the same temperature and standard light
conditions i.e., light intensity ~180–220 μmol m2 s1 at the
soil level (see Notes 17 and 18).
7. First virus symptoms (typically pale green to yellowish short
streaks dotted along the leaf blade) should become visible by
7–10 days post inoculation (dpi) in the upper uninoculated
developing leaves but gene silencing is typically achieved by
approximately 21 dpi.
8. The efficiency of silencing of the gene under study can be
accessed by quantifying the levels of the corresponding
mRNA using quantitative reverse transcription PCR
(qRT-PCR) (see Note 19).
4 Notes
1. The efficiency of gene silencing depends on careful design of

candidate gene fragments for insertion into a VIGS vector. For
this, we strongly advise using siRNA-Finder (si-Fi) software
[25] which helps to select those fragments for each target
gene-of-interest which potentially yield the highest number of
silencing-effective small interfering RNAs while at the time
avoiding or minimizing potential silencing of off-target
genes. The fragments for VIGS should only be selected from
the coding region of a gene and/or its 50 -UTR or 30 -UTR.
Silencing of multiple members of gene family or even an entire
gene family could be achieved by targeting the most highly
conserved gene regions. In principle, it could also be possible
to silence individual members of gene family as well as homo-
eologous gene copies (in tetraploid and hexaploid wheat) by
targeting UTRs as the nucleotide sequence identity across
these regions between the related genes is often much lower
than between the coding regions of these genes. In some cases,
it may even be possible to silence specific alternative transcripts
arising from the same gene by targeting alternative exon(s) or
retained intron(s) sequences.
2. We recommend selecting regions that are 150–350 nt in length
as shorter sequences may not be efficient in gene silencing,
whereas longer inserts may be either highly unstable in the
BSMV VIGS vector or severely impair virus replication
and/or local and systemic spread.
3. When possible select at least two non overlapping regions of

the target genes and develop the corresponding constructs for
VIGS. Obtaining similar visual or molecular phenotypes with
both constructs will provide greater confidence in the inferred
function of the investigated gene.
4. LIC is simple, fast and relatively low-cost cloning technique
that requires no specific restriction sites or ligation. It utilizes
the 30 ! 50 exonuclease activity of T4 DNA polymerase to
generate recessed 50 -ends complementarity between the vector
and the insert. Adding appropriate 50 -extensions to the PCR
primers helps in creating such complementary overhangs,
which after anneal and can be efficiently joined together
in vivo after transformation into E. coli by the bacterial DNA
recombination and repair machinery.
5. The remaining linearized and T4 DNA polymerase-treated
BSMV pCa-γbLIC vector can be stored at 20 C for
future use.
6. When setting up LIC reactions always include positive and
negative controls which can help to troubleshoot any failed
reaction.
7. Generally, 5 mL of A. tumefaciens culture is sufficient to infil-
trate all fully expanded leaves of 7–10 young (3–5 weeks old)
N. benthamiana plants. The culture volume can be scaled up
based on the number of plants to be used for agroinfiltration.
8. Addition of acetosyringone to the infiltration medium induces
A. tumefaciens virulence genes resulting in improved transfor-
mation efficiency.
9. Density of A. tumefaciens can affect the efficiency of agroinfil-
tration. Lower cell density (OD600 < 0.5) can result in reduced
transformation frequency, whereas higher bacterial cell density
(OD600 > 1.5) can result in the host tissue damage in the
infiltrated tissue.
10. A minimum of 3 h incubation of A. tumefaciens with acetosyr-
ingone ensures sufficient activation of the bacterial virulence
genes.
11. Large leaves may require infiltration into 2–4 incisions made in
different areas of the leaves.
12. Care should be taken to avoid cross-contamination when
performing experiments using multiple VIGS constructs. Use
fresh gloves and syringes for each infiltration.
13. It is critical to include appropriate positive and negative control
constructs in every VIGS experiment to monitor the effective-
ness of silencing. For example, silencing of genes encoding
phytoene desaturase (PDS) or Mg-chelatase subunit H
(ChlH) in wheat results in strong photobleaching or yellowing
in the affected leaves. On the other hand, and empty virus

vector or BSMV carrying heterologous sequences that share
no homology to any genes in the plant such as fragments of a
gene encoding Green Fluorescent Protein (GFP) or protein
noncoding sequences from common E. coli plasmid vectors,
induce typical mild mosaic symptoms.
14. We suggest keeping some N. benthamiana plants after harvest-
ing the agroinfiltrated leaves for 2–5 additional days. If the
agroinfiltration was successful, BSMV-induced mosaic symp-
toms should become clearly visible in the upper uninoculated
leaves by 7–12 days post-agroinfiltration.
15. It is important not to damage the leaf too much as this could
result in decreased efficiency of virus infection.
16. When multiple VIGS constructs are to be tested care should be
taken to carefully remove all used material, disinfect the bench,
and change the gloves each time before proceeding with a
new test.
17. Correctly rub-inoculated plant leaves should show no or mini-
mal signs of injury the next day after inoculation.
18. Temperature is a critical environmental factor influencing effi-
ciency of VIGS. In wheat and related monocot species, BSMV-
mediated silencing is the most efficient in the temperature
range of 20–23 C.
19. To determine the gene silencing efficiency primers for
qRT-PCR need to be designed to anneal to a region of the
targeted gene transcript outside the fragment cloned in the
VIGS vector. This aims to prevent amplification from the pro-
lific recombinant viral RNA templates. Use qRT-PCR to ana-
lyse several individual plants as the efficiency of VIGS can vary
from plant to plant.
Acknowledgments
KK and VP would like to acknowledge financial support by the

Institute Strategic Program Grant “Designing Future Wheat”
(BB/P016855/1) from the Biotechnology and Biological Sciences
Research Council of the UK (BBSRC).
References
1. Baulcombe DC (1999) Fast forward genetics gene function studies in plants. Plant J 39:
based on virus-induced gene silencing. Curr 734–746
Opin Plant Biol 2:109–113 3. Senthil-Kumar M, Mysore KS (2011) New
2. Burch-Smith TM, Anderson JC, Martin GB, dimensions for VIGS in plant functional geno-
Dinesh-Kumar SP (2004) Applications and mics. Trends Plant Sci 16:656–665
advantages of virus-induced gene silencing for
4. Ramegowda V, Mysore KS, Senthil-Kumar M 15. Liu N, Xie K, Jia Q, Zhao J, Chen T, Li H,
(2014) Virus-induced gene silencing is a versa- Wei X, Diao X, Hong Y, Liu Y (2016) Foxtail
tile tool for unraveling the functional relevance mosaic virus-induced gene silencing in mono-
of multiple abiotic-stress-responsive genes in cot plants. Plant Physiol 171:1801–1807
crop plants. Front Plant Sci 5:323 16. Mei Y, Zhang C, Kernodle BM, Hill JH, Whi-
5. Dommes AB, Gross T, Herbert DB, Kivivirta tham SA (2016) A Foxtail mosaic virus vector
KI, Becker A (2019) VIGS – empowering for virus-induced gene silencing in maize. Plant
genetics in non-model organisms. J Exp Bot Physiol 171:760–772
70:757–770 17. Yang J, Zhang T-Y, Liao Q-S, He L, Li J,
6. Vaghchhipawala Z, Rojas CM, Senthil-Kumar- Zhang H-M, Chen X, Li J, Yang J, Li J-B et al
M, Mysore KS (2011) Agroinoculation and (2018) Chinese wheat mosaic virus-induced
agroinfiltration: simple tools for complex gene gene silencing in monocots and dicots at low
function analyses. Methods Mol Biol 678: temperature. Front Plant Sci 9:1627
65–76 18. Purkayastha A, Mathur S, Verma V, Sharma S,
7. Zhang J, Yu D, Zhang Y, Liu K, Xu K, Dasgupta I (2010) Virus-induced gene silenc-
Zhang F, Wang J, Tan G, Nie X, Ji Q et al ing in rice using a vector derived from a DNA
(2017) Vacuum and co-cultivation agroinfiltra- virus. Planta 232:1531–1540
tion of (germinated) seeds results in Tobacco 19. Lee W-S, Hammond-Kosack KE, Kanyuka K
rattle virus (TRV) mediated whole-plant (2012) Barley stripe mosaic virus-mediated
virus-induced gene silencing (VIGS) in wheat tools for investigating gene function in cereal
and maize. Front Plant Sci 8:393 plants and their pathogens: virus-induced gene
8. Pang J, Zhu Y, Li Q, Liu J, Tian Y, Liu Y, Wu J silencing, host-mediated gene silencing, and
(2013) Development of Agrobacterium- virus-mediated overexpression of heterologous
mediated virus-induced gene silencing and per- protein. Plant Physiol 160:582–590
formance evaluation of four marker genes in 20. Ramanna H, Ding XS, Nelson RS (2013)
Gossypium barbadense. PLoS One 8:e73211 Rationale for developing new virus vectors to
9. Valentine T, Shaw J, Blok VC, Phillips MS, analyze gene function in grasses through virus-
Oparka KJ, Lacomme C (2004) Efficient induced gene silencing. Methods Mol Biol
virus-induced gene silencing in roots using a 975:15–32
modified Tobacco rattle virus vector. Plant 21. Jackson AO, Lim H-S, Bragg J, Ganesan U,
Physiol 136:3999–4009 Lee MY (2009) Hordeivirus replication, move-
10. Ding XS, Rao CS, Nelson RS (2007) Analysis ment, and pathogenesis. Annu Rev Phyto-
of gene function in rice through virus-induced pathol 47:385–422
gene silencing. Methods Mol Biol 354: 22. Bennypaul HS, Mutti JS, Rustgi S, Kumar N,
145–160 Okubara PA, Gill KS (2012) Virus-induced
11. Holzberg S, Brosio P, Gross C, Pogue GP gene silencing (VIGS) of genes expressed in
(2002) Barley stripe mosaic virus-induced root, leaf, and meiotic tissues of wheat. Funct
gene silencing in a monocot plant. Plant J 30: Integr Genomics 12:143–156
315–327 23. Ma M, Yan Y, Huang L, Chen M, Zhao H
12. Liou MR, Huang YW, Hu CC, Lin NS, Hsu (2012) Virus-induced gene-silencing in wheat
YH (2014) A dual gene-silencing vector system spikes and grains and its application in func-
for monocot and dicot plants. Plant Biotechnol tional analysis of HMW-GS-encoding genes.
J 12:330–343 BMC Plant Biol 12:141
13. Lu H-C, Chen H-H, Tsai W-C, Chen W-H, Su 24. Yuan C, Li C, Yan L, Jackson AO, Liu Z,
H-J, Chang DC-N, Yeh H-H (2007) Strategies Han C, Yu J, Li D (2011) A high throughput
for functional validation of genes involved in Barley stripe mosaic virus vector for virus
reproductive stages of orchids. Plant Physiol induced gene silencing in monocots and dicots.
143:558–569 PLoS One 6:e26468
14. Wang R, Yang X, Wang N, Liu X, Nelson RS, 25. Lück S, Kreszies T, Strickert M, Schweizer P,
Li W, Fan Z, Zhou T (2016) An efficient virus- Kuhlmann M, Douchkov D (2019) siRNA-
induced gene silencing vector for maize func- finder (si-fi) software for RNAi-target design
tional genomics research. Plant J 86:102–115 and off-target prediction. Front Plant Sci 10:
1023
Chapter 7
Virus-Induced Gene Silencing in Sorghum Using Brome

Mosaic Virus
Dharmendra K. Singh and Kirankumar S. Mysore
Abstract
Sorghum [Sorghum bicolor (L.) Moench.] is a versatile crop, grown in 30 countries and a food source for
nearly 500 million people globally. Although the sorghum genome is sequenced, a limited understanding of
gene function prevents the improvement of resistance against almost 150 species of viruses, bacteria,
fungus, and parasitic plants to improve productivity. Here, we present a Brome mosaic virus (BMV)-based
virus-induced gene silencing (VIGS) to silence target genes for functional study in sorghum. This protocol
achieves 100% sorghum infection with BMV by growing the plants at 18 C instead of 22 C. Using this
method, one can achieve gene silencing in sorghum up to 100% of the inoculated plants.
Key words S. bicolor, Monocot VIGS, Phytoene desaturase, Ubiquitin, Antisense strand, Environ-
mental conditions on VIGS
1 Introduction
Sorghum is an essential food source for nearly 500 million people

globally. It is a versatile and adaptable crop grown in dry climatic
conditions where summer temperatures are above 20 C [1]. Sor-
ghum is cultivated in 30 countries globally, planted in 45 million
hectare producing 65.5 million tons [2]. Even though nearly 80%
of the sorghum-growing area is in developing countries, it is the
fifth most important cereal crop after rice, wheat, maize, and barley
[1]. According to the United Nations’ Food and Agriculture Orga-
nization, the five largest sorghum producers in 2014 are the USA,
Mexico, Nigeria, Sudan, and India [1]. Sorghum is a C4 plant with
high photosynthesis efficiency; however, the current challenge is to
increase plant productivity for growing on marginal lands with
limited resources such as water and nutrients. Sorghum is plagued
by approximately 150 species of viruses, bacteria, fungus, and
parasitic plants [1]. It is crucial to increase our understanding of
sorghum’s gene function to improve diseases and pests resistance to
109
110 Dharmendra K. Singh and Kirankumar S. Mysore
increase productivity. Even though the genome sequence of sor-

ghum is available, the desired trait improvement is not fully realized
because of limited understanding of the gene function. A few
sorghum mutant libraries are publicly available, with about 5000
lines of ethyl methanesulfonate treated lines and 5466 gamma-ray-
induced M2 lines, limiting the functional study of genes.
Here we present an efficient method to silence a sorghum gene
using virus-induced gene silencing (VIGS). Our previous study [3]
suggested that the Bromo mosaic virus (BMV)-based VIGS can be
used to efficiently silence a gene in sorghum. BMV has a lower
infection rate (12%) at ambient temperature (22 C), and the
infection rate can be improved to 100% by keeping plants 18 C
after virus inoculation [3]. In summary, the protocol for efficient
VIGS in sorghum involves (1) using antisense strand of the gene of
interest when developing construct for gene silencing, (2) using
BTx623 genotype/variety for VIGS since it is more susceptible to
BMV, and (3) growing the plants at a lower temperature (18 C).
In addition to this, we suggest using Ubiquitin silencing as a better
visual marker for VIGS in sorghum compared to other traditional
markers such as Magnesium Chelatase subunit H (ChlH) and Phy-
toene desaturase (PDS).
2 Materials
2.1 Plant Growth 1. Seeds of Nicotiana benthamiana, Chenopodium alba, barley,

Materials sorghum (BTx623 variety).
2. Synthetic soil mixture (Metro-Mix 830 peat mixture, Sun Gro
Horticulture, Agawam, MA, USA).
3. Plastic trays (6 12 ¼ 72 cells) to grow plants.
2.2 Construct 1. Escherichia coli and Agrobacterium tumefaciens strain GV2260.

Preparation The strain A of A. tumefaciens has RNA1 and RNA2 of BMV,
and strain B has RNA3 of the BMV genome with a restriction
site for gene fragment insertion for silencing [4].
2. Luria-Bertani (LB) media (contains 10 g/L peptone, 5 g/L
yeast extract, 10 g/L NaCl, and 15 g/L agar for solid
medium).
3. 80 C freezer to store the bacteria.
4. Sterile glycerol to prepare the bacterial stock.
5. Serological vial to store the bacterial stock.
6. Induction medium: 10 mM 2-(N-morpholino) ethanesulfonic
acid (MES, pH 5.8) and 100 nM acetosyringone.
7. Phenol/chloroform.
Virus-Induced Gene Silencing in Sorghum Using Brome Mosaic Virus 111
8. SuperScript™ III Reverse Transcriptase (ThermoFisher Scien-

tific, Waltham, MA).
9. Kanamycin (Sigma-Aldrich, St. Louis, MO).
10. Rifampicin (Sigma-Aldrich, St. Louis, MO).
2.3 Inoculation 1. 100 mg carborundum (ThermoFisher Scientific).

Preparation 2. 10 mM potassium phosphate buffer (pH 6.8).
3. Liquid Nitrogen.
4. RNAeasy kit (Qiagen, Hilden, Germany).
5. RNAse-free DNAse I (Millipore-Sigma).
6. Oligo dT.
7. Random primers (Invitrogen, Carlsbad, CA).
8. Syber Green Real-time PCR Master Mix (ThermoFisher
Scientific).
9. ABI PRISM 7500 mechanic (Applied Biosystems, Foster City,
CA) to perform real-time quantitative PCR.
10. Thermal Cycler for PCR.
3 Methods
3.1 Primer Design 1. Identify a gene of interest for silencing. If the gene sequence is
not from sorghum, use the gene’s cDNA to identify the ortho-
logous gene sequence in sorghum using the blast tool of Phy-
tozome. Use Ubiquitin as a positive control for VIGS (see
Note 1).
2. Use the pssRNAit web server (https://plantgrn.noble.org/
pssRNAit) to identify the gene sequence region that can pro-
duce effective and specific siRNAs. Confirm that the gene
sequence chosen has a minimum number of off-target hits to
reduce the chances of silencing other unintended genes in the
plant [5].
3. Use Primer 3 (https://bioinfo.ut.ee/primer3-0.4.0/) to
design the primers with fragment size between two primers of
200 to 400 bases from the chosen region of the gene sequence.
4. Add AvrII recognition sequence (TAATCCTAGG) to 50 end of
the forward primer and NocI recognition sequence (TGCTC
CATGG) to the 50 end of the reverse primer while designing
primers.
5. Design gene-specific primers of the target gene to confirm its
presence in the construct used for silencing.
3.2 Construct 1. The RNAeasy kit can be used to extract the RNA from leaves of
Preparation 3 weeks old sorghum plants. RNAse-free DNAse I should be
used to remove the DNA from the extracted RNA. Superscript
III is used to synthesize the first strand of the cDNA from RNA
using an oligo (dT) primer.
2. This cDNA will be used as a template to amplify a fragment of
the sorghum gene that will be used for VIGS construct. The 50
end of the primers is designed to have NocI and AvrII restric-
tion enzyme sites for restriction digestion and cloning into the
BMV-VIGS vector [4, 6]. The primer sequences used for the
experiment are listed in supplementary Table S2 of Singh et al.,
2018 [3] manuscript (see Note 2, [1]). The size of the insert
should be 200 to 400 base pairs.
3. Use BMV3 forward primer (supplementary Table S2 listed in
Singh et al., 2018 [3]) for sequencing to confirm the presence
of insert in the vector in the desired orientation.
4. The plasmid with the desired insert is transformed into the
A. tumefaciens. This will become strain B.
5. Single clones are picked with a toothpick and transferred into
5 mL LB liquid media containing kanamycin (50 μg mL1) and
rifampicin (50 μg mL1) and cultured overnight in a shaker at
28 C. The presence of the BMV3 construct with gene frag-
ment is confirmed by PCR using gene-specific primers.
6. For long-term storage, 500 μL of bacterial suspension should
be mixed with 500 μL of 30% sterile glycerol and stored in a
serological vial at 80 C.
3.3 Plant 1. Four different plant species are needed to execute the experi-
Germination ment successfully. (1) N. benthamiana to reconstitute and
and Growth multiply the virus, (2) Chenopodium to check the virus infectiv-
ity, (3) barley to test the ability of the reconstituted virus to
infect the host monocot plant, and (4) sorghum for functional
study of the gene of interest.
2. The seeds of the N. benthamiana, Chenopodium, barley, and
sorghum are soaked in sterile water overnight, then placed in
Petri plates containing moist filter cotton gauze at 28 C in the
dark until seeds are germinated. The germinated seeds were
transplanted into plastic seed starting trays (6 12 ¼ 72 cells)
with Metro-Mix 830 peat mixture. The plants were grown at
22 C in a growth chamber with a 12 h/12 h light/dark cycle.
3. The 2-week-old N. benthamiana plants were transplanted into
pots with nutrient metro-mix and grown at 22 C in a green-
house under 12 h/12 h light/dark cycle.
3.4 Virus Inoculum 1. The virus inoculum to infect sorghum, barley, and Chenopo-
and Infection dium is first multiplied in N. benthamiana. Inoculate
Confirmation N. benthamiana plants with a mixture of two A. tumefaciens
strains (A and B).
2. The A. tumefaciens strains A and B are multiplied separately to
1.5 OD600 by shaking overnight at 28 C. Centrifuge bacterial
suspension at 6000 g for 5 min to collect the bacterial pellet.
Resuspend the bacteria in an induction medium containing
10 mM MES (pH 5.8) and 100 nM acetosyringone. Mix the
two Agrobacterium strains (A and B) in a 1:1 ratio (v/v), and
the final OD600 value adjusted to 1.0.
3. Shake the mixture at 100 rpm in the dark at room temperature
(22 C) for 3 h before inoculating N. benthamiana leaves. The
upper 2–3 leaves of 3–weeks-old N. benthamiana will be infil-
trated with A. tumefaciens cocktail (strain A and B) using a
1-mL needle-less syringe.
4. Perform reverse transcription-polymerase chain reaction
(RT-PCR) to confirm the virus’s presence in the inoculated
N. benthamiana. Harvest infiltrated leaf 3 days post A. tumefa-
ciens inoculation to extract RNA for RT-PCR. Perform PCR
using BMV forward (BMV RNA3_F) and reverse primers
(BMV RNA3_R), as shown in supplementary Table 2 of
Singh et al., 2018 [3] manuscript. The primers flank the
inserted DNA fragment of the gene of interest in the RNA3
of the BMV.
5. Harvest the infected N. benthamiana leaves 3 days after inocu-
lation and store at 80 C (see Note 3). The sap of the
harvested leaves can be used to inoculate sorghum or barley
or Chenopodium for up to 6 months from the harvest date.
6. Use the sap of the infected N. benthamiana leaves to inoculate
14 days old sorghum, barley, and Chenopodium. For sap prepa-
ration, pulverize 2 g of infected N. benthamiana leaves in liquid
nitrogen, mix with 100 mg carborundum, and 10 mM potas-
sium phosphate buffer (pH 6.8). Use the sap to inoculate (rub
the sap gently using fingers to the upper and lower surfaces of
leaves without damaging the leaves) two to three bottom leaves
of sorghum, barley, and Chenopodium.
7. Maintain the infected plants in an environmental condition that
best suits plant growth and development and virus multiplica-
tion and symptom manifestation. Keep the infected barley and
Chenopodium plants in a greenhouse with a 16 h photoperiod
and 22 C temperature. Maintain the sorghum plants in a
growth chamber at 18 C, 70% humidity (see Note 4), 12 h
photoperiod, and 150–200 μmolm2 s1 light intensity.
8. The BMV infection symptom can be assessed by counting the
plants with white stripes in the second leaves above the
Agrobacterium Infiltration of N. Harvest infected N. PCR to confirm the virus

tumefaciens benthamiana plant benthamiana leaves with insert
RT-PCR Empty
RNA1 vector
RNA2
Insert
RNA3
Infected sorghum leaves Infected barley leaves Infected Chenopodium leaves
Fig. 1 Schematic representation to prepare and silence a gene in sorghum using BMV-based VIGS
inoculated leaves at 4 weeks after rub inoculation in sorghum

and barley (Fig. 1). The white dots are visible in the inoculated
Chenopodium leaves (Fig. 1).
9. The total RNA of sorghum is extracted using the Qiagen
RNAeasy kit to validate the sorghum’s target gene’s silence.
The RNA is treated with RNAse-free DNAse I to remove any
DNA contamination. Superscript III is used to synthesize the
first strand of the cDNA using oligo (dT) as a primer.
10. To check the presence of viral RNA, quantitative PCR can be
performed using tenfold diluted cDNA, random primers,
Syber Green Real-time PCR Master Mix (ThermoFisher),
and ABI PRISM 7500 mechanic (Applied Biosystems). The
transcript level of the target genes can be normalized with
sorghum Actin. The Student’s t-test should be performed to
determine the statistically significant difference between the
gene of interest’s expression level in the silenced and control
plants.
4 Notes
1. Use the Ubiquitin gene as a marker or positive control as its

silencing results in a distinctly visible phenotype in sorghum
plants.
2. Use the antisense strand of the gene to design the construct as a

higher level of silencing can be achieved by using the antisense
strand.
3. Store the infected N. benthamiana leaves for up to 6 months at
80 C for inoculation. Discard the stored leaves after
6 months and prepare new inoculum by infecting
N. benthamiana.
4. Maintain high humidity for up to 3 days after infection to
minimize damage to sorghum leaves because of wounding.
Acknowledgments
We thank Janie Gallaway for taking care of the plants in the green-
house. The Noble Research Institute LLC supported this work.
References
1. Morris GP, Ramu P, Deshpande SP, Hash CT, 4. Ding XS, Schneider WL, Chaluvadi SR, Mian
Shah T, Upadhyaya HD et al (2013) Population MAR, Nelson RS (2006) Characterization of a
genomic and genome-wide association studies brome mosaic virus strain and its use as a vector
of agroclimatic traits in sorghum. Proc Natl for gene silencing in monocotyledonous hosts.
Acad Sci U S A 110(2):453 Mol Plant Microbe Interact 19(11):1229–1239
2. FAOSTAT (2015) Production of crops. Food 5. Ahmed F, Senthil-Kumar M, Dai X, Ramu VS,
and Agriculture Organization of the United Lee S, Mysore KS et al (2020) pssRNAit: a web
Nations (FAO) Statistics Division. http:// server for designing effective and specific plant
faostat3.fao.org/download/Q/QC/E. siRNAs with genome-wide off-target assess-
Accessed 18 May 2015 ment. Plant Physiol 184(1):65
3. Singh DK, Lee H-K, Dweikat I, Mysore KS 6. Ding XS, Mannas SW, Bishop BA, Rao X,
(2018) An efficient and improved method for Lecoultre M, Kwon S et al (2018) An improved
virus-induced gene silencing in sorghum. BMC brome mosaic virus silencing vector: greater
Plant Biol 18(1):123 insert stability and more extensive VIGS. Plant
Physiol 176(1):496–510
Chapter 8
RTBV-Based VIGS Vector for Functional Genomics in Rice:

Methodology, Advances, Challenges, and Future
Implications
Gaurav Kumar, Kamlesh Kumari, and Indranil Dasgupta
Abstract
The availability of protocols for virus-induced gene silencing (VIGS) in rice has opened up an important
channel for the elucidation of gene functions in this important crop plant. Here, we present an updated
protocol of a VIGS system based on Rice tungro bacilliform virus (RTBV) for gene silencing in rice. We
present complete updated protocols for VIGS in rice, compare the system with other existing ones for
monocots, identify some of the challenges faced by this system and discuss ways in which the vector could
be improved for better silencing efficiency.
Key words Agroinoculation, Rice tungro bacilliform virus, Agrobacterium tumefaciens, Monocot
VIGS
1 Introduction
The phenomenon of virus-induced gene silencing (VIGS) in plants

is based on RNA-interference, a process that plays a fundamental
role in growth, development and defence against intracellular infec-
tious agents such as viruses [1].VIGS exploits this defence system to
selectively silence endogenous genes, whose sequences are
incorporated as part of a modified viral vector, also termed a
VIGS vector. The process of VIGS-mediated gene silencing
involves a variety of conserved proteins participating in the phe-
nomenon of RNA-interference and consists of generation of siR-
NAs, their amplification and spread, and finally sequence-specific
degradation of the target gene transcripts in the inoculated and
distant tissues of the plant (see Fig. 1). VIGS has emerged as a
powerful tool for determining the functions of uncharacterized
genes, by using targeted gene silencing. Over the last couple of
decades, VIGS systems have been developed for a large number of
plants species using a variety of VIGS vectors derived from
117
118 Gaurav Kumar et al.
2
Target
gene
Excision and circularization
of recombinant viral partial
genome
Circularized viral genome with
Recombinant VIGS vector
Nucleus target gene 1
Cytoplas 3 4 5
m RdR
Viral-target gene fusion
p dsRNA synthesis Dice
transcript
r Cleavage of dsRNA
Dicer cleaves dsRNA

6
into 21-24 nt siRNA
RDR 7
s
8 AGO & RISC complex
Secondary dsRNA
recruitment Viral Target gene
amplification primary siRNA primary
siRNA
9 siRNA
Dice Activated primary
r siRNA
loaded RISC
Poly(A) tail
12 Systemic
13
1 Silencing
lencing of
0 Host target gene
1 host
mRNA
1 target
arget gene and
Cleavage of target gene phenotype
Activated secondary siRNA Sequence-specific binding of siRNA-loaded
loaded RISC RISC
To target mRNA
Fig. 1 Diagrammatic representation of VIGS: Numbers given in diagram indicate the steps for systemic spread
of VIGS (1) Recombinant VIGS vector (2) Circularized viral genome after excision from vector (3) Transcribed
viral-target gene fusion RNA in cytoplasm (4) Double stranded RNA (ds) synthesis by RNA-dependent RNA
polymerase (5–7) Cleavage of dsRNA by dicer into primary siRNA and its loading in RISC complex leads to
short distance gene silencing (8–9) secondary target gene siRNA amplification by RDRs and its loading into
RISC complex (10–13) Target mRNA recognition by activated RISC complex leads to systemic degradation of
target gene and loss of systemic gene expression
numerous types of plant viruses [2]. In our lab, we had described a

VIGS system for rice using the rice-infecting DNA virus, belonging
to the species Rice tungro bacilliform virus (RTBV) [3]. The above
VIGS system is called RTBV-VIGS and is capable of causing ~50%
gene silencing efficiency within approximately 3 weeks compared to
non-silenced controls. The process involves injecting the relevant
agrobacterial culture containing the appropriate cloned gene
sequences in the VIGS vector, into the meristematic region of
young rice plants. The effect of gene silencing can be visualized in
young leaves emerging after the process of injection, in the follow-
ing 2 or 3 weeks, when marker genes such as Phytoene desaturase
(PDS) or Magnesium chelatase (Chl) are silenced [3, 4]. The RTBV-
VIGS method has been described in detail earlier [5]. Here, we
present an updated version of the protocols and a short review of
the developments that have taken place since the above publication.
Finally, we identify constraints in the RTBV-VIGS system and
discuss ways in which the system can be improved further.
RTBV-Based VIGS Vector for Functional Genomics in Rice: Methodology. . . 119
Until now, the RTBV-VIGS vector (also referred to as

RTBV-Modified VIGS or MVIGS) has been used to silence PDS,
Mitogen-activated protein kinase-3 (MPK3), Magnesium chelatase
subunit H (ChlH), rice bacterial blight resistant gene (Xa21) in rice
and PDS gene in Cynodon dactylon and Zoysia japonica [3, 4, 6,
7]. The silencing efficiency of PDS gene in 15 days old rice plant
was about 60–90% when cloned in antisense orientation and at a
temperature condition of 27 C throughout [3]. To check whether
the orientation of the insert has any influence on the silencing
efficiency, selected genes were cloned in various orientations
(sense, antisense and hairpin) in RTBV-MVIGS. It was seen that
the target genes (PDS, ChlH, Xa21) were silenced within 20 days,
to the maximum extent when the inserts were in the antisense
orientation. When the inserts were present in hairpin and sense
orientation, the extent of silencing was much less [4]. The physical
and agroinoculation conditions were also tested and it was found
that the maximum silencing efficiency can be achieved at a temper-

ature of 28 C with a relative humidity around 80% and when the
secondary Agrobacterium culture is supplemented with 1 mM MES
and 20 μM acetosyringone [4] (Please see Subheading 2.5 for
further clarification). The youngest rice plant that showed success-
ful gene silencing till date was a 5-days-old seedling in which the
MPK3 gene was silenced [6] keeping all other conditions as men-
tioned earlier [3].
Apart from rice, the RTBV-VIGS system has also been used in
silencing the PDS gene in different cultivars of C. dactylon and
Z. japonica using vacuum infiltration with an average efficiency of
~69% and ~54%, respectively, as observed on 21 days post
agroinfiltration [7].
2 Materials
2.1 PCR 1. RNeasy Plant Mini Kit for RNA isolation (Qiagen, Germany),
Amplification MOPS buffer (10 MOPS: 400 mM MOPS, 99.6 mM sodium
of the Target Gene acetate and 20 mM EDTA, pH 7.0) (see Note 1).
2. EtBr premix solution: 1XMOPS [3-(N -morpholino)-propane
sulfonic acid]: formaldehyde: formamide (see Note 2) at a ratio
of 1:3.5:10 and 250 mg/ml ethidium bromide (EtBr) (see
Note 3).
3. Diethyl pyrocarbonate (DEPC) (Sigma, USA) (see Note 4).
4. cDNA Synthesis Kit (High Capacity cDNA Reverse Transcrip-
tion Kit, Applied Biosystems, Carlsbad, California, USA) (see
Note 5).
5. Nanodrop (NanoVue Spectrophotometer V1.7.3, GE Health-
care, England).
6. High-Fidelity Phusion Polymerase and buffers (Finnzymes,

Espoo, Finland) (see Note 5).
7. Thermal cycler and dNTPs.
8. Gene-specific primers containing restriction enzyme sites for
PacI and MluI at the 50 - end of forward and 30 - end of reverse
primers, respectively (see Note 5).
9. Electrophoresis unit, TBE buffer (10 TBE: 890 mM Tris–
HCL, 890 mM boric acid, 20 mM EDTA, pH 8.0).
10. Autoclaved microcentrifuge tubes and tips.
11. RTBV-based VIGS vector pRTBV MVIGS [3].
2.2 Cloning 1. InsT/A Cloning Kit (Fermentas, Ontario, Canada) and dATP
the PCR-Amplified for A-tailing the blunt end of PCR-amplified product and
Target Gene into cloning in a T-tailed linear vector (see Note 5).
the pRTBV MVIGS 2. T4 DNA ligase and buffer (Fermentas).
Vector 3. Escherichia coli (DH5α) competent cells prepared in the lab or
commercially available chemical-competent cells DH5α (NEB,
Ipswich, Massachusetts, USA).
4. Laminar flow hood, sterile Petri plates, Luria-Bertani
(LB) agar: (1% casein hydrolysate, 0.5% yeast extract, 1%
sodium chloride, 1% agar), pH 7.5, antibiotic stocks, sterilized
toothpicks, incubator shakers, centrifuge machines, spreader
and 37 C incubator.
5. Taq DNA polymerase (NEB, Ipswich, Massachusetts, USA)
and gene-specific primers.
6. LB broth, LB agar and appropriate antibiotics (see Note 6).
7. Plasmid isolation buffers and reagents or plasmid isolation
kit [8].
8. Restriction enzymes (NEB and Fermentas) to confirm the
presence of expected fragments in the resident plasmids in
bacterial colonies appearing on appropriate antibiotic selection
plate.
9. Autoclaved dimethyl sulfoxide (DMSO) for stock preparation
(bacterial culture: DMSO in 930:70 μl ratio) (see Note 7).
2.3 Transformation 1. Sterilized culture tubes, microcentrifuge tubes, and

of Recombinant VIGS micropipette tips.
Vector into 2. LB broth, autoclaved toothpicks, antibiotics, and incubator
A. tumefaciens shaker.
3. Plasmid isolation reagents and buffers T50 E10: (50 mM Tris–
HCl and 10 mM EDTA), T10E1: (10 mM Tris–HCl and 1 mM
EDTA), 0.2 NaOH, 1% SDS, or plasmid isolation kit (RBC,
Korea).
4. Chemical-competent Agrobacterium cells, liquid nitrogen, LB

agar, spreader, and 28 C incubator [9].
5. Taq DNA polymerase (NEB, Ipswich, Massachusetts, USA)
and gene-specific primers.
6. DMSO (930:70 μl ratio) (see Note 7).
2.4 Seed 1. Rice seeds, plastic tray, muslin cloth, and glass culture tubes.
Germination 2. Yoshida’s medium: 40 mg/l NH4NO3, 10 mg/l NaH2-
and Growth Conditions PO4.2H2O, 40 mg/l K2SO4, 40 mg/l CaCl2, 40 mg/l
MgSO4.7H2O, 0.5 mg/l MnCl2.4H2O, 0.05 mg/l
(NH4)6Mo7O24.4H2O, 0.2 mg/l H3BO3, 0.01 mg/l
ZnSO4.7H2O, 0.01 mg/l CuSO4.5H2O, 2 mg/l FeCl3.6H2O
and adjust the pH to 5.8 [10] (see Note 8).
3. Plant growth chamber maintained at 28 C, 80% humidity and
500 μmol/m2/s light intensity for rice growth and diurnal
cycle of 16 h light and 8 h dark.
2.5 Growth 1. Reagents for primary culture: LB agar, LB broth, autoclaved

of A. tumefaciens toothpick, antibiotics, inoculation loop, culture tubes and
Containing incubator shaker.
Recombinant VIGS 2. Reagents for secondary culture: LB broth, antibiotics, glass-
Vector ware, Oak Ridge tubes, 1 mM MES, 20 μM acetosyringone
and incubator shaker (see Note 9).
3. Resuspension buffer: 10 mM MgCl2, 10 mM MES, 500 μM
acetosyringone and double-distilled water (see Note 9).
4. Superspeed centrifuge, spectrophotometer and cuvettes.
2.6 Syringe 1. 15–20 days old healthy rice plants, sterilized 1 ml syringe
Inoculation (DISPO VAN, Hindustan Syringes and Medical Devices Ltd.,
of A. tumefaciens India).
Suspension in Rice 2. Plastic trays, Yoshida’s medium, and plastic plate.
Plants 3. Whatman No.1 filter paper (Whatman International Ltd.,
England).
4. Glass culture tubes and test tube stands.
2.7 Evaluation 1. RNeasy Plant Mini Kit for RNA isolation (Qiagen, Germany).
of VIGS-Mediated 2. Nanodrop (NanoVue Spectrophotometer, V1.7.3, GE Health-
Silencing care, England).
in Agroinoculated
3. Electrophoresis unit, First Strand cDNA Synthesis Kit (High
Plants Capacity cDNA Reverse Transcription Kit, Applied
Biosystems, USA).
4. Real-time PCR cycler (ABI Prism® 7000 Sequence Detection
System, Applied Biosystems, USA).
5. MicroAmp® Fast optical 96-well reaction plate (Applied
Biosystems, USA).
6. MicroAmp® Optical adhesive film kit (Applied

Biosystems, USA).
7. Real-time PCR Kit (SYBR Green PCR Master Mix, Applied
Biosystems, USA) (see Note 10).
8. Real-time specific primers for target gene and housekeeping
genes.
9. Autoclaved DEPC MQ water (milliQ water or deionized
water) and real-time plate spin.
3 Methods
3.1 Cloning 1. Nucleotide sequence analysis of the target gene was done using
the Target Gene genome databases, e.g., National Center for Biotechnology
in the TA Vector Information (NCBI) [5].
3.1.1 Sequence Analysis 2. Gene-specific primers were designed in unique region from the
and Designing of Primers 30 end of the target gene nucleotide sequence [5].
3.1.2 RNA Isolation 1. Collect young leaf tissue for RNA isolation of the target gene
and immediately freeze in liquid nitrogen.
2. All the glassware, plasticware, mortar pestles, RO water
(Reverse Osmosis water) and MQ water should be treated
with DEPC (use 0.1% for solid materials and 0.01% for liquid
materials) for overnight, oven dry all treated materials followed
by autoclaving them (see Note 4).
3. Clean the work platform properly with 70% ethanol to avoid
any contamination and also wear RNase-free gloves during
RNA isolation.
4. Grind frozen leaf tissue up to 100 mg using liquid nitrogen to
make a fine powder into a pre-cooled mortar pestle.
5. Isolate the total RNA using RNeasy Plant Mini Kit as per
manufacturer’s instructions.
6. Quantify the concentration A260/280 ratio using Nanodrop.
7. Check the integrity of the RNA, perform gel electrophoresis
using MOPS buffer; use 2 μg of RNA and EtBr premix solution
to prepare samples.
8. Denature the RNA samples at 65 C in a water bath for 15 min
and cool immediately in ice.
9. Load the denatured RNA samples in 1% agarose gel prepared in
MOPS buffer.
10. Perform electrophoresis at 150 V for 30 min and check the
integrity of the RNA in a UV-transilluminator comparing the
intensity of 28S, 18S, and 5S rRNA.
3.1.3 cDNA Synthesis 1. Take 2 μg of RNA and synthesize cDNA using the High
Capacity cDNA Reverse Transcription Kit as per manufac-
turer’s instructions.
2. Amplify the short fragment of cDNA using gene-specific pri-
mers and High-Fidelity Phusion Polymerase following PCR
cycle: 98 C/2 min; 30 cycles of 98 C/10s, 55 C/30s,
72 C/15 s and final extension at 72 C for 7 min followed
by storing at 4 C.
3. Perform 1% agarose gel electrophoresis (1 TBE, 0.5 mg/ml
of ethidium bromide) at 100 V for 1 h using 5 μl of PCR
product along with DNA molecular marker to assure the cor-
rect size of the amplified product by looking under the UV-
transilluminator.
3.1.4 A-Tailing 1. Perform bulk PCR amplification to get an appropriate quantity

of PCR-Amplified Product of the target product for all further steps. Use 40 μl PCR
product to perform the A-tailing reaction (see Note 11).
2. A-tailing reaction sample preparation: 40 μl PCR product, 6 μl
Taq DNA polymerase buffer, 2 μl dATP, 2 U of Taq DNA
polymerase make the 60 μl volume with autoclaved MQ water.
Mix the reaction mixture properly and incubate at 72 C for
30 min followed by snap cooling on ice.
3. Purify the A-tailed PCR product by ethanol precipitation: Mix
an equal volume of T10 E1, 1/10th volume of 3 M sodium
acetate pH 5.2 and 3 volume of 100% ethanol, keep it at 80 C
freezer for 1 h.
4. Centrifuge the samples at 4 C for 15 min to pellet down the
DNA followed by a 70% ethanol wash at room temperature
(RT) for 10 min. Decant the ethanol, air-dry pellet and dissolve
it in 15 μl sterilized MQ water.
5. Check DNA concentration on 1% agarose gel and perform the
ligation of A-tailed insert with a linear TA vector containing
T-overhangs using InsT/A Cloning Kit as per manufacturer’s
instructions.
6. Transform the ligated product in chemical-competent E. coli
(DH5α) cells and plate on LB agar plate containing appropriate
antibiotics, incubate it overnight at 37 C in an incubator.
3.1.5 Screening 1. Perform colony PCR for the grown colonies on a plate to
of Recombinant Clone analyze the positive recombinant clones using Taq DNA poly-
merase and gene-specific primers.
2. Select positive colonies which amplify the expected DNA frag-
ment and grow for overnight in LB broth containing an anti-
biotic selection at 37 C, 200 rpm in an incubator shaker.
Fig. 2 pRTBV- VIGS vector map
3. Isolate the plasmid from the grown culture using the alkaline
lysis method, confirm the recombinant plasmid DNA through
restriction digestion using different combinations of restriction
enzymes and analyze the digestion pattern using 1% agarose gel
electrophoresis [11].
4. Further confirm the identity of the cloned target gene by
sequencing and alignment with a known gene sequence (see
Note 12).
3.1.6 Cloning 1. Further, to sub clone the target gene from the recombinant TA
and Screening in the VIGS vector into VIGS vector (see Fig. 2), isolate the plasmid using
Vector the alkaline lysis method followed by restriction digestion using
PacI and MluI restriction enzymes.
2. Analyze the digested product on 1% agarose gel at 100 V for
1 h to separate the target gene (insert) and linear TA vector.
Cut and excise the insert with a sharp scalpel and store it at
20 C.
3. Isolate the VIGS vector plasmid using a Midi Plasmid Kit as per
manufacturer’s instructions. Analyze the isolated plasmid on
1% agarose gel and digest 4 μg of the VIGS vector with PacI
and MluI restriction enzymes.
4. Analyze the linearized vector on 1% agarose gel, cut and excise
the linearized vector with a sharp scalpel and store at 20 C.
5. Perform gel extraction of stored excised gel pieces of the vector
and insert using Gel/PCR DNA Extraction Kit and quantify by
checking little amount on 1% agarose gel.
6. Ligate the purified linearized vector and insert DNA in a 1:3
ratio and transform in chemical-competent cells of E. coli
(DH5α) strain.
7. Spread the transformed cells on LB agar Petri plate containing
appropriate antibiotic and keep at 37 C incubator overnight.
8. Select some colonies from the LB plate containing transformed
cells, patch them on a fresh LB plate, using toothpicks and keep
in 37 C incubator for overnight.
9. Screen the transformed positive colonies by colony PCR using

gene-specific primer and start LB broth culture for further
analysis using appropriate antibiotics.
10. Use the alkaline lysis method to isolate plasmid and digest it
with MluI and PacI, load the digested samples on 1% agarose
gel to analyze release of the target gene fragment to ensure that
the plasmid is recombinant.
11. Prepare stock cultures using positive clones for future use.
3.2 Transformation 1. Inoculate a single colony of disarmed A. tumefaciens strain

of Recombinant VIGS EHA105 in 5 ml LB broth culture (primary culture) using an
Vector into autoclaved toothpick, supplement with rifampicin (50 μg/ml)
A. tumefaciens antibiotic selection and keep in the dark at 28 C in a shaker for
36 h (see Note 13).
3.2.1 Preparation
of Chemical-Competent
2. Inoculate 50 ml of LB broth supplemented with rifampicin
A. tumefaciens Cells
(50 μg/ml) with 500 μl of the grown primary culture for a
secondary culture and incubate in the dark at 28 C under
shaking conditions until OD reaches 0.6–0.8.
3. Centrifuge the grown A. tumefaciens culture in SS34 tubes at
1500 g for 10 min at 4 C, gently take out the tubes from the
centrifuge and discard the supernatant by avoiding loss of cells
in pellet.
4. Resuspend the pelleted cells gently with filter-sterilized ice-cold
100 mMCaCl 2 in a cold room and centrifuge at 4 C,
1500 g for 10 min.
5. Discard the supernatant and again resuspend with solution
containing 425 ml ice-cold 100 mM CaCl2 and 75 μl sterilized
100% glycerol in a cold room.
6. Precool the autoclaved 1.5 ml microcentrifuge tubes in ice and
aliquot 50 μl of resuspended cells in each tube and freeze
immediately aliquoted tubes in to liquid nitrogen, store at
70 C.
3.2.2 Transformation 1. Isolate recombinant VIGS vector plasmid using plasmid mini
of Recombinant VIGS kit as per manufacturer’s instructions.
Vector to A. tumefaciens 2. Thaw the prepared competent A. tumefaciens cells on ice and
add 1 μg of purified plasmid. Transfer the tube in liquid nitro-
gen for 2 min and immediately transfer to 37 C water bath for
5 min.
3. Immediately transfer the tubes in ice for 10 min and add 1 ml
of LB broth in laminar hood, incubate at 28 C in a 200 rpm
shaker overnight.
4. Pellet down the cells at 4 C, 2800 g a centrifuge for 5 min,
discard the supernatant, leaving 100 μl in tube.
5. Resuspend the cell pellets gently by swirling the pipette tip and
spread the suspended cells on a LB agar plate containing rifam-
picin (50 μg/ml) and kanamycin (50 μg/ml) using a sterilized
spreader. Keep the plate in a 28 C incubator for 48 h.
6. Perform colony PCR using gene-specific primer to screen the
transformed A. tumefaciens cells and prepare stock culture to
store at 70 C.
3.3 Agrobacterium- 1. Place the surface sterilized rice seeds (70% ethanol for 45 s
Mediated Inoculation followed by three washes with autoclaved MQ water) on a
in Rice Plants small tray covered with muslin cloth.
3.3.1 Rice Plant Growth 2. Transfer the small tray containing seeds into a larger tray filled
with Yoshida’s medium whose ends of the muslin cloth get
dipped into medium and finally cover the complete tray with
serene wrap film.
3. Keep the growth chamber at 28 C and 80% humidity with
16 h day and 8 h night cycle. Add the Yoshida’s medium
regularly for proper nourishment.
4. Transfer the 10-days-old rice plants from the tray to test tubes
containing hydroponic solution (Yoshida’s medium).
3.3.2 Preparation 1. Streak two LB agar plates containing rifampicin (50 μg/ml)
of A. tumefaciens and kanamycin (50 μg/ml) with A. tumefaciens cells trans-
Suspension for Inoculation formed with an empty VIGS vector and recombinant VIGS
vector (VIGS; PDS) from stock using a sterilized inoculation
loop. Incubate the plates in the dark in a 28 C incubator for
48 h.
2. Initiate a primary culture by inoculating 5 ml of LB broth
containing rifampicin (50 μg/ml) and kanamycin (50 μg/ml)
with a single colony for both the constructs, incubate at 28 C
in a 200 rpm shaker in the dark for 36 h.
3. Inoculate 100–200 ml LB broth containing kanamycin
(50 μg/ml) for a secondary culture with 500 μl of the primary
culture and supplement with 1 mM MES and 20 μM acetosyr-
ingone. Incubate at 28 C in a 200 rpm shaker until OD600
reaches 0.6–0.8 (see Notes 9 and 14).
4. Transfer the secondary culture into autoclaved SS34 tubes and
centrifuge at 4200 g for 10 min at 4 C. Discard the super-
natant and dissolve the pellet in resuspension buffer (maintain
the OD600 of the solution at 0.6–1.0 by adding resuspension
buffer) (see Note 15).
5. Leave the final A. tumefaciens suspension at room temperature
without shaking for 2–3 h before agroinoculation of rice plants.
3.4 Preparation 1. While incubating the A. tumefaciens suspension at room tem-

for Agroinoculation perature prepare the platforms to place the rice plants after
agroinoculation.
2. Prepare separate platforms for plants inoculated with empty
and recombinant VIGS vector, take two small trays and fill
1/3rd with Yoshida’s medium, put a plastic plate over trays [5].
3. Cut the appropriately sized Whatman No.1 filter paper, soak in
Yoshida’s medium and place it on the plate in such a way that its
ends get dipped inside the medium [5].
4. Label the platforms with a marker to avoid mixing up rice
plants inoculated with different constructs.
3.4.1 Syringe Inoculation 1. Take 15–20-days-old rice plants from culture tubes and inocu-
of A. tumefaciens late with 100 μl of A. tumefaciens suspension using a sterilized
Suspension in Rice 1 ml syringe at the meristematic region of rice plants also
shown in https://www.youtube.com/watch?
v¼7HUD9BQE7Is (see Note 16).
2. Repeat the agroinoculation at different points in the same plant
if inoculation is not successful (see Note 17).
3. Keep the plants inoculated with empty vector and recombinant
vector horizontally over the wet Whatman No.1 filter paper on
separate platforms (see Note 18).
4. Cover the roots of inoculated plants with tissue paper to avoid
the root drying [5] (see Note 19).
5. Perform the whole procedure above a large empty tray covered
with a blotting sheet to avoid spread of A. tumefaciens.
6. Keep the whole setup in the growth chamber set at 28 C, 80%
humidity and 16h day/8h night for 18 h.
7. Transfer the plants into culture tubes containing hydroponic
solution after carefully washing the plants roots with water in a
beaker (see Note 20).
8. Label and keep the test tubes containing hydroponic solution
in the controlled growth chamber.
9. Observe the inoculated plants daily and change the Yoshida’s
medium every third day.
3.5 Observation 1. For silencing the PDS gene look for the appearance of white
and Validation streaks in emerging leaves [4].
of Silencing Phenotype 2. Harvest the emerging leaf tissues from plants inoculated with
Using Real-Time PCR the VIGS vector containing the target gene and the empty
vector. Immediately freeze the harvested tissues in liquid
nitrogen.
3. Get all the materials ready for real-time PCR, such as an RNA
Isolation Kit, cDNA Synthesis Kit, SYBR Green PCR Master
Mix, gene-specific real-time PCR primer, 96-well real-time
plate and adhesive film.
4. To design a gene-specific real-time PCR primer, use Primer
Express ®software.
5. RNA isolation and cDNA synthesis could be performed as
described in Subheadings 3.1.2 and 3.1.3.
6. To detect the relative transcript levels of the target gene, per-
form real-time PCR reaction for amplification of the
target gene.
7. Prepare the reaction in 25 μl by adding 12.5 μl SYBR Green,
1 μl forward primer (5 μM stock), 1 μl reverse primer (5 μM
stock), 9.5 μl MQ water, and 1 μl cDNA in low light as SYBR
Green is light sensitive (see Note 21).
8. Set another reaction of 25 μl to detect the transcript level of the
endogenous control Ubiquitin 5 gene (UBQ5) in each sample
using UBQ5 specific forward and reverse primers.
9. Load 8 μl of the 25 μl final reaction in triplicate for the target
gene as well as the endogenous control in the 96-well plate and
seal the plate properly with adhesive film.
10. Spin the plate for a while to settle the reaction mixture and put
the plate in a real-time PCR machine. Set the reaction as
follows: 95 C/10 min, 40 (95 C/20s, 60 C/1 min and
72 C/1 min).
11. Analyze the data obtained using the comparative Ct method
(also referred as 2 ΔΔCt method) [12].
The important points to be noted during gene silencing in rice
using RTBV-VIGS system are given below.
4 Notes
1. Wear gloves before every experiment, store the MOPS buffer in

a light-protected glass bottle at room temperature as it is light
sensitive. Discard the buffer when it turns yellow.
2. Wear proper gloves, mask and goggles when using formamide
and formaldehyde because both chemicals are irritants to eyes,
skin and respiratory system.
3. Take proper care when using EtBr because it is carcinogenic in
nature and inhalation and skin absorption can cause irritation in
eyes, skin and respiratory system.
4. Use DEPC in a fume hood and wear a lab coat, face mask,
gloves and safety glasses while using it, as it is a carcinogen.
Cover all the beakers and bottles with aluminum foil after
adding DEPC and store it in 4 C.
5. Store all the enzymes, kits and primer stocks in 20 C freezer.
6. Prepare and filter-sterilize all antibiotics carefully in laminar
flow and keep them in 20 C freezer for future use.
7. Add required amount of DMSO in cryo-vials in laminar flow
and autoclave the vials for future use.
8. Maintain the Yoshida’s medium at pH 4.5–5.0 during prepara-
tion and store at 4 C as a minor change in pH may affect plant
growth.
9. MgCl 2 and MES can be prepared and stored at 4 C for further
use but acetosyringone is prepared fresh in DMSO every time
for the resuspension buffer. Follow the recommended concen-
trations of chemicals for preparation of buffer.
10. Real-time PCR kit is stored in 20 C freezer.
11. PCR amplification of target gene cDNA produces blunt end
DNA using High-Fidelity Phusion Polymerase, therefore
A-tailing and ligation to the TA vector is required for further
cloning.
12. After cloning the target gene in the TA vector, confirm the
clone by nucleotide sequencing, as any deletion or insertion in
the target gene sequence may lead to failure of the experiment.
13. Light-sensitive antibiotics (rifampicin) and LB agar plates con-
taining antibiotics should be kept covered with aluminum foil,
as they degrade under long exposure to light.
14. Secondary culture of A. tumefaciens should be grown by
inoculating recommended primary culture and an OD of
0.6–0.8 should be maintained and checked using a spectro-
photometer; overgrowth of A. tumefaciens results in formation
of dead cells.
15. Maintain the OD of A. tumefaciens cells suspension in resus-
pension buffer at 0.6–1.0 as ODs above and below this range
reduce the silencing efficiency.
16. Inject the needle (vertically downward) in the meristematic
region of the rice plant for agroinoculation so that small
drops of A. tumefaciens suspension come out of the base of
the first leaf. Do not injure plant too much.
17. If the A. tumefaciens suspension flows down through the roots,
try injecting the plant at another point.
18. Keep the plants inoculated with the empty VIGS vector and
recombinant VIGS vector on separate reservoirs as
A. tumefaciens suspension stuck to the roots of plants may
get mixed and lead to a faulty result.
19. Do not add Yoshida’s medium over the tissue paper covering
roots during the incubation period for 18 h, as it may remove
the A. tumefaciens within the plants.
20. Wash the roots of inoculated plants properly with water before
transferring to test tubes to remove excess A. tumefaciens stuck
to roots.
21. SYBR Green is light sensitive so keep SYBR Green away from
light while performing real-time PCR reaction, maintain the
real-time plate at 4 C using ice and use aluminum foil to cover
plate after loading the samples.
RTBV-MVIGS can be obtained from the authors upon request.
The material will be made available in accordance with applicable
national guidelines.
Acknowledgments
GK acknowledges CSIR-Research Associateship from Council of

Scientific and Industrial Research, New Delhi and KK acknowl-
edges Research Fellowship from University Grants Commission,
New Delhi for this work. The work in ID lab is funded by the J. C.
Bose Fellowship awarded by the Science and Engineering Research
Board, Department of Science and Technology, Government of
India. The Departmental infrastructural facilities funded by the
FIST programme of Department of Science and Technology, Gov-
ernment of India are also gratefully acknowledged.
References
1. Tuschl T (2001) RNA interference and small vector derived from a DNA virus. Plant Cell
interfering RNA. Chembiochem 2:239–245 Rep 7:1159–1170
2. Lange M, Yellina AL, Orashakova S, Becker A 5. Kant R, Sharma S, Dasgupta I (2015) Virus-
(2013) Virus induced gene silencing (VIGS) in induced gene silencing (VIGS) for functional
plants: an overview of target species and the genomics in Rice using Rice tungro bacilliform
virus-derived vector systems. Methods Mol virus (RTBV) as a vector. Methods Mol Biol
Biol 975:1–14. https://doi.org/10.1007/ 1287:201–217
978-1-62703-278-0_1 6. Singh P, Sinha AK (2016) A positive feedback
3. Purkayastha A, Mathur S, Verma V et al (2010) loop governed by SUB1A1 interaction with
Virus-induced gene silencing in rice using a MITOGEN-ACTIVATED PROTEIN
vector derived from a DNA virus. Planta 232: KINASE3 imparts submergence tolerance in
1531–1540. https://doi.org/10.1007/ rice. Plant Cell 28(5):1127–1143. https://
s00425-010-1273-z doi.org/10.1105/tpc.15.01001
4. Kant R, Dasgupta I (2017) Phenotyping of 7. Zhang B, Shi J-A, Chen J-B et al (2016) Effi-
VIGS-mediated gene silencing in rice using a cient virus-induced gene silencing in
Cynodondactylon and Zoysia japonica using 10. Kim DW, Rakwal R, Agrawal GK et al (2005) A
rice tungro bacilliform virus vectors. Sci Hortic hydroponic rice seedling culture model system
(Amsterdam) 207:97–103 for investigating proteome of salt stress in rice
8. Sambrook J, Russell DW (2001) Molecular leaf. Electrophoresis 6:4521–4539
cloning: a laboratory manual, 3rd edn. Cold 11. Birnboim HC, Doly J (1979) A rapid alkaline
Spring Harbor Laboratory Press, extraction procedure for screening recombi-
Plainview, NY nant plasmid DNA. Nucleic Acids Res 7:
9. Hood EE, Gelvin SB, Melchers LS et al (1993) 1513–1523
New Agrobacterium helper plasmids for gene 12. Schmittgen DH, Livak JK (2008) Analyzing
transfer to plants. Transgenic Res 2:208–218 real-time PCR data by the comparative CT
method. Nat Protoc 3:1101–1108
Chapter 9
Optimization of Tobacco Rattle Virus (TRV)-Based

Virus-Induced Gene Silencing (VIGS) in Tomato
Ashish Kumar Singh , Dibyendu Ghosh , and Supriya Chakraborty
Abstract
Unveiling of full genome sequence of tomato demands significant advances of tomato functional genomics.
Virus-induced gene silencing (VIGS) is a well explored functional genomics tool in plant biology that
exploits post transcriptional gene silencing to downregulate a desired gene. Although VIGS provides an
easy and highly efficient platform to study plant gene function through reverse genetics approach, currently
VIGS is more efficient in model plants like Nicotiana benthamiana, which further justifies the urgent need
of a highly efficient, reliable, and reproducible VIGS protocol in crop plants such as tomato. In this chapter,
we have detailed an optimized Tobacco rattle virus (TRV)-based VIGS protocol in tomato.
Key words Tomato, Functional genomics, VIGS, TRV, PDS, PTGS, Agrobacterium
1 Introduction
Nutritional qualities (a rich source of antioxidants, vitamins, and

minerals) and amazing taste of the fleshy fruit drive the worldwide
popularity of tomato as a vegetable. Rising Global consumption
and cultivation of tomato warrants its agro economic importance
and necessitates more scientific involvement for crop improvement
and protection. Although breakthrough release of full genome
sequence of tomato provides an insight into tomato genome, less
than 1% of total genes are yet functionally annotated, which further
justifies the urgent need of functional genomics approaches in
tomato [1]. Till date, available means to study functional genomics
through knockout or knockdown approach in tomato plant
includes insertional mutagenesis, RNAi, and CRISPR-Cas9 based
methods. Nonetheless, not being high throughput technique and
need for time-consuming generation of stable transformed lines
dictates the striking limitations of the above-mentioned
approaches. VIGS provides an easily affordable and excellent plat-
form for plant biologists to skip these laborious and time-
133
134 Ashish Kumar Singh et al.
consuming protocols while studying functional genomics at a large

scale [2, 3]. In this method, an engineered viral genome is used as a
vehicle to deliver a partial sequence of the gene of interest into the
plant cells. A wide host range, comparatively milder symptoms and
ease to handle make Tobacco rattle virus (TRV) favorite to be opted
as VIGS vector. Among the two genome segments of this bipartite
RNA virus namely TRV1 and TRV2, the latter had been engineered
with an insertion of MCS for easy cloning of particular sequence
(having no off-target effects) of any host gene in an antisense
orientation. It triggers the formation of dsRNA intermediate inside
the plant cells and induce posttranscriptional gene silencing
(PTGS) leading to knock down of the desired gene [4–7].
In this present study we have optimized TRV-based VIGS
protocol on a popular tomato variety Pusa Early Dwarf (PED)
using Agrobacterium tumefaciens strain GV3101 that can also be
easily adopted for other varieties of this crop plant. Further, we
have fine-tuned agroinfiltration technique to downregulate Phyo-
tene desaturase (PDS) gene and obtained very efficient gene silenc-
ing of this target gene with 100% frequency (Table 1, Figs. 1 and 2).
2 Materials
2.1 Transformation 1. Sterilized Luria-Bertani (LB) liquid media (pH 7.5): 1% tryp-
of Recombinant VIGS tone, 1% sodium chloride, 0.5% yeast extract.
Vector into Competent 2. Agar (1% while making LB agar plates).
A. tumefaciens
3. Rifampicin stock (see Note 1).
2.1.1 Preparation 4. A. tumefaciens strain GV3101.
of Competent
5. NaCl solution, CaCl2 solution.
Agrobacterium Cells
(Chemical CaCl2 Method) 6. Liquid nitrogen.
7. Sterilized microfuge tube (MCT), toothpicks, inoculating
loops, tips, culture tubes, falcons.
8. Heraeus Megafuge 16R with rotor F15-6x100y (Thermo
Fisher Scientific, Massachusetts, United States).
2.1.2 Transformation 1. Competent A. tumefaciens GV3101cells.

of Recombinant TRV Clones 2. Isolated plasmid DNA of TRV1, TRV2, TRV2-GOI (denoted
in A. tumefaciens as pTRV1, pTRV2 and pTRV2-GOI, respectively).
3. Liquid nitrogen, forceps.
4. LB liquid media, agar, rifampicin and kanamycin.
5. Sterilized glass spreaders, toothpicks, inoculating loops, tips,
culture tubes.
6. Thermal cycler (Veriti™ 96-Well Thermal Cycler, Thermo
Fisher Scientific, Massachusetts, United States),
Optimization of Tobacco Rattle Virus (TRV)-Based Virus-Induced Gene. . . 135
Table 1
Summary of TRV-based PDS gene silencing in tomato variety Pusa Early Dwarf
A. tumefaciens Days to
strain GV3101 appearance
OD600 of first bleaching Frequencya Effectivenessb Efficiencyc Persistence
0.25 16 0.8 0.8 -nd- 60 dpi and
continuing
0.5 15 0.8 0.8 -nd- 60 dpi and
continuing
1 12 1 0.92 86.4% 60 dpi and
continuing
a
Frequency of gene silencing (no. of photobleached plants/total number of plants infiltrated)
b
Effectiveness of gene silencing (no. of leaves showing photobleaching/total number of leaves per plant) at 60 dpi
c
Efficiency of gene silencing was calculated by qRT-PCR by the following formula:
PDS expression in silenced plants
%decrease in PDS expression in silenced plants ¼ 100 PDS expression in non‐silenced plants 100
nd—not determined
dpi—days post infiltration
Electrophoresis unit, Geldoc (Gel Doc XR+ Gel Documenta-

tion System, Bio-Rad Laboratories, California, United States),
heat block (Dry bath with standard heating block, Genei
Laboratories Pvt. Ltd., Bangalore, India).
7. 2.5 mM dNTP, 10 μM primers (forward and reverse), Taq
polymerase enzyme, 10 reaction buffer and double distilled
water.
8. TAE buffer: 40 mM Tris-acetate, 1 mM EDTA.
9. Agarose, Ethidium bromide (EtBr) (see Note 2).
10. Glycerol.
2.2 Agroinfiltration 1. Growth chamber (Temperature: 22 C, Humidity: 80%, 16 h

in Tomato Plants light and 8 h dark).
2.2.1 Making Tomato 2. Sterilized tomato seeds.
Plants Ready for Infiltration 3. Sterilized soilrite (Prakruti Products Pvt. Ltd., Karnataka,
India).
4. Pots, tags, and trays.
2.2.2 Preparation 1. Glycerol stocks (GS) of pTRV1, pTRV2 and pTRV2-GOI.

of Agroinoculum 2. Infiltration buffer (pH 5.8): 10 mM MES, 10 mM MgCl2,
for Infiltration 200 μM acetosyringone.
3. LB liquid media, agar, rifampicin and kanamycin.
4. Sterilized toothpicks, inoculating loops, tips, culture tubes and
falcons.
5. Gloves.
Fig. 1 Phenotypes of PDS silenced representative tomato plants at various days

post infiltration. In each panel, left three plants are PDS silenced while the other
plant depicts phenotype of control (TRV1 + TRV2::00) infection
2.2.3 Agroinfiltration 1. Healthy tomato plants (2–3 leaf stage) (see Note 3).
in Tomato Plants 2. Needleless syringe (1 mL).
3. Gloves.
2.3 Confirmation 1. Sterilized forceps, MCT.

of Gene Silencing 2. Liquid nitrogen.
2.3.1 Collection of Leaf
Samples
2.3.2 RNA Isolation 1. DEPC treated water (see Note 2).

2. Sterilized and RNAase free micropistles, MCT.
3. Tri-reagent (Molecular Research Center, Inc., Cincinnati, OH
45212 USA).
Fig. 2 Molecular analysis of PDS silenced plants tomato plants. (a) Detection of PDS transcripts in PDS
silenced (plants P1 to P5) and control (TRV1 + TRV2::00) plants (T1 to T5) through semi-quantitative RT-PCR.
PCR amplification of TRV coat protein (CP) serves as positive control and Actin amplification acts as internal
control. TRV2::PDS and TRV2::00 plasmids were used as positive and negative control, respectively. TRV2 and
TRV1 plasmids were used for positive and negative control, respectively for PCR reaction of TRV CP. (b)
Relative level of PDS transcripts was detected in the PDS silenced (P1 to P5) and control (T1 to T5) tomato
plants through qRT-PCR. Relative mRNA levels were determined by qRT-PCR using the standard curve
approach, and the value of each biological repeat is the mean of three technical repeats. All values are
normalized with respect to the internal control, Actin. Error bars in the graph represent the standard deviations
and have been calculated considering three technical replicates in each case. *P < 0.001 (Student’s t-test)
4. Chloroform, isopropanol, 70% ethanol.

5. Agarose and 10 MOPS buffer (pH 7): 0.2 M MOPS, 20 mM
sodium acetate, 10 mM EDTA (pH 8) (see Note 1).
6. 2 N NaOH (for adjusting the pH of MOPS buffer).
7. Cleaned and RNAase free Electrophoresis unit, Geldoc, heat
block.
8. NanoDrop 2000 spectrophotometer (Thermo Fisher Scien-

tific, Massachusetts, United States), Heraeus Megafuge 16R
with rotor 75003652 (Thermo Fisher Scientific,
Massachusetts, United States).
2.3.3 cDNA Synthesis 1. RNase free DNaseI, 1 U/μL (Thermo Fisher Scientific,
Massachusetts, United States) and EDTA (pH 8.0) (Thermo
Fisher Scientific, Massachusetts, United States).
2. 40 mM dNTPs, 25 mM MgCl2, 0.5 μg/μL Oligo dT, 40 U/μ
L riboblock inhibitor.
3. 200 U/μL Reverse transcriptase (RT) enzyme and its buffer
(5).
4. Thermal cycler, heat block.
2.3.4 Semiquantitative 1. 2.5 mM dNTP, 10 μM primers (forward and reverse), Taq

RT-PCR (sqRT-PCR) polymerase enzyme, 10 reaction buffer and double distilled
water.
2. Thermal cycler (Verti™96-Well Thermal Cycler, Thermo
Fisher Scientific, Massachusetts, United States), Electrophore-
sis unit, Gel doc (Gel Doc XR+ Gel Documentation System,
Bio-Rad Laboratories, California, United States).
3. TAE buffer, agarose and EtBr.
2.3.5 Measuring 1. Sterilized double distilled water.

the Efficiency of Gene 2. Microtips and pipettes.
Silencing Via Quantitative
3. 2 SYBR Green master mix (KAPA SYBR FAST qPCR Master
Real Time RT-PCR
Mix (2) Universal, Kapa Biosystems, East Coast, New Eng-
(qRT-PCR)
land) (see Note 4).
4. Gene specific real time PCR primers.
5. Actin specific real time PCR primers.
6. 48 well plate and adhesive film (provided by the Illumina, San
Diego, California, United States).
7. Eco-real time PCR System (Illumina, San Diego, California,
United States).
3 Methods
3.1 Cloning of Target To silence a gene of interest (GOI), clone a particular stretch of the
Gene in TRV-Based gene (length around 500 bp having no off-target) in TRV2 based
VIGS Vector VIGS vector in antisense orientation (see Note 5). There are several
bioinformatics tools available to identify the DNA sequence for
efficient silencing [7]. In the present study we took PDS as our
GOI. TRV1, TRV2 and TRV2-PDS clones used in the experiment
are developed by Prof. S P Dinesh Kumar’s group and obtained
from the Arabidopsis Biological Resource Center (ABRC) [4].
3.2 Transformation 1. Streak inocula of A. tumefaciens strain GV3101 from glycerol

of Recombinant VIGS stock on LB agar plate containing rifampicin (30 μg/mL) and
Vector into Competent incubate the plate at 28 C for 36 h.
A. tumefaciens Strain 2. Pick a single colony with a sterilized toothpick and inoculate in
GV3110 2 mL LB liquid medium (described in Subheading 2.1.1,
item 1) containing rifampicin (30 μg/mL) and incubate in a
3.2.1 Preparation
shaker at the speed of 220 rpm at 28 C.
of Competent
A. tumefaciens Cells 3. Add 1% of full-grown primary culture to 50 mL LB (liquid)
(Chemical CaCl2 Method) containing rifampicin (30 μg/mL) and incubate at 28 C with a
constant shaking at 220 rpm for ~5 h till O.D600 of the sec-
ondary culture reaches 0.6.
4. Keep the culture in ice for 5 min and spin the chilled culture at
4 C for 5 min with a speed of 4000 g to pelletize the cells.
5. Resuspend the pellet in 10 mL of ice-cold 0.15 M NaCl solu-
tion and incubate in ice water for 15 min.
6. Centrifuge the resuspended solution at 5500 g for 5 min at
4 C.
7. Discard the supernatant and dissolve the pellet with 1 mL
ice-cold 20 mM CaCl2.
8. Aliquot 100 μL of the resuspended solution in each sterilized
micro centrifuge tube (MCT) and freeze the tubes in liquid
nitrogen for 5 min.
9. Now the A. tumefaciens cells are chemically competent and can
be stored at 80 C till further use.
3.2.2 Transformation 1. Takeout the MCTs containing competent cells from 80 C
of Recombinant TRV Clones and keep them in ice to thaw for ~1 h.
in Agrobacterium 2. Add plasmid DNA (1 μg) of TRV1, TRV2, TRV2-GOI
(denoted as pTRV1, pTRV2, pTRV2-GOI respectively) in three
separate MCTs containing competent cells and incubate in ice
for 30 min.
3. After incubation in ice, put the MCTs in liquid nitrogen and
hold for exactly 1 min.
4. Quickly place the MCTs in an incubator set at 37 C and keep
for 1–2 min.
5. Transfer the MCTs in ice and incubate for 5 min.
6. Add 0.5–1 mL LB liquid media (without antibiotic selection
pressure) in each MCT separately and incubate in a shaker at
220 rpm, 28 C for 5–6 h.
7. Spread 200 μL of each grown culture on separate LB agar plate
having rifampicin (30 μg/mL) and kanamycin (50 μg/mL)
with the help of sterilized glass spreaders.
8. Keep the plates in an incubator at 28 C for 36 h.
9. Select a few distinct single colonies and setup colony PCR for
confirmation of the clones using specific sets of primers.
10. After completion of screening, put primary cultures of the
confirmed clones (using 2 mL LB liquid media having rifampi-
cin and kanamycin) and prepare glycerol stock to store at
80 C.
3.3 Agroinfiltration 1. Maintain the following conditions for optimum growth of

in Tomato Plants tomato plants:Temperature: 22 C; Humidity: 80%; 16 h
light and 8 h dark.
3.3.1 Making Tomato
Plants Ready for Infiltration 2. Sow sterilized tomato seeds on a bigger pot containing ster-
ilized soilrite.
3. After 6 days of seed sowing, seedlings will emerge and 12 days
post sowing of seeds tomato seedlings will be ready for trans-
ferring into smaller individual pots.
4. When the acclimatized plants are of 2–3 leaves stage, they are
ready for agroinfiltration (see Note 3).
5. On the day of infiltration pour sufficient amount of water on
trays to ensure plants maintain sufficient water balance (where
the pots harboring tomato plants are kept) and keep the plants
in dark for 1 h before agroinfiltration.
3.3.2 Preparation 1. Take out the concerned A. tumefaciens glycerol stocks (pTRV1,
of Agroinoculum pTRV2, pTRV2-GOI) from 80 C and thaw in ice for 30 min to
for Infiltration 1 h.
2. Take a small amount of inocula from concerned glycerol stocks
and streak them on separate LB agar plates containing rifampi-
cin (30 μg/mL) and kanamycin (50 μg/mL) with the help of
sterilized inoculation loops. Incubate the streaked plates at
28 C for 36 h.
3. Scratch a single colony with a sterilized toothpick/inoculating
needle and inoculate in rifampicin (30 μg/mL) and kanamycin
(50 μg/mL) containing 2 mL liquid medium (LB) and incu-
bate it in a shaker shaking at the speed of 220 rpm at 28 C. Do
separately for three different constructs.
4. Add 1% of full-grown primary culture to 100 mL LB (liquid)
having rifampicin (30 μg/mL), kanamycin (50 μg/mL),
20 μM acetosyringone and incubate at 28 C with a constant
shaking at 220 rpm for 16 h (see Note 6).
5. Centrifuge the well grown secondary cultures at 2800 g for
5 min (room temperature) to pellet down the cells.
6. Prepare Infiltration buffer (described in Subheading 2.2.2,
item 2) and fix the pH of the buffer around 5.8.
7. Dissolve the pellets with the infiltration buffer and measure the
O.D. for each construct at 600 nm using spectrophotometer.
Calculate and adjust the final O.D600 around 1 by adding
appropriate volume of infiltration buffer to it.
8. Mix the resuspended agroinoculum of pTRV1 and pTRV2 in 1:1
(v/v) ratio. Do the same for pTRV1 and pTRV2-GOI.
9. Incubate the mixed suspensions in a shaker at 150 rpm, 28 C
for 30 min.
3.3.3 Agroinfiltration 1. Choose healthy tomato plants of similar growth stage and keep
of Tomato Plants at least a set of 5 plants for a single combination of respective
constructs.
2. Hold a leaf very gently and infiltrate the prepared suspension of
A. tumefaciens cells at abaxial surface of the leaf with the help of
needle less syringes (see Notes 7 and 8). Try to ensure mini-
mum mechanical injury to the leaves while infiltrating. Infil-
trate 0.5 mL in a single leaf and use at least two leaves per plant.
3. Keep the infiltrated plants back to growth chamber maintain-
ing a proper distance between two plants (see Note 9).
3.4 Confirmation Silencing of genes involved in plant growth and development will
of Gene Silencing mark differences on plant phenotype with progression of silencing
as compared to control plants which can be noticed by naked eyes
3.4.1 Phenotyping
and data can be recorded over a period of time. Appearance of white
patches on leaves indicates the onset of PDS silencing in tomato
(Fig. 1) (see Notes 10 and 11).
3.4.2 Validation of Gene Collect the newly emerged leaves of infiltrated tomato plants
Silencing (~100 mg) in labeled MCTs and freeze the collected leaf tissues
in liquid nitrogen immediately.
Collection of Leaf Samples
RNA Isolation 1. Add 1 mL Tri-reagent in each MCT and grind the samples
properly using micro-pestles. Keep the grinded samples on ice.
2. Mix it well after adding 250 μL of chloroform and keep the
samples in room temperature for 10 min without mixing.
3. Centrifuge at 10,000 g for 15 min (room temperature) and
transfer the supernatant to a fresh MCT (see Note 12).
4. Add 0.7 volume of isopropanol and keep in ice for 20 min to
precipitate RNA.
5. Spin at 10,000 g for 15 min at 4 C.
6. After removing the supernatant, add 70% ethanol as washing
agent and centrifuge at 8000 g for 5–10 min (at 4 C).
7. Repeat the step 6 for 2–3 times for better washing to obtain
pure RNA.
8. Discard the ethanol and keep the carefully covered MCT at

room temperature for 30 min for complete evaporation of
ethanol. RNA should be completely dried.
9. Add 30 μL of DEPC treated water to each MCT and allow
RNA to dissolve in it.
10. Quantify isolated RNA by taking Nanodrop reading.
11. Check the quality of isolated RNA by setting up a 1.2% agarose
gel electrophoresis prepared using 1 MOPS buffer (described
in Subheading 2.3.2, item 5). If the quality of RNA is found to
be good, then proceed for cDNA synthesis (see Note 13).
cDNA Synthesis 1. Take 10 μg of RNA and incubate at 37 C for 30 min after

DNase treatment (add DEPC treated autoclaved double dis-
tilled water to makeup the final volume to 20 μL).
2. Add 5 μL EDTA (25 mM, pH 8.0) and then incubate at 72 C
for 10 min to inactivate DNase.
3. Take 1 μg of DNase treated RNA and add 1 μL of Oligo dT and
5.5 μL DEPC treated water with it.
4. Heat the mixture at 72 C for 10 min to denature secondary
structures of RNA.
5. Snap chill the mixture on ice for 10 min.
6. Mix 4 μL of 5 RT buffer, 2 μL of 10 mM dNTPs, 2 μL of
25 mM MgCl2, 1 μL of 200 U RT enzyme and 0.5 μL ribo-
block inhibitor and incubate the mixture at 42 C for 1 h.
7. Incubate it again at 70 C for 10 min to inactivate the RT
enzyme. Now the synthesized first strand cDNA can be used
for performing semiquantitative RT-PCR (sqRT-PCR).
sqRT-PCR 1. Take 2 μL of cDNA for each 25 μL PCR reaction mixture.

2. Set the following program (example of PDS amplification is
cited here) on the thermal cycler and perform PCR using GOI
specific primers.
(a) 94 C for 4 min
(b) 94 C for 30 s
(c) 60 C for 30 s 23 cycles (see Note 14)
(d) 72 C for 30 s
(e) 72 C for 10 min.
3. Load the PCR products on 0.8% agarose gel and perform
electrophoresis at 80 Volts for 30 min. Visualize the EtBR
stained bands using UV light in a gel documentation system
(see Note 15).
4. Set up another PCR to amplify Actin (similarly like PDS) for

each concerned sample using Actin specific primers. Expression
of this house keeping gene can be treated as an internal control.
Then follow step 3 (of 3.4.2.4).
5. To detect TRV transcripts, perform a PCR (similarly like PDS)
for each concerned sample using the viral coat protein (CP)
specific primers. The PCR running program is as follows:
(a) 94 C for 4 min
(b) 94 C for 30 s
(c) 61 C for 30 s 27 cycles
(d) 72 C for 45 s
(e) 72 C for 10 min.
3.4.3 Measuring 1. Dilute the synthesized cDNA five times with sterilized double
the Efficiency of Gene distilled water and take 2 μL of diluted cDNA as template for
Silencing Via Quantitative qRT-PCR.
Real Time RT-PCR 2. Prepare a 10 μL reaction mixture by adding 5 μL of 2 SYBR
(qRT-PCR) Green master mix, 0.1 μL of 10 μM forward primer, 0.1 μL of
10 μM reverse primer (gene specific real time PCR primer) and
2.8 μL sterilized double distilled water with 2 μL of diluted
cDNA for each replicate of every sample (see Note 16).
3. Use a 48 well plate to accommodate all biological and technical
triplicates of each sample at a time and apply adhesive film to
seal the plate.
4. Perform qRT-PCR on an Eco-real time PCR cycler following
the below mentioned program:
(a) 50 C for 2 min
(b) 95 C for 10 min
(c) 95 C for 10 s
(d) 57 C for 30 s 40 Cycles
(e) 72 C for 20 s
(f) 95 C for 15 s
(g) 55 C for 15 s
(h) 95 C for 15 s.
5. Set up another qPCR reaction of the same samples (used in
step 2) using real time PCR primers of Actin to quantify the
transcript level of the internal control.
6. After getting the Ct value (from qPCR mentioned in step 4),
normalize it with Ct value of Actin (obtained from qPCR
mentioned in step 5) and calculate 2–ΔΔCt value for each
sample [8].
7. Calculate the efficiency of gene silencing by comparing the

transcripts level of the target gene between silenced and
non-silenced samples (Table 1).
4 Notes
1. MOPS buffer and rifampicin antibiotic are light sensitive.

Hence, keep MOPS buffer in a dark colored glass bottle or
wrap the bottle with aluminum foil. Use the same to cover
rifampicin containing LB agar plates.
2. As both EtBr and DEPC are potential carcinogenic com-
pounds, handle these with extreme care (using gloves, restrict-
ing inhalation of fumes).
3. For syringe infiltration we have to be cautious enough for
infiltrating tomato plants at proper stage (2–3 leaf stage).
VIGS does not work well for older plants in case of tomato.
Ensure plants get appropriate nutrient throughout the life cycle
to maintain good health.
4. As SYBR Green is light sensitive, deal with it at low light
intensity area.
5. If taking a stretch of CDS leads to off-target silencing, we can
use a stretch of 3’ UTR to minimize it.
6. Overgrowth of A. tumefaciens cells in secondary culture may
hamper the silencing efficiency due to increased load of dead
cells.
7. Change the gloves after each infiltration and before using the
next combination of constructs to prevent cross
contamination.
8. While infiltrating a plant, the culture may leak and come in
contact with another plant which may lead to cross contamina-
tion. Therefore, you need to be cautious while infiltrating
plants and keep two nearby pots away from each other.
9. As TRV is a sap transmissible RNA virus, a slight rubbing of
two leaves of two different plants can transfer TRV from one to
another. Hence arrange infiltrated plants in trays accordingly.
10. Silencing of a gene may facilitate TRV propagation (if the gene
of interest is a resistance factor for TRV) and can intensify viral
symptoms which may mislead the observer to assume the role
of the particular gene in plant growth and development. To
avoid such cases, you should always compare the TRV tran-
scripts level between the silenced and non-silenced plants.
11. Do not forget to sterilize all materials contaminated with
TRV before discarding.
12. Chloroform treatment step can be repeated more than once to

reduce impurity.
13. Distinct bands of rRNAs indicate good quality of RNA.
14. Calibrate the cycle number at which distinct visible difference
in band intensity can be witnessed between silenced and con-
trol samples. To accomplish this, set PCR with 17, 19, 21, 23,
25 cycles and observe the differential band intensities in
each case.
15. You can measure the efficiency of gene silencing by quantifying
comparative band intensities between silenced and
non-silenced plant samples. In this case, you have to consider
internal control while calculating the efficiency.
16. Errorless pipetting is the key for having flawless qRT-PCR data.
A small error in pipetting might result in significant difference
in final values.
Acknowledgments
This study was supported by a grant from the Department of

Biotechnology, Ministry of Science and Technology, Govt. of
India vide grant no. BT/PR31648/GET/119/283/2019.
References
1. Sahu PP, Puranik S, Khan M, Prasad M (2012) 5. Senthil-Kumar M, Mysore KS (2011) Virus-
Recent advances in tomato functional genomics: induced gene silencing can persist for more
utilization of VIGS. Protoplasma 249(4): than 2 years and also be transmitted to prog-
1017–1027. https://doi.org/10.1007/ eny seedlings in Nicotiana benthamiana and
s00709-012-0421-7 tomato. Plant Biotechnol J 9(7):797–806.
2. Senthil-Kumar M, Mysore KS (2011) New https://doi.org/10.1111/j.1467-7652.2011.
dimensions for VIGS in plant functional geno- 00589.x
mics. Trends Plant Sci 16(12):656–665. 6. Liu Y, Schiff M, Dinesh-Kumar SP (2002)
https://doi.org/10.1016/j.tplants.2011. Virus-induced gene silencing in tomato. Plant J
08.006 31(6):777–786. https://doi.org/10.1046/j.
3. Becker A, Lange M (2010) VIGS – genomics 1365-313X.2002.01394.x
goes functional. Trends Plant Sci 15(1):1–4. 7. Senthil-Kumar M, Mysore KS (2014) Tobacco
https://doi.org/10.1016/j.tplants.2009. rattle virus–based virus-induced gene silencing
09.002 in Nicotiana benthamiana. Nat Protoc 9(7):
4. Liu Y, Schiff M, Marathe R, Dinesh-Kumar SP 1549–1562. https://doi.org/10.1038/nprot.
(2002) Tobacco Rar1, EDS1 and NPR1/NIM1 2014.092
like genes are required for N-mediated resistance 8. Schmittgen TD, Livak KJ (2008) Analyzing real-
to tobacco mosaic virus. Plant J 30(4):415–429. time PCR data by the comparative CT method.
https://doi.org/10.1046/j.1365-313X.2002. Nat Protoc 3(6):1101–1108. https://doi.org/
01297.x 10.1038/nprot.2008.73
Chapter 10
Virus-Induced Gene Silencing for Functional Genomics

of Specialized Metabolism in Medicinal Plants
Dikki Pedenla Bomzan, Krishna Kumar, Sarma Rajeev Kumar,
Seema Meena, and Dinesh A. Nagegowda
Abstract
Virus-induced gene silencing (VIGS) is a functional genomics tool to transiently downregulate the expres-
sion of target gene(s) by exploiting the plant’s innate defense mechanism against invading RNA viruses.
VIGS is a rapid and efficient approach to analyze the gene function, particularly, in the plants that are not
amenable to stable genetic transformation. This strategy has been successfully used to decipher the function
of several genes and transcription factors involved in the biosynthesis of specialized metabolites and
regulation of specialized metabolism, respectively, in different medicinal and aromatic plants. Here, we
describe a detailed Tobacco rattle virus (TRV)-mediated VIGS protocol for silencing of the gene encoding
Phytoene desaturase (PDS) in important medicinal plants Catharanthus roseus, Calotropis gigantean, Rau-
wolfia serpentina, and Ocimum basilicum. Our methods allow the study of gene function within 3–4 weeks
after agro-inoculation, and can be an easy and efficient approach for future studies on understanding of the
biosynthesis of specialized metabolites in these important medicinal plants.
Key words Calotropis gigantea, Catharanthus roseus, Functional Genomics, Monoterpene indole
alkaloids, Ocimum basilicum, Phytoene desaturase, pTRV vectors, Rauwolfia serpentina, Specialized
metabolism, Virus-induced gene silencing
1 Introduction
Virus-induced gene silencing (VIGS) is a multifaceted functional

genomics tool for analysis of gene function in plants. VIGS tech-
nology uses viral vectors carrying a target gene fragment to produce
double-stranded (dsRNA) that trigger RNA-mediated gene silenc-
ing [1]. VIGS provides a rapid and quick means to analyze the
functions of candidate genes and further facilitates a way to link
genotype to phenotype and thereby connecting the missing steps in
biosynthetic events in a metabolic pathway. Availability of genomic
and transcriptomic resources through next-generation sequencing
is a boon for many of the VIGS strategies to decipher gene func-
tions. VIGS exploits the innate RNA-mediated defense mechanism
147
148 Dikki Pedenla Bomzan et al.
in plants to knock down or downregulate the expression of target

gene transiently [1]. The modified viral genome carrying a part of
the target gene (to be silenced) in appropriate viral vector is deliv-
ered into the plants. Once inside the host cell, transgenic RNA is
initially transcribed and subsequently replicated by an endogenous
RNA-dependent RNA polymerase (RdRP). This process results in
generation of dsRNA molecules triggering post transcriptional
gene silencing (PTGS). These dsRNAs are recognized by DICER
enzyme, which degrades the dsRNA into short interfering RNA
(siRNA) of 21–25 nucleotide length. The double-stranded siRNAs
are recognized by RNA-induced silencing complex (RISC) and
converted to single-stranded siRNAs [2]. The RISC complex with
siRNA targets specific endogenous mRNA having sequence homol-
ogy leading to transient gene silencing. The sequence-specific
siRNA signal will be further amplified and transported to other
parts of the plant leading to a systematic acquired silencing
[3]. Agrobacterium tumefaciens harboring different vectors
employed for VIGS are introduced into plants through a process
called agro-inoculation [4, 5]. Direct inoculation using tooth pick
or needle, leaf infiltration (with a needleless syringe), agro-
drenching, or vacuum infiltration are the commonly used methods
for delivering VIGS vectors to host plants [1, 6–9]. So far, VIGS has
been adopted for functional genomics in several medicinal and
aromatic plants [10–19].
Plants produce an enormous variety of metabolites that are
either essential (primary metabolites) or non-vital (specialized
metabolites) for the central processes of growth and development.
Plant specialized metabolites are natural products that have no
obvious role in growth and development, but provide overall fitness
to the plant [20]. Specialized metabolites thus produced by plants
for their defence have immense value to humans. Medicinal and
aromatic plants are important sources of high value pharmaceuti-
cally important specialized metabolites such as alkaloids, terpe-
noids, glycosides, saponins, tannins, and essential oils. Plants
belonging to Apocyanaceae family have been known for their
medicinal importance due to the presence of many specialized
metabolites including the well-known monoterpene indole alka-
loids (MIAs). For instance, C. roseus (Madagascar periwinkle) is
an important medicinal plant producing more than 130 MIAs
including pharmacologically important alkaloids like vincristine,
vinblastine, ajmalicine and serpentine [21, 22]. While ajmalicine
and serpentine are used for the treatment of hypertension and
cardiovascular diseases, the dimeric alkaloids vincristine and vin-
blastine are well-known anti-neoplatic agents. Similarly, Rauwolfia
serpentina (Sarpagandha) is distinguished by the presence several
alkaloids including reserpine, ajmaline, ajmalicine, serpentine, and
yohimbine [23]. These alkaloids are accumulated mainly in roots,
which contribute to the plant’s medicinal properties. The active
Virus-Induced Gene Silencing for Functional Genomics of Specialized. . . 149
components from R. serpentina are integral ingredients in drugs

used for the treatment of hypertension and mental illness. Another
important plant of Apocynaceae family, Calotropis gigantea (Giant
milkweed) produces specialized metabolites known as cardenolides,
which have anticancer and antimalarial properties. These cardeno-
lides or cardiac glycosides such as calactin, calotoxin, calotropin,
frugoside, and gofruside belong to C23 steroids with a butenolide
ring at C-17 [24]. The genus Ocimum of Lamiaceae family is a rich
reservoir and well known for its ethnobotanical, medicinal and
aromatic properties, which are due to the presence of several phy-
tochemicals including phenylpropanoids and terpenoids
[25, 26]. The specialized metabolites in these plants are produced
and accumulated through multi-step biosynthetic pathways involv-
ing several genes, regulators, and transporters. The pharmacologi-
cally and commercially important specialized metabolites in these
plants are produced in low amounts. Hence, a thorough under-
standing of the biosynthesis and regulation will facilitate the meta-
bolic engineering or synthetic biology for overproduction of the
important specialized metabolites produced by these medicinal
plants. Though efforts have been made, still a lot needs to be
investigated for a complete understanding of the biosynthesis and
regulation of specialized metabolites in these plants. Since, all
medicinal plants including the above plants are highly recalcitrant
and not amenable to stable genetic transformation, an alternate
method such as VIGS is very much essential for in planta gene
function studies.
In this chapter, we describe Tobacco rattle virus (TRV)-
mediated VIGS method in plants of Apocynaceae family such as
C. roseus, R. serpentina, and C. gigantea, and in Ocimum basilicum
(sweet basil) of Lamiaceae family. We have used PDS gene for
establishing the method in all cases and demonstrated the silencing.
The same approach can be utilized to study any other target gene
(s) in these plants.
2 Materials
2.1 PCR 1. Sterile microcentrifuge tubes and pipette tips.

Amplification 2. Pipettes of different volumes.
and Cloning
3. TRIzol for RNA isolation (Thermo Scientific™, USA). RNa-
seZAP (Sigma-Aldrich, USA).
4. Biospectrophotometer (e.g., Eppendorf BioSpectrophot-
ometer kinetic, Germany).
5. Thermal cycler.
6. cDNA synthesis kit (Applied Biosystems, USA).
7. High-Fidelity Taq DNA polymerase and dNTPs.
8. Gene-specific oligonucleotide primers.

9. Electrophoresis unit, 50 TAE buffer stock: For 100 mL, add
24.2 g of Tris base to 5.7 mL glacial acetic acid and 10 mL
EDTA (0.5 M; pH 8.0). Make up the volume to 100 mL using
distilled water.
10. Agarose.
11. Gel purification kit (Thermo Scientific™).
12. PCR cloning kit (Thermo Scientific™).
13. pTRV1 and pTRV2 plasmids (available in ABRC, The Ohio
State University, USA).
14. Restriction enzymes.
15. T4 DNA ligase and its buffer.
2.2 Transformation 1. Sterile microcentrifuge tubes, tips, 50 mL and 15 mL centri-

of Cloned Constructs fuge tubes, and toothpicks.
2. Escherichia coli (XL1-Blue) and A. tumefaciens (GV3101)
competent cells.
3. Plasmid isolation reagents and buffers:
(a) Solution A: 50 mM Tris–HCl, pH 8.0 and 10 mM EDTA.
(b) Solution B: 0.2 NaOH and 1% SDS.
(c) Solution C: 3 M Potassium acetate.
4. Plasmid isolation kit (e.g., GeneJET plasmid miniprep kit
Thermo Scientific™, USA).
5. Restriction enzymes.
6. 50 mM calcium chloride (CaCl2).
7. 20 mM calcium chloride (CaCl2).
8. YEP (Yeast Extract Peptone) media: Add 10 g of yeast extract,
10 g of peptone and 5 g of sodium chloride (NaCl) into 1 L of
distilled water. Fifteen grams of agar should be added for solid
media. Sterilize the media by autoclaving at 121 C with 15 psi
for 15 min.
9. Antibiotic stocks: Make stock solutions of 100 mg/mL ampi-
cillin, 50 mg/mL kanamycin, and 50 mg/mL gentamicin in
molecular biology grade water. Prepare stock solutions of
60 mg/mL rifampicin in Dimethyl sulfoxide (DMSO). Filter
sterilize the stock solutions using cellulose acetate filter
(0.2 μm) and store as aliquots in 20 C.
10. PCR Master Mix (e.g., EmeraldAmp GT PCR Master Mix,
Takara, Japan).
11. Liquid nitrogen.
12. Laminar air flow chamber.
13. Refrigerated centrifuge.

14. Refrigerated incubator shaker.
15. Water bath set at 37 C.
2.3 Growing 1. Seeds of C. roseus, R. serpentina, C. gigantea, and O. basilicum.

of Plants 2. Plastic trays.
3. Sterilized soil, soilrite (Keltech Energies Limited, Bangalore,
India), and vermicompost (University of Agricultural Sciences,
Bangalore, India).
4. Plant growth chamber maintained at 22 C, 80% humidity, and
diurnal cycle of 16 h light and 8 h dark.
2.4 Agroinfiltration 1. A. tumefaciens harboring pTRV1 vector (Fig. 1).

2. A. tumefaciens harboring pTRV2 vector (Fig. 1).
3. A. tumefaciens harboring pTRV2 derivatives. In this case
pTRV2::CrPDS, pTRV2::RsPDS, pTRV2::CgPDS and
pTRV2::ObPDS (Fig. 1).
4. Sterile 50 mL centrifuge tubes and microcentrifuge tubes.
5. Refrigerated centrifuge.
Fig. 1 Vector maps of pTRV1, pTRV2, and pTRV2::GOI. Abbreviations: GOI, gene of interest.; 2X35S, CaMV 35S
promoter from pCASS2; LB, Left border, T-DNA repeat; RB, Right border T-DNA repeat; NOSt, NOS terminator;
RdRp, RNA-dependent RNA polymerase; 16 K, 16-kDa cysteine rich protein; MP, movement protein; CP, coat
protein; Rz, self-cleaving ribozyme; MCS, multiple cloning sites
6. Infiltration buffer: 10 mM MgCl2, 10 mM MES and 200 mM

acetosyringone. Adjust the pH of the solution to 5.6 using
NaOH. Finally make up the volume of the buffer to 1 L.
Weigh 0.952 g of MgCl2 and 1.95 g of MES and add both
components into 950 mL sterile distilled water. To this, add
1 mL of 200 mM acetosyringone prepared in DMSO. Adjust
the pH of the solution to 5.6 using NaOH. Finally make up the
volume of the buffer to 1 L.
7. Refrigerated incubator shaker.
8. Dissecting needle, and 10 mL syringe.
9. Two to three weeks old two- to four-leaf staged healthy plants
in pots.
10. Plastic trays.
11. Cling wrap.
2.5 Evaluation 1. Autoclaved tips, microcentrifuge tubes, mortar and pestle.

of VIGS 2. RNA isolation reagent (e.g., TRIzol™ Reagent, Thermo
Scientific™, USA).
3. Biospectrophotometer (e.g., Eppendorf BioSpectrophot-
ometer kinetic, Germany).
4. High capacity cDNA reverse transcription kit (Thermo
Scientific™).
5. Thermal cycler.
6. SYBR™ Green PCR master mix (Thermo Scientific™).
7. Fast optical 48-well reaction plate and optical adhesive film kit
for qRT-PCR (Applied Biosystems®. USA).
8. Real-time specific primers.
3 Methods
3.1 Cloning the Gene 1. Isolate total RNA from 50–100 mg leaf tissues (fresh or frozen
of Interest (GOI) into in liquid nitrogen) of C. roseus, R. serpentina, C. gigantea, and
pTRV2 Vector O. basilicum using TRIzol reagent following the manufac-
turer’s instructions (see Note 1).
2. Check the quality of RNA using Biospectrophotometer. The
optimum A260/280 ratio should be 1.9–2.1.
3. Take 2 μg of RNA, and synthesize the cDNA using the reverse
transcription kit as per manufacturer’s instructions.
4. PCR amplify the short fragment of cDNA using cDNA tem-
plate, gene-specific primers, and High-Fidelity Platinum Taq
polymerase (Fig. 2a) (see Note 2).
Fig. 2 Schematic workflow of TRV-mediated silencing of Phytoene desaturase (PDS) in different medicinal
plants. (a and b) Fragment of gene of interest (GOI, PDS in this case) is PCR-amplified and cloned into multiple
cloning site (MCS) of pTRV2 vector and the resulting construct is transformed into A. tumefaciens GV3101. (c)
A. tumefaciens strains individually harboring pTRV1 and pTRV2::PDS with final O.D. 600 adjusted to 1.6 are
grown independently. The cultures are mixed in 1:1 ratio prior to infiltration. Three delivery methods for
agroinfiltration by (d) pricking the plant below apical meristem with a dissecting needle dipped in A.
tumefaciens; (e) by syringe infiltration using a needleless syringe; (f) by dissecting at a cotyledonary stage
with a dissecting needle dipped in A. tumefaciens. Silencing phenotype (photo bleaching due to PDS silencing;
red arrows) is observed 30 days after agroinfiltration
5. Run the PCR product in 1% agarose gel and confirm the

product size under the UV transilluminator and excise the
amplified band of GOI (see Note 3).
6. Purify the PCR product using gel purification kit as per the
manufacturer’s guidelines.
7. Run the gel-purified elute on 1% agarose gel and quantify the
same using spectrophotometer.
8. Clone the GOI (PDS) into the PCR cloning vector as per the
manufacturer’s guidelines.
9. Transform the ligation reaction into chemically-competent

E. coli (XL1-Blue) cells and plate them on LB agar containing
ampicillin (100 μg/mL). Incubate the plate overnight at 37 C
(see Note 4).
10. Perform colony PCR with gene-specific primers to check for
the positive transformants using PCR Master Mix.
11. Inoculate the positive transformants in 5 mL LB broth contain-
ing 100 μg/mL ampicillin and let it grow overnight at 37 C,
200 rpm in an incubator shaker.
12. Isolate the plasmid from the overnight grown culture by alka-
line lysis method or using plasmid isolation kit.
13. Confirm the recombinant plasmid DNA through restriction
digestion using specific restriction enzymes and analyze the
digestion products by agarose gel electrophoresis (see Note 5).
14. Once the plasmid is confirmed, scale up the digestion volume
(50 μL) to get good quantity of the digested product. Excise
and purify the digested product using gel purification kit.
15. For subcloning the GOI into pTRV2 vector, set up ligation
reaction in 10 μL using 3:1 ratio of purified restriction digested
fragment and linearized pTRV2 vector along with 1 μL of T4
DNA ligase (1 U/μL), 1 μL 10X ligation buffer, and molecular
biology grade water. Incubate the ligation reaction at 16 C for
12 h and then transform into E. coli XL1-Blue competent cells
(Fig. 2a) (see Note 6).
16. Screen the recombinant clones by performing colony PCR
with gene-specific primers and PCR master mix. Select the
colonies that gives amplification corresponding to the expected
size of GOI and inoculate in 5 mL LB broth with kanamycin
for plasmid isolation.
17. Isolate the plasmid following the alkaline lysis method or plas-
mid isolation kit. Confirm the presence of the plasmid in the
mini prep by running the DNA in 1% agarose gel and quantify
it by spectrophotometry.
18. Set up the digestion using appropriate restriction enzymes to
confirm the VIGS construct.
19. Prepare glycerol stocks of the positive colony with the over-
night grown culture using sterile glycerol solution to get a final
concentration of 20% glycerol. Flash-freeze the stocks in liquid
nitrogen and store at 80 C.
3.2 Transformation 1. Streak YEP agar plate, supplemented with rifampicin (60 mg/
of Recombinant VIGS L) and gentamicin (50 mg/L) antibiotic, with a small loop of
Vector into A. tumefaciens strain GV3101 and incubate at 28 C for 2 days
A. tumefaciens (see Note 4).
(GV3101) 2. Inoculate a single colony from the streaked plate into 5 mL of
Competent Cells YEP broth containing rifampicin (60 mg/L) and gentamicin
(50 mg/L) and incubate the culture overnight in an incubator
3.2.1 Preparation
shaker at 28 C at 200 rpm (see Note 4).
of A. tumefaciens
Competent Cells 3. Take 5 μL of the overnight grown culture and add to 250 mL
Erlenmeyer flask containing 50 mL of YEP broth, substituted
with antibiotics rifampicin (60 mg/L) and gentamicin
(50 mg/L). Allow the cells to grow overnight (15–16 h) at
28 C at 100 rpm so as to obtain the culture OD600 of 0.3–0.4
(see Note 7).
4. Harvest the cells at 2800 g for 5 min in a refrigerated
centrifuge maintained at 4 C. Remove the tubes gently from
the centrifuge and discard the supernatant to avoid the loss of
the bacterial pellet.
5. Wash the bacterial pellet by adding autoclaved YEP and centri-
fuge at 2800 g for 5 min at 4 C. Discard the media gently
and repeat the washing step.
6. After the second wash, add 1 mL of ice cold 20 mM CaCl2 and
resuspend the pellet by tapping gently. Incubate the suspension
on ice for 10 min.
7. Aliquot 100 μL of competent cells into pre-chilled microcen-
trifuge tubes. Snap-freeze the microfuge tubes containing
competent cells using liquid nitrogen and store it in 80 C
until further use (see Note 8).
3.2.2 Transformation 1. Thaw the aliquoted tube containing A. tumefaciens strain

of pTRV Plasmids GV3101 competent cells on ice, and add 2.5 μg of plasmid
and pTRV-Derived DNA (pTRV1 or pTRV2 or pTRV2::PDS). Tap gently to mix
Constructs into the DNA with cells and incubate the tube on ice for 20–30 min
A. tumefaciens (Fig. 2b).
2. After 30 min on ice, freeze the microfuge tube containing
mixture of plasmid DNA and competent cells in liquid nitrogen
for 2 min and thaw immediately at 37 C in a water bath.
Repeat this freeze-thaw step three times.
3. Add 400 μL of YEP to the microcentrifuge tube in the laminar
hood and incubate the tube in an incubator shaker maintained
at 28 C with 100 rpm for 2–3 h for optimal growth of the
culture (see Note 7).
4. Take 200 μL of the solution and plate it on YEP agar medium
containing rifampicin (60 mg/L), gentamicin (50 mg/L), and
kanamycin (50 mg/L) antibiotic selection. Keep the plate at

28 C for 2–3 days until transformed colonies appear (see
Note 4).
5. Screen the transformants by colony PCR using gene-specific
primers and make glycerol stocks (20% glycerol) of the positive
transformants. Flash-freeze the stocks in liquid nitrogen and
store in 80 C freezer until use (Fig. 2b).
3.3 Virus-Induced 1. Sow the seeds by casting method in a seedbed containing sterile
Gene Silencing soilrite, soil, and vermicompost in the ratio of 1:1:1. Allow the
seeds to geminate in a glass house condition (see Note 9).
3.3.1 Seed Germination
and Preparation of Plant 2. When the seedlings reach two- to four-leaf stage, transplant
Material for VIGS them into individual pots containing the same composition of
soilrite, soil and vermicompost (1:1:1). Take care not to dam-
age the leaves and roots during transplantation (see Note 10).
3. After two to three weeks of transplantation, plants of two
(cotyledonary) or four- to six-leaf stage can be used for agroin-
filtration to silence specific target gene(s) or GOI.
3.3.2 Preparation 1. For primary culture, inoculate a small scoop of frozen glycerol
of A. tumefaciens stock of A. tumefaciens harboring pTRV2-derived construct /
Suspension for Inoculation pTRV1 / pTRV2 into 5 mL of YEP broth supplemented with
rifampicin (60 mg/L), gentamicin (50 mg/L) and kanamycin
(50 mg/L). Grow the culture overnight at 200 rpm in an
incubator shaker maintained at 28 C (see Note 4).
2. For secondary inoculum, take 500 μl of the primary culture and
add to 50 mL YEP broth containing antibiotics rifampicin
(60 mg/L), gentamicin (50 mg/L), kanamycin (50 mg/L),
and 200 μM acetosyringone. Allow the cells to grow overnight
in an incubator shaker maintained at 28 C and 200 rpm (see
Note 11).
3. Harvest the overnight grown A. tumefaciens (secondary cul-
ture) at 2800 g in a refrigerated centrifuge maintained at
4 C. Discard the supernatant immediately.
4. Resuspend the bacterial pellet in the infiltration buffer and set
the OD600 to ~1.6. Incubate A. tumefaciens suspension at
28 C for 3–4 h with continuous shaking at 200 rpm as it
helps in the induction of vir genes (see Note 12).
3.3.3 Agroinfiltration 1. Take well acclimatized cotyledonary or four- to six-leaf staged

of C. roseus, R. serpentina, plants potted in an individual pot (see Note 13).
C. gigantea, 2. Mix the A. tumefaciens cultures containing pTRV1 and
and O. basilicum pTRV2-derivatives (pTRV2::PDS in this case) in 1:1 ratio.
For control experiment, use A. tumefaciens cultures containing
pTRV1 and pTRV2 empty vectors (Fig. 2c) (see Note 14).
3. The method of infiltration varies for different plants. For VIGS

in C. roseus and C. gigantea, pinch slightly below the apical
meristem of four- to six-leaf staged plant with a dissecting
needle (see Note 15). Inoculate the pricked plants with the
A. tumefaciens culture drops using the dissecting needle
(Fig. 2d).
4. For R. serpentina infiltration, two- to four-leaf staged plants are
used. A. tumefaciens culture is infiltrated with a needleless
syringe at the abaxial surface of leaves (Fig. 2d) (see Note 16).
5. For O. basilicum inoculation is done at the cotyledonary stage
plants. Dissect the plant with dissecting needle just below the
apical meristem and inoculate the A. tumefaciens culture
(Fig. 2d).
6. Post-infiltration, cover the trays containing plants with cling
film and make small perforations to maintain the aeration and
humidity. To facilitate higher efficiency of agro-transformation,
keep the plants in dark for 48 h at 22 C (see Note 17).
7. After 48 h, transfer the tray containing the infected plants to
growth chamber maintained at 22 C, 70% humidity, with 16 h
light and 8 h dark cycle.
8. Characteristic phenotypic change can be observed on the sec-
ond week of infiltration in C. roseus (Fig. 3) and third week in
other plants used in this work (Fig. 4).
9. Collect the first fully expanded leaves after 21–30 days post-
infiltration (dpi) and store at 80 C for further analysis.
3.3.4 Isolation of RNA 1. Isolate total RNA from leaf tissues of C. roseus, C. gigantea,
from VIGS Leaves R. serpentina, and O. basilicum using TRIzol reagent following
for Evaluation of Gene manufacturer’s instructions.
Silencing 2. Take 50–100 mg of leaf samples (fresh or frozen in liquid
nitrogen) and homogenize with 1 mL of TRIzol. Transfer the
suspension to 1.5 mL microcentrifuge tube and incubate at
room temperature for 10 min.
3. Add 200 μL of nuclease-free chloroform and invert the tubes
gently 3–5 times until it becomes a milky suspension.
4. Incubate the samples at room temperature for 10 min and
centrifuge the lysate at 13,000 g for 10 min at 4 C in a
refrigerated microfuge.
5. Remove the tubes gently without disturbing the three layers
formed. Transfer the upper clear layer to a new tube and add
500 μL of nuclease-free isopropanol to the aqueous phase. Mix
by inverting the tubes slowly 2–3 times and incubate the tube
for 10 min at room temperature.
Fig. 3 Agroinfiltration of Catharanthus roseus leaves by pricking method leading to VIGS of PDS. Four-leaf
staged plant is pricked on the apical meristem with a dissecting needle dipped in A. tumefaciens (a–c).
Photobleached phenotype is observed on 30 dpi in third and fourth pair leaves of C. roseus (d). Different
patterns of photobleaching with varying levels of PDS silencing (e–h) in C. roseus plants. (i) A representative
pot with plants treated with pTRV2::PDS showing the efficacy of VIGS at 30 dpi
6. After incubation, centrifuge the samples at 13,000 g for

10 min in a refrigerated centrifuge maintained at 4 C. Care-
fully remove the supernatant using a micropipette without
disturbing the pellet.
7. Wash the pellet with 1 mL of 75% ethanol, vortex the sample
briefly, and then centrifuge at 2800 g for 5 min at 4 C.
Fig. 4 TRV-mediated VIGS of PDS in medicinal plants Rauwolfia serpentina, Calotropis gigantea, and Ocimum
basilicum. The upper panel shows infection symptoms like slight paleness of leaves (a), light curling of leaves
(b) and photobleaching phenotype (c) observed on 30 dpi. The lower panel displays the semiquantitative
RT-PCR analysis of PDS and endogenous control (RPS9/Actin) using cDNA prepared from total RNA extracted
from leaves showing the viral infection symptoms or photo bleaching phenotype. The expression of PDS in
each pTRV2::PDS infected medicinal plant was drastically reduced compared to the empty vector (EV) control
8. Remove the supernatant carefully using a micropipette and air

dry the RNA pellet for 10–15 min. Resuspend the pellet in
26 μL of RNase-free water (see Note 18).
9. To remove contaminating genomic DNA in RNA preparation,
add 3 μL of DNase buffer (10) and 1 μL of RNase-free
DNase I (1 U/μL) to 26 μL RNA, and incubate for 30 min
at room temperature.
10. After DNase treatment, add 1 μL of 50 mM EDTA and incu-
bate at 72 C for 1–2 min, and store the RNA at 80 C until
further use.
3.3.5 cDNA Synthesis 1. Thaw the RNA samples on ice and quantify using a
and Semi or Quantitative spectrophotometer.
Reverse Transcriptase-PCR 2. Take 2 μg of the total RNA for the synthesis of first strand
(qRT-PCR) Analysis cDNA with random hexamer primers using reverse transcrip-
tion kit as per manufacturer’s instructions.
3. Perform semi or quantitative RT-PCR using an appropriate
amount of cDNA to check the expression level of the silenced
gene. Use N227-like family protein encoding gene (N227) as
endogenous controls for C. roseus and R. serpentina. Ribosomal
protein S9 (RPS9), and Actin is used as the endogenous con-
trols for C. gigantea and O. basilicum, respectively (Fig. 4) (see
Note 19).
4 Notes
1. Use autoclaved mortar-pestle, microcentrifuge tubes, micro-

tips for isolating RNA and clean the work bench with 70%
ethanol to avoid any contamination. Perform all steps involving
centrifugation at 4 C. Use RNaseZAP to prevent degradation
of RNA.
2. In order to avoid the possibility of cross-silencing of genes
having homologous sequences, the gene sequence for VIGS
is selected from the unique coding region or preferably from 50
or 30 untranslated region (UTR) where the similarity is low.
The size of the target gene (to be silenced) can be from 250 to
500 bp. However, it is recommended to use 500 bp for higher
efficiency.
3. It is advised not to expose the amplified PCR product to UV
for long time during gel-documentation and excising the band
from the gel.
4. Plating and inoculation of bacterial culture (E. coli and
A. tumefaciens) into the media for culturing and infiltration
should be done in the laminar hood. All the media, tubes, tips,
syringes, etc., should be sterilized.
5. It is advisable to confirm the clone by nucleotide sequencing
after cloning the target gene in the cloning vector to check for
any mutation in the target gene sequence.
6. Digest 4 μg pTRV2 vector with the same restriction enzymes
that is used to digest the GOI from PCR cloning vector. Purify
the linearized vector using gel purification kit.
7. Do not exceed 100 rpm as the lower speed prevents the
proper growth of cells. The OD600 after 15–16 h is approxi-
mately 0.3–0.4.
8. It is best to use A. tumefaciens competent cells within 1 month
of preparation. Longer storage can reduce the transformation
efficiency.
9. Proper care should be taken to prevent damping off of the
seedlings and infestation.
10. Gently uproot the plants using forceps without damaging the
root and carefully transfer to the pot. Add topsoil to the pot
and sprinkle the water to maintain the moisture.
11. Use freshly prepared acetosyringone in DMSO.
12. The derived A. tumefaciens culture is resuspended in infiltra-
tion buffer to OD600 of 1.6. Lower OD600 of culture reduces
the efficiency of silencing. Infiltration buffer is made by mixing
MgCl2, MES (2-(4-morpholino)-ethane sulfonic acid), and
acetosyringone of required concentration. All the components

should be prepared freshly and pH of the buffer should be
maintained at 5.6.
13. Before infiltration, label the pots properly in order to avoid
confusion and while using two or more constructs keep the
plants in different trays to prevent cross-contamination.
14. To evaluate the specificity of VIGS and rule out the effect of
viral propagation, a parallel set of experiment should always be
performed by infecting plants with A. tumefaciens cultures
harboring pTRV1 and pTRV2 empty vectors that serve as the
control.
15. Make sure not to injure the plant during pinching as it may lead
to branching or even death of plant. It is advisable to use
separate dissecting needle when different gene constructs
are used.
16. Do not apply more pressure during infiltration by syringe as it
may damage the leaves.
17. Post-infiltration, keep the plants that are infiltrated with empty
vector and GOI in separate trays.
18. The pellet can be lost while pipetting ethanol, hence care
should be taken. Do not dry the pellet for more than 15 min.
19. After confirming the silencing of target gene(s) by RT-PCR or
qRT-PCR, metabolites can be extracted and analyzed using
GC-MS or LC-MS for determining the effect of silencing so
as to know the in planta role of the gene(s) under
investigation.
Acknowledgments
This work was supported by the Department of Biotechnology

(Govt. of India) supported project (GAP-272: BT/PR6109/
AGII/106/857/2012) to D.A.N. D.P.B is the recipient of
Research Fellowship from University Grant Commission (UGC)
and enrolled under Academy of Scientific and Innovative Research
(AcSIR). The institutional communication number for this article
is CIMAP/PUB/2020/JUN/53.
References
1. Lu R, Martin-Hernandez AM, Peart JR, 3. Kalantidis K, Schumacher HT, Alexiadis T,

Malcuit I, Baulcombe DC (2003) Virus- Helm JM (2008) RNA silencing movement in
induced gene silencing in plants. Methods 30: plants. Biol Cell 100:13–26
296–303 4. Rochester DE, Kositratana W, Beachy RN
2. Ding SW, Voinnet O (2007) Antiviral immu- (1990) Systemic movement and symptom pro-
nity directed by small RNAs. Cell 130: duction following Agroinoculation with a
413–426
single DNA of tomato yellow leaf curl Gemini 15. Liu J, Gao F, Ren J, Lu X, Ren G, Wang R
virus (Thailand). Virology 178:520–526 (2017) A novel AP2/ERF transcription factor
5. Evans D, Jeske H (1993) Complementation CR1 regulates the accumulation of vindoline
and recombination between mutants of com- and serpentine in Catharanthus roseus. Front
plementary sense genes of DNA of Abutilon Plant Sci 8:2082
mosaic virus. Virology 197:492–496 16. Agarwal AV, Singh D, Dhar YV, Michael R,
6. Burch-Smith TM, Anderson JC, Martin GB, Gupta P, Chandra D, Trivedi PK (2018)
Dinesh-Kumar SP (2004) Applications and Virus-induced silencing of key genes leads to
advantages of virus-induced gene silencing for differential impact on withanolide biosynthesis
gene function studies in plants. Plant J 39: in the medicinal plant, Withania somnifera.
734–746 Plant Cell Physiol 59:262–274
7. Ryu CM, Anand A, Kang L, Mysore KS (2004) 17. Knoch E, Sugawara S, Mori T, Poulsen C,
Agrodrench: a novel and effective Agroinocu- Fukushima A, Harholt J, Fujimoto Y, Naoyuki
lation method for virus-induced gene silencing Umemoto N, Saito K (2018) Third DWF1
in roots and diverse Solanaceous species. Plant paralog in solanaceae, sterol δ 24-isomerase,
J 40:322–331 branches withanolide biosynthesis from the
8. Hileman LC, Drea S, Martino G, Litt A, Irish general phytosterol pathway. Proc Natl Acad
VF (2005) Virus-induced gene silencing is an Sci U S A 115:E8096–E8103
effective tool for assaying gene function in the 18. Qu Y, Easson MAEM, Simionescu R,
basal eudicot species Papaver somniferum Hajicek J, Thamm AMK, Salim V, De Luca V
(opium poppy). Plant J 44:334–341 (2018) Solution of the multistep pathway for
9. Wang C, Cai X, Wang X, Zheng Z (2006) assembly of corynanthean, strychnos, iboga,
Optimisation of tobacco rattle virus-induced and aspidosperma monoterpenoid indole alka-
gene silencing in Arabidopsis. Funct Plant Biol loids from 19 E-geissoschizine. Proc Natl Acad
33:347–355 Sci U S A 115:3180–3185
10. Liscombe DK, O’Connor SE (2011) A virus- 19. Kumar SR, Rai A, Bomzan DP, Kumar K,
induced gene silencing approach to under- Hemmerlin A, Dwivedi V, Godbole RC,
standing alkaloid metabolism in Catharanthus Barvkar V, Shanker K, Shilpashree HB, Bhatta-
roseus. Phytochemistry 72:1969–1977 charya A (2020) A plastid-localized bona fide
geranylgeranyl diphosphate synthase plays a
11. Pabón-Mora N, Ambrose BA, Litt A (2012) necessary role in monoterpene indole alkaloid
Poppy APETALA1/FRUITFULL orthologs biosynthesis in Catharanthus roseus. Plant J
control flowering time, branching, perianth
identity, and fruit development. Plant Physiol 20. Nagegowda DA, Gupta P (2020) Advances in
158:1685–1704 the biosynthesis, regulation, and metabolic
engineering of plant specialized terpenoids.
12. Kumar K, Kumar SR, Dwivedi V, Rai A, Shukla Plant Sci 294:110457
AK, Shanker K, Nagegowda DA (2015) Pre-
cursor feeding studies and molecular character- 21. O’Connor SE, Maresh JJ (2006) Chemistry
ization of geraniol synthase establish the and biology of monoterpeneindole alkaloid
limiting role of geraniol in monoterpene indole biosynthesis. Nat Prod Reports 23:532–547
alkaloid biosynthesis in Catharanthus roseus. 22. O’Connor SE (2012) Strategies for engineer-
Plant Sci 239:56–66 ing plant natural products: the iridoid-derived
13. Singh AK, Dwivedi V, Rai A, Pal S, Reddy SG, monoterpene indole alkaloids of Catharanthus
Rao DK, Shasany AK, Nagegowda DA (2015) roseus. Methods Enzymol 515:189–206
Virus-induced gene silencing of Withania Som- 23. Mukherjee E, Gantait S, Kundu S, Sarkar S,
nifera squalene synthase negatively regulates Bhattacharyya S (2019) Biotechnological inter-
sterol and defence-related genes resulting in ventions on the genus Rauvolfia: recent trends
reduced withanolides and biotic stress toler- and imminent prospects. Appl Microbiol Bio-
ance. Plant Biotechnol J 13:1287–1299 technol 103:7325–7354
14. Singh AK, Kumar SR, Dwivedi V, Rai A, Pal S, 24. Hoopes GM, Hamilton JP, Kim J, Zhao D,
Shasany AK, Nagegowda DA (2017) A WRKY Wiegert-Rininger K, Crisovan E, Buell CR
transcription factor from Withania somnifera (2018) Genome assembly and annotation of
regulates triterpenoid withanolide accumula- the medicinal plant Calotropis gigantea, a pro-
tion and biotic stress tolerance through modu- ducer of anticancer and antimalarial cardeno-
lation of phytosterol and defense pathways. lides. G3: genes, genomes. Genetics 8:
New Phytol 215:1115–1131 385–391
25. Rastogi S, Meena S, Bhattacharya A, Ghosh S, 26. Rastogi S, Kalra A, Gupta V, Khan F, Lal RK,
Shukla RK, Sangwan NS, Lal RK, Gupta MM, Tripathi AK, Parameswaran S,
Lavania UC, Gupta V, Nagegowda DA, Sha- Gopalakrishnan C, Ramaswamy G, Shasany
sany AK (2014) De novo sequencing and com- AK (2015) Unravelling the genome of holy
parative analysis of holy and sweet basil basil: an “incomparable” “elixir of life” of tra-
transcriptomes. BMC Genomics 15:588 ditional Indian medicine. BMC Genomics 16:
413
Chapter 11
VIGS-Based Gene Silencing for Assessing Mineral Nutrient

Acquisition
Akash, Rajat Srivastava, and Rahul Kumar
Abstract
Virus-induced gene silencing (VIGS), is a transient gene silencing method for plants, allows rapid and
parallel characterization of promising candidate genes. This helps in the selection of the best candidate gene
(s) for their application in crop improvement. Mineral elements such as nitrogen (N), phosphorus (P), and
potassium (K) are often in short supply in the soil environment and frequently limits crop’s potential.
Further, mineral elements such as P and K are mined from natural rocks, a nonrenewable resource.
Therefore, there is an urgent need to cut down on chemical fertilizers to ensure their prolonged and
uninterrupted availability in agriculture. In this regard, the bioengineering of crops with improved nutrient-
use-efficiency (NUE) can help reduce fertilizers’ widespread application in agriculture. The development of
such crops is not as straightforward as it appears and depends on the prerequisite knowledge of the
biological function of the candidate gene(s). Here we describe an updated VIGS protocol for tomato,
based on the Tobacco rattle virus (TRV, an RNA virus), which can be successfully employed to decipher gene
function rapidly. Using this updated protocol, we successfully demonstrate the silencing of three genes,
including genes encoding phytoene synthase, root-specific purple acid phosphatase, and an F-box protein in
tomato.
Key words VIGS, Agroinfiltration, Nutrient acquisition, Phosphorus, Tomato
1 Introduction
Virus-induced gene silencing (VIGS) is one of the rapid methods of

reverse genetics to study gene function in plants [1]. In this
method, a recombinant virus-based vector is used to infect plants,
leading to transient knock-down of target genes’ expression. This
method is a manifestation of RNA-interference (RNAi) and was
first reported by Kumagai and coworkers [2]. The mechanism of
VIGS-based silencing is adopted from the plant’s antiviral defense
system, which is widely conserved among eukaryotes [3]. In
response to viral infections, plants generally employ two related
defense mechanisms to suppress viral transcription and replication,
namely posttranscriptional gene silencing (PTGS) and
165
166 Akash et al.
transcriptional gene silencing (TGS). Both of these mechanisms

involve short interfering RNAs (siRNAs). In RNAi, siRNAs origi-
nate from the site of infection, spreads throughout the entire plant,
and suppress the corresponding gene(s). In VIGS, the endogenous
transcripts are degraded by a sequence-specific RNA degradation
machinery, thereby leading to the silencing of the corresponding
gene. A partial fragment (300–500 bp) of a candidate gene is
cloned into a viral binary vector in this method. The generated
recombinant binary vector upon introduction to plants using Agro-
bacterium tumefaciens produces virus-related small interfering
RNA (siRNA). The double-stranded RNAs are recognized and
acted upon by DICER-like (DCL) multi-domain ribonucleases to
produce 21–24 nt small interfering primary RNAs [3–6]. These
siRNAs are eventually loaded on ARGONAUTE proteins, leading
to degradation of the complementary RNA of the corresponding
endogenous gene [7–9].
The first-generation VIGS vector systems were primarily based
on the Tobacco mosaic virus (TMV), Potato virus X (PVX), and
Tomato golden mosaic virus (TGMV). The silencing of endogenous
genes with the first-generation vectors was often associated with
undesirable effects such as shorter silencing period and unhealthy
plants due to chlorosis of leaves [10–12]. In the second-generation
VIGS systems, viruses with milder symptoms were selected to
minimize the side effects in the host plant [13]. The second-
generation VIGS systems have a broader host spectrum and can
infect many plant species [14], thereby allowing functional studies
in even non-model species [15–17]. The Tobacco rattle virus (TRV)
based VIGS system is mostly used to silencing endogenous genes in
dicots. On the contrary, Apple latent spherical virus (ALSV), Barley
stripe mosaic virus (BSMV), and Brome mosaic virus (BMV) based
VIGS systems are more popular among monocots [18, 19].
Various modified virus vectors have been created in the past, and
different protocols have been successfully developed to suppress
genes in several plant species [15]. The TRV-based VIGS vector is
an excellent example of the second-generation VIGS system with a
broad host spectrum in angiosperms. This vector system comprises
two plasmids: TRV1 (i.e., RNA1) and TRV2 (i.e., RNA2). TRV1
plasmid carries several virus-specific essential genes, including
RNA-dependent RNA polymerase, which is required for the viral
RNA replication and generation of siRNAs. Similarly, TRV2 plasmid
carries a coat protein gene and a multiple cloning sites region, which
is used for inserting the host-target gene (Fig. 1).
Here, we describe a detailed protocol based on the TRV VIGS
system to quickly analyze gene function in tomato. One of the main
features that distinguish this protocol from the previously published
procedures is the inclusion of a step for early agroinfiltration of
germinated seeds. This step makes this protocol suitable to charac-
terize promising candidate genes involved in nutrient acquisition.
VIGS-Based Gene Silencing for Assessing Mineral Nutrient Acquisition 167
Fig. 1 Representative vector maps of pTRV1 and recombinant pTRV2, with cloned VIGS-fragment of the
candidate gene. RdRp RNA-dependent RNA polymerase, 16K 16 kDa cysteine-rich protein, MP movement
protein, CP coat protein, LB and RB left and right borders of T-DNA, Rz self-cleaving ribozyme, MCS multiple
cloning sites
The infected plants can be hydroponically grown, thereby allowing

the scoring of root morphology for visible root traits at early devel-
opmental stages. In this protocol, 3- to 4-day-old synchronously
germinated seeds (approximately 1-cm radicle) are agro-inoculated
and cultivated in either hydroponics or coconut peat (Figs. 2 and 3).
Cultivation of agroinfiltrated seeds in coconut peat or soils is recom-
mended when the scoring of root traits is not the VIGS experiment’s
primary objective. Scoring of phenotypes and subsequent charac-
terization at biochemical and molecular levels is performed
2–3 weeks after inoculation. To demonstrate the effectiveness of
this VIGS protocol, we selected three tomato genes, namely Phy-
toene desaturase (PDS), a carotenoid biosynthetic enzyme encoding
gene, Purple acid phosphatase (PAP15) and an F-box domain-con-
taining gene (FBX2). The silencing of all three genes, either at
phenotype or molecular level, was observed in hydroponics and
coconut peat grown plants (Fig. 4). As expected, the silencing of
SlPDS resulted in the photo-bleaching of leaves (Fig. 3). Compared
to their control plants, silencing of SlFBX2 and SlPAP15 resulted in
elevated and decreased levels of total soluble phosphate (Pi) in
SlFBX2 and SlPAP15-silenced plants, respectively, under phosphate
deficiency (Fig. 4).
2 Materials
2.1 Plant Material 1. Seeds of Solanum lycopersicum (tomato) (see Note 1).
and Growth Conditions 2. 4% Sodium hypochlorite, plastic trays, blotting paper, auto-
claved double distilled water (DDW), timer, blunt-end forceps,
15 mL syringe, plastic plates.
3. Plant culture room maintained at 22 C, 60–70% relative
humidity and 200 μmol m2 s1 light intensity, the diurnal
cycle of 16 h light, and 8 h dark.
4. Hoagland’s media [19] and coconut peat (see Note 2).
5. Antibiotics stocks: Kanamycin, 50 μg/mL; Rifampicin, 30 μg/
mL.
168 Akash et al.
Fig. 2 Diagrammatic representation of the various steps of agroinfiltration used in the VIGS protocol, including
seed germination, initiation of primary and secondary cultures of pTRV1, pTRV2, and pTRV2-derivatives,
agroinfiltration, and cultivation of agroinfiltrated seeds in either hydroponics or coconut peat
6. Plastic pots: size 12 13 cm, volume 1-L for hydroponics,

mini bubbler.
2.2 Vectors 1. pTRV2 vector (pYL156; accession AF406991) TAIR (https://

www.arabidopsis.org).
2. pTRV1 vector (pYL192; GenBank accession AF406990) TAIR
(https://www.arabidopsis.org).
2.3 PCR 1. TRI Reagent® (Sigma, St. Louis, Missouri, USA).

Amplification 2. 10 MOPS [3-(N-morpholino)-propanesulfonic acid]:
400 mM MOPS, 99.6 mM sodium acetate and 20 mM
EDTA, pH 7.0, 2% (v/v) Formaldehyde.
3. RQ1 RNase-Free DNase kit (Promega, Madison,
Wisconsin, USA).
4. Diethyl pyrocarbonate (DEPC).
5. iScript™ cDNA synthesis kit (Bio-Rad Laboratories, Hercules,
California, USA).
Fig. 3 Agroinfiltration of germinated seeds with pTRV1 and pTRV2-derivatives and phenotype scoring of
SlPDS-silenced plants. (a) 3- to 4-day-old germinated seeds with ~1-cm long radicle. (b) Generation of
pressure during agroinfiltration in glass vials using a 10-mL syringe. (c and d) Scoring of phenotype for photo-
bleached leaves. Photo-bleaching of leaves is visible in the pTRV1/pTRV2::SlPDS infiltrated plants. In contrast,
pTRV1/pTRV2 injected plants (control) did not exhibit any such symptoms
6. iProof™ High-Fidelity DNA Polymerase (Bio-Rad

Laboratories, USA).
7. GEL/PCR purification kit.
8. Primers of tomato ACTIN (Solyc11g005330) gene.
Forward primer (50 TCTCAACCCTAAGGCCAACAGAGAG
30 ).
Reverse primer (50 TCTCTCGGTGAGGATCTTCATCAGG
30 ).
9. Gene-specific primers containing restriction enzyme sites for
XbaI and BamHI.
2.4 Cloning 1. XbaI and BamHI restriction endonucleases.

of VIGS-Fragment 2. T4 DNA ligase and buffer.
3. Plasmid DNA extraction mini kit.
4. Escherichia coli (DH5α)-chemical competent cells.
170 Akash et al.
Fig. 4 Characterization of VIGS-silenced tomato seedlings. (a) qRT-PCR analysis of VIGS plants using pTRV2
coat-specific protein primers. (b) qRT-PCR analysis SlFBX2 and SlPAP15 in pTRV1/pTRV2 (control) and pTRV1/
pTRV2::SlFBX2 and pTRV1/PAP15 infiltrated seedlings. (c) Total Pi level in pTRV1/pTRV2::SlFBX2 and pTRV1/
pTRV2:SlPAP15 silenced seedlings. One-way ANOVA was used for statistical analysis. HP high phosphorus, LP
low phosphorus. *** represents p-value <0.0001
5. Taq DNA Polymerase and custom gene-specific primers.

6. 80% autoclaved glycerol.
2.5 Mobilization 1. 15-mL capacity autoclaved culture glass vials (Borosil, Mum-
of VIGS Vectors bai, India).
2. YEM broth: 53 mM Mannitol, 2.8 mM K2HPO4, 0.81 mM
MgSO4·7H2O, 1.7 mM NaCl and 1 g/L yeast extract.
3. YEM-agar: YEM broth + 15 g/L Agar.
4. A. tumefaciens strain GV3101 cells, liquid N2, YEM broth,
appropriate antibiotics. Subheading 2.1, step 5.
5. Lysozyme (HiMedia Laboratories, Mumbai, India).
2.6 Initiation 1. Primary culture: YEM medium, antibiotics.

of Agrobacterium 2. Agroinfiltration solution: 19.62 mg/L Acetosyringone,
Cultures Containing 400 mg/L Cysteine, and 5 mL/L Tween20 (see Note 3).
Recombinant VIGS
Vectors
2.7 Agroinfiltration 1. 3- to 4-day-old synchronously germinated tomato seeds, ster-

of pTRV2 VIGS Vectors ilized 10-mL syringe, sterilized distilled water.
and Plant Growth 2. Hoagland medium or coconut peat (Keltech energies Ltd.,
Conditions Bengaluru, India).
3. Plant culture room, as described in Subheading 2.1, step 3.
2.8 Evaluation 1. Plant Genomic DNA Extraction Mini Kit.

of VIGS-Mediated 2. Plant Total RNA Mini Kit.
Silencing by PCR
3. RQ1 RNase-Free DNase kit.
and Quantitative
Real-Time PCR 4. Real-time PCR cycler.
5. SYBR Green real-time PCR mix.
6. Taq DNA Polymerase and dNTPs.
7. Primers of tomato glyceraldehyde phosphate-3-dehydrogenase
(GAPDH).
Forward primer (50 GGCTGCAATCAAGGAGGAA30 ).
Reverse primer (50 AAATCAATCACACGGGAACTG30 ).
8. PCR primers for the coat protein gene (as present in pTRV2
vector).
CP Forward primer (50 CCTTTATCCCTCTCCCTGACG30 ).
CP Reverse primer (50 CCATCAAGTCAGCAGGACCG30 ).
9. Gene-specific qPCR primers.
2.9 Pi Estimation 1. Glacial acetic acid.

2. Pestle and mortar, liquid N2.
3. Spectrophotometer.
3 Methods
3.1 Identification 1. Retrieve the coding sequence of the target gene(s) from Sol
of Suitable Gene Genomics Network (https://solgenomics.net/).
Fragment for VIGS 2. Use the retrieved sequence as a query in the SGN VIGS Tool
(https://vigs.solgenomics.net/). In this online tool, select the
latest database of tomato. In the other parameters, change the
default fragment length, given on this webpage, to the desired
fragment length. Keep the size of the fragment between
300–600 bp to minimize the chances of off-target silencing
(see Note 4).
3. Run the VIGS analysis tool and retrieve the output sequence;
work with this sequence to silencing the selected target gene.
172 Akash et al.
4. Design the gene-specific primers using the selected sequence

and Gene Runner (http://www.generunner.net/); add
selected restriction enzyme sites in both forward and reverse
primers.
5. Synthesize the designed oligos.
3.2 Cloning 1. Harvest tomato seedlings for isolation of the target gene and
of the VIGS-Fragment immediately snap-freeze the tissue using liquid N2; proceed for
in the pTRV2 VIGS RNA extraction from the frozen tissue.
Vector 2. Treat all glassware, plasticware, Milli-Q (MQ) water, RO water
with DEPC (use 0.1% for solid materials and 0.01% for liquid
materials) overnight; transfer all treated materials to an oven
drying and subsequent autoclaving (see Note 5).
3. Before initiating the protocol of RNA extraction, clean the
workbench with 70% ethanol.
4. Isolate the total RNA from 100 mg of the frozen tissue using
TRI Reagent® buffer following the ‘manufacturer’s
instructions.
5. Measure the quality and concentration of RNA samples using
gel electrophoresis and calculating the A260/280 ratio using
Nanodrop.
6. Take 1 μg of high-quality RNA for cDNA synthesis using first-
strand cDNA synthesis kit and follow the ‘manufacturer’s
instructions during the process.
7. Check the quality of synthesized cDNA by amplifying the
ACTIN gene in a PCR reaction using Taq DNA polymerase.
Use different synthesized cDNAs‘dilutions to select the final
concentration for the subsequent PCR reactions (see Note 6).
8. Amplify the VIGS-fragment of the selected gene(s) using
cDNA, gene-specific primers and High-Fidelity DNA Polymer-
ase; follow the PCR cycle: 98 C for 2 min; 30 cycles of 98 C
for 5 s, 60 C for 15 s, 72 C for 15 s; and a final extension at
72 C for 5 min followed by cooling at 4 C.
9. Check the amplified PCR product by performing 1% agarose
gel electrophoresis (1 TAE, 0.5 mg/mL of ethidium bro-
mide); use a DNA ladder marker to ascertain the correct size of
the amplified product under the UV transilluminator (see
Note 7).
10. Perform PCR reaction and bulk the amplified product for
further gene cloning experiments.
11. Purify the amplified PCR product using GEL/PCR purifica-
tion kit following the ‘manufacturer’s protocol.
12. Determine the concentration and yield of the purified product
using Nanodrop.
13. Perform restriction digestion of pTRV2 vector plasmid and

purified PCR amplified product(s) using the selected restric-
tion enzymes.
14. Verify the restriction digestion by running the samples on 1%
agarose gel.
15. Purify the digested plasmid and PCR products using
GEL/PCR purification kit following the ‘manufacturer’s
protocol.
16. Quantify the concentration of purified digested products using
Nanodrop.
17. Perform a ligation reaction taking purified vector and insert
DNA in a 1:3 molar ratio using T4 DNA ligase; incubate the
reaction mix at 16 C overnight.
18. Transform the ligated product in chemical-competent E. coli
(DH5α), spread on LB agar plate containing antibiotics, and
incubate it at 37 C in an incubator overnight.
19. Screen the resulting colonies for recombinant clones by
performing colony PCR reactions using gene-specific primers.
Proceed with the colonies that amplify the expected fragment,
and grow them in LB broth containing appropriate antibiotics
at 37 C in an incubator shaker maintained at 200 rpm speed
for 16 h.
20. Perform plasmid isolation using a plasmid DNA extraction
mini kit; check the concentration of the isolated recombinant
plasmids using Nanodrop.
21. Confirm the release of expected size fragment from the recom-
binant plasmids by restriction digestion analysis using the dif-
ferent sets of restriction enzymes; analyze the results by
running digested products on 1% agarose gel.
22. Sequence the positive clones using gene-specific primers for
final confirmation (see Note 8).
23. Prepare a stock of the positive clones using 80% glycerol for
future use.
3.3 Transformation 1. Add 500 ng to 1 μg pTRV1, pTRV2 and recombinant pTRV2-

of VIGS Vectors into plasmids (pTRV2 derivatives) into the MCT containing com-
Agrobacterium petent cells of A. tumefaciens GV3101 strain on ice; freeze the
tumefaciens (GV3101) tube in liquid N2 for 75 s, then quickly transfer to a water bath
Competent Cells maintained at 37 C for 5 min.
2. Transfer the MCTs to the ice for 10 min and add 1 mL of
autoclaved LB broth into each tube; incubate these at 28 C
and 200 rpm in an incubator shaker for 2–3 h.
3. Spin the cells at room temperature, at 2500 g in a centrifuge
for 10 min; discard the supernatant but leave approximately
174 Akash et al.
100 μL supernatant in each MCT; re-suspend the pellet and

spread the suspended cells on LB agar plate supplemented with
rifampicin and kanamycin. Keep the Petri plates at 28 C in an
incubator for 36–48 h (see Note 9).
4. Screen the obtained colonies by performing colony PCR reac-
tions using gene-specific primers; check the expected length
PCR amplified fragment on 1% agarose gel.
5. Prepare the stocks and store them at 80 C.
3.4 Seed 1. Take tomato seeds in a 50-mL glass beaker and wash them with
Germination detergent for 5 min.
2. Wash the seeds thoroughly by keeping the beaker under run-
ning tap water for 20 min.
3. Discard the water and surface sterilize tomato seeds by soaking
them in 4% sodium hypochlorite for 10 min (see Note 10).
4. Rinse the sterilized seeds thoroughly with autoclaved distilled
water and transfer them on a moist filter paper for germination
in 150-mm diameter plastic plates.
5. Incubate the setup at room temperature for 72 h in the dark.
3.5 Preparation 1. Initiate separate primary culture for each clone, pTRV1 (empty
of Agrobacterium vector), pTRV2::SlPDS, pTRV2::SlPAP15, pTRV2::SlFBX2,
Cultures for Infiltration and pTRV2 (empty vector), by inoculating a single colony for
each vector in 5-mL YEM medium containing Rifampicin and
Kanamycin in autoclaved 25-mL conical flasks; incubate the
cultures at 28 C/180 rpm in an incubator shaker overnight.
2. In the morning, use the overnight grown primary cultures to
initiate secondary cultures in 10-mL agroinfiltration solution
containing acetosyringone (19.62 mg/L), cysteine (400 mg/
L), and Tween20 (5 mL/L) in 100 mL autoclaved conical
flasks; incubate the culture at 28 C/180 rpm in an incubator
shaker until OD600 reaches to 0.25 (see Note 11).
3. Mix secondary culture of either pTRV2, or its derivatives
pTRV2::SlPDS, pTRV2::SlFBX2 and pTRV2::SlPAP15 with
pTRV1 culture (1:1 ratio) in 15-mL Borosil glass vials, and
leave them at room temperature for 1 h.
4. Transfer the 3- to 4-day-old synchronously germinated seeds,
Subheading 3.4, step 4, in equal number to each 15 m culture
vial; create pressure inside the vial by placing a 10-mL syringe at
the opening of the vial and pressing its plunger for 15 s; repeat
the same for all vials (see Note 12).
5. Transfer the agroinfiltrated seeds and agroinfiltration solution
from each vial back to its corresponding 50-mL flask;
co-cultivate it at 28 C and 150 rpm in an incubator shaker for

30 min (see Note 13).
6. Wash the co-cultivated seeds with sterilized distilled water;
transfer them to either “Hoagland’s medium in a hydroponic
system or a pot containing coconut peat for further growth (see
Note 14).
7. Transfer the pots with co-cultivated seeds to a plant culture
room with conditions set at 22 C, 200 μmol m2 s1 light,
16 h light/8 h dark photoperiod, and 60–70% relative humid-
ity (see Note 15).
8. Record the seedling phenotype for gene silencing after
2–3 weeks.
3.6 Screening 1. For the silencing of the PDS gene, look for the photo-bleached
of VIGS Plants Either appearance of the emerging leaves. For the other genes, harvest
by Observation or by the leaf tissue from each plant and snap-freeze using liquid N2.
PCR Analysis Using 2. Extract total genomic DNA from the harvested tissue using the
TRV Coat Dellaporta method [20] or Plant Genomic DNA Extraction
Protein-Specific Mini Kit; check the quality and concentration of DNA by
Primers running the samples on 0.8% agarose gel or using Nanodrop.
3. Use the isolated genomic DNA samples as a template for
setting up PCR reactions using viral coat protein gene-specific
primers. Perform PCR reaction using Taq DNA polymerase
with following PCR cycle: 94 C for 5 min; 35 cycles of 94 C
for 15 s, 55 C for 30 s, 72 C for 30 s; and a final extension at
72 C for 10 min followed by cooling at 4 C.
4. Check the amplified PCR product by performing 1% agarose
gel electrophoresis; proceed further with only PCR confirmed
plants.
3.7 Validation 1. Extract total RNA from VIGS and WT control plants and
of Downregulation perform reverse transcriptase reaction as described in Subhead-
of Target Gene ing 3.2, steps 4–7 to obtain the cDNA. Perform a PCR reac-
Transcript by tion using coat protein-specific primers, as described in
Quantitative Subheading 3.6, steps 3–4, to check its relative mRNA
Real-Time PCR abundance.
2. Initiate a real-time PCR reaction using candidate gene-specific
primers to study the extent of gene silencing in VIGS plants.
3. Prepare the reaction in 25 μL by adding 12.5 μL SYBR Green
mix (2), 1 μL each of forward and reverse primer (5 μM
stock), 9.5 μL MQ water, and 1 μL cDNA; mix the compo-
nents in a MCT in low light as SYBR green mix is light-
sensitive; prepare separate reaction mix for each primer pair.
176 Akash et al.
4. Divide each reaction mix into three technical replicates of 8 μL

each at the time of loading the samples in the 96-well plates;
seal the 96-well microplate carefully with the adhesive pad.
5. Spin the plate briefly before taking it to the real-time machine;
run the machine with settings of PCR reaction: 95 C/3 min,
40 (95 C/15 s, 60 C/30 s.
6. Normalize the data using the GAPDH gene and calculate the
transcripts’ relative level using the 2ΔΔCt method [21].
3.8 Determination 1. Take 250 mg tissue from the silenced plants, rinse them with
of Total Soluble Pi distilled water, freeze in liquid N2, and powder the samples
Content in the Silenced using pre-chilled pestle and mortar.
Plants 2. Transfer 40 mg of powdered tissue in a pre-chilled microcen-
trifuge tube, add 250 μL of glacial acetic acid to it, vortex
vigorously.
3. Immerse microcentrifuge in liquid N2 for 30 s, and then leave
at room temperature for thawing.
4. Spin it in a centrifuge at 17,000 x g for 1 min at room
temperature.
5. Transfer the supernatant to a fresh 1.5 mL microcentrifuge.
6. Assay the supernatant for Pi using a phosphomolybdate colori-
metric assay, as described [22].
4 Notes
1. We used tomato seeds of Pusa Ruby and Arka Vikas, both

Indian varieties, for the VIGS experiments. Ensure that the
quality of seeds w.r.t. their germination efficiency, as it is critical
for obtaining healthy seedlings.
2. When plants were grown hydroponically in half-strength
“Hoagland’s medium, the concentration of phosphate in the
high–phosphate medium was kept 1.25 mM. To make
low-phosphate ‘‘Hoagland’s medium (0.3 μM phosphate),
KH2PO4 was withdrawn from the medium and was replaced
with equimolar KCl to maintain K concentration in the
medium.
3. In this protocol, the secondary culture of A. tumefaciens is
initiated in the agroinfiltration solution, as described previously
[23]. After mixing the primary culture of pTRV2, or its deriva-
tives pTRV2::SlPDS, pTRV2::SlFBX2 and pTRV2::SlPAP15
with pTRV1 culture, the mixed culture solutions were left at
room temperature for 1 h for homogenous mixing.
4. The best silencing results in VIGS experiments have been
obtained with 300–600 bp long fragment. The selected nucle-
otide sequence for VIGS should be used as a query in a
BLASTN search against the Tomato Genome cDNA (ITAG

release 3.20). The selected sequence can be discarded if it
shows high sequence similarity with other gene loci in the
genome to avoid off-target silencing.
5. Always wear gloves during the experiments. DEPC is a potent
carcinogen, and its treatment should be performed in a
fume hood.
6. Prepare RNA samples in a premix-loading buffer: 1 MOPS:
Formaldehyde: Formamide at a ratio of 1:3.5:10 and 0.5 mg/
mL EtBr before performing the agarose gel electrophoresis.
For better resolution and separation of rRNA bands, agarose
gel should be run, preferably at a lower voltage.
7. Take care to avoid inhalation of EtBr fumes while preparing or
casting the agarose gel. EtBr is a potent carcinogen.
8. Final confirmation of the cloning should always be done by
sequencing the cloned product as any mismatch or deletion
may affect the degree of gene silencing in the experiment. It is
advised to sequence at least 2–3 independent recombinant
clones for each cloning reaction.
9. Rifampicin antibiotic is sensitive to light. Work in the dim light
while preparing LB agar or YEM-agar plates supplemented
with this antibiotic. The Petri plates should be covered with
aluminum foil when working in the light, otherwise, the anti-
biotic will degrade upon prolonged light exposure.
10. Do not treat tomato seeds with 4% Sodium hypochlorite for
more than 12 min, as it may interfere with seed germination
and subsequent growth.
11. Do not allow secondary cultures to exceed OD600 0.3. Higher
OD600 cultures increase the severity of the infection and lead to
poor recovery of the agroinfiltrated plants.
12. Do not generate pressure for more than 15 s as that may lead to
severe infection and poor recovery of the germinated seedlings.
13. During co-cultivation, do not exceed 150 rpm of the shaker as
higher rpm may cause physical injury to emerged radicle and
make sprouts susceptible to the infection.
14. After incubation, wash seedling gently to avoid any damage to
the emerged radicle. Ensure minimum light penetration in
“Hoagland’s medium in hydroponics system to inhibit algal
growth.
15. Transfer the co-cultivated seedlings from glass vials to the pots
quickly to minimize their air and dryness exposure. After trans-
fer, the seedling pots should be covered with a transparent
plastic cover for 2–3 days to maintain high humidity.
178 Akash et al.
Acknowledgments
The authors acknowledge the support and resources developed

under the University Grants Commission Special Assistance
Programme (UGC-SAP), and the Department of Science and
Technology supported Funds for Infrastructure in Science and
Technology (FIST), Level II grants to the Department of Plant
Sciences, University of Hyderabad. We also thank the Institute of
Eminence grant to the University of Hyderabad by MHRD, Govt.
of India. This work was supported by SERB, DST, Govt. of India
(CRG/2018/001033), by DST Indo-Bulgaria Bilateral Research
Cooperation grant (INT/BLG/P-06/2019). Akash and Rajat Sri-
vastava acknowledge CSIR, Govt. of India, for their JRF fellowship.
Rajat Srivastava also acknowledges the BBL fellowship from Uni-
versity of Hyderabad. The authors thank Dr. Senthil-Kumar
Muthappa, National Institute of Plant Genome Research, New
Delhi, for sharing the VIGS vectors and Prof. Sreenivasulu Kurkuti,
School of Life Sciences, University of Hyderabad, for sharing his
Real-time PCR cycler with us.
References
1. Liu YL, Schiff M, Marathe R et al (2002) 9. Baulcombe D (2004) RNA silencing in plants.
Tobacco Rar1, EDS1 and NPR1/NIM1 like Nature 431(7006):356–363
genes are required for N-mediated resistance 10. Kjemtrup S, Sampson KS, Peele CG et al
to tobacco mosaic virus. Plant J 30 (1998) Gene silencing from plant DNA carried
(4):415–429 by a geminivirus. Plant J 14(1):91–100
2. Kumagai MH, Donson J, Della-Cioppa G et al 11. Ruiz MT, Voinnet O, Baulcombe DC (1998)
(1995) Cytoplasmic inhibition of carotenoid Initiation and maintenance of virus-induced
biosynthesis with virus-derived RNA. Proc gene silencing. Plant Cell 10(6):937–946
Natl Acad Sci 92(5):1679–1683 12. Ratcliff F, Martin-Hernandez AM, Baulcombe
3. Zhang C, Wu Z, Li Y et al (2015) Biogenesis, DC (2001) Technical advance: tobacco rattle
function, and applications of virus-derived virus as a vector for analysis of gene function by
small RNAs in plants. Front Microbiol 6:1237 silencing. Plant J 25(2):237–245
4. Molnar A, Csorba T, Lakatos L et al (2005) 13. Liou MR, Huang YW, Hu CC et al (2014) A
Plant virus-derived small interfering RNAs dual gene-silencing vector system for monocot
originate predominantly from highly and dicot plants. Plant Biotechnol J 12
structured single-stranded viral RNAs. J Virol (3):330–343
79(12):7812–7818 14. Dommes AB, Gross T, Herbert DB et al
5. Liu Y, Ye X, Jiang F et al (2009) C3PO, an (2019) Virus-induced gene silencing: empow-
endoribonuclease that promotes RNAi by facil- ering genetics in non-model organisms. J Exp
itating RISC activation. Science 325 Bot 70(3):757–770
(5941):750–753 15. Senthil-Kumar M, Mysore KS (2011) New
6. Aregger M, Borah BK, Seguin J et al (2012) dimensions for VIGS in plant functional geno-
Primary and secondary siRNAs in geminivirus- mics. Trends Plant Sci 16(12):656–665
induced gene silencing. PLoS Pathog 8(9) 16. Stratmann JW, Hind SR (2011) Gene silencing
7. Carbonell A, Carrington JC (2015) Antiviral goes viral and uncovers the private life of plants.
roles of plant ARGONAUTES. Curr Opin Entomol Exp Appl 140(2):91–102
Plant Biol 27:111–117 17. Holzberg S, Brosio P, Gross C et al (2002)
8. Becker A, Lange M (2010) VIGS–genomics Barley stripe mosaic virus-induced gene silenc-
goes functional. Trends Plant Sci 15(1):1–4 ing in a monocot plant. Plant J 30(3):315–327
18. Gordon CS, Rajagopalan N, Risseeuw EP et al 21. Livak KJ, Schmittgen TD (2001) Analysis of
(2016) Characterization of Triticum aestivum relative gene expression data using real-time
abscisic acid receptors and a possible role for quantitative PCR and the 2ΔΔCT method.
these in mediating fusarium head blight sus- Methods 25(4):402–408
ceptibility in wheat. PLoS One 11(10): 22. Ames BN (1966) Assay of inorganic phos-
e0164996 phate, total phosphate and phosphatases.
19. Hoagland DR, Arnon DI (1950) The water- Methods Enzymol 8:115–111
culture method for growing plants without 23. Zhang J, Yu D, Zhang Y et al (2017) Vacuum
soil. Circ Calif Agric Exp Stn 347 and co-cultivation agroinfiltration of (germi-
20. Dellaporta SL, Wood J, Hicks JB (1983) A nated) seeds results in tobacco rattle virus
plant DNA minipreparation: version II. Plant (TRV) mediated whole-plant virus-induced
Mol Biol Rep 1(4):19–21 gene silencing (VIGS) in wheat and maize.
Front Plant Sci 8:393
Chapter 12
High-Throughput Analysis of Gene Function under Multiple

Abiotic Stresses Using Leaf Disks from Silenced Plants
Ramegowda Yamunarani, Venkategowda Ramegowda,
Muthappa Senthil-Kumar, and Kirankumar S. Mysore
Abstract
The high throughputness and affordability of “omics” technologies is leading to the identification of a large
number of abiotic stress genes, with many of them responsive to multiple stresses. In vivo functional
characterization of these genes under multiple stresses is challenging but essential to develop resilient crops
for the changing climate. Here we describe a high-throughput Virus-Induced Gene Silencing-based
methodology for functional analysis of genes under multiple abiotic stresses using leaf disks. Leaves with
maximal silencing, which is localized to only a few leaves and to a short period, can be effectively used for
multiple stress imposition and stress affect quantification.
Key words Virus-Induced Gene Silencing, Leaf disks, Multiple abiotic stresses
1 Introduction
Abiotic stresses negatively influence plant growth, development,

and survival resulting in an estimated yield loss of up to 50%
worldwide [1]. Understanding the plant tolerance to abiotic stres-
ses is challenging due to its complex-quantitative nature involving
multiple genes and influenced by other environmental factors.
Nevertheless, it is a major focus of current research due to its
agricultural importance. Plant responses to abiotic stresses involve
a coordinated expression of thousands of genes related to direct
cellular protection or regulation of other genes [2–5]. Application
of omics tools such as transcriptomics, metabolomics, proteomics
in association with comparative genomics has greatly aided in the
identification and characterization of such genes to an extent [6–
9]. However, the high-throughput functional characterization of
these genes is a greater challenge. Functional analysis of these genes
is critical in understanding the stress tolerance mechanisms and also
identifying candidate genes for genetic improvement of susceptible
181
182 Ramegowda Yamunarani et al.
crops. Reverse genetics tools have been successfully used in study-

ing the functional relevance of several genes under abiotic stresses
[10–12]. However, these screens have been laborious, requiring
the generation of a large number of mutant populations or trans-
genics involving multiple generations to ascertain the role of a
gene, therefore limiting their use in high-throughput phenotyping
for abiotic stress tolerance [13–15]. Besides, the presence of func-
tionally redundant genes in the genome resulting in no or limited
phenotype in genetically modified plants further hindered the use
of these tools [16]. Virus-Induced Gene Silencing (VIGS) has been
successfully used in the functional analysis of genes without many
pitfalls associated with traditional reverse genetic approaches
described above [17]. Individual or multiple genes have been tar-
geted using VIGS [18] and can be adapted in high-throughput
screens as the reverse- as well as forward-genetics tool [19–23].
Omics studies have shown that several genes induced under
one abiotic stress are also induced under other abiotic stresses
suggesting the existence of similar stress response mechanisms in
plants [24, 25]. In addition, several transgenics developed for
tolerance to one stress have shown tolerance to other stresses as
well [26–28]. Therefore, functional analysis of these shared genes
under multiple abiotic stresses will aid in the development of mul-
tiple stress-tolerant crops under the present climate change sce-
nario. Achieving this through the development of stable
transgenics and the use of other genetic tools is not practical.
Despite its potential, VIGS has not been effectively used in studying
the role of a gene in multiple stress tolerance due to a lack of
suitable stress imposition and stress effect quantification methods
within the window of transient gene silencing. In VIGS, maximal
silencing is localized to only a few leaves and to a short period.
Therefore, it is relevant to stress only these leaves and understand
stress tolerance mechanisms. However, most of the currently used
stress treatment methods involve whole plant exposure, which is
tedious and also not amenable for high-throughput screening for
tolerance to multiple abiotic stresses. In our previous study, we have
demonstrated that leaf disk-based stress imposition and stress effect
quantification methods can be used for characterization of several
genes under multiple abiotic stresses [29]. We have shown that,
gene silencing will continue to occur in the leaf disks excised from
inoculated leaves and persist for more than 6 weeks. With this
methodology, we have shown the usefulness of VIGS in the identi-
fication of genes involved in multiple abiotic stress tolerance and
also the possible pleiotropic effect of a gene when tested under
multiple stresses.
Here we describe a VIGS-based high-throughput method for
functional validation of genes under multiple abiotic stresses using
leaf disks. This methodology allows high throughput and precise
multiple stress imposition and stress effect quantification under
High-Throughput Analysis of Gene Function under Multiple Abiotic Stresses. . . 183
laboratory conditions with minimal facility and time. The method

described here can also be extended to combined stress response
studies by applying two or more stresses together.
2 Materials
2.1 Plants and 1. Nicotiana benthamiana seeds.

Growth Conditions 2. Germination flats and pots (10 cm diameter).
3. Metro-Mix 830 and BM7 potting mix.
4. Fertilizer (20-10-20) solution, along with soluble trace
element.
5. Controlled environment greenhouse with 21 2 C day/
night temperatures, 500 μmol/m2/s light intensity,
14/10 h day/night photoperiod and 45–60% relative
humidity.
2.2 Plasmids, 1. pTRV1 and Gateway ready pTRV2 vectors [30, 31].
Cloning, and 2. Gateway cloning kit.
Agrobacterium Strain
3. Agrobacterium tumefaciens strain GV2260 electrocompetent
cells.
4. Electroporation system.
5. Antibiotic stocks: 50 mg/mL kanamycin and 5 mg/mL
rifampicin.
6. Luria-Bertani (LB) medium.
2.3 Infiltration 1. Agrobacterium induction buffer: 10 mM MES, 100 mM acet-

Components osyringone, pH 5.5.
2. Infiltration buffer: 5 mM MES, pH 5.5.
3. 1 mL needleless syringe.
2.4 Stress 1. 1% (v/v) sodium hypochlorite.

Treatments 2. Murashige and Skoog (MS) medium: 4.32 g of MS minimal
salts, 1 mL vitamin stock solution (0.5 mg/mL nicotinic acid,
0.5 mg/mL pyridoxine, 0.5 mg/mL thiamine-HCl), 30 g
sucrose, 1 g phytagel per liter of medium, pH 5.7.
3. Callus induction medium: 4.32 g MS basal salts, 1 mL vitamin
stock, 100 mg myo-inositol, 20 g glucose, 0.5 mg 2, 4-D,
0.3 mg kinetin, 5 mg IAA, 1 g per liter phytagel, pH 5.7. To
prevent bacterial contamination, 200 μg/mL of cefotaxime
and 100 μg/mL of ticarcillin can be used in the media.
4. Osmotic stress: 0.5 MPa polyethylene glycol (PEG)-10,000.
5. Salinity stress: 100 mM NaCl.
6. Temperature stress: High (35–45 C) and low (4 C to 2 C)

temperature chambers.
7. Oxidative stress: 10 μM menadione sodium bisulfite (Sigma
Aldrich Inc., St. Louis, MO, USA).
3 Methods
3.1 Preparation of 1. Germinate N. benthamiana seeds in flats filled with Metro-Mix

Plant Material 830 potting mix.
2. Transplant individual 2-week-old seedlings into pots filled with
BM7 potting mix and apply fertilizer as needed.
3.2 Vector 1. Identify specific siRNA regions in the gene of interest using
Construction tools such as siRNA scan (http://bioinfo2.noble.org/
RNAiScan.htm or http://plantgrn.noble.org/pssRNAit/)
(see Note 1).
2. Amplify specific homologous or heterologous gene fragments
of 200–400 bp using cDNA as a template.
3. Clone amplified fragments into Gateway ready pTRV2 vector
following the manufacturer’s instructions. Specific fragments
used for silencing can be sequence confirmed using PCR ampli-
fied product or after cloning into pTRV2.
4. Marker constructs with genes such as phytoene desaturase
(PDS), Mg-chelatase H subunit (ChlH), or green fluorescent
protein (GFP) can be used as vector controls.
5. Mobilize confirmed plasmids into A. tumefaciens strain
GV2260 by electroporation.
3.3 Preparation of 1. Set up starter cultures by inoculating 2 mL of LB broth con-

Agrobacterium for taining 5 μg/mL of rifampicin and 50 μg/mL of kanamycin
Infiltration with a single Agrobacterium colony carrying pTRV1 or pTRV2
derivatives and grow them at 28 C while shaking at 250 rpm
overnight.
2. Subculture 0.5 mL of starter culture into 10 mL of LB broth at
28 C containing 50 mg/mL of kanamycin and 5 mg/mL of
rifampicin and grow at 28 C with shaking at 250 rpm until
OD600 of 0.5–0.6.
3. Harvest the cells by centrifugation (3000 g) for 5 min at
room temperature and resuspend in 10 mL of Agrobacterium
induction buffer.
4. Incubate at room temperature in a shaker (50 rpm) for 3 h and
harvest the cells by centrifugation (3000 g) for 5 min at room
temperature and resuspend in infiltration buffer to an OD600 of
<0.5.
3.4 Infiltration of N. 1. Mix TRV1 and TRV2 cultures at 1:1 ratio in 5 mM MES buffer
benthamiana (pH 5.5).
Seedlings with 2. Select three-week-old N. benthamiana plants grown in pots.
Agrobacterium
3. Use a needleless syringe to deliver about 0.5 mL of Agrobacter-
ium mixture to the abaxial side of 3–4 lower leaves and main-
tain the inoculated plants in the greenhouse under conditions
described in Subheading 2.1, item 5.
4. Monitor plants for phenotypic change from 10 days post-
inoculation (DPI) (see Note 2).
3.5 Stress 1. Select newly developed non-inoculated leaves from 10 DPI and
Treatments and Stress surface sterilize with 10% household bleach for 5 min, followed
Effect Quantification by 3–4 rinses with sterile water.
3.5.1 Leaf Disk-Based 2. Include vector control as well as wild-type plants in the assay.
Assays 3. Osmotic, salt and oxidative stress: Make equal-sized (11 mm
diameter) leaf disks from sterile leaves and place them on MS or
CIM plates supplemented with 0.5 MPa PEG-10000,
100 mM NaCl and 10 μM menadione sodium bisulfite to
create osmotic, salt and oxidative stress, respectively (see
Notes 3 and 4) (Fig. 1).
4. Stress effect on the silenced leaf disks treated to osmotic, salt
and oxidative stress can be assessed by observing the change in
phenotype 15 days after stress treatment in MS plates and
measuring stress-induced changes in CIM 20 days after stress
by taking the dry weight of oven-dried callus at 80 C for 24 h.
5. Temperature stress: For high-temperature treatment, float leaf
disks on deionized water and expose to an acclimation temper-
ature of 35 C for 6 h followed by a severe temperature of
45 C for 1 h. For low temperature, float leaf disks on deio-
nized water and expose to an acclimation temperature of 4 C
for 12 h followed by a severe low temperature of 2 C for 1 h.
Measure cell membrane stability from both high and low tem-
perature treated leaf disks as described in Tripathy et al. [32]
(Fig. 1).
3.5.2 Detached Leaf 1. Detach leaves from gene-silenced, vector control, and
Assay for Drought non-inoculated plants and measure the decline in fresh weight
Avoidance over the time at an interval of 30 min for 6–8 h. Set up
experiments under controlled temperature, light, and humidity
conditions allowing a gradual decline in leaf water content (see
Note 5) (Fig. 1).
Wild-type TRV:GFP TRV:GOI

a b c
New leaves 10 days after infiltration
Surface sterilization
Leaf disks Whole leaf
Detached leaf assay for

drought avoidance
MS + PEG, CIM + PEG, Water Air dry under

NaCl or MV NaCl or MD controlled conditions
15 d 20 d
Visual Callus dry CMS Weight over time
phenotype weight
Fig. 1 An overview of the leaf disk-based high-throughput screen for multiple abiotic stress response of
silenced genes. (a) Non-inoculated plants; (b) TRV:GFP infiltrated plants as vector control; (c) TRV:GOI (gene of
interest) infiltrated plants. TRV::NbChlH is shown as an example for GOI here
4 Notes
1. These tools will also help in identifying off-target genes in the

specific genome. In addition, specific siRNA which can poten-
tially target a single gene or multiple genes in a family can be
identified. To increase the specificity, the regions (30 or UTRs)
with less homology to other genes can be chosen.
2. Typically, abiotic stress-responsive genes will not produce
growth phenotype under normal growing conditions. If the
phenotype is severe than the vector control plants, then it could

be due to loss of immunity against TRV. TRV2 coat protein-
specific RT-PCR might help in determining this.
3. Hydrogen peroxide (H2O2) and methyl-viologen (MV) can
also be used to create oxidative stress in leaf disks by floating
the leaf disks in H2O2 or MV solutions and estimating the
chlorophyll content [33, 34]. While using the MV, care should
be taken to expose the plates with leaf disks to a little high light
intensity. Similarly, salinity tolerance can also be tested by
floating leaf disks in NaCl solution and estimating the chloro-
phyll content [35]. The imposition of constant osmotic stress
conditions can be best achieved through the use of PEG-
infused agar plates [36].
4. Leaf disks on MS media supplemented with stressors can be
used to analyze the extent of gene silencing by semiquantitative
RT-PCR or qRT-PCR.
5. The rate of water loss from the leaves is largely determined by
stomata. Therefore, the detached leaf assay will measure sto-
mata mediated drought avoidance mechanisms and not
drought tolerance mechanisms. A combination of microscopic
observations for stomatal behavior and thermal imaging for leaf
temperature with water loss assay will help in a better quantifi-
cation of drought avoidance [36].
Acknowledgments
RV thanks SERB, DST, Govt. of India for Ramanujan Fellowship

(SE/S2/RJN-039/2016) and Early Career Research Award
(ECR/2018/00l942).
References
1. Bray EA, Bailey-Serres J, Weretilnyk E, 5. Nakashima K, Yamaguchi-Shinozaki K, Shino-
Buchannan B, Jones R (2000) Responses to zaki K (2014) The transcriptional regulatory
abiotic stresses. In: Biochemistry and molecu- network in the drought response and its cross-
lar biology of plants. American Society of Plant talk in abiotic stress responses including
Biologists, Rockville, MD, pp 149–158 drought, cold and heat. Front Plant Sci 5:170
2. Xiong L, Schumaker KS, Zhu JK (2002) Cell 6. Urano K, Kurihara Y, Seki M, Shinozaki K
signaling during cold, drought, and salt stress. (2010) ‘Omics’ analyses of regulatory net-
Plant Cell 14(Suppl):S165–S183 works in plant abiotic stress responses. Curr
3. Haak DC, Fukao T, Grene R, Hua Z, Ivanov R, Opin Plant Biol 13(2):132–138
Perrella G et al (2017) Multilevel regulation of 7. Arbona V, Manzi M, Ollas C, Gómez-Cadenas
abiotic stress responses in plants. Front Plant A (2013) Metabolomics as a tool to investigate
Sci 8:1564 abiotic stress tolerance in plants. Int J Mol Sci
4. Shinozaki K, Yamaguchi-Shinozaki K (2007) 14(3):4885–4911
Gene networks involved in drought stress 8. Fahimirad S, Ghorbanpour M (2019) Omics
response and tolerance. J Exp Bot 58(2): approaches in developing abiotic stress toler-
221–227 ance in rice (Oryza sativa L.). In: Advances in
rice research for abiotic stress tolerance. Else- 22. Senthil-Kumar M, Wang M, Chang J,
vier, Amsterdam, pp 767–779 Ramegowda V, Del Pozo O, Liu Y et al
9. Mosa KA, Ismail A, Helmy M (2017) Omics (2018) Virus-induced gene silencing database
and system biology approaches in plant stress for phenomics and functional genomics in
research. In: Plant Stress Tolerance. Springer, Nicotiana benthamiana. Plant Direct 2(4):
New York, pp 21–34 e00055
10. Bahuguna RN, Gupta P, Bagri J, Singh D, 23. Ramegowda V, Mysore KS, Senthil-Kumar M
Dewi AK, Tao L et al (2018) Forward and (2014) Virus-induced gene silencing is a versa-
reverse genetics approaches for combined stress tile tool for unraveling the functional relevance
tolerance in rice. Indian J Plant Physiol 23(4): of multiple abiotic-stress-responsive genes in
630–646 crop plants. Front Plant Sci 5:323
11. Singh B, Kukreja S, Goutam U (2018) Mile- 24. Georgii E, Jin M, Zhao J, Kanawati B, Schmitt-
stones achieved in response to drought stress Kopplin P, Albert A et al (2017) Relationships
through reverse genetic approaches. F1000Res between drought, heat and air humidity
7:1311 responses revealed by transcriptome-
12. Singh B, Salaria N, Thakur K, Kukreja S, metabolome co-analysis. BMC Plant Biol
Gautam S, Goutam U (2019) Functional 17(1):120
genomic approaches to improve crop plant 25. Shaar-Moshe L, Blumwald E, Peleg Z (2017)
heat stress tolerance. F1000Res 8:1721 Unique physiological and transcriptional shifts
13. Wang N, Long T, Yao W, Xiong L, Zhang Q, under combinations of salinity, drought, and
Wu C (2013) Mutant resources for the func- heat. Plant Physiol 174(1):421–434
tional analysis of the rice genome. Mol Plant 26. Prabhavathi VR, Rajam MV (2007) Polyamine
6(3):596–604 accumulation in transgenic eggplant enhances
14. Krishnan A, Guiderdoni E, An G, Hsing Y-IC, tolerance to multiple abiotic stresses and fungal
C-D H, Lee MC et al (2009) Mutant resources resistance. Plant Biotechnol 24(3):273–282
in Rice for functional genomics of the grasses. 27. Wang R-K, Li L-L, Cao Z-H, Zhao Q, Li M,
Plant Physiol 149(1):165–170 Zhang L-Y et al (2012) Molecular cloning and
15. Ahmad N, Mukhtar Z (2017) Genetic manip- functional characterization of a novel apple
ulations in crops: challenges and opportunities. MdCIPK6L gene reveals its involvement in
Genomics 109(5–6):494–505 multiple abiotic stress tolerance in transgenic
plants. Plant Mol Biol 79(1–2):123–135
16. Cutler S, McCourt P (2005) Dude where’s my
phenotype? Dealing with redundancy in signal- 28. Bi H, Zhao Y, Li H, Liu W (2020) Wheat heat
ing networks. Plant Physiol 138(2):558–559 shock factor TaHsfA6f increases ABA levels and
enhances tolerance to multiple abiotic stresses
17. George GM, Bauer R, Blennow A, in transgenic plants. Int J Mol Sci 21(9):3121
Kossmann J, Lloyd JR (2012) Virus-induced
multiple gene silencing to study redundant 29. Ramegowda V, Senthil-Kumar M,
metabolic pathways in plants: silencing the Udayakumar M, Mysore KS (2013) A high-
starch degradation pathway in Nicotiana throughput virus-induced gene silencing pro-
benthamiana. Biotechnol J 7(7):884–890 tocol identifies genes involved in multi-stress
tolerance. BMC Plant Biol 13(1):193
18. Miki D, Itoh R, Shimamoto K (2005) RNA
silencing of single and multiple members in a 30. Liu Y, Schiff M, Dinesh-Kumar SP (2002)
gene family of rice. Plant Physiol 138(4): Virus-induced gene silencing in tomato. Plant
1903–1913 J 31(6):777–786
19. Baulcombe DC (1999) Fast forward genetics 31. Senthil-Kumar M, Mysore KS (2014) Tobacco
based on virus-induced gene silencing. Curr rattle virus-based virus-induced gene silencing
Opin Plant Biol 2(2):109–113 in Nicotiana benthamiana. Nat Protoc 9(7):
1549–1562
20. Bernacki S, Karimi M, Hilson P, Robertson N
(2010) Virus-induced gene silencing as a 32. Tripathy JN, Zhang J, Robin S, Nguyen TT,
reverse genetics tool to study gene Nguyen HT (2000) QTLs for cell-membrane
function. In: Plant developmental biology. stability mapped in rice (Oryza sativa L.) under
Springer, New York, pp 27–45 drought stress. Theor Appl Genet 100(8):
1197–1202
21. Ramegowda V, Senthil-Kumar M,
Udayakumar M, Kirankumar SM (2013) A 33. Bao H, Chen X, Lv S, Jiang P, Feng J, Fan P
high-throughput virus-induced gene silencing et al (2015) Virus-induced gene silencing
protocol identifies genes involved in multi- reveals control of reactive oxygen species accu-
stress tolerance. BMC Plant Biol 13(1):193 mulation and salt tolerance in tomato by
γ-aminobutyric acid metabolic pathway. Plant 35. Ghosh A, Pareek A, Singla-Pareek SL (2015)
Cell Environ 38(3):600–613 Leaf disc stress tolerance assay for tobacco.
34. Li F, Wu QY, Sun YL, Wang LY, Yang XH, Bio-protocol 5(7):e1440
Meng QW (2010) Overexpression of chloro- 36. Verslues PE, Agarwal M, Katiyar-Agarwal S,
plastic monodehydroascorbate reductase Zhu J, Zhu JK (2006) Methods and concepts
enhanced tolerance to temperature and methyl in quantifying resistance to drought, salt and
viologen-mediated oxidative stresses. Physiol freezing, abiotic stresses that affect plant water
Plant 139(4):421–434 status. Plant J 45(4):523–539
Chapter 13
A Method for Developing RNAi-Derived Resistance

in Cowpea Against Geminiviruses
Sanjeev Kumar, Sunil Kumar Mukherjee, and Lingaraj Sahoo
Abstract
In plants, RNA interference (RNAi) is triggered by double-stranded RNA (dsRNA). Accordingly, various
RNA silencing technologies involving hpRNA, artificial microRNA (miRNA), and virus-induced gene
silencing (VIGS) are used for controlling the expression of genes. Such manipulations help understanding
gene functions and crop improvement biotechnology. A typical hpRNA construct is comprised of an intron
splicable perfect inverted repeat of the target gene sequences under the control of a strong promoter.
Geminiviruses, especially Mungbean Yellow Mosaic India Virus (MYMIV) cause devastating diseases in
legume plants including cowpea, incurring severe crop loss. RNAi, involving hpRNA construct as trans-
gene, is used to control these diseases at the early stages of geminivirus infection in the host, preventing
symptom development and viral DNA accumulation. In this chapter, we describe a detailed protocol for the
identification of geminivirus isolates from the filed grown cowpea plants, characterization of virus isolates
under the laboratory conditions, design and construct RNAi vectors for effective suppression of viral target
genes, and consequent development of transgenic cowpea using Agrobacterium-mediated transformation
protocol. These transgenics are subsequently evaluated for resistance to MYMIV.
Key words RNAi, Cowpea, Agrobacterium tumefaciens-mediated, Genetic transformation, MYMIV,

siRNA, Vigna unguiculata
1 Introduction
Geminiviridae is a large family of small circular single-stranded

DNA viruses, containing mono- or bipartite genomes and charac-
terized by the unique morphology of their icosahedral geminate
capsids with a unique morphology. Geminiviridae is divided into
nine genera, based on their genome structure (monopartite or
bipartite), transmission by insect vectors (whitefly, treehopper, leaf-
hopper or aphid), host selection (monocotyledonous or dicotyle-
donous), and phylogenetic origin of the species [1]. Geminiviruses
infect a wide range of plant species and pose severe damages and
crop loss in many agriculturally important crops including maize,
cotton, beans, tomato, cassava, okra, potato, cabbage, and Asiatic
191
192 Sanjeev Kumar et al.
grain legumes (cowpea, mungbean, and urdbean). The disease

symptoms caused by geminiviruses typically consist of leaf curling,
mosaic, mottle, vein yellowing, or leaf yellowing as well as chlorosis,
crumpling, and rugosity. Infected plants are often stunted, particu-
larly when infected early in development resulting in a substantial
reduction in yield. Current climate change brings more risks in
altering the insect vector distribution throughout the globe, posing
a significant threat to agriculture worldwide. Recently, two major
species of geminiviruses, belonging to the Begomovirus genus, the
monopartite Tomato yellow leaf curl virus (TYLCV) and the bipar-
tite African cassava mosaic virus (ACMV), have been included in
the top ten list for economically important plant viruses [2].
Cowpea is an important grain and fodder legume of Sub
Saharan Africa and Asia [3, 4]. The grains are a major source of
dietary protein f millions of rural and urban populace [5–7]. The
leaves and crop residues are an invaluable source of fodder for
livestock. However, cowpea production in the regions where the
crop is best adapted suffers from severe losses (10–100%) due to
virus infection [8]. To date, more than 140 viral strains have been
reported to infect cowpea, and 20 of them are known to have
widespread distribution and cause a severe infection resulting in
significant yield loss [9–11]. In India, cowpea is mostly affected by
severe leaf curl diseases and golden mosaic disease (CGMD) caused
by different isolates of Mungbean yellow mosaic India virus
(MYMIV) [12–15]. The annual yield loss due to viral diseases in
legumes including cowpea accounts for approximately $300 mil-
lion [16]. To date, there are no natural sources of resistance to
MYMIV known in cowpea, therefore, resistance breeding is diffi-
cult to achieve. RNAi strategy has emerged as an efficient and
widely adopted method to control begomoviruses infection in
various crops including legumes [17–23]. RNAi is also known as
Post-Transcriptional Gene Silencing (PTGS), in which the target
RNA degradation occurs in a sequence-specific manner post-
formation of double-stranded RNA, and its processing into small-
interfering RNAs (siRNA) by the Dicer-Like (DCL) proteins and
the RNA-Induced Silencing Complex (RISC) [24–29]. RNAi-
based gene silencing can be triggered in the target organism by
delivering RNAs in two forms: (1) dsRNA molecules or (2) small
RNAs (sRNAs). Currently, there are two major classes of small
RNAs (sRNAs) acting on the RNAi pathway: small-interfering
RNAs (siRNAs) and microRNAs (miRNAs). MiRNAs are endoge-
nously derived and involved in the regulation of gene expression,
while siRNAs can be of exogenous origin from viruses or artificial
supply [30, 31]. Delivery of dsRNA or sRNAs can be made either
transgenically or by non-transgenic means.
It has been earlier reported that, in most cases, insects take up
dsRNAs longer than 50 bp but not sRNAs [32], although some
studies have shown that sRNA can trigger gene silencing
A Method for Developing RNAi-Derived Resistance in Cowpea Against Geminiviruses 193
[33]. Once the RNA molecules are delivered in the field by

non-transgenic means, they need to enter inside the cellular cytosol
of a target organism to trigger gene silencing. This process can
occur through either direct or indirect uptake. Direct uptake occurs
when the RNA molecules are taken up through topical contact or
feeding of dsRNA bearing bacteria on plant tissues. By contrast,
indirect uptake of RNA molecules involves first entering into the
plant vascular system and then uptake by the insect/pathogen
[34]. The indirect uptake is also sometimes called as host induced
gene silencing.
A number of RNAi pathways use dsRNAs to generate small
RNAs (sRNAs) depending on the organism undergoing silencing.
In insects and fungi, the siRNA pathway is activated only when the
dsRNA molecules are present inside or as a result of a direct siRNA
supply [35, 36]. Once the dsRNAs are recognized inside the cell,
dsRNAs are processed into siRNA fragments of 20 base pairs
(bp) in length by a ribonuclease III enzyme called Dicers or
Dicer-like enzymes (DCL). Further, the siRNA fragments are
incorporated into the RISC complex (RNA-induced Silencing
Complex), which contains the Argonaute 2 (AGO-2) protein.
After unloading the non-incorporated passenger strand, the
whole complex binds with complementary mRNA in a sequence-
specific manner, slicing it, or preventing it to translate [37, 38].
In this chapter, we describe the protocols for the development
and characterization of developing Agroinfectious dimeric clones
followed by their, agroinoculation in cowpea leaves, detection of
viral particles in the infected plants. We also describe the construc-
tion of RNAi gene silencing vectors, the generation of transgenic
cowpea overexpressing hpRNA, and the evaluation of hpRNAi
cowpea lines for MYMIV resistance.
2 Materials
2.1 Plant Material Seeds of a commercially grown cultivar of cowpea in India cv. Pusa
Komal (procured from Indian Agricultural Research Institute, New
Delhi) was used for plant transformation.
2.2 Agrobacterium A. tumefaciens strain EHA105 harboring the RNAi binary vector
tumefaciens Strain pART27 were used for cowpea transformation and pCAM-
and Vector BIA3300 for the construction of agroinfectious dimers. The
T-DNA of pART27 includes nptII (neomycin phosphotransferase)
plant selectable marker gene, driven by CaMV 35S promoter.
The intron containing hpRNA vector, pKANNIBAL was used
as a base vector for developing the final silencing vector. For the
construction of final RNAi constructs, inverted repeats of viral
target sequences were employed that were interrupted by Pyruvate
dehydrogenase kinase (PDK) intron.
2.3 Stock Solutions All media components were prepared fresh on a monthly basis and
stored at 4 C.
2.3.1 MES Buffer for 1. MES Buffer (0.5 M)—per liter: Dissolve 97.62 g of MES free
Agroinfiltration acid (mw. ¼ 195.24 g/mol) in 750 mL of dH2O and adjust the
desired pH 6.0 using 10 N NaOH. Adjust the final volume of
1 L with sterile dH2O. Filter sterilize or autoclave and store at
4 C.
2. 1 M Magnesium chloride (MgCl2): Dissolve 203.3 g of
MgCl2·6H2O in 800 mL of sterile dH2O. Adjust the volume
to 1 L with sterile dH2O. Dispense into aliquots and sterilize by
autoclaving.
2.3.2 Media Components 1. MS major salts (10), per liter: Dissolve 19.0 g/L KNO3,
16.5 g/L NH4NO3, 3.7 g/L MgSO4·7H2O, 4.4 g/L
CaCl2·2H2O, and 1.7 g/L KH2PO4 in 1 L dH2O.
2. MS minor salts (100), per liter: Dissolve 2.2 g/L
MnSO4·4H2O, 83 mg/L KI, 620 mg/L H3BO4, 860 mg/L
ZnSO4·7H2O, 2.5 mg/L CuSO4·5H2O, 25 mg/L
NaMoO4·2H2O, and 2.5 mg/L CoCl2·6H2O in 1 L dH2O.
3. Iron Fe stock (200): Dissolve 7.45 g of Na2EDTA (ethyle-
nediaminetetraacetic acid, disodium salt) in 500 mL dH2O and
5.57 g of FeSO4 in 500 mL dH2O separately. Boil Na2EDTA
solution and add FeSO4 solution to it, gently by stirring.
4. B5 vitamin stock (100), per liter: Dissolve 100 mg/L nico-
tinic acid, 100 mg/L pyridoxine·HCl, and 1.0 g/L thiami-
ne·HCl in 1 L dH2O.
5. MS vitamin stock (200), per liter: Dissolve 20 mg/L thiami-
ne·HCl, 100 mg/L niacin, 400 mg/L glycine, and 100 mg/L
pyridoxine·HCl in 1 L dH2O.
6. AB buffer (20): Dissolve 60 g/L K2HPO4 and 20 g/L
NaH2PO4 in dH2O, adjust pH to 7.0 using either 1 N
NaOH or 1 N HCl, as required, and then autoclave.
7. AB salts (20): Dissolve 20 g/L NH4Cl, 6 g/L
MgSO4·7H2O, 3 g/L KCl, 0.2 g/L CaCl2, and 50 mg/L
FeSO4·7H2O in dH2O and then autoclave.
2.3.3 Phytohormone 1. Kinetin: Prepare the 1 mM stock solution y by dissolving

Stocks 21.53 mg of kinetin salt in a few drops of 1 N NaOH, make
up the volume to 100 mL with dH2O, filter sterilize, and store
at 20 C.
2. 6-Benzylaminopurine (BAP): Prepare 1 mM stock solution of
1 mM by dissolving 22.52 mg of BAP salt in a few drops of 1 N
NaOH, then make up the volume to 100 mL with dH2O, filter
sterilize, and store at 20 C.
3. Indole-3-butyric acid (IBA): Prepare 1 mM stock solution by

dissolving 20.04 mg of IBA salt in few drops of 1 N NaOH/
ethanol, then make up the volume to 100 mL with dH2O, filter
sterilize, and store at 20 C.
4. Thidiazuron (TDZ): Prepare 1 mM stock solution by dissol-
ving 22.02 mg of thidiazuron salt in a few drops of 1 N NaOH,
then make up the volume to 100 mL with dH2O, filter sterilize,
and store at 20 C.
2.3.4 Antibiotic Stocks 1. Kanamycin sulfate: Prepare 100 mg/mL stock solution by
dissolving 500 mg of kanamycin sulfate salt in 5 mL of sterile
dH2O, filter sterilize, and store at 20 C.
2. Cefotaxime: Prepare 250 mg/mL stock solution by dissolving
250 mg of cefotaxime salt in dH2O, filter sterilize, and store at
20 C. For rinsing infected explants, prepare a stock solution
of cefotaxime (500 mg/L), filter sterilize and store at 20 C.
3. Rifampicin: Prepare 10 mg/mL stock solution by dissolving
50 mg of rifampicin salt in few drops of DMSO, then make up
the volume by adding sterile dH2O, filter sterilize, and store at
20 C.
2.3.5 Other Solutions 1. Resuspension Buffer: Add 10 mM MgCl2, and 10 mM MES

[pH 5.6] buffer in 750 mL of sterile dH2O, raise the volume up
to 1 L, and finally add 100 μM acetosyringone in the buffer
before use.
2. Phosphate Buffer: Add 2.40 g of potassium di-hydrogen phos-
phate (KH2PO4), 5.40 g of potassium hydrogen phosphate
(K2HPO4) in 1000 mL of sterile dH2O and autoclave. Add
1.56 mL of β-mercaptoethanol after autoclaving before use.
3. Acetosyringone: Prepare 100 mM stock solution by dissolving
0.392 g acetosyringone (3,50 -dimethoxy-4-
0
-hydroxyacetophenone) in 10 mL dimethyl sulfoxide
(DMSO), filter sterilize, and store at 20 C.
4. Mercuric chloride (HgCl2): 0.2% (w/v) solution.
2.4 Culture Media 1. LB solid medium: Dissolve 25 g of LB powder in 1 L of

dH2O. Add 15 g/L agar-agar, autoclave, cool to about
2.4.1 For Agrobacterium
55 C, and add 50 mg/L kanamycin, 10 mg/L rifampicin for
tumefaciens
the selection of vector and Agrobacterium.
2. LB liquid medium: Dissolve 25 g of LB powder in 1 L of
dH2O. Autoclave, cool to about 55 C, and add 50 mg/L of
kanamycin, 10 mg/L of rifampicin for the selection of vector
and Agrobacterium.
3. AB-minimal medium: Combine 50 mL sterile 20 AB buffer

and 50 mL sterile 20 AB salts in 900 mL sterile D-glucose
(final concentration of D-glucose in 1 L is 0.5%.
4. YEP medium: Suspend 21.50 g in 1000 mL of sterile dH2O.-
Heat to boiling to dissolve the medium completely. Sterilize by
autoclaving at 15 lbs. pressure (121 C) for 15 min.
2.4.2 For Cowpea 1. MSB5 medium (MS major: MS minor: Fe stock: B5 vitamin 20:
Transformation 2:1:2, myoinositol 100 mg/L): For 1 L, add 100 mL of 10
major salts, 10 mL of 100 MS minor salts, 5 mL of 200 Fe
stock, 10 mL of 100 B5 vitamin stock, and 100 mg
myoinositol.
2. MS medium (MS major: MS minor: Fe stock: MS vitamin ¼ 20:
2:1:1, myoinositol 100 mg/L): For 1 L, add 100 mL of 10
MS major salts, 10 mL of 100 MS minor salts, 5 mL of 200
Fe stock, 10 mL of 100 MS vitamin stock, and 100 mg
myoinositol.
3. Germination medium (GM): MSB5 medium supplemented
with 3% (w/v) sucrose, and solidified with 0.8% (w/v) agar-
agar. Adjust pH to 5.8 with 1 N NaOH or 1 N HCl, autoclave,
and add TDZ to a concentration of 5 μM.
4. Shoot induction and selection medium (SISM (1): MSB5
medium supplemented with 5 μM BAP, 3% (w/v) sucrose,
and solidified with 0.8% (w/v) agar-agar. Adjust pH to 5.8
with 1 N NaOH or 1 N HCl and autoclave.
5. Shoot induction and selection medium (SISM (2): MSB5
medium containing 5 μM BAP, 20 g/L mannose, 5 g/L
sucrose, and 0.8% (w/v) agar–agar. Adjust pH to 5.8 with
1 N NaOH or 1 N HCl and autoclave.
6. Shoot induction, elongation, and selection medium (SIESM):
MS medium supplemented with 2.5 μM BAP, 0.5 μM of kine-
tin, 3% (w/v) sucrose, and solidified with 0.8% (w/v) agar–
agar. Adjust pH to 5.8 with 1 N NaOH or 1 N HCl, autoclave,
and add 150 mg/L kanamycin and 500 mg/L cefotaxime for
selection.
7. Liquid plant growth medium (LPGM): MS medium supple-
mented with 1 μM BAP, and 3% (w/v) sucrose. Adjust pH to
5.5, autoclave, and store at room temperature. Add 100 μM
acetosyringone during infection.
8. Rooting medium (RM): MS medium supplemented with
2.5 μM IBA, 3% (w/v) sucrose, and solidified with 0.8%
(w/v) agar–agar. Adjust pH to 5.8 with 1 N NaOH or 1 N
HCl, autoclave, and add 500 mg/L cefotaxime.
3 Methods
3.1 Collection of 1. To investigate the occurrence of viral disease in major agro-

Symptomatic Virus- climatic zones in India, we surveyed in five major states; Uttar
Infected Plant Pradesh, Madhya Pradesh Jharkhand, Chhattisgarh, and Assam
Materials and during 2012–2013 at different time intervals in various field
Extraction of Genomic locations (August–December) [39, 40].
DNA 2. The samples were collected from field infected cowpea plants
exhibiting stunted growth, severe leaf curling, reduced leaf
size, yellow patches and distortion of leaf lamina symptoms
for sampling.
3. Infected leaf materials collected from many different plants
were processed for genomic DNA isolation. Total genomic
DNA was isolated from infected samples by cetyltrimethylam-
monium bromide (CTAB) method.
3.2 Rolling Circle 1. The full-length viral genomic components (DNA-A and
Amplification DNA-B) were amplified from the isolated genomic DNA
using the Rolling circle amplification (RCA) [41] based Tem-
pliPhi™ DNA amplification kit (GE Healthcare) as per manu-
facturer’s instruction.
2. The resultant concatemeric RCA products were monomerized
by restriction digestion with appropriate restriction enzymes.
Aliquots of 3 μL of RCA products were digested independently
with five suitable restriction enzymes BamHI, HindIII, EcoRI,
SacI, and EcoRV (Thermo Scientific FastDigest, USA).
3.3 Cloning of Viral 1. The digested products were resolved on 1% agarose gel and the
DNA Components bands corresponding to ~2.7 kb genomes (DNA-A and
DNA-B genomes) were purified as per the standard procedure.
The 2.7 kb fragment of DNA-A or 2.6 kb of DNA-B were
cloned into the pUC18 vector. We also looked for satellite
DNA bands in the agarose gel but did not find any. Thus the
two genome components were solely responsible for the dis-
ease symptoms.
2. The recombinant clones were confirmed by PCR and restric-
tion digestion. The recombinant clones were purified using
SureTrap Plasmid Mini Kit (Genetix, India) and sequenced
commercially (Eurofins, Bangalore).
3.4 Identification of 1. The full-length sequences were obtained, either by combining

Cowpea Isolates of the sequencing results of two or three portions of the genomes
Begomoviruses or sequenced full-length fragments using a primer walking
strategy. The obtained sequences were analyzed using the soft-
ware Mega 5.2.2 (5130611), BIOEDIT version 7.0
programs [42].
2. Database searches with begomovirus sequences were carried

out by NCBI-BLAST program (http://blast.ncbi.nlm.nih.
gov). Nucleotide (nt) and amino acid (aa) sequence alignments
were performed for each component from various begomo-
virus isolates using CLUSTALW program using Mac Vector
software (v11.1.2; MacVector Inc., USA).
3. A total of 13 components, including complete sequences of
6 DNA-A, 6 DNA-B, and 1 complete genome component
were identified, belonging to four strains of MYMIV, each of
CGMV and FbSLCV.
3.5 Construction of 1. To check the infectivity of begomovirus isolate, a high-fidelity

Agroinfectious Dimeric PCR-based strategy was adopted for making agroinfectious
Clones dimeric clones of MYMIV DNA-A [KY556679] and DNA-B
[KY556680].
2. Two different sets of abutting primers specific for amplification
of complete MYMIV-DNA-A and MYMIV-DNA-B genomic
components of the virus isolate was designed and commercially
synthesized by adding appropriate restriction enzyme sites on
both primer ends for the ease of cloning.
3. The PCR product was purified as per the manufacturer’s
instruction (Suretrap PCR/gel extraction kit; Genetix—USA)
followed by cloning into commercially available TA cloning
vector such as pTZ57R/T (Thermo Scientific, USA).
4. The ligated clones were confirmed by colony PCR, restriction
digestion, and sequencing. Subsequently, the 2.7 kb cloned
fragment from the recombinant pTZ57R/T clone of DNA-A
was cloned in a plant binary vector (pCAMBIA3300) using the
same restriction sites and named as pC-A0 .
5. Another earlier cloned 2.7 kb fragment of viral DNA (RCA
fragment ~2.7 kb cloned in pUC-18 vector) were released and
subcloned in pC-A0 with the same enzyme sites to generate a
complete DNA-A dimer into the plant binary vector (pC-A0 ) in
head to tail fashion (named as pC-2.0 A).
6. The orientation of the dimeric clones of DNA-A was confirmed
by restriction digestion using the unique cutter MfeI, present in
viral DNA sequence [39].
7. For the construction of DNA-B dimeric clone, a similar strat-
egy was followed by designing two abutting primer from both
ends of MYMIV-DNA-B to amplify the entire sequences.
8. The resulting PCR products were gel-purified as per the stan-
dard procedure and subsequently cloned into commercially
available TA vector such as pTZ57R/T (Thermo Scientific,
USA), further the recombinant clones were confirmed by the
colony PCR, restriction digestion, and sequencing.
9. Like that of the preparation of pC-A0 , the TA vector cloned

2.6 kb fragment of DNA-B were subcloned in a plant binary
vector (pCAMBIA3300) with the same restriction sites and the
clone was named as pC-B0 .
10. Subsequently, the earlier cloned 2.6 kb fragment of viral DNA
(RCA fragment ~2.6 kb cloned in pUC18) was released and
subcloned in pC-B0 to generate the dimeric clone of MYMIV-
DNA-B (named as pC-2.0B). Insert integrity and orientation
were confirmed by restriction digestion using the unique inter-
nal cutter [39].
3.6 Mobilization of 1. Both the dimeric clones, pC-2.0A and pC-2.0B were mobi-
Dimeric Clones to lized into suitable A. tumefaciens strain, such as EHA105, by
Agrobacterium electroporation or triparental mating.
tumefaciens 2. Agrobacterium transconjugants were confirmed by colony
PCR using the internal primers specific of DNA-A and
DNA-B genome. The empty plant binary vector mobilized
into Agrobacterium was used as a negative control for mock
inoculation.
3.7 Method of 1. Young cowpea leaves showing typical Yellow Mosaic Disease
Inoculation of (YMD) symptoms were collected. The leaf samples were
Infectious Dimeric ground in a chilled mortar and pestle using inoculation buffer
Clones into Cowpea such as phosphate buffer (0.05 M; pH 7.0).
3.7.1 Sap Inoculation
2. One gram of leaf tissue was ground in 10 mL of phosphate
buffer. After complete homogenization, the pulp was squeezed
through two layers of muslin cloth and the whole filtrate was
used as inoculum. Before inoculation, a small quantity of fine
carborundum powder (600 mesh) was dusted over to the leaf
surfaces.
3. The inoculum was rubbed on the upper leaf surface with the
help of cotton wool previously dipped in the inoculum. During
inoculation, the leaves were supported from below with left-
hand palm to avoid any injury and assure uniform pressure and
spread of the inoculum.
4. The inoculated leaves were washed immediately with a fine jet
of distilled water using a wash bottle to remove excess residual
inoculum and carborundum powder. The inoculated plants
were maintained in an insect-proof glasshouse for up to seven
weeks to observe for symptoms. The uninoculated controls
were also maintained in the same condition (Notes 1–6).
3.7.2 Agroinfiltration of 1. To check the infectivity into the test plants, Agrobacterium
Infectious Dimers cultures were grown at 28 C in liquid YEP medium
(pH-7.0 0.2) containing kanamycin (50 μg/mL), rifampicin
Fig. 1 Agroinfiltration of dimeric clones and symptom development in cowpea: (a) 3 weeks old cowpea plants
grown under greenhouse condition (fully expanded trifoliate leaf); (b) after agroinfiltration of dimeric clones
(the infiltrated zones marked with red circle); (c) development of viral symptoms after 3 weeks of
agroinoculation
(20 μg/mL) with constant agitation at 180 rpm to reach

OD600 ¼ 0.8.
2. Overnight grown cultures were harvested at 5000 rpm for
15 min at 4 C and resuspended in MES buffer [10 mM 2-
(N-morpholino) ethanesulfonic acid (MES), 10 mM Magne-
sium chloride (MgCl2)] and used for agroinfiltration in three
different combinations, in first one, only Agroinfectius dimer
of pCDNA-2A, in second only Agroinfectius dimer of
pCDNA-2B and the third, the mixture of both pCDNA-2A
and pCDNA-2B were used.
3. Cowpea (Vigna unguiculata) cv. Pusa Komal plants were
grown in soil: compost (1:1) inside a temperature-controlled
greenhouse maintained at 25 2 C and a 16/ 8 h light/dark
cycle. At the stage of 6–8 trifoliate leaves, cowpea plants were
used for agroinfiltration using both the agroinfectious dimer
constructs in combinations at equimolar concentrations [39].
4. A total of 4–5 mL of bacterial culture was infiltrated per plant,
in 2–3 fully expanded trifoliate leaves using a needless syringe
(Fig. 1).
5. Plants were maintained in dim light or dark at 23 C under high
humidity for 1–2 days.
6. A total of five plants were used for each agroinfiltration experi-
ments and agroinfiltrated plants were maintained in an insect-
free greenhouse at 16/8 h photoperiod for 2–3 months to
observe the symptoms, periodically [39][Notes 7–10].
3.7.3 Insect Bioassay 1. Controlled infestations of whiteflies were established on differ-

ent host plants for bioassays. Approximately 100 adult white-
flies per host plant colony were transferred to uninfested plants
and maintained in a separate cage (60 40 40 cm) for 24 h
oviposition at 25 1 C, and 16/8 h photoperiod, after which
adult whiteflies were removed [43].
2. The resulting nymphs were maintained on each host plant for
10 days, till the F1 second instars get observed. The plants
could be manually adjusted to 50 nymphs per leaf for confor-
mity prior to tests.
3. The bioassays can be conducted to evaluate the infectivity of
whiteflies onto the host plant. In the study, whitefly nymphs
can be exposed in various numbers to assess the effect of white-
flies on virulence. The wetting agent Tween 20 can be used at
0.1% v/v in all cases; control plants can be treated with water/
transformation buffer plus wetting agent alone.
3.8 RNAi in Plants 1. The RNAi constructs were designed to trigger RNAi-mediated
resistance through the expression of short hairpin RNAs in
3.8.1 Construction of
transgenic plants.
RNAi Vectors
2. Three hairpin constructs spanning the conserved regions of
RNAi-suppressors like AC2, AC4, and fusion (AC2 + AC4
stack) ORFs of seven cowpea infecting begomoviruses were
made. The conserved sequences of AC2 (186 nt) and AC4
ORFs (197 nt) were amplified by polymerase chain reaction
(PCR) from the DNA-A genome of MYMIV cowpea isolate.
3. Both of the fragments were cloned in sense orientation, by
adding the restriction sites for the ease of cloning (XhoI and
KpnI), and in antisense orientation, at the restriction sites
(XbaI and ClaI), interrupted by Pdk intron of the intermediate
vector, pKANNIBAL (CSIRO, Plant Industry, Canberra,
Australia) (Fig. 2a, b).
4. For the construction of AC2 + AC4 stack RNAi construct, the
sense fragments of AC2 (XhoI and EcoRI) and AC4 (EcoRI and
KpnI) were interrupted by 8 nt gap, and antisense fragments of
AC2 (XbaI and BamHI) and AC4 (BamHI and ClaI) were
similarly interrupted by 8 nt gaps. These fragments were cloned
on either side of the Pdk intron of pKANNIBAL (Fig. 2c).
5. For generating stable transgenic cowpea lines, the RNAi con-
structs under the control of CaMV35S promoter and OCS
terminator (as NotI fragments) were subcloned into the plant
binary vector, pART27 (CSIRO, Plant Industry, Canberra,
Australia) (Fig. 2d) [23].
Fig. 2 Schematic map for the construction of hairpin RNAi constructs in binary vector pART27. CaMV 35SP
Cauliflower mosaic virus 35S promoter, OCS terminator octopine synthase terminator, PDK intron pyruvate
dehydrogenase kinase intron, Restriction enzyme NotI were used for cloning of all the three RNAi cassettes
from the intermediate RNAi vector pKANNIBAL into the plant transformation binary vector pART27
3.9 Generation of 1. Healthy seeds of YMD susceptible, commercially grown Cow-

hpRNA Cowpea pea cultivar, Pusa Komal were used in this study.
Transgenic Lines 2. The round and healthy seeds were selected for surface-
3.9.1 Seed Sterilization sterilization with 0.2% mercuric chloride (w/v) for 5 min,
and Germination rinsed 5–6 times with sterile deionized water, and cultured on
seed germination medium.
3. The seed cultures in the plankton boxes were incubated at
25 C for 4 days in 25 2 C under 16-h photoperiod with a
photosynthetic photon flux density (PPFD) of 50 μmol/m2/
s provided by 40 W cool white fluorescent lamps (Fig. 3a)
3.9.2 Preparation of 1. All three RNAi constructs, mobilized to Agrobacterium, were

Agrobacterium Culture and streaked on LB media containing appropriate antibiotics and
Inoculation of Explants incubated at 28 C for 2 days.
2. A single bacterial colony was inoculated into 25 mL of liquid
AB-minimal medium with appropriate antibiotics to select the
binary plasmid and agitated overnight at 28 C on a rotary
shaker at 180 rpm, until the optical density at 600 nm
reaches 0.8.
3. The liquid culture was transferred to a centrifuge tube, and the
cells were pelleted by spinning for 10–15 min at 4 C for
6840 g.
4. The supernatant was decanted and the cell pellet was resus-
pended in an equal volume of freshly prepared 5% LPGM
solution containing 100 μM acetosyringone. The bacterial
cell density was adjusted, if necessary, by further dilution to
achieve OD 600 ¼ 0.6–0.8.
Fig. 3 Agrobacterium-mediated transformation of cowpea cv. PUSA Komal and regeneration of hpRNA lines:
(a) Seeds germinated on seed germination medium, (b) 4 days old germinated seedlings used for transfor-
mation, (c) Cotyledonary node explants excised from 4 days old germinated seedling, (d) Untransformed
Cotyledonary node explants on kanamycin containing medium (bar 1 mm), (e) Multiple shoot bud induction
from transformed cotyledonary node explants cultured on kanamycin containing medium (bar 1 mm), (f)
Multiple elongated transformed shoots selected on selection medium (bar 5 mm), (g) Transformed shoot on
rooting medium (bar 2 cm), (h) Putative transformed plant (bar 10 cm), (i) T1 and T2 cowpea progeny plants
growing in transgenic greenhouse containment
5. The cotyledonary node explants (5–6 mm) were excised by

decapitating epicotyls as close as possible and hypocotyls
3 mm below the nodal region (Fig. 3b, c) [44–46].
6. The cotyledonary node explants were transferred to a petri dish
(100 mm 20 mm) containing Agrobacterium suspension,
sealed with parafilm, and incubated for 30 min on a rotary
shaker at 22 C for 90 rpm.
3.9.3 Cocultivation, 1. The explants were blot dried on sterile filter paper and
Selection, and co-cultivated in petri dish lined with filter paper, moistened
Regeneration with LPGM supplemented with 100 μM acetosyringone for
3 days under 16-h photoperiod at 22 C.
2. Following cocultivation, the explants were washed 5–6 times
with sterile dH2O and blot dried on sterile filter paper.
3. The explants were cultured on SISM supplemented with
150 mg/L kanamycin and 500 mg/L cefotaxime for shoot
bud induction and selective regeneration of transformants
(Fig. 3d, e).
4. After 1 week, the cultures were transferred to SIESM, and
maintained for 3 weeks for optimal induction, elongation,
and selective regeneration of transformants.
3.9.4 Rooting and 1. The elongated shoots were transferred to a rooting medium
Hardening of Transformed (RM) (Fig. 3f).
Plants 2. The putative transformed plants were established in soil: com-
post (1:1) and grown to maturity in a greenhouse containment
facility [Notes 11–14].
3. The transgenic plants were covered by transparent plastic bags
to maintain high humidity and maintained in the greenhouse.
4. The plants were irrigated with tap water periodically for the first
2 weeks followed by the nutrient solution. The plastic bags
were gradually removed to reduce the humidity level and the
plants were irrigated with tap water 4–5 times a week (Fig. 3g).
5. Cowpea plants normally flowered after 45 days of transfer to
the greenhouse. Mature seeds were harvested within
2–3 months. The seeds were grown in soil to raise the T1 plants
and seeds were collected for segregation study (Fig. 3h) [47].
3.10 Molecular 1. Genomic DNA was isolated from non-transformed (WT) and
Characterization of putative transformed cowpea plants (T0, T1, and T2 genera-
Putative RNAi Plants tions) using the CTAB (cetyltrimethylammonium bromide)
method [48].
3.10.1 PCR and Southern
Blotting Analysis
2. The PCR was performed in a thermal cycler (Bio-Rad, USA) to
detect the presence of nptII, AC2 and AC4 transgenes in
putative T0 (or other generations) transformed cowpea plants.
Primers specific to the target genes (nptII, AC2 and AC4) were
used to amplify the products.
3. The PCR products were analyzed under UV light after electro-
phoresis on a 1% agarose gel and staining with ethidium
bromide.
4. Molecular analysis confirmed twenty-seven transgenic T0 lines
from RNAi-AC2 construct, 34 lines from RNAi-AC4 con-
struct, and 36 lines from RNAi-AC2 + AC4 stacked construct.
5. For Southern hybridization, the genomic DNA was isolated
from the WT and T0 PCR positive plants using NucleoSpin
Plant II Maxi (Takarabio, Clontech, Japan).
6. The purified genomic DNA (~60 μg) were processed for
restriction digestion with EcoRI (Thermo Fisher Scientific,
USA) and resolved on 0.8% agarose gel. The completely
digested and purified genomic DNA were blotted onto Zeta-
Probe membrane (Bio-Rad, Hercules, CA, USA) and hybri-
dized with the DIG-labeled 0.54 kb PCR product
corresponding to the coding region of nptII.
7. All the washing steps were followed according to the manufac-
turer’s instructions of the DIG Labeling and Detection kit
(Roche Diagnostics, Mannheim, Germany).
8. The plants in T1 and T2 generations were checked for trans-

gene segregation by PCR. The independent transgenic events
with segregating transgenes in all of their offspring (in the T1
and T2 generations) were considered as homozygous.
9. The DNA of the homozygous lines was Southern blotted in
order to select lines with single-copy transgene insertions. The
single-copy integrands were stable and not subjected to endo-
silencing processes.
3.10.2 siRNA 1. The siRNA accumulation analysis in control and transgenic

Accumulation Analysis in cowpea plants was performed by Northern blot hybridization.
Single-Copy Transgenic 2. Total RNA was isolated from leaves using TRIZOL Reagent
Cowpea Plants (Invitrogen, CA, USA). Approximately 50 μg of total RNA was
fractionated on a 15% PAGE gel containing 7 M urea, 1 Tris-
borate-EDTA (TBE), and electroblotted on a Hybond-N+
membrane (Amersham Pharmacia Biotech, Buckinghamshire,
U.K.).
3. The blot was hybridized with a probe specific to either AC2 or
AC4 using DIG High Prime DNA labeling and detection kit
(Roche Applied Science, Germany).
4. The membranes were washed and processed for the signal
detection using CDP-star (Roche Applied Science, Germany),
as described in the DIG system and the DIG application
manual.
5. The northern probes were obtained by cloning the MYMIV-
AC2 (186 bp) and MYMIV-AC4 (197 bp) segments in the
pGEM-T-Easy vector (and named as pGEM-T/AC2 and
pGEM-T/AC4).
6. The cloned segments of MYMIV-AC2 and MYMIV-AC4 were
subjected to in vitro transcription with T7 RNA polymerase for
sense strand and by SP6 RNA polymerase for antisense strand
using the DIG RNA labeling kit (Roche Applied Science,
Indianapolis, USA).
7. The AC2 and AC4 labeled transcripts [a mixture of sense
(T7) and antisense (SP6)] were hydrolyzed and denatured at
100 C for 5 min and then added to a fresh aliquot of DIG
Easy-hyb buffer, for hybridization of the membranes for 18 h at
42 C [49–51].
8. The hybridized blots were washed at 42 C in the rotatory
shaker and the chemiluminescence based signals were detected
using CDP-star as described in the DIG System and the DIG
Application Manual (Roche Applied Science,
Indianapolis, USA).
9. The transgenic lines that harbored siRNAs of 20–25 nt sizes
were later selected for virus challenge analyses.
3.10.3 RT-PCR Analysis 1. Total RNA was extracted using a NucleoSpin RNA Plant Kit
of Transgenic Cowpea (Takara, Clontech, Japan) from both control and transgenic
Plants plants that were challenged with MYMIV infectious clones,
and subjected to RT-PCR (RevertAid™ H Minus first-strand
cDNA synthesis, Fermentas, USA) using MYMIV per-coat
protein (AV2) specific primers.
2. The cowpea ubiquitin gene served as an internal control to
check the quality of cDNA synthesized in the RT-PCR.
3. The PCR products were visualized in 1.2% Agarose gel under
UV transilluminator.
4. The PCR products were not detected as the transgene RNAs
were diced giving rise to siRNAs which were detectable as
mentioned in the earlier section.
3.11 Transgenic 1. The MYMIV agroinfectious dimers of DNA-A and DNA-B

Plant Inoculation with were used for the inoculation to both control and transgenic
MYMIV and Symptom cowpea plants (T0, T1, and T2) under the greenhouse
Analysis conditions.
2. All the inoculated plants were maintained in the greenhouse for
symptom development and evaluation. Five plants from each
transgenic lines expressing hpRNA from RNAi constructs
(MYMIV-AC2, MYMIV-AC4, and MYMIV-AC2 + AC4) and
plants transformed with empty vector pART27 and WT plants
were used for each experiment.
3. Symptom evaluations were performed every alternate day for a
period of 10 weeks or until the development of complete
disease symptoms on control plants.
4. The symptomatic cowpea plants were photographed and pro-
cessed for molecular analysis through RCA, qRT-PCR, and
Northern blotting.
5. The disease symptoms were scored in each inoculated plant
using a scale of 0–5 and level of virus resistance was deter-
mined. Plants transformed with the empty vector pCAM-
BIA3300 (used for agroinfectious dimer preparation) served
as negative controls for each replicate of experiments.
3.12 Detection of 1. The viral DNA detection in control and transgenic lines were
Viral DNA in carried out in the uppermost leaf of infected plants by both
Transgenic Cowpea semi-quantitative and Real-time PCR, post 35 days of virus
Plants inoculation.
2. The precoat protein (AV2) specific primers were used to
amplify the internal fragment of AV2 to detect MYMIV viral
DNA regions. A pair of housekeeping cowpea ubiquitin pri-
mers were also used as an internal control to check the quality
of cDNA synthesized in the RT-PCRs.
3. The real-time qPCR was also performed with the AV2 specific
primers with cowpea ubiquitin as an internal control, using
USB VeriQuest SYBR Green qPCR Master Mix (2) (Affyme-
trix, USA) on a Rotor-Gene Q Real-Time PCR System (Qia-
gen, Germany). The whole experiment was repeated thrice
independently with three replicates each.
4. The standard curve was calculated for each sample relative to
the expression values. The relative expression of AV2 in WT and
transgenic cowpea lines was determined by normalizing the
expression values of AV2 with that of housekeeping cowpea
ubiquitin.
5. The transgenic plant lines displayed nearly complete resistance
showed an absence of viral DNA (<0.5- fold in mild symptom-
atic transgenic lines) while all MYMIV challenged WT plants
showed higher accumulation of AV2 transcripts (>2.0- fold).
3.13 Rolling Circle RCA was also performed to detect viral DNA components
Amplification (RCA) for (MYMIV DNA-A and DNA-B) in control and RNAi transgenic
Detection of Viral DNA lines, raised with all the three constructs, as per the manufacturer
Components instructions of Templiphi 100 amplification kit (GE Healthcare
Life Sciences, Pittsburgh, USA).
1. Total genomic DNA was extracted from all the virus inoculated
plants, and 100 ng of purified genomic DNA were used for this
assay.
2. The RCA amplified products were digested with MfeI, a unique
restriction site present in the genome of MYMIV DNA-A, and
with DraI, present in the genome of DNA-B, and the digested
products were resolved on 1% agarose gel [23].
3. The MfeI digested fragment of DNA-A (2.7 kb) and DraI
digested fragment of DNA-B (2.6 kb) were visualized under
UV transilluminator.
4. The respective 2.7 kb MfeI fragment of MYMIV-DNA-A and
2.6 kb DraI fragment of MYMIV-DNA-B were absent in all
the resistant transgenic lines while it was present in all WT,
MYMIV challenged plants.
4 Notes
1. Add Acetosyngone just before use during Agroinfiltration (sen-

sitive toward light and heat) [23].
2. During pressure infiltration, minimum pressure is required,
additional applied pressure may damage the leaf surface result-
ing in leakage of Agrobacterium suspension solution [39].
3. AB salt solution sometimes may show yellow precipitation after

autoclaving; this is due to ferrous salts precipitating out which
will get dissolved by shaking vigorously just before use [46].
4. HgCl2 is a highly hazardous chemical. Strict precautionary
measures should be followed in its handling as well as
disposal [46].
5. A. tumefaciens strain harboring the RNAi constructs must be
streaked regularly to keep it in activated form [23].
6. The culture should grow at least to mid-logarithmic phase or
close to the initial stationary phase for optimum transformation
efficiency [46].
7. During the cowpea transformation step, incubation for a pro-
longed period might cause necrosis in explant tissue leading to
no regeneration during selection [46].
8. Acetosyringone stock solution sometimes forms precipitation
while in storage which gets removed when it is brought to
room temperature [46].
9. Explant should be washed vigorously with cefotaxime to
remove Agrobacterium residuals [46].
10. The greenhouse should be maintained at 25 2 C, the
relative humidity of 60 5%, and 16-h photoperiod. The
light intensity should be maintained at a photosynthetic pho-
ton flux density (PPFD) of 240 μmol/m2/s provided by 40 W
cool white fluorescent lamps at 4 ft. above ground for optimum
results during acclimatization of transgenic cowpea plants or
development of viral symptoms in post-inoculation with
agroinfectious dimer constructs [23].
11. Special care should be taken toward newly transferred plants in
the greenhouse by strictly maintaining the humidity failing
which the plantlets may die [46].
12. During Southern and Northern hybridization, add the opti-
mum amount of probe as the excess amount of probe during
hybridization may create black background during image
development [23].
13. RNA isolation should be carried out at a neat and clean envi-
ronment. During the preparation of reagents, all RNAse free
ingredients should be used [23].
14. To germinate T1 seeds, sterilize the seeds and keep them in
water-soaked cotton placed in a petri dish (100 mm 20 mm)
for 2 days (dark). The germinated seedlings are then directly
transferred to pots in the greenhouse [23].
References
1. Zerbini FM, Briddon RW, Idris A et al (2017) 14. Surendranath B, Usharani KS, Nagma A et al
ICTV virus taxonomy profile: Geminiviridae. J (2005) Absence of interaction of genomic
Gen Virol 98(2):131 components and complementation between
2. Rybicki EP (2015) A top ten list for economi- Mungbean yellow mosaic India virus isolates
cally important plant viruses. Arch Virol in cowpea. Arch Virol 150(9):1833–1844
160(1):17–20 15. John P, Sivalingam PN, Haq QMI et al (2008)
3. Ehlers JD, Hall AE (1997) Cowpea (Vigna Cowpea golden mosaic disease in Gujarat is
unguiculata L. Walp). Field Crops Res 53: caused by a Mungbean yellow mosaic India
187–204 virus isolate with a DNA B variant. Arch Virol
4. Timko MP, Ehlers JD, Roberts PA (2007) 153(7):1359
Cowpea. In: Kole C (ed) Genome mapping 16. Varma A, Malathi VG (2003) Emerging gemi-
and molecular breeding in plants, vol nivirus problems: a serious threat to crop pro-
3. Springer, New York, pp 49–67 duction. Ann Appl Biol 142(2):145–164
5. Singh BB (2002) Recent genetic studies in 17. Day AG, Bejarano ER, Buck KW et al (1991)
cowpea. In: Fatokun CA, Tarawali SA, Singh Expression of an antisense viral gene in trans-
BB, Kormawa PM, Tamo M (eds) Challenges genic tobacco confers resistance to the DNA
and opportunities for enhancing sustainable virus tomato golden mosaic virus. Proc Natl
cowpea production. Internat Inst of Trop Agri- Acad Sci U S A 88(15):6721–6725
cul Ibadan, Nigeria, pp 3–13 18. Bendahmane M, Gronenborn B (1997) Engi-
6. Diouf D, Hilu KW (2005) Microsatellites and neering resistance against tomato yellow leaf
RAPD markers to study genetic relation- ship curl virus (TYLCV) using antisense RNA.
among cowpea breeding lines and local vari- Plant Mol Biol 33(2):351–357
eties in Senegal. Genet Res Crop Evol 52: 19. Aragão FJL, Ribeiro SG, Barros LMG et al
1057–1067 (1998) Transgenic beans (Phaseolus vulgaris
7. Xu P, Wu X, Wang B et al (2010) Development L.) engineered to express viral antisense RNAs
and polymorphism of Vigna unguiculata ssp. show delayed and attenuated symptoms to
unguiculata microsatellite markers used for phy- bean golden mosaic geminivirus. Mol Breed
logenetic analysis in asparagus bean [Vigna 4(6):491–499
unguiculata ssp. sesquipedialis (L.) Verdc]. 20. Zhang P, Vanderschuren H, Fütterer J, Gruis-
Mol Breed 25:675–684 sem W (2005) Resistance to cassava mosaic
8. Kareem KT, Taiwo MA (2007) Interactions of disease in transgenic cassava expressing anti-
viruses in cowpea: effects on growth and yield sense RNAs targeting virus replication genes.
parameters. Virol J 4(1):15 Plant Biotechnol J 3(4):385–397
9. Thottappilly G, Rossel HW (1992) Virus dis- 21. Haq QMI, Ali A, Malathi VG (2010) Engi-
eases of cowpea in tropical Africa. Int J of Pest neering resistance against Mungbean yellow
Manage 38(4):337–348 mosaic India virus using antisense RNA.
10. Kang BC, Yeam I, Jahn MM (2005) Genetics Indian J Virol 21(1):82–85
of plant virus resistance. Annu Rev Phytopathol 22. Patil BL, Bagewadi B, Yadav JS et al (2016)
43:581–621 Mapping and identification of cassava mosaic
11. Hema M, Sreenivasulu P, Patil BL et al (2014) geminivirus DNA-A and DNA-B genome
Tropical food legumes: virus diseases of eco- sequences for efficient siRNA expression and
nomic importance and their control. Adv Virus RNAi based virus resistance by transient agro-
Res 90:431–505 infiltration studies. Virus Res 213:109–115
12. Malathi VG, Surendranath B, Naghma A et al 23. Kumar S, Tanti B, Patil BL et al (2017) RNAi-
(2005) Adaptation to new hosts shown by the derived transgenic resistance to Mungbean yel-
cloned components of Mungbean yellow low mosaic India virus in cowpea. PLoS One
mosaic India virus causing cowpea golden 12(10):e0186786
mosaic in northern India. Can J Plant Pathol 24. Smith NA, Singh SP, Wang MB et al (2000)
27(3):439–447 Total silencing by intron-spliced hairpin RNAs.
13. Rouhibakhsh A, Malathi VG (2005) Severe leaf Nature 407(6802):319–320
curl disease of cowpea–a new disease of cowpea 25. Chuang CF, Meyerowitz EM (2000) Specific
in northern India caused by Mungbean yellow and heritable genetic interference by double-
mosaic India virus and a satellite DNA β. Plant stranded RNA in Arabidopsis thaliana. Proc
Pathol 54(2):259–259 Natl Acad Sci U S A 97(9):4985–4990
26. Wang MB, Abbott DC, Waterhouse PM to cowpea production in Assam. India World
(2000) A single copy of a virus-derived trans- Res J Biotechnol 3(1):53–56
gene encoding hairpin RNA gives immunity to 41. Haible D, Kober S, Jeske H (2006) Rolling
barley yellow dwarf virus. Mol Plant Pathol circle amplification revolutionizes diagnosis
1(6):347–356 and genomics of geminiviruses. J Virol Meth-
27. Waterhouse PM, Wang MB, Lough T (2001) ods 135(1):9–16
Gene silencing as an adaptive defence against 42. Hall TA (1999) BioEdit: a user-friendly
viruses. Nature 411(6839):834–842 biological sequence alignment editor and anal-
28. Ding SW, Voinnet O (2007) Antiviral immu- ysis program for windows 95/98/NT. Nucleic
nity directed by small RNAs. Cell 130(3): Acids Symp. Ser 41:95–98
413–426 43. Jalender P, Bhat BN, Anitha K et al (2017)
29. Ruiz-Ferrer V, Voinnet O (2009) Roles of Studies on transmission of cucumber mosaic
plant small RNAs in biotic stress responses. virus (CMV) by sap inoculation in tomato. Int
Annu Rev Plant Biol 60:485–510 J Pure App Biosci 5(4):1908–1912
30. Preall JB, Sontheimer EJ (2005) RNAi: RISC 44. Solleti SK, Bakshi S, Sahoo L (2008) Addi-
gets loaded. Cell 123(4):543–545 tional virulence genes in conjunction with effi-
31. Matranga C, Zamore PD (2007) Small silenc- cient selection scheme, and compatible culture
ing RNAs. Curr Biol 17(18):R789–R793 regime enhance recovery of stable transgenic
32. Ivashuta S, Zhang Y, Wiggins BE et al (2015) plants in cowpea via Agrobacterium tumefa-
Environmental RNAi in herbivorous insects. ciens-mediated transformation. J Biotechnol
RNA 21(5):840–850 135(1):97–104
33. Gong L, Chen Y, Hu Z et al (2013) Testing 45. Solleti SK, Bakshi S, Purkayastha J et al (2008)
insecticidal activity of novel chemically synthe- Transgenic cowpea (Vigna unguiculata) seeds
sized siRNA against Plutella xylostella under expressing a bean α-amylase inhibitor 1 confer
laboratory and field conditions. PLoS One resistance to storage pests, bruchid beetles.
8(5):e62990 Plant Cell Rep 27(12):1841
34. Zotti M, dos Santos EA, Cagliari D et al (2018) 46. Behura R, Kumar S, Saha B et al (2015) Cow-
RNA interference technology in crop protec- pea (Vigna unguiculata L. Walp). In: Wang K
tion against arthropod pests, pathogens and (ed) Agrobacterium protocols, Methods in
nematodes. Pest Manag Sci 74(6):1239–1250 molecular biology vol. 1223, vol 2. Springer
Protocols Humana Press, Totowa, New Jersey,
35. Carthew RW, Sontheimer EJ (2009) Origins pp 255–264
and mechanisms of miRNAs and siRNAs. Cell
136(4):642–655 47. Bakshi S, Sadhukhan A, Mishra S et al (2011)
Improved agrobacterium-mediated transfor-
36. Zotti MJ, Smagghe G (2015) RNAi technol- mation of cowpea via sonication and vacuum
ogy for insect management and protection of infiltration. Plant Cell Rep 30(12):2281–2292
beneficial insects from diseases: lessons, chal-
lenges and risk assessments. Neotrop Entomol 48. Rogers SO, Bendich AJ (1989) Extraction of
44(3):197–213 DNA from plant tissues. In: Plant Mol biol
Manual. Springer, Dordrecht, pp 73–83
37. Agrawal N, Dasaradhi PVN, Mohmmed A et al
(2003) RNA interference: biology, mechanism, 49. Patil BL, Ogwok E, Wagaba H et al (2011)
and applications. Microbiol Mol Biol Rev RNAi-mediated resistance to diverse isolates
67(4):657–685 belonging to two virus species involved in cas-
sava brown streak disease. Mol Plant Pathol
38. Huvenne H, Smagghe G (2010) Mechanisms 12(1):31–41
of dsRNA uptake in insects and potential of
RNAi for pest control: a review. J Insect Physiol 50. Patil BL, Fauquet CM (2015) Differential
56(3):227–235 behaviour of the genomic components of cas-
sava mosaic geminiviruses and the diversity of
39. Kumar S, Tanti B, Mukherjee SK et al (2017) their small RNA profiles. Virus Genes 50:
Molecular characterization and infectivity of 474–486
Mungbean yellow mosaic India virus associated
with yellow mosaic disease of cowpea and 51. Patil BL, Fauquet CM (2015) Light intensity
mungbean. Biocatal Agric Biotechnol 11: and temperature affect systemic spread of
183–191 silencing signal in transient agroinfiltration
studies. Mol Plant Pathol 16(5):484–494
40. Kumar S, Sahoo L, Tanti B (2016) Whitefly
transmitted yellow mosaic disease, severe threat
Chapter 14
In Vitro Method for Synthesis of Large-Scale dsRNA

Molecule as a Novel Plant Protection Strategy
Siddappa Sundaresha, Aarti Bairwa, Maharishi Tomar, Ravinder Kumar,
E. P. Venkatasalam, Vinay Sagar, Vinay Bhardwaj, and Sanjeev Sharma
Abstract
Double-stranded RNA (dsRNAs) molecules are the precursors and effective triggers of RNAi in most
organisms. RNAi can be induced by the direct introduction of dsRNAs in plants, fungi, insects, and
nematodes. Until now RNAi is usually established by transformation of the plant with a construct that
produces hairpin RNAs. Alternatively, advances in RNA biology demonstrated efficiently the in vitro
method of large-scale synthesis of dsRNA molecule. Here we describe the de novo synthesis of dsRNA
molecule targeting the specific gene of interest for functional application. Selection of off-target effective
siRNA regions, flanking of T7 promoter sequences, T7 polymerase reaction, and maintenance of the
stability of dsRNA molecules are the main criteria of this method to obtain pure and effective yield for
functional applications. IPTG (isopropyl-β-D-thiogalactopyranoside) induced, T7 express E. coli cells,
could be used for large scale synthesis of dsRNA molecule are also described in this method.
Key words Double-stranded multi-siRNA, Off-targets, RNA, RNAi, T7 Express cell, T7 Promoter
1 Introduction
Advances in molecular biology and RNA functional biology creates

the avenue for the development of novel technologies in the field of
agricultural improvement. Since the first report of gene silencing in
petunia plants in the 1980s and later in a nematode Caenorhabditis
elegans, by Fire and Mello established the role of dsRNA in RNA
interference [1, 2]. This technology has been well demonstrated
and developed in many organisms for functional and practical
utility [3–14]. Koch et al. [14] demonstrated the spraying of
dsRNA, called Spray Induced Gene Silencing (SIGS), and its
potential to suppress Fusarium graminareaum in barley, determin-
ing the performance of dsRNA for field applications. SIGS chiefly
rely on the use of RNAi-based mechanisms as an exciting and
promising option due to its greater and diverse mode of action.
211
212 Siddappa Sundaresha et al.
RNAi is posttranscriptional gene regulation through interception

and degradation of mRNA. Upon parasitism, the RNAi sequence
enters the parasite, activating the posttranscriptional gene silencing
(PTGS) mechanisms.
The probable mechanism of gene silencing by RNAi could be
as follows. dsRNA containing the target genes is processed in a
stepwise and sequential manner. It is first acted upon by RNase-III-
type endonucleases called Dicer which is specific to dsRNA and cuts
it into smaller 21–23 nucleotide long dsRNA fragments. These
dsRNA fragments are then acted upon by an RNA helicase and
other associated proteins to form a single-stranded siRNA-contain-
ing RNA-induced silencing complex (RISC) [15]. This RISC then
assists the sequence-specific degradation of complementary or
near-complementary target mRNAs of the specific genes whose
information was present in the dsRNA [16].
A key challenge and crucial step for the synthesis of dsRNA
molecules is the identification of effective target genes. The gene
sequence is chosen so that it shares no homology with the host’s
genes or those of other off-target organisms [17, 18]. There are
three ways of in vitro synthesis of dsRNA. The first approach
includes a one-step PCR reaction in which there is, in vitro tran-
scription of PCR generated DNA template containing T7 pro-
moter sequences at both ends. Alternatively, the second method
includes a dsRNA construct containing vector such as L4404, for
generating dsRNA molecules. This simply requires the insertion of
PCR products, derived from the target gene and cloning of custo-
mized multi copies of siRNA targeting multi-genes into T7 pro-
moter flanked cloning sites, by conventional cloning. The third
method is the in vivo production of large dsRNAs using T7 expres-
sion E. coli cells. Using this strategy, it is possible to modulate or
inhibit the expression of one or more target genes of the patho-
genic microorganism, leading to the cessation of infection, growth,
development or reproduction, and eventual death of the pathogen.
Also, it is an easy way to obtain crude extracts of bacterially
expressed inhibitory dsRNAs by inducing T7 expression in cells
using IPTG.
E. coli strain HT115 (DE3) was chosen to take advantage of an
IPTG-inducible T7 RNA polymerase gene contained within a sta-
ble insertion of a modified lambda prophage λ DE3 [19]. This
strain is deficient for RNase III, an enzyme that normally degrades
a majority of dsRNAs in the bacterial cell, thereby improving the
accumulation of extended dsRNA duplexes compared to BL21
(DE3), an RNase III-expressing strain [20–23]. This method
could easily synthase large-scale of dsRNA formulations which can
be used as a novel strategy for plant protection.
Generation of transgenics for beneficial plant trait requires
significant investment in research and development and pose
numerous regulatory hurdles, especially in India. Therefore, this
In Vitro Method for Synthesis of Large-Scale dsRNA Molecule as a Novel. . . 213
RNAi-based RNA molecules would become the non-transgenic

approach and it could circumvent the limitations of transformation
and public concerns about the GMOs. SIGS using dsRNA mole-
cules provide an easy and eco-friendly alternative to chemical pes-
ticides and fungicides.
2 Materials
2.1 In Vitro dsRNA 1. Target-specific gene fragments (cDNA sequence).

Synthesis 2. T7 RNA Polymerase.
2.1.1 PCR-Based Method 3. Primers for target gene amplification. The forward and reverse
target specific primer (Primer Forward/Primer Reverse are
designed using online software for each target sequence and
each 50 end of primer flanked with T7 promoter sequences)
restriction sites incorporated in their 50 ends to facilitate sub-
cloning into the transcription vector. These restriction sites
should be absent from the target sequence and present in the
polylinker of the transcription vector.
4. Sequencing primers to confirm plasmid constructs:
M13 Forward (20): 50 GTAAAACGACGGCCAG 30 .
M13 Reverse: 50 CAGGAAACAGCTATGAC 30 .
5. T7 primer: 50 TAATACGACTCACTATAGG 30 .
6. High-Fidelity Taq DNA polymerase.
7. dNTPs.
8. T4 DNA Ligase.
9. PCR cloning vector: T/A cloning vector.
10. In vitro transcription vector: Containing an extensive set of
restriction sites in polylinker, T7 promoters on both sides of
the polylinker.
11. Escherichia coli DH5α.
12. Gel Extraction Kit.
13. PCR Purification Kit.
14. Plasmid Isolation Kit.
15. In vitro transcription MegaScript RNAi System.
16. DNase and RNase, provided with the Express RNAi System.
17. 100% ethanol.
18. 70% ethanol (stored at 4 C).
19. 3 M sodium acetate pH 5.2 (store at 4 C).
20. RNase-free water: Prepared as follows: add 0.1% diethylpyro-
carbonate (DEPC) in distilled water, mixed and stirred at room
temperature overnight and autoclaved.
21. Agarose.
22. Molecular Grade Tris borate EDTA (TBE) buffer:50 mM Tris
base, 50 mM H3BO3, 2.5 mM EDTA, pH 8.3.
23. 10 loading dye: 50% glycerol, 40 mM EDTA pH 8.0, 0.1%
bromophenol blue (w/v), 0.1% xylene cyanol) (w/v), and
ethidium bromide (EtBr) or SYBR Gold (Invitrogen) for aga-
rose gel electrophoresis.
24. 1 kbp DNA Ladder.
25. Target specific DNA, e.g., genomic Plant, Fungal, nematode,
viral DNA or plasmid DNA containing the target specific DNA
or cDNA sequence.
2.1.2 Traditional Cloning 1. Online siRNA target finder tools ((http://sidirect2.rnai.jp/)

Method and siRNA scan software (http://bioinfo2.noble.org/
for the Development RNAiScan.htm).
of Multi-gene Target 2. Customization of multi-gene target dsRNA construct.
dsRNA Constructs
3. Forward and reverse gene-specific primers (PRF/PRR)
and Large Scale Synthesis
designed to have restriction sites incorporated in their 50 ends
of dsRNA (In Vivo
to facilitate subcloning in the transcription vector. These
Synthesis)
restriction sites should be absent in the target gene sequence
and present in the polylinker of the transcription vector. The
target sequence can be the whole or part of a gene.
PRF: 50 restriction site-forward target specific sequences 30 .
PRR: 50 restriction site-reverse target specific sequences-30 .
4. Phusion High-Fidelity DNA Polymerase.
5. dNTPs (Promega).
6. L4440 is a transcription vector that has two convergent T7
promoters flanking the multiple cloning site.
7. HT115 (DE3) is an RNase III-deficient E. coli strain, which
expresses T7 RNA polymerase from an isopropyl β-D-1-thio-
galactopyranoside (IPTG)-inducible promoter.
8. Luria–Bertani (LB) broth (1 l): add 10 g of Tryptone, 5 g of
Yeast Extract, 5 g of NaCl, and deionized water up to 1 l (adjust
pH 7 with NaOH). Dissolve components and sterilize by auto-
claving at 121 C for 15 min.
9. Ampicillin (Amp).
10. IPTG.
2.1.3 Bioassay of dsRNA 1. Nano clay, Magnetic stirrer, and Vacuum pump.
and dsRNA Nano Clay 2. Earthen pots for raising plants, Hand Sprayer.
Formulation Against Pest
3. Glasshouse, FYM, Sandy loam soil.
and Pathogens
4. Pathogen screening chambers (Marinating light, temperature

and humidity).
5. Microscope, Haemocytometer.
3 Methods
3.1 In Vitro dsRNA 1. The total RNA was isolated from fungus, nematode, and virus-
Synthesis: One-Step infected plants and also from fungal mycelium using plant RNA
PCR Method kit or using the phenol-chloroform method [24], the extract
was concentrated and quantified spectrophotometrically at
260 nm.
2. One microgram of total RNA was subjected to cDNA synthesis
using reverse transcriptase enzyme (cDNA synthesis kit).
3. Reverse transcriptase PCR was performed to isolate the fungal,
viral, and nematode encoding genes. The ORF genes were
subjected to siRNA target finder tools, siRNA scan software
was used to identify the possible off-target sequences, and the
segment of the gene that was devoid of non-specificity was used
to synthesize dsRNA.
4. The primers were designed for the specific segment of the
target gene flanked with T7 promoter sequence. The PCR
reaction was carried out, with the reaction mixture containing
100 ng of cDNA, 5 picomoles of primer, 25 mM dNTP’s
mixture, 1 unit of Taq polymerase, and 1x of Taq buffer was
kept at a specific annealing temperature of the gene-specific
primer.
5. PCR products were run in 1% agarose gel and desired gene
fragments were eluted using gel extraction kit.
6. Minimum 1 μg to 2 μg PCR products were subjected to
dsRNA synthesis using dsRNA MEGA script RNAi kit. It is a
system for the preparation of dsRNA, free of protein and other
contaminating molecules, for use in RNA interference (RNAi)
experiments.
7. The procedure begins with a high yield transcription reaction
to synthesize two complementary RNA transcripts from the
PCR product amplified from the target cDNA molecule using
gene-specific primers flanked with T7 primers and synthesize
dsRNA using T7 polymerase enzyme.
8. dsRNA reaction was set as follows. Take 1–2 μg PCR product,
2 μl each of dATP, dUTP, dGTP, 2 μl of T7 Polymerase
enzyme, 5 μl of 10 reaction buffer and make up the volume
to 50 μl by adding nuclease-free water. Incubate the reaction
mixture at 37 C temperature for overnight conditions.
9. Analyze the purified dsRNA, by loading 2 μl of the reaction

mixture on 1% agarose gel along with a standard DNA marker
to detect the fragment size of dsRNA. Sometime ssRNA and
DNA can be detected if the reaction mixture is not fully con-
verted to dsRNA. The expected results should be, smear back-
ground with a specific fragment size. To compare the dsRNA
synthesis, load the PCR product, used for dsRNA synthesis on
the same gel. (Fig. 1 illustrating the method and dsRNA gel
image).
Fig. 1 Illustrating the in vitro dsRNA synthesis by one-step PCR reaction and T7 polymerase reaction. (i) PCR
amplification of target gene fragment using T7 promoter-specific primers. (ii) T7 polymerase reaction using
purified PCR product (iii) Agarose gel depicting the synthesized dsRNA and comparing with the PCR product
used for dsRNA reaction
10. Based on the qualitative observation, purify the reaction mix-

ture using RNAi mega script kit or Chloroform: isoamyl alco-
hol (24:1) treatment. Add an equal volume of chloroform:
isoamyl alcohol to the reaction solution. Vortex the mixture
and then centrifuge for 10 min at 13,000 g at room temper-
ature. Transfer the aqueous phase to a new tube. Add 1/10
volume of 3 M sodium acetate (pH 5.2). Add 2.5 volumes of
100% ethanol. Leave at 20 C overnight. Spin at top speed in
a standard microcentrifuge at 4 C for 30 min. Wash with 70%
ethanol followed by a spin for 10 min at 4 C at top speed. Dry
the pellet and resuspended in the same volume of RNase-free
water and subjected to DNAase treatment if any DNA contam-
ination in the reaction mixture.
11. Quantify the purified dsRNA product spectrophotometrically
(Nanodrop) and asses the dsRNA with different concentra-
tions against fungal, insect pest, nematode, and viral particles
under in vitro system.
3.2 Method II: 1. For multi-gene targets, choose an effective siRNA region from
Traditional Cloning each targeted gene fragment, using siRNA target finder tools
Method of Multi-gene (online software), assemble all siRNAs, and customize the
Target dsRNA multi siRNA construct.
Construct 2. Positive clones carrying multi siRNA region can subclone into
L4404 vector (harboring T7 promoter on either side of the
polylinker site) at the prior designed specific restriction enzyme
sites. Ligated products are transferred into DH5α E.coli cells
using standard CaCl2 transformation method using LB
medium containing 100 μg of ampicillin per ml of LB medium.
The positive plasmid clones were confirmed by restriction
digestion, if required, validate the multi dsRNA construct, by
subjecting to in vitro dsRNA synthesis as described above.
3.2.1 In Vivo dsRNA 1. The above multi dsRNA construct, the plasmid is transformed
Synthesis: Production into T7 express cells HTT1B, (DE3 Strain) using the standard
of dsRNA Using T7 CaCl2 transformation method.
Express Cells 2. Inoculate the T7 expressing cells carrying multi dsRNA con-
structs into 5 ml LB medium containing 100 μg of Ampicillin/
ml of LB medium and incubate with shaking at 37 C. A 5 ml
culture is usually enough to induce 1 l of culture for induction.
3. Induce the cell culture harboring T7 polymerase gene by the
addition of IPTG with the final concentration of 0.4 mM and
incubate with a shaker at 37 C for 3 h.
4. Centrifuge the culture at 8000 g 20 min. Resuspend the
pellet into 1/50 vol of 25 mM Tris, pH 7.5. To estimate the
amount of dsRNA produced, lyse 100 μl of the culture by
adding 1 M ammonium acetate, chloroform-isoamylalcohol
(24:1), and incubate at 65 C. Precipitate nucleic acids by
adding ethanol and incubate at 80 C for at least 15 min.

Resuspend the pellet in 10 mM Tris, pH 7.5. Analyze by
electrophoresis in 1% agarose (TBE buffer) and stain with EtBr.
3.2.2 Use of Nano Clay 1. The nano clay particle (Kaolinite, M/s EICL Pvt. Ltd., Thir-
Particle and Development uvananthapuram, Kerala, India.) at different concentrations
of dsRNA Formulation (5 ppm, 10 ppm, and 20 ppm) mixed with dsRNA. The differ-
ent concentrations of nano clay particles were prepared with
nuclease-free water and kept on a magnetic stirrer overnight.
2. The next day nano solution was kept for sonification for 3 h and
subsequently mixed with T7 cells expressing small RNA har-
boring target gene of interest.
3. Nano solution containing dsRNA molecule can be used for
in vitro bioassay against pests and pathogens. The assay may
vary with the pathogen used to test.
3.2.3 Bioassay of dsRNA 1. The plants were maintained under controlled conditions for
Against Target Pest the whole plant assay. Plants were grown in a greenhouse
Pathogens maintaining the light and dark conditions with the temperature
(night/day) conditions specific to the crop plants used for the
assay.
2. For potato fungal pathogen Phytophthora infestans assay, the
inoculum was prepared from 7 day-old cultures grown on rye
agar medium in the dark (18 1 C). P. infestans mycelia were
harvested in sterile water and stimulated to release zoospores at
4 C. The sporangia suspension was observed under a haemo-
cytometer and the concentration was adjusted to 4 104 /ml
for use as an inoculum.
3.2.4 In Vitro Bioassay The required concentration of dsRNA was placed on a specific
of dsRNA Against Pest pathogen medium. For Phytophthora infestans Rye Agar medium
and Pathogens: Case Study in the centers of the plate, subsequently placed healthy grown
Potato Phytophthora P. infestans mycelium bit upside down using a sterile cork borer
infestans and Potato Cyst on the drop of dsRNA, in such a way that mycelium should come in
Nematode contact with dsRNA. Plates were incubated under 18 C for
10 days to observe the growth of mycelium in both dsRNA and
In the Case of Fungal Assay sterile water plated medium (Fig. 2a).
dsRNA Assay Using 1. Using the different concentrations of (100 ng, 150 ng, 250 ng,
Detached Leaf Against and 500 ng and 1 μg of dsRNA concentration) in vitro synthe-
Phytophthora infestans sized dsRNA was evaluated against fungal development using
detached leaf assay.
2. Example: Potato leaf from the 40–45 days old plants were
placed abaxial side up inside the plastic trays lined with a wet
paper towel on perforated plastic separators and challenge
inoculated with P. infestans with zoospore suspension of
4 104 sporangial zoospores/ml.
Fig. 2 Effect of dsRNA on Phytophthora infestans growth (a) 150 ng/μl dsRNA targeting Phytophthora infestans
genes (b) Efficacy of dsRNA nano clay particle solution against late blight. 200 ng/μl of dsRNA with 10 ppm of
nano clay
3. The inoculated leaves were incubated for 6 days at 18 1 C

temperature. Lesion area (LA) was measured daily after deter-
mination of the incubation period. Length and breadth of each
lesion were recorded and the lesion area was computed by
substituting these measurements into the equation for an
ellipse [25] as lesion area (LA) ¼ π/4 ab, where, a ¼ length
and b ¼ breadth of the lesion. Sporulation (SP) was determined
on the sixth day of inoculation (Fig. 2b). Lesion area (1 cm)
were cut with a sterilized cork borer and transferred to Eppen-
dorf tubes with 5 ml of sterilized distilled water. Tubes were
vortexed for 20 s to dislodge sporangia. The plant tissue was
removed and sporangia were counted using a haemocytometer.
At least two haemocytometer readings were done for each
sporangial suspension.
In the Case To optimize the protocol dsRNA is to be taken up by juveniles or

of Nematode Assay worms (J2s) in the M9 buffer. Accordingly, FITC was used as a
marker to detect the ingestion of dsRNA from the solution into the
alimentary canal through mouthparts. After 10 h of soaking in M9
Fig. 3 Fluorescence microscopy showing ingestion of dsRNA labeled with fluoroscein isothiocyanate dye
(FITC). (Left side) Uptake of dsRNA with FITC @1 μl/500 μl from incubation solution by J2s of Globodera spp. in
the presence of 50 mM octopamine after soaking for 10 h. Scale bar ¼ 50 μm (Right side) In case of untreated
control, J2s soaked in the FITC+M9 solution without octapamine (inducer) showed no ingestion of FITC inside
the J2s system
buffer, the soaked J2s were washed and checked under stero-zoom
microscope for their mortality and mobility. In the case of dsRNA
treated J2s after 10 h of soaking the mobility of J2s were increased
due to silencing as compared to untreated control. Similarly, when
these J2s were checked under a fluorescent microscope, FITC
signal was recorded in the mouth part, nervous system and diges-
tive system of dsRNA treated J2s. This shows that dsRNA of
entered inside the J2s system (Fig. 3).
Exogenous Application 1. For large scale experiment, T7 RNA polymerase express cells
of Nano Clay dsRNA (NEB T7 Express cells, UK) are used to induce dsRNA synthe-
Formulation Assay: Case sis using 0.4 mM IPTG for 3 hrs. IPTG induced cells were
Study Against Potato pelleted and dissolved using 1% nano clay solution.
Phytophthora infestans 2. Nano clay dsRNA formulations are sprayed on crop plants of
and Potato Cyst Nematode interest using a high-pressure sprayer, i.e., 24 h before inocula-
tion of the pathogen of interest.
3. Pathogen inoculum was prepared specific to sporulation
nature. For P. infestans zoospore inoculum was prepared
(4 104) and sprayed on potato plants, 24 h after spraying of
dsRNA nano clay formulation.
4. The plants were maintained at 18 C temperature with 90%
RH. Late blight progression was recorded as described earlier.
Leaf samples were collected at 24-h intervals, snap-frozen, and
stored at 80 C until required. The number of sporangia
produced on each lesion was also enumerated using haemocyt-
ometer from treated as well as control plants.
Fig. 4 Effect of dsRNA in the preparasitic juveniles (J2s) in root tissues. VNC ventral nerve cord, LG Lumbar
ganglion
In the Case of Nematode, The purpose of this study was to demonstrate the effect of increased
Soil Drenching of dsRNA locomotory ability on J2s infestation rate. Accordingly, dsRNA
Formulation treated J2s were applied to the root zone of 4-week old potato
plants, and after a period 15 DAI, plant roots were analyzed for the
presence of nematodes. The roots were washed and stained with
acid fuschin (2%) lacto-phenol to check the infestation of J2s in the
root system under stereo-zoom microscope. The results showed
that increased infestation rate of dsRNA treated J2s as compared to
untreated J2S. It shows that silencing of the locomotory gene
increased the infestation rate in roots and due to the depletion of
finite energy reserves in these non-feeding J2s resulting in prema-
ture death (Fig. 4).
In the Case of Viral Disease The dsRNA has to prepare as described above specific to viral genes.
Nano clay solutions are prepared as described above and viral sap
inoculation was applied 24 h after spraying of viral-specific dsRNA
nano clay solutions. Inoculate the viral sap (mechanically transmit-
ted virus inoculum) by gently rubbing on fully expanded leaf
surface sing carborundum as abrasive.
1. Keep the plants in virus culture glass house under the condition
suitable for symptoms development of the specific virus-host
system. For example, ToLCNDV, maintain plants at 28 C and
for PVY 24 C. etc.
2. Monitoring the symptom development after 5–7 days after assay
and assess the viral titre using ELISA after 15 days of the assay.
3. The overall multi-gene construct development and in vivo syn-
thesis has been illustrated in Fig. 5.
Fig. 5 Illustrating the development of multi-dsRNA construct and in vivo synthesis of dsRNA using T7 express
cell and efficacy of topical application of dsRNA against potato late blight. (i) Selection of off-target effective
siRNA. (ii) Assembly and customization of multi siRNA construct. (iii) Subcloning into L4404 vector harboring
T7 promoter. (iv) Transformation to T7 express cell and lysis. (v) Preparation of 1% Nano clay. (vi) Exogenous
application of dsRNA nano clay solution. (vii) Disease reaction against P. infestans (Bio-efficacy of dsRNA
spray against late blight of potato)
4 Notes
1. Before beginning the experiment, grow and maintain target

interest of the healthy young pathogen culture (viral, fungal,
nematodes, and insect pest) As a case study, P. infestans isolate
grown at 18 C in the dark on rye agar medium supplemented
with 2% sucrose [26]. Mycelium, to be used for isolation of
RNA, were grown in a liquid rye sucrose medium at 18 C.
Mycelia were harvested by centrifugation of the liquid medium
at 5000 g for 5 min, snap-frozen in liquid nitrogen, and total
RNA extracted using commercial RNA kit or traditional phe-
nol: chloroform methods.
2. Selection of target genes for dsRNA experiment: Targets
genes for dsRNA experiments are most important to assess
against the pathogens. Targets genes were selected based on
their functional redundancy, and highly regulated genes in all
the stages of the pathogen [27].
3. The selection of off-target genes: Off-target gene silencing is
also important to avoid the non-specific effect. Care should be
taken while the selection of effective siRNA region. Short
interfering RNA (siRNA) in siRNA target finder SiRNA target
finder tools and based on siRNA criteria, choose the best
siRNA regions. Sometimes, this will affect the silencing effi-
ciency [28–30].
4. It is recommended that the 10 dsRNA Synthesis DsRNA
synthesis Buffer is heated at 35 C for 10 min before use. The
addition of MnCl2 is essential for the catalytic activity of
RdRPRNA-dependent RNA polymerase (RdRP) [31–33].
5. Special care should be given to work on T7 express cells
(HTTIB cells are preferred) because T7 cells are weak and
work fast to extract the dsRNA lysate following induction
with the IPTG [34].
6. The dsRNA can be made from cDNA CDNAs or genomic
DNA templates. The length of dsRNA ranges from 300 to
2000 bp and most of the dsRNA should correspond to exon
regions [35].
7. The dsRNA enriched supernatant and in vitro synthesized
dsRNA aliquot can be preserved for several weeks at 800 C
by adding an equal amount of isopropanol [35, 36].
8. The dsRNA pellet is not necessarily visible (pure dsRNA is
opaque; a high salt concentration or ssRNA yields a white
pellet) [35, 36].
9. Special care should be given not to over-dry the pellet and
resuspend the pellet using RNAse-free water [36].
10. It is recommended to include dsRNA of identical product size,

with unrelated nucleotide sequence as a negative control to
compare the efficiency of dsRNA synthesis [36].
11. All the working area should be RNAse-free and use the nucle-
ase and RNAse-free water, wherever required to process and
Special care should be given to ensure proper disposal (dispo-
sables into the disposable bin, glassware decontamination by
0.2 M NaOH) [36].
12. Care should be taken during nano clay solution preparation,
dissolve the nano clay very vigorously in a magnetic stirrer, and
do not allow it to settle down for a long time. Sonification is an
important step to homogenize the nano clay with water
molecules [37].
13. If possible measure the size of the particle, if the lab has a
zeitasizer. This would imply the efficacy of dsRNA as stability
and entry into host cells [37].
14. Late blight symptoms caused by Phytophthora infestans
(P. infestans) were significantly reduced when plants were
sprayed with nano clay solution containing lysed bacteria
up to several days before Phytophthora inoculation. Extracts
derived from bacteria expressing specific P. infestans dsRNA
can prevent late blight symptoms and inhibit the sporulation
load. The protection conferred by exogenously supplied Nano
dsRNA formulation enters the cell together with the nano clay,
which interferes with the pathogen gene via host cell Phy-
tophthora interactions [38, 39].
References
1. Agrawal N, Dasaradhi PVN, Mohmmed A, resistance in transgenic plants by RNAi silenc-

Malhotra P, Bhatnagar RK, Sunil KM (2003) ing of a conserved and essential root-knot
RNA interference: biology, mechanism, and nematode parasitism gene. Proc Natl Acad Sci
applications. Microbiol Mol Biol Rev 67: U S A 103:14302–14306
657–685 6. Nowara D, Schweizer P, Gay A, Lacomme C,
2. Eamens A, Wang MB, Neil AS, Waterhouse Shaw J, Ridout C, Douchkov D, Hensel G,
PM (2008) RNA silencing in plants: yesterday, Kumlehn J (2010) HIGS: host-induced gene
today and tomorrow. Plant Physiol 147: silencing in the obligate biotrophic fungal
456–468 pathogen Blumeria graminis. Plant Cell 22:
3. Baum JA, Bogaert T, Clinton W, Heck GR, 3130–3141
Feldmann P, Ilagan O (2007) Control of cole- 7. Koch A, Kumar N, Weber L, Keller H, Imani J,
opteran insect pests through RNA interfer- Kogel KH (2013) Host-induced gene silencing
ence. Nat Biotechnol 25(11):1322–1326 of cytochrome P450 lanosterol C14-
4. Mao YB, Cai WJ, Wang JW, Hong GJ, Tao XY, α-demethylase-encoding genes confers strong
Wang LJ, Huang YP, Chen XY (2007) Silenc- resistance to fusarium species. Proc Natl Acad
ing a cotton bollworm P450 monooxygenase Sci U S A 110:19324–19329
gene by plant-mediated RNAi impairs larval 8. Tenllado F, Martı́nez-Garcı́a B, Vargas M,
tolerance of gossypol. Nat Biotechnol 25: Dı́az-Ruı́z JR (2003) Crude extracts of bacte-
1307–1313 rially expressed dsRNA can be used to protect
5. Huang G, Allen R, Davis EL, Baum TJ, Hussey plants against virus infections. BMC Biotech-
RS (2006) Engineering broad root-knot nol 3:3
9. Tenllado F, Llave C, Dı́az-Ruı́z JR (2004) double-stranded RNA bacteriophage phi6.

RNA interference as a new biotechnological EMBO J 19:124–133
tool for the control of virus diseases in plants. 22. Sun Y, Qiao X, Mindich L (2004) Construc-
Virus Res 102:85–96 tion of carrier state viruses with partial gen-
10. Wang M, Jin H (2017) Spray-induced gene omes of the segmented dsRNA
silencing: a powerful innovative strategy for bacteriophages. Virology 319:274–279
crop protection. Trends Microbiol 25:4–6 23. Romanovskaya A, Paavilainen H, Nygårdas M,
11. Yin G, Sun Z, Liu N, Zhang L, Song Y, Zhu C, Bamford DH, Hukkanen V, Poranen MM
Wen F (2009) Production of double-stranded (2012) Enzymatically produced pools of
RNA for interference with TMV infection uti- canonical and dicer-substrate siRNA molecules
lizing a bacterial prokaryotic expression system. display comparable gene silencing and antiviral
Appl Microbiol Biotechnol 84:323–333 activities against herpes simplex virus. PLoS
12. Yin C, Jurgenson JE, Hulbert SH (2011) One 7:e51019
Development of a host-induced RNAi system 24. Dellaporta S, Wood J, Hicks JB (1983) A plant
in the wheat stripe rust fungus Puccinia strii- DNA minipreparation: version I. Plant Mol
formis f. sp. tritici. Mol Plant-Microbe Interact Biol Rep 1:19–21
24:554–561 25. Birhman RK, Singh BP (1995) Path-coefficient
13. Dalakouras A, Jarausch W, Buchholz G, analyses and genetic parameters of the compo-
Bassler A, Braun M, Manthey T, Krczal G, Was- nents of field resistance of potatoes to late
senegger M (2018) Delivery of hairpin rnas blight. Ann Appl Biol 127:353–362
and small rnas into woody and herbaceous 26. Caten CE, Jinks JL (1968) Spontaneous varia-
plants by trunk injection and petiole absorp- bility of single isolates of Phytophthora infes-
tion. Front Plant Sci 9:1253 tans. I. Cultural variation. Canadian J Botany
14. Koch A, Biedenkopf D, Furch A et al (2016) 46:329–347
An RNAi-based control of fusarium grami- 27. Tani S, Yatzkan E, Judelson HS (2004) Multi-
nearum infections through spraying of long ple pathways regulate the induction of genes
dsRNAs involves a plant passage and is con- during zoosporogenesis in Phytophthora infes-
trolled by the fungal silencing machinery. tans. Molecular Plant-Microbe Interactions
PLoS Pathog 12:e1005901 17:330–337
15. Martinez J, Patkaniowska A, Urlaub H, 28. Firoz Ahmed, Muthappa Senthil-Kumar, Xin-
Lührmann R, Tuschl T (2002) Single-stranded bin Dai, Vemanna S. Ramu, Seonghee Lee,
antisense siRNAs guide target RNA cleavage in Kirankumar S. Mysore, Patrick Xuechun Zhao
RNAi. Cell 110:563–574 (2020) pssRNAit: A Web Server for Designing
16. Meister G, Tuschl T (2004) Mechanisms of Effective and Specific Plant siRNAs with
gene silencing by double-stranded RNA. Genome-Wide Off-Target Assessment. Plant
Nature 431:343–349 Physiol 184:65–81
17. Yuan B, Latek R, Hossbach M, Tuschl T, 29. Myers, J.W. et al. (2006) Minimizing off-target
Lewitter F (2004) siRNA selection server: an effects by using diced siRNAs for RNA inter-
automated siRNA oligonucleotide prediction ference. J RNAi Gene Silencing 2:181–194
server. Nucleic Acids Res 32:130–134 30. Tafer H, Ameres SL, Obernosterer G, Gebe-
18. Naito Y, Yoshimura J, Morishita S, Ui-Tei K shuber CA, Schroeder R, Martinez J, et al.
(2003) siDirect 2.0: updated software for (2008) The impact of target site accessibility
designing functional siRNA with reduced on the design of effective siRNAs RNAplex:
seed-dependent off-target effect. BMC Bio- a fast tool for RNA-RNA interaction search.
technology 10:392 Nat Biotechnol Bioinformatics 2624:
19. Huang L, Judy L (2013) Production of highly 578–5832657–583266
potent recombinant siRNAs in Escherichia coli. 31. Makeyev EV, Bamford DH (2000) Replicase
Nat Protocol 8:2325–2336 activity of purified recombinant protein P2 of
20. Aalto AP, Sarin LP, van Dijk AA, Saarma M, double-stranded RNA bacteriophage phi6.
Poranen MM, Arum€ae U, Bamford DH EMBO J 19:124–133
(2007) Large-scale production of dsRNA and 32. Poranen MM, Salgado PS, Koivunen MRL,
siRNA pools for RNA interference utilizing Wright S, Bamford DH, Stuart DI, Grimes
bacteriophage phi6 RNA-dependent RNA JM (2008) Structural explanation for the role
polymerase. RNA13:422–9 of Mn2+ in the activity of phi6 RNA-depen-
21. Makeyev EV, Bamford DH (2000) Replicase dent RNA polymerase. Nucleic Acids Res
activity of purified recombinant protein P2 of 36:6633–6644
33. Wright S, Poranen MM, Bamford DH, Stuart wool fabric using nano kaolinite. 109:
DI, Grimes JM (2012) Non-catalytic ions 225–231
direct the RNAdependent RNA polymerase of 38. Kalyandurg PB, Sundararajan P, Dubey M,
bacterial dsRNA virus phi6 from de novo initi- Ghadamgahi F, Zahid MA, Whisson S, Vetu-
ation to elongation. J Virol 86:2837–2849 kuri RR. Spray-induced gene silencing as a
34. Huang L, Lieberman J (2013) Production of potential tool to control potato late blight dis-
highly potent recombinant siRNAs in Escher- ease. Phytopathology 11: https://doi.org/10.
ichia coli. Nat Protoc 8:2325–2336 1094/PHYTO-02-21-0054-SC
35. Carthew, Clemens, Tuschl (2005) PCR tem- 39. Sundaresha S, Sharma S, Bairwa A, Tomar M,
plate method for dsRNA-synthesis https:// Kumar R, Bhardwaj V, Jeevalath A, Bakade R,
mcmanuslab.ucsf.edu/protocol/pcr-template- Salaria N, Thakur K, Singh B.P, Chakrabarti SK
method-dsrna-synthesis. (2021) Spraying of dsRNA Molecules Derived
36. Voloudakis AE, Holeva MC, Sarin LP, Bam- from Phytophthora Infestans, as a Plant Pro-
ford DH, Vargas M, Poranen MM, Tenllado F tection Strategies for the Management of
(2015) Efficient double-stranded RNA pro- Potato Late Blight. Preprints 2021020280:
duction methods for utilization in plant virus https://doi.org/10.20944/preprints202102.
control. Methods Mol Biol 1236:255–74 0280.v1
37. Seiko Jose, Shanmugam Nachimuthu, Sekhar
Das, Ajay Kumar (2017) Moth proofing of
Chapter 15
Fine-Tuning Plant Gene Expression with Synthetic

Trans-Acting Small Interfering RNAs
Lucio López-Dolz, Maria Spada, José-Antonio Daròs,
and Alberto Carbonell
Abstract
RNAi-based tools are widely used in gene function studies and for crop improvement. However, no
effective methods for precisely controlling the degree of induced silencing have been reported until
recently. Here we report a detailed protocol for designing and generating synthetic trans-acting small
interfering RNA (syn-tasiRNA) constructs for fine-tuning gene expression in plants. Recently developed
high-throughput AtTAS1c-D2-B/c-based vectors are used to clone and express syn-tasiRNAs that possess
different efficacies depending on their precursor location and on their degree of base-pairing with the 50 end
of target RNAs.
Key words Fine-tuning gene expression, syn-tasiRNA, Artificial small RNA, RNA silencing, P-SAMS
1 Introduction
RNAi-based tools have been extensively used to study gene func-

tion and for crop improvement. Typically, double-stranded RNA
(dsRNA)-producing transgenes are overexpressed with strong con-
stitutive promoters and processed by Dicer-like (DCL) enzymes to
produce large populations of small interfering RNAs (siRNAs) that
target highly complementary RNA sequences [1, 2]. Despite their
popularity, these tools have two main limitations. First, they are not
highly specific as the accidental targeting of cellular transcripts
sharing high sequence complementarity with the siRNAs occurs
[3]. Second, they have been mainly optimized for inducing maxi-
mal silencing of target genes, although lower levels of target gene
silencing may be required in some particular cases such as the
functional study of vital genes. While the first limitation has been
overcome by the development of “second-generation” RNAi stra-
tegies based on artificial small RNAs (art-sRNAs) –21-nucleotide
sRNAs computationally designed to target exclusively their target
227
228 Lucio López-Dolz et al.
RNA(s) [4, 5]–, efficient methods for fine-tuning the silencing

activity were missing until recently [6].
Synthetic trans-acting siRNAs (syn-tasiRNAs) are a particular
class of plant art-sRNAs that are produced in planta by expressing a
functional TAS precursor in which the endogenous tasiRNA
sequences are replaced by syn-tasiRNA sequences [7, 8] (Fig. 1).
In the case of Arabidopsis thaliana (Arabidopsis) TAS1c
(AtTAS1c)-based syn-tasiRNAs, cleavage of the syn-tasiRNA pre-
cursor by endogenous miR173/AGO1 complexes triggers the
conversion of the 30 cleaved product into dsRNA by RNA-DEPEN
DENT RNA POLYMERASE 6 (RDR6). Next, the dsRNA is
sequentially processed by DCL4 into syn-tasiRNA duplexes in
register with miR173 cleavage site. Finally, the guide strand of the
syn-tasiRNA duplex is loaded in an AGO protein, usually AGO1, to
target and silence complementary RNAs (Fig. 1).
In this chapter we provide protocols for designing and gener-
ating syn-tasiRNA constructs for fine-tuning gene expression in
plants. We first detail the general methodology to design and
clone syn-tasiRNAs into recently developed high-throughput
AtTAS1c-D2-B/c-based vectors [6]. Next, we specify protocols to
generate syn-tasiRNA constructs expressing syn-tasiRNAs with dif-
ferent efficacies depending on their precursor location or on their
degree of base-pairing with the 50 end of target.
2 Materials
2.1 Syn-tasiRNA 1. Computer connected to the internet.

Design 2. Web browser (e.g., Google Chrome, Safari, Mozilla Firefox,
Internet Explorer).
2.2 Syn-tasiRNA 1. Oligo Annealing buffer: 60 mM Tris–HCl (pH 7.5), 500 mM

Cloning NaCl, 60 mM MgCl2, 10 mM DTT (see Note 1).
2. Thermocycler or water bath.
3. Sterile H2O.
4. T4 DNA ligase (5 U/μL, Thermo Fisher Scientific, Waltham,
Massachusetts, USA).
5. BsaI (10 U/μL, New England Biolabs, Ipswich,
Massachusetts, USA).
6. AtTAS1c-D2-B/c-based vectors [6] (see Note 2).
7. Competent cells of Escherichia coli ccdB-sensitive strain (e.g.,
DH5α, DH10B, TOP10).
8. Luria-Bertani (LB) agar plates with kanamycin: 20 g/L of LB
(10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl), 15 g/L
of Bacto Agar and 50 mg/L of kanamycin.
Fine-Tuning Plant Gene Expression with Synthetic Trans-Acting Small. . . 229
Fig. 1 The AtTAS1c-based syn-tasiRNA pathway. A syn-tasiRNA transgene,

containing the Arabidopsis TAS1 (AtTAS1c) precursor (black rectangles) in
which a subset of the original tasiRNA sequences has been substituted by
several syn-tasiRNA sequences (dark and light blue or green rectangles) in
tandem, is introduced into plants to express a syn-tasiRNA primary transcript.
Endogenous AGO1/miR173 complexes cleave this primary transcript, a process
that triggers the recruitment of RDR6 complexes to synthesize a dsRNA from one
of the cleavage products. DCL4 processes the dsRNA into phased syn-tasiRNA
duplexes in 21-nucleotide register with the miRNA cleavage site. Syn-tasiRNA
guide strands with a 50 U are incorporated into AGO1 to direct specific silencing of
sequence unrelated target transcripts at one or multiple sites. Adapted from
Carbonell [5]
9. Liquid LB with kanamycin: 20 g/L of LB and 50 mg/L of

kanamycin.
10. GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific).
11. Oligonucleotides:
(a) M13-F (CCCAGTCACGACGTTGTAAAACGACGG),
(b) M13-R (CAGAGCTGCCAGGAAACAGCTATGACC).
Fig. 2 Diagram of AtTAS1c precursors highlighting the location of DCL4

processing positions 30 D1[+], 30 D2[+], 30 D3[+], 30 D4[+], and 30 D5[+], and of
miR173 trigger target site (ts). Curved black arrows indicate DCL4 processing
sites, black linear arrow indicates miR173-guided cleavage site
(c) attB1 (ACAAGTTTGTACAAAAAAGCAGGCT),

(d) attB2 (ACCACTTTGTACAAGAAAGCTGGGT).
12. Competent cells of Agrobacterium tumefaciens GV3101 strain.
3 Methods
The whole process from syn-tasiRNA design to plant transforma-

tion can be completed within a week.
3.1 Generation While the syn-tasiRNA design protocol detailed next is general, the
of Syn-tasiRNA syn-tasiRNA cloning protocol is specific for inserting syn-tasiRNAs
Constructs at DCL4 processing position 30 D2[+] (Fig. 2) (see Note 3) in
recently developed AtTAS1c-D2-B/c-based vectors (Fig. 3) [6]. It
has been adapted from a previous protocol to clone syn-tasiRNAs at
position 30 D3[+] in previously described AtTAS1c-B/c-based vec-
tors [9, 10].
3.1.1 Syn-tasiRNA The Plant Small RNA Maker Suite (P-SAMS) syn-tasiRNA
Design Designer web app [11] is used to design syn-tasiRNAs with a 50 U
nucleotide, a C in position 19 and with a mismatch with the target
transcript at position 21. The app designs one or more syn-tasiRNA
(see Note 4), each of which may target one or multiple genes in
Arabidopsis or in other plant species if the miR173 trigger is
co-expressed (see Notes 5 and 6).
The protocol described next is intended for the design of
syn-tasiRNA(s) targeting endogenous plant transcripts. The possi-
bility of designing syn-tasiRNAs to target exogenous transcripts is
also discussed.
1. Go to P-SAMS website (http://p-sams.carringtonlab.org/).
2. Click the “P-SAMS syn-tasiRNA Designer” application button
to enter the syn-tasiRNA Designer tool (http://p-sams.
carringtonlab.org/syntasi/designer).
3. To start the design process, click “Get Started” and then

“Design syn-tasiRNAs.”
4. Select the transcriptome of the species of interest and click
“Yes” (see Notes 7–9).
5. Click “Option 1” if you have the gene ID(s) of the target
transcripts (see Note 9).
6. Enter one or more sets of target gene ID(s) (see Note 10). Each
gene set can contain one or more target gene ID(s). Click
“Next” (see Note 11).
7. Click “Yes” to have the results automatically filtered based on
target specificity (see Note 12).
8. Click “Submit” to submit the job (see Note 13).
9. Select “Click to see Results” to display results.
10. Navigate through the “Detailed Results” tab to display the list
of “Optimal Results” and “Suboptimal Results” for each gene
set. Syn-tasiRNAs predicted to target uniquely desired target
transcript(s) are output as “Optimal Results”; syn-tasiRNAs
predicted to target desired target transcript(s) are output as
“Suboptimal Results” (see Note 14). Each result contains the
syn-tasiRNA sequence and a summary of the target prediction
analysis (score, target coordinates, target sequence, syn-ta-
siRNA/target base-pairing and target description (see Note
15).
3.1.2 Oligonucleotides Follow the next steps to design the two oligonucleotides for clon-
for Syn-tasiRNA Cloning ing your syn-tasiRNA into AtTAS1c-D2-B/c vectors.
1. Insert your syn-tasiRNA sequence where you see
50 X1X2X3X4X5X6X7
X8X9X10X11
X12X13X14X15X16X17X18X19X20X21 30 .
2. Insert its reverse and complementary where you see.
50 Y21Y20Y19Y18Y17Y16Y15Y14Y13Y12
Y11Y10
Y9Y8
Y7Y6Y5Y4Y3Y2Y1 30 .
3. Verify that you obtain the following base-pairing:
5’ X1 X2 X3 X4 X5 X6 X7 X8 X9 X10X11X12X13X14X15X16X17X18X19X20X21 3’
| | | | | | | | | | | | | | | | | | | | | | |
3’ Y1 Y2 Y3 Y4 Y5 Y6 Y7 Y8 Y9 Y10Y11Y12Y13Y14Y15Y16Y17Y18Y19Y20Y21 5’
4. Build the sequences of the two oligonucleotides needed for

cloning a single syn-tasiRNA at position 30 D2[+] in AtTAS1c-
D2-B/c-based vectors as follows (Table 1):
232
Table 1
Sequences of the two oligonucleotides
needed for cloning a single syn-tasiRNA
at position 30 D2[+], 30 D3[+],
30 D4[+] and 30 D5[+] in AtTAS1c-D2-B/c-based vectors
Lucio López-Dolz et al.
Forward oligonucleotides Reverse oligonucleotides

Syn-tasiRNA construct (50 ! 30 )a (50 ! 30 )
Syn-tasiRNA-D2 TTTAX1X2X3X4X5X6X7 CCGAY21Y20Y19Y18Y17Y16Y15Y14Y13Y12Y11Y10Y9
X8X9X10X11 Y8Y7Y6Y5Y4Y3Y2Y1
X12X13X14X15X16X17X18X19X20X21
Syn-tasiRNA-D3 TTTAtcggtggatc CCGAY21Y20Y19Y18Y17Y16Y15Y14Y13Y12Y11Y10Y9Y8
ttagaaaattaX1X2X3X4X5X6 Y7Y6Y5Y4Y3Y2Y1taattttctaagat
X7X8X9X10X11 ccaccga
X12X13X14X15X16X17X18X19X20X21
Syn-tasiRNA-D4 TTTAtcggtggatcttagaaaattattcta CCGAY21Y20Y19Y18Y17Y16Y15Y14Y13Y12Y11Y10Y9Y8
agtccaacatagcgtaX1X2X3X4X5X6X7X8 Y7Y6Y5Y4Y3Y2Y1tacgctatgttggacttagaataatttt
X9X10X11X12X13X14X15X16X17X18X19X20X21 ctaagatccaccga
Syn-tasiRNA-D5 TTTAtcggtggatcttagaaaattattctaagtccaaca CCGAY21Y20Y19Y18Y17Y16Y15Y14Y13Y12Y11Y10Y9
tagcgtattctaagttcaacatatcgacX1X2X3X4X5X6 Y8Y7Y6Y5Y4Y3Y2Y1gtcgatatgttgaacttagaatacgctatg
X7X8X9X10X11X12X13X14X15X16X17X18X19X20X21 ttggacttagaataattttctaagatccaccga
a
The sequence of the 50 overhangs resulting after the annealing of the two oligonucleotides are in upper case and underlined. The sequences of endogenous tasiRNAs are in lower
case. X1 to X21 and Y21 to Y1 correspond to the syn-tasiRNA sequence and to the reverse and complementary of the syn-tasiRNA sequence, respectively (50 ! 30 )
(a) For the forward oligonucleotide, add “TTTA” upstream

of the syn-tasiRNA sequence:
50 TTTAX1X2X3X4X5X6
X7X8X9X10X11
X12X13X14X15X16X17X18X19X20X21 30 .
(b) For the reverse oligonucleotide, add “CCGA” upstream
of the reverse and complementary sequence of the syn-ta-
siRNA sequence:
50 CCGAY21Y20Y19Y18Y17Y16Y15Y14Y13Y12
Y11Y10
Y9Y8
Y7Y6Y5Y4Y3Y2Y1 30 .
3.1.3 Syn-tasiRNA A diagram of the main steps for the high-throughput cloning of
Cloning syn-tasiRNA sequences in AtTAS1c-D2-B/c-based vectors is shown
in Fig. 4. Importantly, pMDC32B-AtTAS1c-D2-B/c is used to
clone syn-tasiRNA(s) for expression in Arabidopsis and close rela-
tives, while pMDC32B-AtTAS1c-D2-B/c-AtMIR173 must be used
to clone syn-tasiRNAs to be co-expressed with miR173 in
non-Arabidopsis species (see Note 11).
Follow the steps described next using the AtTA1c-D2-B/c-
based syn-tasiRNA vector of your choice (Fig. 3) (see Note 16).
1. Resuspend the two oligonucleotides in sterile H2O to a final
concentration of 100 μM.
2. Assemble the oligonucleotide annealing reaction in a PCR tube
as follows: 2 μL of 100 μM forward oligonucleotide, 2 μL of
100 μM reverse oligonucleotide, and 46 μL of oligo annealing
buffer.
3. Transfer the tube to a thermocycler set to heat the annealing
reaction 5 min at 94 C and then cool down to 20 C at a rate
of 0.05 C/s (see Note 17).
4. Dilute the annealed oligonucleotides to a final concentration of
0.15 μM by mixing 3 μL annealed oligonucleotides and 37 μL
H2O (see Note 18).
5. Assemble the digestion-ligation reaction as follows: 50 ng
AtTAS1c-D2-B/c-based vector, 1 μL diluted annealed oligonu-
cleotides, 1 μL 10 T4 DNA ligase buffer, 1 μL T4 DNA ligase
(5 U/μL), 1 μL BsaI (10 U/μL), and add sterile H2O to 10 μL.
6. Mix the reactions by pipetting, and incubate for 5 min at 37 C
(see Note 19).
7. Transform 1–5 μL of the digestion-ligation into a ccdB-sensi-
tive E. coli strain (see Note 20). Plate all the culture in a LB agar
plate containing kanamycin.
8. Pick two colonies per construct, grow in 4 mL of liquid LB
with kanamycin and purify plasmids with a miniprep kit.
Fig. 3 AtTAS1c-D2-B/c-based vectors for direct cloning of syn-tasiRNAs at

position 30 D2[+]. (a) Diagram of the GATEWAY compatible pENTR-AtTAS1c-
D2-B/c entry vector. attL1 and attL2: GATEWAY recombination sites. KanR:
kanamycin resistance gene. BsaI: BsaI recognition site. ccdB: gene encoding
the ccdB toxin. (b) Diagrams of the pMDC32B-AtTAS1c-D2-B/c (up) and
pMDC32B-AtTAS1c-D2-B/c-AtMIR173 (bottom) binary vectors for expression
of syn-tasiRNAs in Arabidopsis or in any plant species, respectively. RB right
border, 35S Cauliflower mosaic virus promoter, LB left border, HygR hygromycin
resistance gene. Other details are as in (a). (Adapted from López-Dolz et al. [6])
9. Sequence two clones per construct with appropriate oligonu-

cleotides: M13-F and M13-R for pENTR-based vectors, and
attB1 and attB2 for pMDC32B-based vectors.
10. Transform 0.5 μL of the purified plasmid into A. tumefaciens
GV3101. Plate 1/10 of the culture in a LB agar plate contain-
ing rifampicin and kanamycin.
11. Incubate the plate at 28 C during 48 h.
12. Store the plate with grown colonies at 4 C until use.
Fig. 4 Diagram of the steps for syn-tasiRNA cloning in AtTAS1c-D2-B/c vectors. The syn-tasiRNA insert
obtained after annealing the two overlapping oligonucleotides has 50 TTTA and 50 CCGA overhangs and is
directly inserted into the BsaI-linearized AtTAS1c-D2-B/c vector. Nucleotides of AtTAS1c and syn-tasiRNA are
in black and light blue, respectively. Nucleotides of the BsaI sites and arbitrary nucleotides used as spacers
between the BsaI recognition site and the AtTAS1c sequence are in purple and light brown, respectively.
(Adapted from López-Dolz et al. [6])
3.2 Generation Our previous work showed that both the accumulation and efficacy
of Syn-tasiRNA of transgenically expressed AtTAS1c-based syn-tasiRNAs progres-
Constructs sively decrease as the syn-tasiRNA is expressed from DCL4 proces-
for Fine-Tuning Plant sing positions more distal to the trigger miR173 target site in
Gene Expression AtTAS1c precursors (Fig. 5) [6]. For example, a syn-tasiRNA
expressed from DCL4 processing position 30 D2[+] (hereafter posi-
3.2.1 Expression of a tion D2) in AtTAS1c generally accumulates to higher levels than
Single Syn-tasiRNA from the same syn-tasiRNA expressed from position 30 D3[+] (hereafter
Different Precursor position D3). Similarly, a syn-tasiRNA expressed from position D3
Positions in AtTAS1c generally accumulates to higher levels than the same
syn-tasiRNA expressed from position 30 D4[+] (hereafter position
D4), and so on. Thus, syn-tasiRNA accumulation and efficacy can
be adjusted by expressing the syn-tasiRNA from different AtTAS1c
precursor positions [6].
Fig. 5 Diagrams of syn-tasiRNA constructs expressing a single syn-tasiRNA from

different precursor positions. tasiRNA positions 30 D1[+] to 30 D5[+] are indicated
by brackets, with positions including syn-tasiR-FT highlighted in blue. Curved
black arrows indicate DCL4 processing sites. Black linear arrows indicate sRNA-
guided cleavage sites. ts refers to target site
The following are recommendations to obtain the desired

degree of target gene silencing:
1. For inducing high target silencing levels, insert the syn-ta-
siRNA at position D2 in AtTAS1c.
2. For inducing moderate target silencing levels, insert the syn--
tasiRNA at positions D3 or D4 in AtTAS1c.
3. For inducing low silencing target levels, insert the syn-tasiRNA
at position D5 in AtTAS1c or even more distally from miR173
target site.
Follow the next steps to generate diverse AtTAS1c-D2-B/c-
based constructs expressing a single syn-tasiRNA from different
precursor positions (Fig. 5).
1. Use P-SAMS to design your syn-tasiRNA as described in Sub-
heading 3.1.1 (see Note 21).
2. Build the sequence of the two oligonucleotides needed to
insert the syn-tasiRNA at position D2, D3, D4, or D5 in
AtTAS1c-D2-B/c-based vectors based on the information listed
in Table 1.
3. Generate the corresponding syn-tasiRNA construct as
described in Subheading 3.1.3.
Next is the sequence of AtTAS1c (AT2G39675) including

annotations of sequences corresponding to miR173 target site
and endogenous tasiRNAs at positions D2, D3 and D4:
AAACCTAAACCTAAACGGCTAAGCCCGACGTCAAAT
ACCAAAAAGAGAAAAACAAGAGCGCCGTCAAGCT
CTGCAAATACGATCTGTAAGTCCATCTTAACACAA
AAGTGAGATGGGTTCTTAGATCATGTTCCGCCGT
TAGATCGAGTCATGGTCTTGTCTCATAGAAAGGTA
CTTTCGTTTACTTCTTTTGAGTATCGAGTAGAGCG
TCGTCTATAGTTAGTTTGAGATTGCGTTTGTCAGA
AGTTAGGTTCAATGTCCCGGTCCAATTTTCACCAG
CCATGTGTCAGTTTCGTTCCTTCCCGTCCTCTTCT
TTGATTTCGTTGGGTTACGGATGTTTTCGAGATGA
AACAGCATTGTTTTGTTGTGATT
<-----
TTTCTCTACAAGCGAATAGACCATTTAt
cggtggatcttagaaaattattctaagtccaaca
miR173 ts------> <-----tasiRNA D2----><-----tasiRNA
tagcgtattctaagttcaacatatcgac GAACTAGAAAAGACATTGGA
CATATTCCAGGATA
D3----><-----tasiRNA D4---->
TGCAAAAGAAAACAATGAATATTGTTTTGAATGTGTTC
AAGTAAATGAGATTTTCAAGTCGTCTAAAGAACAG
TTGCTAATACAGTTACTTATTTCAATAAATAATTG
GTTCTAATAATACAAAACATATTCGAGGATATGCA
GAAAAAAAGATGTTTGTTATTTTGAAAAGCTTGAG
TAGTTTCTCTCCGAGGTGTAGCGAAGAAGCATCA
TCTACTTTGTAATGTAATTTTCTTTATGTTTTCAC
TTTGTAATTTTATTTGTGTTAATGTACCATGGCCG
ATATCGGTTTTATTGAAAGAAAATTTATGTTACTT
CTGTTTTGGCTTTGCAATCAGTTATGCTAGTTTTC
TTATACCCTTTCGTAAGCTTCCTAAGGAATCGTTC
ATTGATTTCCACTGCTTCATTGTATATTAAAACTT
TACAACTGTATCGACCATCATATAATTCTGGGTCA
AGAGATGAAAATAGAACACCACATCGTAAAGTGAAAT.
3.2.2 Expression Our previous work showed that silencing activity of transgenically
of Syn-tasiRNAs that expressed syn-tasiRNAs can be gradually decreased by increasing
Base-Pair with Target the number of consecutive mismatches between the 30 end of the
RNAs to Different Degrees syn-tasiRNA and the 50 end of the target RNA (Fig. 6) (see Note
22) [6]. For example, the presence of one mismatch at the syn-ta-
siRNA 30 end is generally well tolerated without affecting silencing,
while 2–3 and 4–5 consecutive mismatches at this same end signifi-
cantly diminish or abolish, respectively, syn-tasiRNA activity. Thus,
syn-tasiRNA efficacy can be adjusted by modifying the degree of
base-pairing between the 30 end of the syn-tasiRNA and the 50 end
of the target RNA [6].
Fig. 6 Diagrams of syn-tasiRNA constructs expressing a single syn-tasiRNA with

different degrees of base-pairing with target mRNAs. Base-pairing and mis-
matches between each syn-tasiRNA and target RNA nucleotides are shown with
green and red circles, respectively. Mutated nucleotides are shown in red. ts
refers to target site
The following are recommendations to obtain the desired

degree of target gene silencing:
1. For inducing high target silencing levels, the 30 end of the
syn-tasiRNA and the 50 end of the target RNA should contain
0–1 mismatches.
2. For inducing intermediate target silencing levels, the 30 end of
the syn-tasiRNA and the 50 end of the target RNA should
contain 2–3 mismatches.
3. For inducing low target silencing levels, the 30 end of the
syn-tasiRNA and the 50 end of the target RNA should contain
at least four mismatches.
Follow the next steps to generate diverse AtTAS1c-D2-B/c-
based constructs expressing a single syn-tasiRNA that base-pairs
to the target RNA with a different number of mismatches at its 30
end (Fig. 6), and that is highly specific (see Note 23).
1. Use P-SAMS to design syn-tasiRNA-1M, a syn-tasiRNA base-
pairing to its target RNA with one mismatch at its 30 end, as
described in Subheading 3.1.1 (see Notes 21 and 24).
2. To design syn-tasiRNA-2M, a syn-tasiRNA base-pairing to its
target RNA with two mismatches at its 30 end, substitute
nucleotide at position 20 of syn-tasiRNA-1M by nucleotide at
position 2 of the target site (see Note 25).
3. Run TargetFinder (https://github.com/carringtonlab/

TargetFinder) [12] to check for potential off-targets in the
species of interest.
4. If no potential off-targets exist, then the syn-tasiRNA sequence
can be used.
5. If potential off-targets are retrieved, then repeat steps 2–4.
until identifying the most specific (with less predicted
off-targets) syn-tasiRNA sequence.
target RNA with three consecutive mismatches at its 30 end,
substitute nucleotide at position 19 of syn-tasiRNA-2M by
nucleotide at position 3 of the target site. Follow the steps 2–
5 to modify this nucleotide and complete the design.
target RNA with four consecutive mismatches at its 30 end,
substitute nucleotide at position 18 of syn-tasiRNA. Follow the
steps 2–5 to modify this nucleotide and complete the design.
target RNA with five consecutive mismatches at its 30 end,
substitute nucleotide at position 17 of syn-tasiRNA-4 M by
nucleotide at position 5 of the target site (see Note 26). Follow
the steps 2–5 to modify this nucleotide and complete the
design.
4 Notes
1. Prepare 1 mL aliquots of oligo annealing buffer and store at

20 C until use.
2. Order AtTAS1c-D2-B/c-based vectors at Addgene website
(http://www.addgene.org/): pENTR-AtTAS1c-D2-B/c
(Addgene plasmid 137,883), pMDC32B-AtTAS1c-D2-B/c
(Addgene plasmid 137,884) and pMDC32B-AtTAS1c-D2-B/
c-AtMIR173 (Addgene plasmid 137,885).
3. The first DCL4 processing position in AtTAS1c, named 30 D1
[+], cannot be used for syn-tasiRNA expression as it must
contain the sequence of the 30 half of miR173 target site.
4. Visit http://p-sams.carringtonlab.org/faq for video tutorials
on how to design syn-tasiRNAs with P-SAMS syn-tasiRNA
designer app.
5. The app outputs the sequence of the syn-tasiRNA(s) together
with the sequence of the two oligonucleotides required for
cloning the syn-tasiRNA(s) in previous AtTAS1c-B/c vectors
at position 30 D3[+] [9, 10]. Thus, these oligonucleotides are
not valid to clone the syn-tasiRNA(s) at position 30 D2[+] in

recent AtTAS1c-D2-B/c vectors [6].
6. If you want to clone your artificial sRNA into a very different
vector system, you can still use P-SAMS to design the artificial
sRNA and disregard the information related to the two oligo-
nucleotides compatible with B/c vectors.
7. A large menu of plant species is available, but if your species of
interest is missing then request its addition at
administrator@carringtonlab.org.
8. When entering more than one gene ID, please separate gene
IDs with a comma as shown in the examples. A syn-tasiRNA
sequence will be designed for each gene set, and the syn-ta-
siRNA for each set can be combined in any order after the
design step is completed.
9. Click “Option 2” to target an unannotated or exogenous
transcript (e.g., a viral RNA). Enter or paste the FASTA
sequence(s) of target transcript(s) and click “Next.” Click
“Yes” to have the results automatically filtered based on target
specificity, and “Submit” to submit the job. Select “Click to see
Results” to display the results.
10. The number of syn-tasiRNAs to multiplex in your construct is
decided at this point. We have successfully tested multiplexing
up to four syn-tasiRNAs in a single construct [10]. Importantly,
the farther from the miR173 target site the syn-tasiRNA is
cloned, the less it accumulates in vivo [6] suggesting that
syn-tasiRNAs located too far away from miR173 target site
may be poorly expressed and, consequently, possibly inactive.
Thus, we decided to limit to four the number of syn-tasiRNAs
that can be multiplexed in a single construct using P-SAMS
syn-tasiRNA Designer.
11. Note that only A. thaliana and close related species (e.g.,
Camelina sativa) produce miR173 required for triggering
syn-tasiRNA biogenesis from TAS1c precursors. Therefore, if
a different species is selected you should co-express miR173 to
produce syn-tasiRNAs.
12. Clicking “Yes” will activate a target prediction module. Results
that have predicted undesired targets will be discarded. Click
“No” to deactivate the target prediction module.
13. Jobs generally take only a few minutes to finish. Leave open the
browser’s tab to access results when ready.
14. Due to the relatively long runtime requirements of the target
prediction module, P-SAMS web is set up to return only up to
three optimal results. Use P-SAMS script “psams.pl” (https://
github.com/carringtonlab/p-sams) in the command line with
the “- u” option activated to obtain all possible optimal results.
15. Clicking the “Build construct” tab will start the building of
your syn-tasiRNA construct [10]. P-SAMS builds syn-tasiRNA
constructs based on the previously described AtTAS1c-B/c-
based vectors for inserting syn-tasiRNAs at position 30 D3[+]
[9, 10]. Thus, the sequences of the two oligonucleotides dis-
played in results are compatible for cloning in AtTAS1-B/c-
based vectors but not in AtTAS1c-D2-B/c-based vectors. Sub-
stituting the 50 terminal “ATTA” and “GTTC” of displayed
forward and reverse oligos, respectively, by “TTTA” and
“CCGA”, respectively, will make the oligos compatible with
AtTAS1c-D2-B/c-based vectors.
16. If you prefer to clone your art-sRNA in a different vector
system, it is recommended to clone the artificial sRNA insert
in a pENTR-based B/c vector, and then transfer it to the vector
of your choice (e.g., by LR recombination if the vector is
GATEWAY compatible).
17. Alternatively, the annealing reaction can be done in a water
bath or thermoblock by heating during 5 min at 94 C and
then turning off the apparatus. Let the reaction to cool down
until it reaches room temperature.
18. Do not store the diluted oligonucleotides.
19. The incubation time of the digestion-ligation reaction can be
increased up to 30 min if necessary.
20. The digestion-ligation reaction can be transferred to a spin
column for nucleic acid purification. This optional step
increases the number of colonies obtained after E. coli
transformation.
21. The use of the off-target filtering option in P-SAMS is recom-
mended to design a highly specific syn-tasiRNA.
22. The strategy of introducing mismatches between the 30 end of
the syn-tasiRNA and the 50 end of the target RNA should
remain valid for adjusting the silencing activity of amiRNAs.
23. If high specificity of the syn-tasiRNA is not required, you can
follow the recommended steps without applying the Target-
Finder analyses.
24. P-SAMS designs optimal syn-tasiRNAs to base-pair with its
target RNA with at least 1 mismatch at the 30 end of the
syn-tasiRNA.
25. Nucleotide positions in syn-tasiRNAs and target sites are
counted relative to their 50 ends.
26. More than five mismatches between the syn-tasiRNA 30 end
and the target RNA 50 end will probably inactivate syn-ta-
siRNA silencing activity.
Acknowledgments
This work was supported by grants RTI2018-095118-A-100,

BIO2017-83184-R and RYC-2017-21648 from Ministerio de
Ciencia, Innovación y Universidades (MCIU, Spain), Agencia Esta-
tal de Investigación (AEI, Spain) and Fondo Europeo de Desarrollo
Regional (FEDER, European Union).
References
1. Bernstein E, Caudy AA, Hammond SM, Han- 7. Zhang ZJ (2014) Artificial trans-acting small
non GJ (2001) Role for a bidentate ribonucle- interfering RNA: a tool for plant biology study
ase in the initiation step of RNA interference. and crop improvements. Planta 239:
Nature 409:363–366 1139–1146
2. Fire A, Xu S, Montgomery MK, Kostas SA, 8. Carbonell A (2019) Secondary small interfer-
Driver SE, Mello CC (1998) Potent and spe- ing RNA-based silencing tools in plants: an
cific genetic interference by double-stranded update. Front Plant Sci 10:687
RNA in Caenorhabditis elegans. Nature 391: 9. Carbonell A, Takeda A, Fahlgren N, Johnson
806–811 SC, Cuperus JT, Carrington JC (2014) New
3. Senthil-Kumar M, Mysore KS (2011) Caveat generation of artificial MicroRNA and syn-
of RNAi in plants: the off-target effect. In: thetic trans-acting small interfering RNA vec-
Kodama H, Komamine A (eds) RNAi and tors for efficient gene silencing in Arabidopsis.
plant gene function analysis: methods and pro- Plant Physiol 165:15–29
tocols. Humana Press, Totowa, NJ, pp 13–25 10. Carbonell A (2019) Design and high-
4. Ossowski S, Schwab R, Weigel D (2008) Gene throughput generation of artificial small RNA
silencing in plants using artificial microRNAs constructs for plants. Methods Mol Biol 1932:
and other small RNAs. Plant J 53:674–690 247–260
5. Carbonell A (2017) Artificial small RNA-based 11. Fahlgren N, Hill ST, Carrington JC, Carbonell
strategies for effective and specific gene silenc- A (2016) P-SAMS: a web site for plant artificial
ing in plants. In: Dalmay T (ed) Plant gene microRNA and synthetic trans-acting small
silencing: mechanisms and applications. CABI interfering RNA design. Bioinformatics 32:
Publishing, Wallingford, pp 110–127 157–158
6. López-Dolz L, Spada M, Daròs J-A, Carbonell 12. Fahlgren N, Carrington JC (2010) miRNA
A (2020) Fine-tune control of targeted RNAi target prediction in plants. Methods Mol Biol
efficacy by plant artificial small RNAs. Nucleic 592:51–57. https://doi.org/10.1007/978-1-
Acids Res 48:6234–6250 60327-005-2_4
Chapter 16
Trans-Kingdom RNA Silencing in Plant-Fungal Disease

Control
Tao Zhang, Fei Wang, Hui-Shan Guo, and Yun Jin
Abstract
Trans-kingdom RNA interference (RNAi) has been reported in several plant-fungal pathosystems. Our
recent works have demonstrated natural RNAi transmission from cotton plants into Verticillium dahliae, a
soil-borne phytopathogenic fungus that infects host roots and proliferates in vascular tissues, and successful
application of trans-kingdom RNAi in cotton plants to confer Verticillium wilt disease resistance. Here, we
provide a detailed protocol of cotton infection with V. dahliae, fungal hyphae recovery from infected cotton
stems, and transmitted small RNA detection developed from our previous studies for trans-kingdom RNAi
assays.
Key words Verticillium dahliae, Cotton infection, Fungal hyphae recovery, Trans-kingdom small
RNA
1 Introduction
RNA silencing (or RNA interference, RNAi) is a conserved regu-

latory mechanism of gene expression that has been widely charac-
terized in eukaryotic organisms which is mediated by small RNAs
(sRNAs) [1]. Small RNAs, including small interfering RNAs (siR-
NAs) and microRNAs (miRNAs) with 20–25 nucleotides (nt) in
length are critical regulators of RNA silencing, leading to mRNA
cleavage, translation inhibition, or chromatin modification
[1, 2]. siRNAs and miRNAs are distinctive in biosynthetic pathways
[3]. siRNAs are produced from long double-stranded RNAs
(dsRNAs) which are synthesized by RNA-dependent RNA poly-
merases (RDRs) [4, 5], whereas miRNAs are derived from single-
stranded endogenous stem-loop noncoding RNA [6]. Both siR-
NAs and miRNAs are processed by the RNase Drosha or Dicer/
Dicer-like protein and then incorporated into the RNA-induced
silencing complex (RISC) to negatively regulate target gene expres-
sion in a sequence-specific manner [7–9]. RNA silencing
243
244 Tao Zhang et al.
mechanisms have been studied extensively in different organisms,

including plants and fungi [10–12]. In plants, RNA silencing is
involved in the regulation of plant growth and development, as well
as biotic or abiotic stress responses [13, 14], endogenous miRNAs
and siRNAs have been exploited to knock down genes of interest
and engineer antiviral resistance to invading viruses, which replicate
and propagate inside the infected plant cells [15]. The studies in
Neurospora crassa, Schizosaccharomyces pombe, and also some phy-
topathogens like Verticillium dahliae, Magnaporthe oryzae, and
phytophthora indicate that endogenous small RNAs and RNAi path-
ways in fungi and oomycete are complex and mainly function in
genomic defense, heterochromatin formation, and gene regulation
[12, 16–19].
In plants, in addition to the endogenously produced sRNA
duplexes, siRNAs are also derived from exogenous dsRNAs that
are taken up by cells. Based on this, host-induced gene silencing
(HIGS) is developed as an effective defense strategy against
microbes [20, 21]. It has been successfully applied to protect plants
against various pathogens, although only a few labs are capable of
detecting the trans-kingdom regulatory small RNA by using
Northern blot but not RNA sequencing due to the difficulty in
experimental operations. Moreover, natural bidirectionally trans-
mission of RNAi signals between fungal and host plants have been
reported recently [22, 23], further supporting that small RNAs
could be transmitted from hosts to pathogens as well as from
pathogens to hosts [24–28]. The mechanisms underlying this
trans-kingdom regulation are gradually uncovered in recent years
relying on the exquisite operation in fungal recovery and small
RNAs detection.
Our previous work has demonstrated that host plants exported
specific miRNAs, including miR159 and miR166, into V. dahliae
hyphae to target fungal virulence genes, a Ca2+-dependent cysteine
protease (Clp-1) and an isotrichodermin C-15 hydroxylase (HiC-
15) respectively, for silencing [29]. We also successfully applied
trans-kingdom RNAi by using HIGS technology in transgenic
RNAi cotton plants expressing double-stranded RNAs to defend
against Verticillium wilt caused by V. dahliae [30]. dsRNA-derived
siRNAs were detected in fungal hyphae recovered from infected
RNAi cotton [30]. Given the successful HIGS developed and
applied in controlling Verticillium wilt diseases, we propose an
ideal research system of plant vasculature–Verticillium interaction
in the study of trans-kingdom RNA silencing.
Previously, the regular procedure for infection of plants with
the soil-borne pathogen is to uproot soil-grown plants, incubate
the roots in a conidial suspension, and then replant the plants in
fresh soil. To avoid damaging the roots and better to mimic natural
infection conditions, we have developed a novel unimpaired root
dip-inoculation method to assess the pathogenicity of V. dahliae in
Trans-Kingdom RNA Silencing in Plant-Fungal Disease Control 245
cotton [31]. In the chapter, we describe the detailed method for

laboratory root inoculation which is convenient for operation, the
protocol of fungal recovery from stems, and Northern blotting of
transmitted small RNA for facilitating the study of trans-kingdom
gene silencing.
2 Materials
2.1 Cotton Infection 1. V. dahliae strain, V592, was used in our lab for cotton
infection.
2. Cotton seeds: susceptible upland cotton wide-type wc-ck and
transgenic RNAi cotton, 35S-VdH1i [30].
3. 30% sodium hypochlorite: Add 30 mL sodium hypochlorite
and 70 mL distilled water to a 100 mL graduated cylinder,
stored at room temperature.
4. Potato dextrose agar (PDA): Boil 200 g of peeled potatoes in
adequate distilled water for about 30 min. Filtrate through
4 layers of gauze, add 20 g of glucose and 20 g of agar. Add
distilled water to a final volume of 1 L. Sterilize by autoclaving
20 min at 113 C.
5. MS (Murashige and Skoog) liquid medium: 0.1% (w/v)
MS. Weigh 1 g MS and make it to 1 L with water.
6. Czapek–Dox medium: Weigh 30 g sucrose, 3 g NaNO3, 1 g
K2HPO4, 0.5 g MgSO4·7H2O, 0.5 g KCl, and 0.1 g FeS-
O4·7H2O, mix and make it to 1 L with distilled water. Sterilize
by autoclaving 20 min at 113 C.
7. Round (90 mm diameter) Petri dishes.
8. Sterilized gauze: Oven dry after sterilization by autoclave.
9. Pot for cotton growth (dimensions: 300 200 100).
10. Distilled water.
11. Hemocytometer.
2.2 Fungal Recovery 1. 70% (v/v) ethanol: Add 70 mL ethanol and 30 mL distilled
water to a 100 mL graduated cylinder, stored at room
temperature.
2. 30% sodium hypochlorite.
3. Tweezers: sterilized by alcohol burner before use.
4. Filter paper: oven dry after sterilized by autoclave.
5. Scissors: sterilized by alcohol burner before use.
6. Fifty mL conical tubes: oven dry after sterilized by autoclave.
7. Sterilized water.
8. Czapek–Dox medium.
2.3 sRNA Gel Blotting 1. TRIzol reagent (Invitrogen) or other commercial RNA
extraction kits.
2. 10 TBE buffer: 108 g/L Tris base, 55 g/L boric acid, and
20 mM EDTA.
3. 60 mL 17% polyacrylamide gel: 34 mL 30% polyacrylamide
(acrylamide–bis ¼ 29:1), 3 mL 10 TBE buffer, 25.2 g urea,
2.5 mL ddH2O.
4. 480 μL 10% APS (ammonium persulfate): Weigh 0.1 g APS
and transfer to the 1.5 mL centrifuge tube, add water to a
volume of 1 mL.
5. 20 μL TEMED (tetramethylethylenediamine).
6. 10 MOPS–EDTA–sodium acetate buffer: 400 mM pH 7.0
MOPS, 100 mM sodium acetate, 10 mM pH 8.3 EDTA.
7. 6 RNA loading buffer: 62.5% (v/v) deionized formamide,
1.14 M formaldehyde, 1.25 MOPS–EDTA–sodium acetate
buffer, 200 μg/mL bromophenol blue, 200 μg/mL xylene
cyanol FF.
8. Probe labeling reagents: [α-32P]-UTP (Perkinelmer), MAXI
script In vitro Transcription Kit (Ambion).
9. Hybridization buffer: Perfect Hyb™ Plus Hybridization Buffer
(Sigma).
10. 20 SSC: 175.3 g/L NaCl, 88.2 g/L sodium citrate, adjust
pH to 7.0 with HCl.
11. 20% SDS: 20 g SDS dissolved in 100 mL distilled water.
12. Wash buffer: 2 SSC with 0.2% SDS. Measure out 100 mL
20 SSC and 10 mL 20% SDS, add water to a volume of 1 L.
13. DNaseI.
14. Carbonate buffer: 240 mM Na2CO3, 160 mM NaHCO3.
3 Methods
3.1 Cotton Infection 1. Sterilize cotton seeds in 30% sodium hypochlorite for 15 min
and rinse three times with distilled water. Soak the seeds over-
night at room temperature. Germinate seeds in pots filled with
wet soil and cover with plastic dome for 1 week to grow
seedlings until two cotyledons are fully expanded.
2. Transplant 12 seedlings per pot with MS liquid medium and
grow at 26 C with a 16 h light (8000 lux)/8 h dark cycle for
about 2 weeks before inoculation of V592.
3. Streak V592 onto PDA plates (refresh from glycerol stocks)
and incubate for 1 week at 26 C in the dark. Transfer one plate
(90 mm) of mycelia into 200 mL Czapek–Dox medium with
shaking at 200 rpm for 3 days at 26 C in the dark to obtain
conidia.
Fig. 1 Cotton infection with V. dahliae. (a) Root-dip inoculation of cotton seedling with conidia suspension. (b)
Representative disease symptom in wild-type cotton at 20 dpi of V. dahliae infection. (c) 35S-VdH1i cotton
exhibited reduced disease grade at 20 dpi of V. dahliae infection
4. Prepare the conidial suspension through filtrating the fungal

cultures with 4 layers of sterilized gauze to remove mycelia.
Measure the concentration of conidia in the suspension using a
hemocytometer and adjust to approximately 1 107 conidia
per mL with Czapek–Dox medium.
5. Immerse the roots of seedlings with two true leaves to the
conidial suspension from step 4 for 1 h (Fig. 1a). Put back
the inoculated seedlings to MS liquid medium and supply water
once a week.
6. Take cotton plant that shows wilting symptom of CK and
resistant phenotype of 35S-VdH1i at 20 days post inoculation
(dpi) to carry out next step (Fig. 1b and 1c) (see Note 1).
3.2 Fungal Recovery To identify whether the colonization of V. dahliae in vascular

tissues taken up small RNAs from the plant, we isolate the
V. dahliae from inoculated cotton stems for further research.
1. Cut the stem sections immediately under the cotyledons of
infected cotton plants at 20 dpi (see Notes 2 and 3) (Fig. 2a).
2. Sterilize the stem sections for 1 min in 70% ethanol within a
50 mL conical tube followed by 30 min in 30% sodium hypo-
chlorite. Revolve the tube on the rotator at 20 rpm during this
process.
3. Rinse the stems three times with sterilized water for 3 min each
time (see Note 4).
4. Put the stems on filter paper with sterilized tweezers, till the
stems are totally dry (Fig. 2b) (see Note 5).
5. Culture the dry stems at 26 C on PDA medium in the dark.
The colonies of V. dahliae would normally grow from the stem
transection in 5 days (Fig. 2c) (see Note 6).
Fig. 2 Recovery of V. dahliae hyphae from the infected cotton stems. (a) Cut the stem sections immediately
under the cotyledons. (b) Dry stems after three times rinses with sterilized filter paper. (c, d). V. dahliae hyphae
grow out from the cotton stems in 5 days (c) and 10 days (d) on PDA
6. Transfer one plate (90 mm) of mycelia after 10 days of growth

by a sterilized blade (see Note 7) into 200 mL Czapek–Dox
medium with shaking at 200 rpm for 3 days at 26 C in the dark
to obtain more conidia and mycelia (Fig. 2d).
7. Transfer the conidia and mycelia to 50 mL centrifuge tubes,
then spin for 15 min at room temperature and discard the
supernatant.
8. Invert the tube on the filter paper for 5–10 min to absorb the
residual liquid absolutely (see Note 8).
9. Quick-freeze the mixture of conidia and mycelia with liquid
nitrogen, then store at 80 C or carry on RNA extraction.
10. Isolated RNA can be used for Northern blot analysis or small
RNA sequencing.
3.3 sRNA Gel Blotting Northern blotting is carried out to verify the expression of small
RNAs in V. dahliae hyphae recovered from infected cotton plants.
1. Total RNAs are isolated using TRIzol according to the manu-
facturer’s instructions.
2. Gently mix the components of a 17% polyacrylamide gel
(minus APS and TEMED) in a 100 mL flask, heat the mixture
in the microwave with high fire for 1 min. Shake gently until
urea is dissolved completely.
3. Add 480 μL 10% APS (little by little, from bottom to top), and
mix gently (see Note 9). Add 20 μL TEMED (little by little,
from bottom to top), mix gently, transfer to a gel casting
apparatus and then let it solidify for an hour.
4. Assemble the gel apparatus, and add the running buffer
(0.5 TBE). Make sure there are no leaks.
5. Add 1 volume of deionized formamide to 40–60 μg of total
RNA (dissolved in ddH2O) (see Note 10). Denature at 100 C
for 5–10 min, then put the sample on ice for 5–10 min.
Fig. 3 The diagram of gel-membrane assembly for the semi-dry electrophoretic transfer of RNAs from
polyacrylamide gel to nitrocellulose membranes
6. Add RNA loading buffer to the above RNA samples and mix
quickly. Load RNA samples to gel columns. Run in 0.5 TBE
at 80 V until the bromophenol blue band reaches the bottom
of the gel (~16 h for a 20 20 cm gel).
7. Cut the appropriate region of the gel and appropriate size of
the membrane (about 1 cm larger than the gel), then immerse
the gel, membrane, and filter paper in 1 TBE for about 30 s.
8. Set up a RNA transfer sandwich in the Trans-blot Semi-Dry
Electrophoretic transfer cell as follows, from bottom to top:
filter paper, membrane, gel, filter paper (Fig. 3). Make sure to
roll out any bubbles between the layers using a glass rod.
Transfer membrane for about 30–45 min at X mA (X mA ¼ area
(cm2 of membrane) 3).
9. Remove the membrane and place it in a UV cross-linker and
cross-link at an optimal setting (usually at 1200 100 μJ/cm2
for 2 min).
10. Store the fixed membrane at 4 C until use.
11. For siRNAs Northern blotting, take siRNAs from 35S-VdH1i
for example, the probe is prepared using the pSK-VdH1i con-
struct (see Note 11) with MAXI script In vitro Transcription
Kit according to the manufacturer’s instructions. The labeling
mixture contains 2 μL 10 reaction buffer, 0.5–1 μg Probe,
1 μL ATP, 1 μL CTP, 1 μL GTP, 3 μL [α-32P]-UTP, and 2 μL
T7 RNA Polymerase, incubate at 37 C for 1 h. Add 1 μL
DNaseI, incubate at 37 C for 15 min, then add 300 μL
carbonate buffer, incubate at 60 C for 2.5 h. Add the labeled
probe to the hybridization buffer, hybridize at 42 C
overnight.
12. Wash the membrane with 2 SSC containing 0.2% SDS at
50 C for 15–20 min for two to three times.
13. Check radioactivity signals on the membrane with a Geiger
counter.
14. Wrap the membrane with a sealing bag and expose to a Phos-
phorimager to detect hybridization signals (Fig. 4).
Fig. 4 Northern blotting of transmitted siRNAs in recovery hyphae. Weak but

clear signals of siVdH1 in Vda35S-VdH1i colonies but not in the VdaCotton colony
were detected. Vdacotton: colonies that recovered from wild-type cotton; Vda35S-
VdH1i
: colonies that recovered from 35S-VdH1i plants
4 Notes
1. Typical leaf wilt disease symptoms were observed on wild-type

cotton at 20 dpi, whereas transgenic cotton of the 35S-VdH1i
lines exhibited resistance to V592 infection with significantly
reduced disease symptoms (Fig. 1c).
2. It is the best position to isolate V. dahliae in vascular tissues.
3. V. dahliae isolated from stems at 20 dpi is most likely best to
detect small RNAs transmitted from cotton plants.
4. The sodium hypochlorite residue will affect the mycelia
growth. Thus, three times rinses are required to make sure
the stems have no residue.
5. Roll the stems on filter paper with sterilized tweezers to absorb
residual water, then dry up the stems with the wind in a clean
bench (Fig. 2b).
6. Carry out this procedure in a clean bench. The V. dahliae
colonies would grow out from both wild-type cotton and
35S-VdH1i stems on PDA plates.
7. Remove the stems with sterilized tweezers carefully to make
sure that there is no plant debris left before transferring the
mycelia.
8. The residual liquid will affect the RNA extraction quality.
Therefore, it is important to dry the conidia and mycelia for
5–10 min on the filter paper.
9. Make sure to prepare a fresh 10% APS each time.
10. The RNA sample should be loaded as much as possible due to

the small amount of trans-kingdom small RNA which is hardly
detected by Northern blotting.
11. Any other vectors containing T7 promoter and the target gene
fragments in accordance with the transgenic gene sequence
could be used for probe labeling.
Acknowledgments
This work was supported by a grant from the National Natural

Science Foundation of China (31730078 to H.-S.G. and
31700131 to Y.J.).
References
1. Baulcombe D (2005) RNA silencing. Trends 12. Li L, Chang SS, Liu Y (2010) RNA interfer-
Biochem Sci 30:290–293 ence pathways in filamentous fungi. Cell Mol
2. Sontheimer EJCR (2005) Silence from within: Life Sci 67:3849–3863
endogenous siRNAs and miRNAs. Cell 122: 13. Yu Y, Zhang YC, Chen XM et al (2019) Plant
9–12 noncoding RNAs: hidden players in develop-
3. Axtell MJ (2013) Classification and compari- ment and stress responses. Annu Rev Cell Dev
son of small RNAs from plants. Annu. Rev Biol 35:407–431
Plant Biol 64:137–159 14. Guo Z, Li Y, Ding SW (2019) Small
4. Dalmay T, Hamilton A, Rudd S et al (2000) An RNA-based antimicrobial immunity. Nat Rev
RNA-dependent RNA polymerase gene in Ara- Immunol 19(1):31–44
bidopsisis required for post transcriptional 15. Duan C, Wang CH, Guo HS (2012) Applica-
gene silencing mediated by a transgene but tion of RNA silencing to plant disease resis-
not by a virus. Cell 101:543–553 tance. Silence 3:5
5. Mourrain P, Beclin C, Elmayan T et al (2000) 16. Chang SS, Zhang Z, Liu Y (2012) RNA inter-
Arabidopsis SGS2 and SGS3 genes are required ference pathways in fungi: mechanisms and
for posttranscriptional gene silencing and nat- functions. Annu Rev Microbiol 66:305–323
ural virus resistance. Cell 101:533–542 17. Martienssen R, Moazed D (2015) RNAi and
6. Papp I, Mette MF, Aufsatz W et al (2003) heterochromatin assembly. Cold Spring Harb
Evidence for nuclear processing of plant micro- Perspect Biol 7(8):a019323
RNA and short interfering RNA precursors. 18. Nunes CC, Gowda M, Sailsbery J et al (2011)
Plant Physiol 132:1382–1390 Diverse and tissue-enriched small RNAs in the
7. Carthew RW, Sontheimer EJ (2009) Origins plant pathogenic fungus, Magnaporthe oryzae.
and mechanisms of miRNAs and siRNAs. Cell BMC Genomics 12:288
136:642–655 19. Jin Y, Zhao JH, Zhao P et al (2019) A fungal
8. Lin H, Hannon GJ (2004) MicroRNAs: small milRNA mediates epigenetic repression of a
RNAs with a big role in gene regulation. Nat virulence gene in Verticillium dahliae. Philos
Rev Genet 5:522–531 Trans R Soc Lond Ser B Biol Sci 374
9. Bartel D (2004) MicroRNAs: genomics, bio- (1767):20180309
genesis, mechanism, and function. Cell 116: 20. Koch A, Kogel KH (2014) New wind in the
281–297 sails: improving the agronomic value of crop
10. Baulcombe D (2004) RNA silencing in plants. plants through RNAi-mediated gene silencing.
Nature 431:356–353 Plant Biotechnol J 12(7):821–831
11. Dang Y, Yang Q, Xue Z et al (2011) RNA 21. Nunes CC, Dean RA (2012) Host-induced
interference in fungi: pathways, functions, and gene silencing: a tool for understanding fungal
applications. Eukaryot Cell 10:1148–1155 host interaction and for developing novel
disease control strategies. Mol Plant Pathol 13 RNAi for powerful innovative pre- and post-
(5):519–529 harvest plant protection. Curr Opin Plant Biol
22. Hou Y, Ma W (2020) Natural host-induced 38:133–141
gene silencing offers new opportunities to 28. Cai Q, Qiao L, Wang M et al (2018) Plants
engineer disease resistance. Trends Microbiol send small RNAs in extracellular vesicles to
28(2):109–117 fungal pathogen to silence virulence genes. Sci-
23. Hua C, Zhao JH, Guo HS (2018) Trans- ence 360(6393):1126–1129
kingdom RNA silencing in plant-fungal patho- 29. Zhang T, Zhao YL, Zhao JH et al (2016b)
gen interactions. Mol Plant 11(2):235–244 Cotton plants export microRNAs to inhibit
24. Qiao Y, Liu L, Xiong Q et al (2013) Oomycete virulence gene expression in a fungal pathogen.
pathogens encode RNA silencing suppressors. Nat Plants 2(10):16153
Nat Genet 45:330–333 30. Zhang T, Jin Y, Zhao JH et al (2016a) Host
25. Weiberg A, Wang M, Lin FM et al (2013) induced gene silencing of the target gene in
Fungal small RNAs suppress plant immunity fungal cells confers effective resistance to the
by hijacking host RNA interference pathways. cotton wilt disease pathogen Verticillium dah-
Science 342:118–123 liae. Mol Plant 9(6):939–942
26. Baulcombe DC (2015) VIGS, HIGS and 31. Gao F, Zhou BJ, Li GY et al (2010) A glutamic
FIGS: small RNA silencing in the interactions acid-rich protein identified in Verticillium dah-
of viruses or filamentous organisms with their liae from an insertional mutagenesis affects
plant hosts. Curr Opin Plant Biol 26:141–146 microsclerotial formation and pathogenicity.
27. Wang M, Thomas N, Jin H (2017) Cross- PLoS One 5(12):e15319
kingdom RNA trafficking and environmental
Chapter 17
An Integrated Bioinformatics and Functional Approach for

miRNA Validation
Sombir Rao, Sonia Balyan, Chandni Bansal, and Saloni Mathur
Abstract
MicroRNAs (miRNAs) are small (20–24 nucleotides) non-coding ribo-regulatory molecules with signifi-
cant roles in regulating target mRNA and long non-coding RNAs at transcriptional and post-transcriptional
levels. Rapid advancement in the small RNA sequencing methods with integration of degradome sequenc-
ing has accelerated the understanding of miRNA-mediated regulatory hubs in plants and yielded extensive
annotation of miRNAs and corresponding targets. However, it is becoming clear that large numbers of such
annotations are questionable. Therefore, it is imperative to adopt reliable and strict bioinformatics pipelines
for miRNA identification. Furthermore, sensitive methods are needed for validation and functional char-
acterization of miRNA and its target(s). In this chapter, we have provided a comprehensive and streamlined
methodology for miRNA identification and its functional validation in plants. This includes a combination
of various in silico and experimental methodologies. To identify miRNA compendium from large-scale
Next-Generation Sequencing (NGS) small RNA datasets, the miR-PREFeR (miRNA PREdiction From
small RNA-Seq data) bioinformatics tool has been described. Also, a homology-based search protocol for
finding members of a specific miRNA family has been discussed. The chapter also includes techniques to
ascertain miRNA:target pair specificity using in silico target prediction from degradome NGS libraries using
CleaveLand pipeline, miRNA:target validation by in planta transient assays, 50 RLM-RACE and expression
analysis as well as functional techniques like miRNA overexpression, short tandem target mimic and
resistant target approaches. The proposed strategy offers a reliable and sensitive way for miRNA:target
identification and validation. Additionally, we strongly promulgate the use of multiple methodologies to
validate a miRNA as well as its target.
Key words MicroRNAs, Degradome, 50 RLM-RACE, Short Tandem Target Mimic, Target cleavage,
Resistant target, miRNA sensor
1 Introduction
MicroRNAs (miRNAs) are 20–24 nucleotide regulatory RNAs that

originate from the precise processing of stem-loop precursors. They
have emerged as the key regulators of protein coding mRNAs and
long non-coding RNAs in various vital biological and physiological
pathways of plants such as growth, development, environmental
adaptation, and stress response [1–9]. In plants, the primary mode
253
254 Sombir Rao et al.
of miRNA regulation is post-transcriptional by the way of comple-

mentary target mRNA cleavage [10–12]. Since the discovery of
miRNAs in Caenorhabditis elegans, various methods have been
developed for miRNA identification, validation, and functional
characterization in both animals and plants [13]. The technological
advancement in next-generation sequencing (NGS)-based
approaches has led to a surge in the availability of not only many
genomes of different organisms but has also captured the transcript
profiles of mRNAs and various non-coding RNAs including miR-
NAs [14–17]. Several plant miRNA validation strategies used in
earlier decades of miRNA research such as miRNA cloning [18],
splinted-ligation mediated methods [19], and genetic screening
[20] are very robust and effective in identification of genuine
miRNAs. However, these techniques are considerably time-
consuming, labour intensive, and costly. Therefore, they are not
suitable for high throughput and comprehensive studies [21, 22].
Using small RNA-Seq NGS data is the most powerful way for
large-scale detection of genuine known and novel miRNAs
together with their isoforms as well as isomiRs (miRNA variants
derived from the same precursor exhibiting 1 or 2 nucleotides
variation from either 50 or 30 end of mature miRNA) [2, 14–17,
21, 23–25]. Wide applications of small RNA sequencing
technology-based tools such as miRanalyzer, miR-PREFeR, miR-
TRAP, and ShortStack [26–29] have led to the explosion of
miRNA discovery in the last few years. These tools for plant
miRNA discovery vary widely in their performance and predict
thousands of miRNAs, increasing false positives. To overcome this
problem, Axtell and Mayers [30] have proposed revised and strict
miRNA annotation criteria. Moreover, by comparative analysis of
several tools, Lei and Sun [29] have suggested miR-PREFer and
ShortStack platforms as the best miRNA identifiers.
Furthermore, the coupling of small RNA deep sequencing with
degradome (NGS data representing cleaved target transcripts) anal-
ysis has revolutionized the field of plant miRNA research, enabling
identification of targets of miRNAs at a global scale. This requires
development of powerful computational tools to collate all the
NGS data to provide fast, efficient, reliable, and sensitive approach
for identification and characterization of miRNA:target pairs
[31]. The most widely accepted and efficient computational tool
among them is the CleaveLand pipeline [32]. Apart from the small
RNA-Seq NGS data-based approach, several studies have also uti-
lized the sequence homology-based in silico pipelines to identify
new members (isoforms) of plant miRNA families [9, 33–35]. Cou-
pling of homology-based pipeline to identify miRNA loci, determi-
nation of stem-loop precursor by bioinformatics tools like Vienna
RNA secondary structure server, M-fold [36, 37], precursor con-
firmation by cloning and sequencing offers an efficient and sensitive
method for miRNA identification and validation. Furthermore,
An Integrated Bioinformatics and Functional Approach for miRNA Validation 255
confirmation of target cleavage by miRNA using 50 RLM-RACE

(RNA Ligation Mediated-Rapid Amplification of cDNA Ends)
together with transient in planta assays in heterologous system
like Nicotiana benthamiana to validate miRNA:target pairs has
been successfully used [9].
To understand functional roles of miRNAs in plants, overex-
pression of miRNAs under constitutive promoter is widely used but
this can potentially lead to deceptive identification of miRNA func-
tion due to incorrect spatio-temporal expression and subsequent
development of aberrant phenotypes [38]. In contrast to miRNA
overexpression, the Short Tandem Target Mimic (STTM) acts as a
“miRNA sponge” that titers out complementary miRNAs and
hence is suitable for their functional characterization [39]. A
miRNA can efficiently target many genes and produce pleiotropic
phenotypes by regulating different target mRNAs [3, 4, 9,
40]. Therefore, to delineate the functional specificity to a particular
target, studies have utilized resistant target approach, wherein a
non-cleavable form of a target gene is expressed under a native
promoter. In this way, by comparing the phenotypic impact of the
expression of miRNA-resistant target to its wild-type counterpart,
the functional significance of miRNA-mediated regulation of a
target can be elucidated. Using these functional approaches, several
target genes of miRNAs have been successfully established in plants
[3, 4, 9, 40–44].
This chapter describes a stepwise protocol combining in silico
and functional strategies for miRNA and its target identification
and validation using miR169 as a case study in tomato. We share
protocols that include identification of miRNA repertoire using
small RNA-Seq data along with a homology-based bioinformatics
method for identification of miRNA169 isoforms. Focusing on
target cleavage by miRNA as the main post-transcriptional regu-
latory method in plants, we provide protocols for target identifica-
tion by bioinformatics approach to analyze large-scale data as well
as characterization of single target. Furthermore, transient in
planta assays to establish miRNA:target pair are included. These
provide a quick and reliable way to confirm the predicted miRNA:
target pair before proceeding for raising transgenic plants for func-
tional characterization.
2 Materials
2.1 Small RNA NGS 1. System platform: Linux, Windows, or Mac OS.
Dataset Analysis and 2. CLC genomics workbench (QIAGEN) for adapter trimming
miRNA Identification (https://digitalinsights.qiagen.com/products-overview/dis
Using miR- covery-insights-portfolio/analysis-and-visualization/qiagen-
PREFeR Tool clc-genomics-workbench).
3. miR-PREFeR software (https://github.com/hangelwen/

miR-PREFeR; [29]).
4. Python (2.6.7, 2.7.2, 2.7.3 and should work under Python
2.6. and Python 2.7; https://www.python.org/downloads).
5. Vienna RNA package (version 1.8.5 or 2.1.2, 2.1.5 http://
www.tbi.univie.ac.at/~ronny/RNA/index.html; [36, 45]).
6. Samtools (http://samtools.sourceforge.net/; [46]).
7. Bowtie (https://sourceforge.net/projects/bowtie-bio/files/
bowtie; [47]).
8. Genome sequences in fasta format (for example, “Genome.fa”
for tomato in this study).
9. Small RNA sequencing reads.
2.2 Homology-Based 1. Curated reference set of non-redundant plant miRNA169

In Silico Identification mature sequences.
of miRNA169 Family 2. Sol genomics network (SGN) database (https://solgenomics.
Members in Tomato (a net/; [48]).
Case Study) 3. RNA fold (http://rna.tbi.univie.ac.at/cgi-bin/
RNAWebSuite/RNAfold.cgi; [45]).
4. M-fold (http://unafold.rna.albany.edu/?q¼mfold; [37]).
2.3 Validation of 1. Tomato Functional Genomics Database (TFGD) (http://ted.

Predicted Tomato bti.cornell.edu/cgi-bin/TFGD/sRNA/sRNA.cgi; [49]).
MIR169 Loci 2. miRNEST (http://rhesus.amu.edu.pl/mirnest/copy/home.
2.3.1 Validating the php; [50]).
Putative MIR Loci by Small 3. PNRD: Plant Non-coding RNA Database (http://bioinformat
RNA Data Support ics.cau.edu.cn/PMRD/; [51]).
2.3.2 Validation of 1. DNase I treated total RNA.

Precursor by Cloning 2. cDNA Reverse Transcription Kit.
3. RNase-free microcentrifuge tubes.
Preparation of cDNA
4. PCR tubes.
5. PCR machine.
Cloning and Sequencing 1. cDNA.

2. Precursor-specific primers.
3. TA PCR cloning kit.
4. Microcentrifuge tubes.
5. Luria Bertani (LB) broth (10 g tryptone, 5 g yeast extract, and
10 g sodium chloride make up to 1 L, pH 7).
6. 2% LB agar.
7. Escherichia coli (E. coli) competent cells.
8. Taq DNA Polymerase.

9. dNTPs.
10. Water bath.
11. Incubator-shaker.
12. Safety hood.
13. PCR machine and DNA sequencer.
2.3.3 qRT-PCR Based 1. cDNA.

Validation of miRNAs 2. SYBR Green master mix.
Precursors
3. Precursor-specific primers.
4. Actin (Solanum lycopersicum) primers: Forward: 50 -CAAAGG
CAGAGTATGACGA-30 , reverse: 50 -GCATCTCTGGTCCAG
TAGGAA-30 .
5. 18S (Solanum lycopersicum) rRNA primers: Forward: 50 -CAT
GATAACTCGACGGATCG -30 , reverse: 50 - AGGCCAC
TATCCTACCATCG-30 .
6. Optical 96-well fast plates and sealer.
7. Plate centrifuge.
8. Real-time PCR system.
2.4 Expression 1. Total RNA 50–100 μg.

Analysis of miRNAs 2. Diethyl pyrocarbonate ({DEPC} for treating MQ,
2.4.1 Isolation of Small plastic ware).
RNAs by Lithium Chloride 3. Chloroform.
Precipitation 4. Isopropanol.
5. 75% ethanol.
6. Phenol:Chloroform:Isoamyl-alcohol (P:C:I) 25:24:1.
7. 3 M sodium acetate (NaOAc).
8. Ethanol.
9. 4 M lithium chloride (LiCl).
10. 10 Tris-borate-EDTA buffer: TBE: 1 M Tris base, 1 M Boric
acid, and 0.02 M EDTA.
11. 15% denaturing urea PAGE (Polyacrylamide gel electrophore-
sis) gel 10 ml: 5 ml of 30% AA:BAA (acrylamide:bis-
acrylamide); 4.2 g of urea {7 M}; 1 ml 10 TBE buffer;
60 μl of 10% Ammonium persulfate (APS); and 15 μl of Tetra-
methyl ethylene diamine (TEMED)].
12. RNA loading dye: 95% deionized formamide, 0.025% {w/v}
bromophenol blue, 0.025% {w/v} xylene cyanol FF, 5 mM
EDTA {pH 8.0}, and 0.025% {w/v} sodium dodecyl sulfate.
13. GelRed or Ethidium bromide (EtBr) stain.
14. Gel imaging system.

15. Heating block or water bath.
16. Microcentrifuge.
18. Bioanalyzer.
19. Vertical gel electrophoresis apparatus.
2.4.2 Poly A-Tailing of 1. Small RNA.

the Small RNA 2. Poly(A) Polymerase Tailing Kit.
3. RNase inhibitor.
4. RNase-free water.
5. RNase-free 0.2 ml PCR tubes.
6. PCR machine.
2.4.3 Preparation of 1. Poly(A) tailed small RNA.

cDNA from Small RNA 2. RNase-free 0.2 ml PCR tube.
3. 10 mM dNTPs mix.
4. 100 μM RT-Primer miR_oligodT_RTQ: 50 - CGAATTCTA
GAGCTCGAGGCAGGCGACATGGCTGGCTAGT
TAAGCTTGGTACCGAGCTCGGATCCAC
TAGTCCTTTTTTTTTTTTTTTTTTTTTTTTTVN-30 .
5. Reverse transcription kit.
6. RNase inhibitor.
7. PCR machine.
2.4.4 TaqMan qRT-PCR 1. TaqMan PCR Master Mix.

Based Expression Analysis 2. Fam (Fluorescein) dye and BHQ labelled TaqMan universal
of miRNAs probe (50 -{6FAM} CTTGGTACCGAGCTCGGATCCAC
TAGTCC{BHQ}-30 ).
3. miRNA-specific forward primer.
4. RTQ-universal reverse primer.
5. 5S rRNA primer (Solanum lycopersicum) as the endogenous
control (50 -CAGAACTCCGAAGTTAAGCGT-30 ).
6. Small RNA cDNA.
2.5 miRNA Target 1. Transcriptome fasta file (e.g., “transcriptome-3.fa”).

Identification Using 2. Unique miRNA sequences in fasta format (for example,
Degradome Datasets “miRNA.fa” in the present study).
Following
3. Degradome datasets: either in house generated or downloaded
CleaveLand Tool from Sequence Read Archive {SRA} of National Center for
Biotechnology Information {NCBI}.
4. CleaveLand version 4.5 software (https://github.com/
MikeAxtell/CleaveLand4; [32]).
5. Perl module version 5.10.0, Getopt::Std, Math::CDF.
6. Bowtie (https://sourceforge.net/projects/bowtie-bio/files/
bowtie; [47]).
7. RNAplex from Vienna RNA package (http://www.tbi.univie.
ac.at/~ronny/RNA/index.html; [45]).
8. Generic Small RNA-Transcriptome Aligner (GSTAr) (https://
github.com/MikeAxtell/GSTAr; [52]).
9. R package (https://cran.r-project.org/bin/windows/base/).
10. SAMtools (http://samtools.sourceforge.net/; [46]).
2.6 Validation of 1. Total RNA.

miRNA-Mediated 2. Poly(A) mRNA purification kit.
Target Cleavage:
3. 50 RNA oligonucleotide adapter (50 - GUUCAGAGUUCUA
0
2.6.1 5 RLM-RACE: CAGUCCGAC-30 ).
4. T4 RNA ligase.
5. Oligo(dT) primer.
6. First-strand cDNA synthesis kit.
7. Adaptor-specific forward primer (50 - GTTCAGAGTTCTA
CAGTCCGAC-30 ).
8. Target gene-specific reverse primers.
9. TA cloning kit.
10. PCR machine.
11. E. coli competent cells.
2.6.2 Transient Assays 1. miRNA precursor (to make miRNA overexpression construct)
for Target Cleavage and target sequences.
2. miRNA and target alignment, full length cDNA as template.
3. Phusion Taq DNA polymerase.
4. Binary vectors: pCAMBIA1302 and PBI121.
5. T4 DNA ligation kit.
7. Agrobacterium tumefaciens (EHA105) competent cells.
8. LB broth and agar plates with appropriate antibiotic.

9. Benchtop microcentrifuge.
10. Infiltration buffer: 10 mM MgCl2, 10 mM 2-(N-morpholino)
ethanesulfonic acid {MES}, pH 5.8, 0.5% glucose and 150 μM
acetosyringone.
11. 4-week-old Nicotiana benthamiana plants grown in a growth
chamber maintained at 26 C and light intensity of 300 μM per
m2 per sec.
12. GFP primers: Forward: 50 - GTCAGTGGAGAGGGT
GAAGGTG-30 , reverse: 50 -GTCGTGCCGCTTCATATGATC
-30 .
13. Hygromycin phosphotransferase II primers: Forward: 50 -GGAG
GCTATGGATGCGAT -30 , reverse: 50 - CCGTCAGGA
CATTGTTGG-30 .
14. SYBR Green master mix.
18. Benchtop centrifuge.
19. PCR machine.
20. Oakridge tubes.
22. 1 ml syringe.
2.7 Functional 1. miRNA sequence.

Delineation of miRNA: 2. Overlapping fragments with 48 nucleotide long spacer.
Target Pair in Planta
3. Binary vector: pCAMBIA2300 with a cassette containing
2.7.1 Short Tandem 2 35S promoter and NOS terminator.
Target Mimic (STTM): 4. A. tumefaciens (EHA105 strain).
5. Infiltration buffer (as in Subheading 2.6.2).
6. 4-week-old tomato plants grown in a growth chamber main-
tained at 26 C and light intensity of 300 μM per m2 per sec.
7. Total RNA, reverse transcription kit.
8. Target gene-specific primer.
9. Actin primers.
15. PCR machine.

16. Oakridge tubes.
18. 1 ml syringe.
2.7.2 Resistant Target 1. Total RNA.

2. Reverse transcription kit.
3. psRNATarget tool (http://plantgrn.noble.org/psRNATarget;
[52]).
4. Primers to amplify mutated target.
5. Target gene-specific primers.
6. Actin primers.
7. Phusion Taq DNA Polymerase.
8. PCR machine.
9. Binary vector: pBI121.
10. Restriction endonucleases.
11. T4 DNA ligation kit.
13. Agrobacterium competent cells (EHA105).
14. Infiltration buffer (as in Subheading 2.6.2).
15. 4-week-old N. benthamiana plants grown in a growth cham-
ber maintained at 26 C and light intensity of 300 μM per m2
per sec.
21. PCR machine.
22. Oakridge tubes.
24. 1 ml syringe.
3 Methods
The small RNA sequencing data are usually obtained in fastq for-
mats consisting of four lines (sequence identifier, sequence, separa-
tor, and base call quality scores). The raw reads of small RNA
sequencing contain adapters that need to be removed before
3.1 Small RNA miRNA identification. The trimming of adapter sequence can be
Dataset Analysis for performed by many tools (see Note 1) available but here we have
miRNA Identification used the CLC genomics workbench tool. This workbench is also
Using miR- used to convert NGS data into different formats as per require-
PREFeR Tool ments. To identify the small RNA repertoire using the small RNA
sequencing data of any plant tissue, there are many software and
methods available (see Note 2). We have adopted miR-PREFeR
tool [29] as it uses expression patterns of miRNA based on miRNA
annotation guidelines and with sensitive, accurate, fast, and low
false positive predictions (see Note 3).
3.1.1 Adapter Trimming Import the small RNA data file in “fastq” format into the CLC
genomics workbench using the “NGS import tab.” Then to
remove the adapter sequences from the small RNA tags use the
“Extract and Count tool” of CLC genomics workbench with the
following trim settings: Removal of ambiguous nucleotides: no
ambiguous nucleotide allowed; Removal of adapter sequences,
using Illumina small RNA (50 -CAAGCAGAAGACGGCATACGA
-30 ), strand ¼ minus, action ¼ discard when not found, score ¼ [2,
3, 10, 4]; Removal of sequences on length: minimum length
19 nucleotide and maximum length 24 nucleotides. Next, export
the trimmed small RNA tags in fasta formats, e.g., “Data1.fa.” Now
the adapter trimmed small RNA-Seq fasta files are ready for down-
stream analysis using miR-PREFeR pipeline (see Note 4).
3.1.2 miR-PREFeR Before using the above tool, install the ViennaRNA package [45],
Analysis SAMtools package [46], and Bowtie [47] on your system with
Python versions as per the guidelines of platform package manage-
ment system. Make all above executable to the PATH environment
variable. Download the latest version of miR-PREFeR pipeline (see
Note 5) from https://github.com/hangelwen/miR-PREFeR/
releases [29] and perform the analysis as summarized in following
steps:
Testing miR-PREfeR Before proceeding with your analysis, first run the “example file”
provided for testing the pipeline (see Note 6). Go to the “example
folder” and decompress the “exampledata.tar.gz file.” Change the
PIPELINE_PATH in the “config.example” file to the path where
the miR-PREFeR package folder (miR-PREFeR-master) is located.
Use the following commands to execute the above:
$ cd example
$ tar xvf exampledata.tar.gz
$ python2.7 miR_PREFeR.py -L -k pipeline config.example
-L option generates log file in the output directory example-
result
-k option makes temporary directories for storing intermediate
files
Confirm and compare the output to the expected results to

ensure proper functioning of the software before proceeding with
your own data.
Running miR-PREFeR on The analysis requires genome sequence in fasta format. Download
your Datasets the plant genome from its respective database or repository. For
instance, download genome of tomato (Genome.fa) from https://
solgenomics.net/organism/Solanum_lycopersicum/genome.
Ensure that all sequences have different identifiers. The analysis
takes SAM alignment files of small RNA-seq data with the genome;
therefore, the required files can be generated by Bowtie (http://
bowtie-bio.sourceforge.net/index.shtml) for the same. The fol-
lowing are the steps for analysis:
Pre-processing to Convert To increase the performance and accuracy of the analysis by using
Uncollapsed Fasta Files multiple RNA-seq data at a time, it is advised to pre-process the
into Collapsed Fasta Files different RNA-seq fasta files using the python script “process-
reads-fasta.py” present in the script folder. Make a directory with
a custom name of your choice for the analysis, for example “sRNA-
analysis,” as shown below. Copy Genome.fa and small RNA-seq
fasta files into the above directory. Make a text file having the
sample names (sample-names.txt) in the same order as the small
RNA data list, e.g., here we have two data sets from tomato,
“Data1.fa” and “Data2.fa.” Use the following commands to exe-
cute the above:
$ mkdir sRNA-analysis
$ cp Data1.fa /sRNA-analysis
$ cp Data2.fa /sRNA-analysis
$ python2.7 /opt/miR-PREFeR-master/scripts/process-reads-fas-
ta.py sample-name.txt Data1.fa Data2.fa
As a result, processed files with extension “.processed” will be

generated for each small RNA-seq data, e.g., “Data1.fa.processed,”
which now contain sequences with new identifiers containing three
parts (sample name, sequential number “rx” and depth “xN”).
Alignment of RNA-Seq Next, the processed fasta small RNA-seq files are aligned on
Fasta Files with Genome genome using the script “bowtie-align-reads.py,” present in the
Using Bowtie script folder. The command will generate the bowtie index files
for the reference genome sequence and uses 8 threads to align the
processed small RNA-seq files and the resultant output will be SAM
files containing both mapped and unmapped alignments, which are
then filtered using SAMtools (f option). So for each small
RNA-seq data their corresponding “.sam” files will be generated,
e.g., “Data1.fa.processed.sam” and “Data2.fa.processed.sam.” Use

the following commands to execute the above:
$ export PATH=$PATH:/opt/bowtie-1.1.2/
$ python2.7 /opt/miR-PREFeR-master/scripts/bowtie-align-
reads.py –p 2 –k 20 –f –r /sRNA-analysis/Genome.fa Data1.fa.
processed Data2.fa.processed
Preparation of The miR-PREFeR analysis requires a configuration file (config.

Configuration File for the tomato) as an input for the execution of a script “miR-PREFeR.
Pipeline py”. This file lists all the information which is needed to run the
pipeline, therefore, users are required to modify the following
parameters as given below:
PIPELINE_PATH = /opt/miR-PREFeR/FASTA_FILE = ./Genome.fa

ALIGNMENT _FILE= ./Data1.fa.processed.sam, ./Data2.fa.pro-
cessed.sam
PRECURSOR_LEN = 300
READS_DEPTH_CUTOFF = 20
NUM_OF_CORE = 4
OUTFOLDER = miRNA-result
TMPFOLDER = /tmp/ miRNA
NAME_PREFIX = miRNA
MAX_GAP = 100
MIN_MATURE_LEN = 18
MAX_MATURE_LEN = 24
ALLOW_NO_STAR_EXPRESSION = Y
ALLOW_3NT_OVERHANG = N
CHECKPOINT_SIZE = 3000
Running the Pipeline Now one can run the pipeline using the following command:
$ python2.7 /opt/miR-PREFeR-master/miR_PREFeR.py –L –k pipe-

line config.tomato
‘-L’ option generates a log file and –k option keeps the tempo-
rary files that contain intermediate files. The above script performs
sequential analysis including check (checks the presence of RNAL-
fold and samtools and recovery information); pipeline (runs the
whole pipeline, i.e., prepare files, identify candidate regions, fold
candidate precursor regions followed by the prediction of miRNA
loci) and recover (tries to complete unfinished jobs). As a result,
several output files are generated giving details about miRNAs, its
precursors, read mapping, etc. (see Note 7).
3.2 Homology-Based 1. Curate a reference set of non-redundant miR169 sequences by

In Silico Identification collecting previously known miR169 sequences of diverse plant
of miRNA169 Family species from miRNA registry database, i.e., miRBase release
Members in Plant 22.1 (http://www.mirbase.org; [54]) and known literature.
Genomes (tomato 2. Perform a homology search to identify miR169 family mem-
MIR169 as a Case bers by using the curated reference set of miR169 members
Study) against the tomato genome (Tomato genome chromosome
build SL4.0) at sol genomics network (SGN) database by
blastn for short query sequences, with increased e-value param-
eter (set E ¼ 10).
3. In the blastn output, consider the hits with 75% identity for
further analysis.
4. From the selected hits, extract 80–250 nucleotide sequence
upstream of the beginning of the mature miRNA to 80–250
nucleotides downstream of the miRNA region [55].
5. Predict the fold-back secondary structures of pre-MIRNAs by
submitting the extracted nucleotide sequences to online tools
RNA fold and M-fold [37].
6. Analyze the predicted pre-MIR169 secondary structures as per
the MIR stem-loop structure criteria defined by Lu and Yang
[56]. Consider the following criteria:
(a) The predicted mature miRNAs should have no more than
3 nucleotide substitutions when compared to the known
miR169s.
(b) There should be no more than 6 mismatches between the
predicted mature miRNA sequence and its miRNA*
sequence.
(c) The mature miRNA should be in the stem region of the
hairpin structure.
(d) There should be no loop or break (not more than
3 unpaired nucleotides) in the miRNA* sequences.
(e) The predicted pre-miRNA secondary structure should
have high Minimum Folding Energy Index (MFEI
>0.85) and negative Minimum Folding Energy (MFE).
3.3 Validation of The existence of the putative MIR169 loci can be validated by using
Predicted MIR169 publicly available sRNA data. Verify the presence of identified
Genes in Tomato miR169 sequence by querying the sequences at Tomato Functional
Genomics Database (TFGD; http://ted.bti.cornell.edu/cgi-bin/
3.3.1 Validating the TFGD/sRNA/sRNA.cgi; [49]), miRNEST (http://rhesus.amu.
Putative MIR169 Loci by edu.pl/mirnest/copy/home.php; [50]), and Plant Non-coding
Small RNA Data Support RNA Database (PNRD; http://bioinformatics.cau.edu.cn/
PMRD/; [51]).
3.3.2 Validation of 1. To validate the predicted MIR169 precursors, design

Precursor by Cloning and precursor-specific primers manually with 45–55% GC content
Sequencing and check for specificity by using BLAST tool available at SGN
database against cDNA sequences.
2. PCR amplify miRNA precursors using cDNA prepared from
total RNA (see Note 8).
3. Ligate the amplicons into TA vector.
4. Select putative clones by colony PCR.
5. Sequence the cloned precursors for confirmation.
3.3.3 qRT-PCR Based 1. Synthesize cDNA from 2 μg of DNase I treated total RNA by
Validation of miRNAs using Reverse Transcription Kit (see Note 9).
Precursors 2. Prepare the reaction mixture by mixing cDNA (1 μl); 10 mM
forward primer (1 μl); reverse primer (1 μl) (see Note 10);
2 SYBR GREEN master mix (5 μl); sterile MQ water to
make the volume to 10 μl.
3. For each well, prepare a total reaction volume of 10 μl and
analyze the expression of each precursor with biological and
technical replicates. Normalize the expression data by using
Actin as the endogenous control (see Note 11).
4. Aliquot the reaction mixture in the optical 96-well fast plates,
seal the plates with optical adhesive covers, and centrifuge the
plate at 100 g for 1 min in the plate centrifuge to briefly spin
down the content.
5. Run the plate on real-time PCR system following the
chemistry-based comparative CT parameters.
6. Analyze the data by following the ΔΔCT calculations using
different technical and biological replicates to determine the
relative fold change values.
3.4 Expression 1. To enrich small RNA, add equal volume of 4 M lithium chlo-
Analysis of miRNAs ride to 100 μg total RNA in a DEPC-treated microcentrifuge
tubes and incubate at 20 C for about 2 h (see Note 12).
3.4.1 Enrichment of
Small RNAs by Lithium 2. Centrifuge the microcentrifuge tubes at 12,500 g for 20 min
Chloride Precipitation at 4 C, discard the pellet (containing the heavy molecular
weight RNA and genomic DNA), and transfer the supernatant
(containing small RNA) to a fresh DEPC-treated microcentri-
fuge tubes.
3. To this supernatant add equal volume of isopropanol, mix the
samples properly, and incubate at 70 C for 2 h. Centrifuge
the samples at 9000 g for 40 min at 4 C, discard the
supernatant, and wash the pellet with 75% ethanol.
4. Dry the pellet and dissolve in appropriate volume of 0.1%
DEPC-treated MQ water and check the quantity and quality
of small RNA using bioanalyzer followed by gel electrophoresis

quantification.
3.4.2 Poly A-Tailing of 1. Polyadenylate the small RNA by using the Poly(A) Polymerase
the Small RNA Tailing Kit (see Note 13).
2. Take 2 μg of the polyadenylated small RNA in an RNase-free
tube and set the reaction on ice as follows: RNase-Free Water
2.5 μl; Poly(A) Polymerase 10 Reaction Buffer 2 μl; 10 mM
ATP 2 μl; RNase inhibitor (40 units/μl) 0.5 μl; RNA substrate
2 μl (2 μg); Poly(A) Polymerase (4 Units) 1 μl to make a final
reaction volume of 10 μl.
3. Incubate the reaction at 37 C for 15–20 min. Terminate the
reaction by immediately storing at 20 C.
3.4.3 Preparation of 1. For expression analysis of miRNA, synthesize cDNA from

cDNA from Small RNA 500 to 2000 ng of poly-A tailed small RNA by using Reverse
Transcription kit (see Note 14).
2. Thaw the kit components on ice and add the following com-
ponents to RNase-free 0.2 ml PCR tube using the following
reaction: poly-A tailed small RNA 2 μl (2 μg); dNTPs Mix
(10 mM) 1 μl; primer miR_oligodT_RTQ (100 μM) 1 μl;
DEPC-treated water 9 μl to a final volume of 13 μl. The
miR_oligodT_RTQ is a special 100 bp primer having two
variable bases at its 30 end followed by the poly(T)25 and
then a random adapter sequence (see Note 15).
3. Mix the constituents properly by pipetting up and down, incu-
bate the reaction mixture at 65 C for 5 min and snap cool
on ice.
4. Add the following components to the above reaction: 5 First-
Strand Buffer 4 μl; 0.1 M DTT 1 μl; RNase inhibitor (40 units/
μl) 1 μl; SuperScript III RT (200 units/μl) 1 μl to make a final
volume of 7 μl.
5. Mix the tube contents properly by pipetting up and down,
incubate at 50 C for 1 h and stop the reaction by keeping
the tube at 70 C for 15 min.
3.4.4 TaqMan qRT-PCR 1. Validate the expression of miRNAs by using the TaqMan PCR
Based Expression Analysis Master Mix and “Fam (Fluorescein) dye” and BHQ labelled
of miRNAs TaqMan universal probe specific to the adapter region of the
miR_oligodT_RTQ primer (see Notes 15 and 16).
2. Use a common reverse primer (RTQ-universal reverse primer)
and miRNA-specific forward primer for the expression analysis.
3. For each well prepare a total reaction volume of 7 μl and
analyze the expression of each miRNA with at least three
biological and three technical replicates. Normalize the expres-

sion data by using 5S rRNA as the endogenous control.
4. Prepare the reaction mixture using small RNA cDNA (1 μl);
10 mM miRNA-specific forward primer (0.6 μl); 10 mM
RTQ-universal reverse primer (0.6 μl); 2 TaqMan Fast Uni-
versal PCR master mix (3.5 μl); 10 mM Fam and BHQ labelled
TaqMan probe (0.16 μl) and sterile MQ water to make the
volume to 7 μl.
5. Aliquot the reaction mixture in the optical 96-well fast plates,
seal the plates with optical adhesive covers, and centrifuge the
plate at 100 g for 1 min in the plate centrifuge to briefly spin
down the contents.
6. Run the plate on real-time PCR system following the TaqMan
chemistry based comparative CT parameters.
7. Analyze the data by following the ΔΔCT calculations using
different technical and biological replicates to determine the
relative fold change values.
3.5 miRNA Target This approach involves Parallel Analysis of RNA ends (PARE)/
Identification Using degradome analysis which is a modified 50 RLM-RACE followed
degradome Datasets by bioinformatics tools to identify the miRNA-target pairs at global
Following scale using the most reliable tool called CleaveLand (version 4.5)
CleaveLand Tool [32]. The whole analysis consists of the following steps:
1. Download and install the following as per recommended
instructions CleaveLand software version 4.5 (https://github.
com/MikeAxtell/CleaveLand4/blob/master/
CleaveLand4.pl; [32]), GSTAr v1-0 (https://github.com/
MikeAxtell/CleaveLand4/tree/master/GSTAr_v1-0; [52]),
bowtie ( [47], version 0.12.x or 1.x), Vienna RNA package
[45], R and SAMtools [46]. In addition, make sure that the
specified “perl” modules are installed in your system. All the
above dependencies must be executable from your PATH (see
Note 6).
$ export PATH=$PATH:/opt/CleaveLand4/CleaveLand4-master/
bowtie1.1.1/
ViennaRNA-2.1.9/
GSTAr_v1-0/
samtools-1.2/
2. The analysis requires three files, i.e., (a) in house sequenced or

published degradome data downloaded from SRA (NCBI) in
multiline format, adapter trimmed and in fasta format (e.g.,

SRR1272024.fa); (b) multiline fasta sequence file of unique
miRNA sequences with short names devoid of any space; and
(c) transcriptome sequence file in one line fasta format with
short headers (see Note 17). Convert the multiline fasta to one
line fasta.
3. The software offers four different modes of analysis as per
requirement of the user by specifying different input options
given during running the script “CleaveLand4.pl [options] >
[out.txt]” (see Note 18). Mode 1 is the basic mode, which is
described below:
Mode 1: Align a degradome data (SRR1272024.fa) and create
degradome density file (SRR1272024_dd.txt) followed by
small RNA query (miRNA.fa) and transcriptome (tran-
scriptome.fa) analysis using GSTAr and analyze. Required
options: -e (degradome data), -u (miRNA), -n (transcrip-
tome). By default, CleaveLand prints hits that pass the p-
value and category filters to STDOUT in a human-
readable, verbose format that is self-explanatory
(SRR1272024.txt).
$ perl /opt/CleaveLand4/CleaveLand4-master/CleaveLand4.
pl –e SRR1272024.fa –u miRNA.fa –n transcriptome.fa –o
SRR1272024-t-plots.txt > SRR1272024.txt
Where “SRR1272024.txt” is the output file and

“SRR1272024-t-plots.txt” is the output directory con-
taining all the t-plot files (Target-plots). The black line
on the plot shows all of the degradome data, and the red
dot shows the putative slicing site. The title of each T-plot
indicates the transcript (“T¼”), the query (“Q¼”), and
the putative slicing site (“S¼”), as well as the “category”
and the p-value.
4. One can also obtain the result in tabular format using
following:
$ perl ^/opt/CleaveLand4/CleaveLand4-master/CleaveLand4.
pl ^ -e ^ SRR1272024.fa ^ -g ^ miRNA.fa_GSTAr.txt ^ -n ^
transcriptome.fa ^ –t > ^ SRR1272024.txt
Subsequently, output of different degradome datasets from

different tissue and conditions can be analyzed to identify the
complete repertoire of miRNA regulated targets. As a result, the
analysis gives you all required information about miRNA-
target alignment, cleavage site, degradome reads at predicted cleav-

age site, p-value, category, etc. It is recommended to carefully
analyze the results based on p-value, cleavage support from more
than one dataset, alignment score, “category” and read number to
filter out the most reliable miRNA-target pair (see Note 19).
3.6 Validation of The predicted targets either from the online psRNATarget tool
miRNA-Mediated [53] or degradome analysis can be validated and its cleavage site
Cleavage should be mapped using modified RLM-RACE as described by
Zhai et al. ( [57], Fig. 1).
3.6.1 Mapping of miRNA
Targets Cleavage Sites by 1. Using 50–100 μg total RNA purify the Poly-A RNA by using
50 RLM-RACE Poly-A mRNA purification kit (see Note 20).
2. Ligate the 50 RNA oligonucleotide adapter to approximate
1–2 μg of Poly-A RNA by using T4 RNA ligase.
3. Synthesize the first-strand cDNA with oligo(dT) primer using
a first-strand cDNA Synthesis kit (see Notes 14 and 21).
4. Design a target specific primer about 150–200 nucleotide
downstream of the predicted cleavage site (see Note 22).
5. Perform the RACE PCR subsequently with adaptor-specific
forward primer and gene-specific reverse primer for the ampli-
fication of cleavage products of the target mRNAs.
6. Clone the PCR products into the TA vector and sequence the
clones to locate the predicted miRNA cleavage sites (Fig. 1) (see
Note 23).
3.6.2 Transient Assays The transient assays in N. benthamiana leaves provide a convenient
for Validating Target method to rapidly validate the miRNA-mediated cleavage of target
Cleavage transcripts in planta (see Note 24; Fig. 2).
1. Locate the predicted miRNA binding site in target mRNA, i.e.,
Transient Assays for Target
CDS or UTR by analyzing degradome data or at
Cleavage
psRNATarget tool.
2. Design specific primers to amplify the desired CDS or the UTR
region of targets and miRNA precursor (about 150–350 bp)
with appropriate restriction sites as per the effector vector
multi-cloning site.
3. Amplify the target CDS or UTR and miRNA precursor by
using full length cDNA (see Note 25) as template with Phusion
Taq DNA polymerase enzyme.
4. Ligate the amplified target CDS/UTR in pCAMBIA1302 vec-
tor in continuous frame with GFP reporter gene (miRNA
sensor) and overexpression of miRNA precursor in PBI121
vector under CaMV 35S promoter (miRNA effector) by using
T4 DNA ligase (see Note 26).
Fig. 1 Schematic representation of 50 RLM-RACE for mapping miRNA targets cleavage site on target gene
5. Transform the miRNA sensor and miRNA effector constructs

in A. tumefaciens EHA105 strain (see Note 27).
6. Select the miRNA sensor and miRNA effector positive
A. tumefaciens colonies by colony PCR using cloned amplicon
specific primers.
7. Inoculate single positive colony in 30 ml LB broth with appro-
priate antibiotic and incubate at 28 C temperature by shaking
at 200 rpm for 24 h.
8. Harvest the overnight grown A. tumefaciens cells from individ-
ual miRNA sensor and miRNA effector cultures by centrifuga-
tion at 2000 g for 10 min.
9. Suspend the cell pellet by gently swirling the tube and adjust
the cell suspension density to OD600 1 by adding infiltration
buffer.
Fig. 2 Schematic representation of transient assays in Nicotiana benthamiana to confirm in planta miRNA-
mediated target cleavage
10. Incubate the suspension for 3 h at room temperature for the

induction of A. tumefaciens virulence.
11. Infiltrate a set of N. benthamiana leaves (abaxial side of healthy
and expanded leaves) by syringe with empty vector alone, the
miRNA sensor constructs alone, miRNA effector alone, and in
a 1:1 ratio of miRNA sensor miRNA effector constructs in
independent set of at least six plants with four healthy and
expanded leaves.
12. Keep the agro-infiltrated plants in a growth chamber main-
tained at 26 C and light intensity of 300 μM per m2 per sec.
13. Harvest the infiltrated leaves after 2 days and prepare cDNA
from total RNA extracted from these leaves.
14. Quantify the precursor expression level in miRNA effector and

empty vector infiltrated plants by qRT-PCR using actin endog-
enous control.
15. Upregulation of precursor level confirms the overexpression
construct.
16. One can use this functional construct to raise stable transgenic
lines.
17. Quantify the expression of target gene by assessing the reporter
gene, GFP (as GFP is in frame with the target gene) levels by
qRT-PCR in miRNA sensor alone and miRNA sensor plus
miRNA effector infiltrated plants and normalize the expression
data with hygromycin phosphotransferase II (HPT) gene, present
in vector backbone as endogenous control (see Note 28).
18. Visualization and imaging of the infiltrated miRNA sensor and
miRNA sensor:miRNA effector constructs can be done for
qualitative data (see Note 29). Absence of GFP fluorescence
in miRNA sensor:miRNA infiltrated sample confirms the target
cleavage (Fig. 2).
3.7 Functional 1. To construct a STTM structure targeting miR169s in tomato,

Delineation of miRNA- align all the mature miR169 sequence and design the suitable
Target Pair in Planta STTM sequence that optimally chelate all miR169s, as
described below.
3.7.1 Short Tandem
Target Mimic (STTM) to
2. The mature miR169 sequence is 50 - TAGCCAAGGAT
Sponge miRNA: A Case GACTTGCCTG-30 . For its chelation deduce its complemen-
Study of STTM169 in tary sequences, i.e., 50 -CAGGCAAGTCATCCTTGGCTA-30 .
Tomato 3. Introduce a tri-nucleotide bulge (ATC) in the cleavage region
between the 10th and 11th positions of the mature miR169,
making the sequence as
5'- CAGGCAAGTCAATCTCCTTGGCTA-3' (see Note 30).
4. Add a 48 nucleotide spacer between the two complementary
sites to form a complete STTM fragment (Fig. 3).
5. Design two long primers (60 mers) from the above STTM169
fragment by keeping a complementary region of 24 nucleotides
at their 30 ends (highlighted in yellow in the primer sequence
below).
5'-
CAGGCAAGTCAATCTCCTTGGCTAGTTGTTGTTGTTATGGTCTAAT
TTAAATATGGTCTA-3' and 5'-
TAGCCAAGGAGATTGACTTGCCTGATTCTTCTTCTTTAGACCATATT
TAAATTAGACCAT-3'
6. Anneal the fragments by mixing equal molar ratios of two

fragments and incubate at 100 C (5 min); slowly cool down
Fig. 3 Depiction of STTM169 construct to chelate miR169 in tomato. Black font sequences depict the two
miR169 chelating sites (complementary to miR169) having a tri-nucleotide bulge (ATC, in red text). The two
sequences are separated by a 48 nucleotide spacer forming an imperfect weak stem-loop. The nucleotide
bases in purple font show the mature miR169 sequence. The STTM169 construct is cloned under 2 CaMV
35S promoter in a modified pCAMBIA 2300 backbone [9]
to room temperature in a thermocycler by stepping tempera-

ture down 5 C every 30 s (0.1 C per second to reach 25 C).
7. Finally, amplify the annealed duplex by using primers with
appropriate restriction sites and clone in the downstream of
the 2 CaMV 35S promoter in modified pCAMBIA2300 (see
Note 31).
8. Confirm the cloned STTM169 construct (Fig. 3) by sequenc-
ing, and transform it in A. tumefaciens strain EHA105 (see
Note 27).
9. Grow the overnight cultures of STTM169 EHA strains and
harvest the cells by centrifugation at 2000 g for 10 min.
buffer.
12. Infiltrate the tomato leaves with the induced A. tumefaciens
suspension containing STTM169 and empty vector by 1 ml
syringe.
13. Keep the infiltrated plants in a growth chamber maintained at

26 C and light intensity of 300 μM per m2 per sec and
harvested after 2 days for RNA extraction.
14. Quantify the expression of putative miR169 targets by
qRT-PCR in STTM169 and vector control tomato leaves.
15. Upregulation of miR169 targets in STTM169 seedlings con-
firms the chelation of miR169 and hence the validation of its
targets [9].
3.7.2 Resistant Target: 1. A resistant target is a mutated version of the original target that
Target with Mutated miRNA has the capacity to allow the miRNA to bind but escapes
Binding Site miRNA-mediated cleavage because of change in the 10th–
11th miRNA binding position. To construct a resistant target,
choose the specific target of a miRNA from the degradome
library, psRNATarget tool, or literature. Mark the miRNA
binding site in target mRNA. If the cleavage site resides in
the CDS of the target gene, care needs to be taken to mutate
the target in such a way so as to not change the amino acid
sequence.
2. To make the construct, design a set of specific primers to
amplify the full target (F1 and R1) and a pair of forward
(F2) and reverse (R2) primer exactly complementary to each
other, with mutated bases at the cleavage site in the target.
3. Amplify the resistant target using three rounds of PCR. In the
first round of PCR, take full length cDNA as a template and
amplify using Primers F1 and R2. Second PCR is performed
with primer F2 and R1 by again taking cDNA as template.
After this, purify these PCR products. Mix purified PCR prod-
uct in equal concentration and take this as template for final
round of PCR with primer combination F1 and R1.
4. Confirm the final amplicon by sequencing and ligate into
pBI121 vector in frame with GUS reporter gene under
CaMV 35S promoter by using T4 DNA ligase. Transform it
in A. tumefaciens strain EHA105.
5. Amplify the miRNA precursor by using cDNA (see Note 25) as
template with Phusion Taq DNA polymerase enzyme.
6. Ligate the MIRNA precursor in pCAMBIA1302 vector
(miRNA effector) under CaMV 35S promoter by using T4
DNA ligase. Transform construct A. tumefaciens strain
EHA105.
7. Select the resistant target construct and MIRNA effector posi-
tive A. tumefaciens colonies by colony PCR.
8. Grow overnight cultures of individual resistant target construct
and miRNA effector strains and harvest the cells by centrifuga-
tion at 2000 g for 10 min.
buffer.
11. Infiltrate a set of N. benthamiana leaves by syringe with the
resistant target constructs alone or in a 1:1 ratio of resistant
target construct: miRNA effector constructs.
12. Keep the plants in a growth chamber maintained at 26 C and
light intensity of 300 μM per m2 per sec and harvested after
2 days for RNA extraction.
13. Quantify the expression of GUS gene by qRT-PCR in both the
infiltrated sets and normalize the expression data with neomycin
phosphotransferase II (NPT II) gene present in the vector
backbone.
4 Notes
1. Other popular tools exist for adapter removal: Atropos

(a python 3.x script), cutadapt (a python 2.x/3.x script), trim-
momatic (a java tool), or BBDuk (also a java tool).
2. Many miRNA identification and annotation tools are available,
e.g., ShortStack and miRDeep2.
3. User can use already published small RNA-seq datasets or in
house generated data depending on type of study. It is recom-
mended to perform analysis using all datasets together
(if dealing with multiple datasets), for identification of high
confidence miRNAs.
4. Always analyze the adapter removal statistics after trimming is
done. Under ideal conditions the adapter should be present in
over 90% of the small RNA reads.
5. Always use the latest version of miR-PREFeR as it may enhance
your analysis with addition of updates.
6. The reader needs to have the basic working knowledge of
Unix/Linux. It is highly recommended to consult the instruc-
tion manuals of software being used.
7. It is recommended to carefully analyze the result of miR-PRE-
FeR (or any other software one is using) to ensure that the
criteria outlined by Axtell and Meyers [30] are fulfilled.
8. Use a pool of cDNAs from different tissues, development
stages, and stress conditions so as to capture those miRNA
precursors or the targets that may be expressing in specific
spatio-temporal manner.
9. It is important to use high quality RNA as starting material

(RNA Integrity Number, RIN¼>8).
10. Always check the PCR efficiency of primers used for qRT-PCR.
It is recommended that all the primer sets used in your experi-
ment have 90–110% amplification efficiency.
11. It is highly recommended to use at least two endogenous
controls for comparative expression analysis and at least three
biological with three technical replicates for reproducible
results. Amplicon size for internal control must be designed
keeping in mind of length of precursors.
12. Due to the small size and low abundance of miRNAs, we
recommend the use of precipitation-based methods over
column-based methods for small RNA isolation.
13. For better results, we recommend the use of Poly
(A) Polymerase Tailing Kit (epicenter—An Illumina
company, USA).
14. For the efficient synthesis of first-strand cDNA, we recom-
mend SuperScript® III Reverse Transcriptase
(Invitrogen, USA).
15. miR_oligodT_RTQ is a specialized long primer with “VN” at
its 30 end allowing the synthesis of miRNA cDNA and also
allows user to use the same as a common universal reverse
primer during qRT-PCR.
16. The use of TaqMan probe based qRT-PCR assays allows spe-
cific expression of mature miRNAs as compared to SYBR
Green methods.
17. User can use coding sequence (CDS), cDNAs, expressed
sequence tags (ESTs), and long non-coding RNAs as “tran-
scriptome.fa” file for miRNA target identification. Since many
miRNA binding sites are located in the untranslated regions
(UTRs), it is recommended to use full length transcripts as
input file.
18. Different modes of CleaveLand can be used for advanced
studies: Mode 2: Allows using an existing degradome density
file for the analysis of new miRNA list with transcriptome.
Mode 3: Allows using the existing GSTAr alignments for iden-
tifying targets in different degradome datasets. Mode 4: Allows
the use of existing degradome density file and existing GSTAr
alignments to identify targets. The different options available
are -h (Print help message); -t (Output in tabular format
instead of the default verbose format); -r [float >0 to 1]
(Minimum Free Energy Ratio cutoff. Default: 0.65 – for
GSTAr); -o [string]: (Produce T-plots in the directory indi-
cated by the string; if the dir does not exist, it will be created);
-d (string: Path to degradome density file); -e [string](Path to
FASTA-formatted degradome reads); -g [string] (Path to

GSTAr-created tabular formatted query-transcript align-
ments); -u [string] (Path to FASTA-formatted small RNA
queries); -n [string] (Path to FASTA-formatted transcrip-
tome); -p [float >0.1] ( p-value for reporting). Default is
1 (no p-value filtering); -c [integer 0 to 4 Maximum category
for reporting. Default is 4 (all categories reported)].
19. One can opt for minimum 10 cleaved tags and presence of
cleaved tags in more than two degradome libraries with less
than 5 allen score as a criteria for target selection.
20. To get the higher yield of pol(A) RNA, we recommend to use
the cost-effective NucleoTrap mRNA Kit (MACHEREY-
NAGEL, Germany).
21. If the target gene of interest is present in low abundance, then
use gene reverse specific primer to synthesize first strand of
cDNA to enrich the candidate gene transcripts (instead of
cDNA from total RNA).
22. To reduce false positives, use a pair of nested reverse primers
designed downstream of the predicted cleavage site of miRNA.
23. Support from sequence of at least 8–10 clones is preferred to
validate target cleavage site.
24. The transient target cleavage assay in N. benthamiana based
heterologous system offers the advantage to study miRNA:
target pairs that may be tissue-specific, developmental stage
specific, or low abundant. Moreover, agroinfiltration is easy
to do in N. benthamiana leaves. However, if these limitations
are not there in the native system, then this assay can be done in
the plant system one is working with. Researcher can measure
the decrease in the endogenous target transcript levels by
qRT-PCR after agroinfiltrating the specific miRNA precursor
overexpression construct.
25. To amplify the target CDS or miRNA precursors, use full
length cDNA as template. However, if the precursor sequence
is same as genomic DNA sequence, then the template can be
genomic DNA.
26. One can use any two binary vectors but they should have
different reporter genes as well as different antibiotic resistance
genes to be used for transient assay based qRT-PCR analysis.
27. The use of A. tumefaciens strain GV2260 is recommended for
Solanaceae species for better results.
28. One should quantify the transcripts of GFP and normalize it
with proper infiltration control from at least four biological
repeats to consider a candidate as true and valid target.
29. For miRNA sensor constructs, check the functionality of the

construct by imaging GFP fluorescence under confocal/fluo-
rescent microscope.
30. The tri-nucleotide bulge in the STTM sequence can be other
than ATC depending upon the mismatches to the complemen-
tary bases of the target miRNA.
31. A double strength strong constitutive promoter like 2 CaMV
35S is preferred for high levels of STTM transcripts to sponge
up complementary miRNA efficiently.
Acknowledgments
Grants from DBT-NIPGR, New Delhi, India, DST-SERB India

grant (EMR/2016/006229) and University Grants Commission,
Government of India are acknowledged for providing fellowships.
The authors are thankful to DBT-eLibrary Consortium (DeL-
CON) for providing access to e-resources.
References
1. Reinhart BJ, Weinstein EG, Rhoades MW et al Phytophthora resistance. Proc Royal Soc B
(2002) MicroRNAs in plants. Genes Dev 285(1873):20172560
16:1616–1626 9. Rao S, Balyan S, Jha S, Mathur S (2020) Novel
2. Bartel DP (2004) MicroRNAs: genomics, bio- insights into expansion and functional diversi-
genesis, mechanism, and function. Cell fication of MIR169 family in tomato. Planta
116:281–297 251:55
3. Guan Q, Lu X, Zeng H et al (2013) Heat stress 10. Mallory AC, Vaucheret H (2006) Functions of
induction of miR398 triggers a regulatory loop microRNAs and related small RNAs in plants.
that is critical for thermotolerance in Arabidop- Nat Genet 38(6):S31–S36
sis. Plant J 74:840–851 11. Addo-Quaye C, Eshoo TW, Bartel DP, Axtell
4. Sorin C, Declerck M, Christ A et al (2014) A MJ (2008) Endogenous siRNA and miRNA
miR169 isoform regulates specific NF-YA tar- targets identified by sequencing of the Arabi-
gets and root architecture in Arabidopsis. New dopsis degradome. Curr Biol 18(10):758–762
Phytol 202:1197–1211 12. German MA, Pillay M, Jeong DH et al (2008)
5. Hivrale V, Zheng Y, Puli COR et al (2016) Global identification of microRNA–target
Characterization of drought- and heat- RNA pairs by parallel analysis of RNA ends.
responsive microRNAs in switchgrass. Plant Nat Biotechnol 26(8):941–946
Sci 242:214–223 13. Alptekin B, Langridge P, Budak H (2017) Abi-
6. Bai Q, Wang X, Chen X et al (2018) Wheat otic stress miRNomes in the Triticeae. Funct
miRNA TaemiR408 acts as an essential media- Integr Genomics 2:145–170
tor in plant tolerance to Pi deprivation and salt 14. Xu X, Chen X, Chen Y et al (2020) Genome-
stress via modulating stress-associated physio- wide identification of miRNAs and their targets
logical processes. Front Plant Sci 9:499 during early somatic embryogenesis in Dimo-
7. deVries S, de Vries J, Rose LE (2019) The carpus longan Lour. Sci Rep 10(1):1–15
elaboration of miRNA regulation and gene 15. He X, Guo S, Wang Y et al (2020) Systematic
regulatory networks in plant–microbe interac- identification and analysis of heat-stress-
tions. Genes 10(4):310 responsive lncRNAs, circRNAs and miRNAs
8. de Vries S, Kukuk A, von Dahlen JK et al with associated co-expression and ceRNA net-
(2018) Expression profiling across wild and works in cucumber (Cucumis sativus L.).
cultivated tomatoes supports the relevance of Physiol Plant 168(3):736–754
early miR482/2118 suppression for
16. Li S, Cheng Z, Peng M (2020) Genome-wide tool using small RNA-Seq data. Bioinformatics
identification of miRNAs targets involved in 30:2837–2839
cold response in cassava. Plant Omics 13(1):57 30. Axtell MJ, Meyers BC (2018) Revisiting cri-
17. Gadhavi H, Patel M, Mangukia N et al (2020) teria for plant microRNA annotation in the
Transcriptome-wide miRNA identification of era of big data. Plant Cell 30(2):272–284
Bacopamonnieri: a cross-kingdom approach. 31. Hannoufa A, Matthews C, Feyissa BA et al
Plant Signal Behav 15(1):1699265 (2020) Progress toward deep sequencing-
18. Sunkar R, Girke T, Jain PK, Zhu JK (2005) based discovery of stress-related microRNA in
Cloning and characterization of microRNAs plants and available bioinformatics tools. Prog
from rice. Plant Cell 17:1397–1411 Bot 81:41–76
19. Chamnongpol S, Maroney PA, Nilsen TW 32. Addo-Quaye C, Miller W, Axtell MJ (2009)
(2010) A rapid, quantitative assay for direct CleaveLand: a pipeline for using degradome
detection of microRNAs and other small data to find cleaved small RNA targets. Bioin-
RNAs using splinted ligation. Methods Mol formatics 25(1):130–131
Biol 667:3–17 33. Ranjit P, Archana G, Sowjanya G et al (2013)
20. Aukerman MJ (2003) Regulation of flowering Identification of miRNAs in Eucalyptus globu-
time and floral organ identity by a microRNA lus plant by computational methods. Int J
and its APETALA2-like target genes. Plant Cell Pharm Sci Invent 2(5):70–74
15:2730–2741 34. Mehta A, Gupta H, Rawal R et al (2016) In
21. Wang X, Zhang J, Li F et al (2005) MicroRNA silico microRNA identification from Stevia
identification based on sequence and structure rebaudiana transcriptome assembly. European
alignment. Bioinformatics 21(18):3610–3614 J Med Plants 27:1–4
22. Kleftogiannis D, Korfiati A, Theofilatos K et al 35. Hasan M, Ahmed M, Ahmed F et al (2021) In
(2013) Where we stand, where we are moving: silico identification and functional characteriza-
surveying computational techniques for identi- tion of conserved miRNAs in fibre biogenesis
fying miRNA genes and uncovering their reg- crop Corchorus capsularis. Heliyon 7.4:
ulatory role. J Biomed Inform 46:563–573 e06705
23. Budak H, Khan Z, Kantar M (2014) History 36. Hofacker IL (2003) Vienna RNA secondary
and current status of wheat miRNAs using structure server. Nucleic Acids Res 31
next-generation sequencing and their roles in (13):3429–3431
development and stress. Brief Funct Genomics 37. Zuker M (2003) Mfold web server for nucleic
14:189–198 acid folding and hybridization prediction.
24. Budak H, Kantar M (2015) Harnessing NGS Nucleic Acids Res 31(13):3406–3415
and big data optimally: comparison of miRNA 38. Zhang H, Zhang J, Yan J et al (2017) Short
prediction from assembled versus tandem target mimic rice lines uncover func-
non-assembled sequencing data—the case of tions of miRNAs in regulating important agro-
the grass Aegilops tauschii complex genome. nomic traits. Proc Natl Acad Sci U S A
OMICS 19:407–415 114:5277–5282
25. Balyan S, Joseph SV, Jain R et al (2020) Inves- 39. Yan J, Gu Y, Jia X et al (2012) Effective small
tigation into the miRNA/5’isomiRNAs func- RNA destruction by the expression of a short
tion and drought-mediated miRNA processing tandem target mimic in Arabidopsis. Plant Cell
in rice. Funct Integr Genomics 10:1–4 24:415–427
26. Hendrix D, Levine M, Shi W (2010) miR- 40. Damodharan S, Corem S, Gupta SK, Arazi T
TRAP, a computational method for the system- (2018) Tuning of SlARF10A dosage by
atic identification of miRNAs from high sly-miR160a is critical for auxin-mediated
throughput sequencing data. Genome Biol compound leaf and flower development. Plant
11:R39 J 96(4):855–868
27. Hackenberg M, Rodrı́guez-Ezpeleta N, Ara- 41. Mallory AC, Dugas DV, Bartel DP, Bartel B
nsay AM (2011) MiRanalyzer: an update on (2004) MicroRNA regulation of NAC-domain
the detection and analysis of microRNAs in targets is required for proper formation and
high-throughput sequencing experiments. separation of adjacent embryonic, vegetative,
Nucleic Acids Res 39:132–138 and floral organs. Curr Biol 14:1035–1046
28. Axtell MJ (2013) Classification and compari- 42. Sieber P, Wellmer F, Gheyselinck J et al (2007)
son of small RNAs from plants. Annu Rev Plant Redundancy and specialization among plant
Biol 64:137–159 microRNAs: role of the MIR164 family in
29. Lei J, Sun Y (2014) miR-PREFeR: an accurate, developmental robustness. Development
fast and easy-to-use plant miRNA prediction 134:1051–1060
43. Garcia D (2008) A miRacle in plant develop- 50. Szcześniak MW, Makałowska I (2014) miRN-
ment: role of microRNAs in cell differentiation EST 2.0: a database of plant and animal micro-
and patterning. Semin Cell Dev Biol RNAs. Nucleic Acids Res 42(D1):D74–D77.
19:586–595 http://rhesus.amu.edu.pl/mirnest/copy/
44. Devi K, Dey KK, Singh S et al (2019) Identifi- home.php
cation and validation of plant miRNA from 51. Yi X, Zhang Z, Ling Y et al (2015) PNRD: a
NGS data—an experimental approach. Brief plant non-coding RNA database. Nucleic Acids
Funct Genomics 18(1):13–22 Res 43(D1):D982–D989
45. Lorenz R, Bernhart SH, Siederdissen CHZ 52. Brousse C, Liu Q, Beauclair L et al (2014) A
et al (2011) ViennaRNA Package 2.0. Algo- non-canonical plant microRNA target site.
rithms Mol Biol 6(1):26. http://www.tbi. Nucleic Acids Res 42(8):5270–5279
univie.ac.at/~ronny/RNA/index.html 53. Dai X, Zhuang Z, Zhao PX (2018) psRNATar-
46. Li H, Handsaker B, Wysoker A et al (2009) get: a plant small RNA target analysis server
The sequence alignment/map format and (2017 release). Nucleic Acids Res 46(W1):
SAMtools. Bioinformatics 25 W49–W54. http://plantgrn.noble.org/
(16):2078–2079. http://samtools. psRNATarget/
sourceforge.net/ 54. Kozomara A, Birgaoanu M, Griffiths-Jones S
47. Langmead B, Trapnell C, Pop M, Salzberg SL (2019) miRBase: from microRNA sequences
(2009) Ultrafast and memory-efficient align- to function. Nucleic Acids Res 47(D1):
ment of short DNA sequences to the human D155–D162
genome. Genome Biol 10(3):R25. https:// 55. Singh J, Nagaraju J (2008) In silico prediction
sourceforge.net/projects/bowtie-bio/files/ and characterization of microRNAs from red
bowtie flour beetle (Tribolium castaneum). Insect
48. Fernandez-Pozo N, Menda N, Edwards JD Mol Biol 17(4):427–436
et al (2015) The sol genomics network 56. Lu Y, Yang X (2010) Computational identifi-
(SGN)—from genotype to phenotype to cation of novel microRNAs and their targets in
breeding. Nucleic Acids Res 43(D1): Vigna unguiculata. Comp Funct Genomics
D1036–D1041. https://solgenomics.net/ 2010:128297
49. Fei Z, Joung JG, Tang X et al (2010) Tomato 57. Zhai J, Arikit S, Simon SA et al (2014) Rapid
functional genomics database: a comprehensive construction of parallel analysis of RNA end
resource and analysis package for tomato func- (PARE) libraries for Illumina sequencing.
tional genomics. Nucleic Acids Res 39 Methods 67(1):84–90
(suppl_1):D1156–D1163. http://ted.bti.cor
nell.edu/cgi-bin/TFGD/sRNA/sRNA.cgi
Chapter 18
Development of a Ligation-Independent Cloning-Based Dual

Vector System for RNA Interference in Plants
Jinping Zhao, Carlos Garcia Rios, Jingjing Xu, Ijaz Ahmad,
and Junqi Song
Abstract
RNA interference (RNAi) is an evolutionarily conserved post-transcriptional gene silencing mechanism that
responds to double-stranded RNA (dsRNA) by sequence-specific downregulation of target genes. The
dsRNA-mediated RNAi technology has become one of the most widely used and powerful tools for
functional genomic studies in diverse organisms. However, its application has been limited due to the
technical difficulty of making RNAi constructs caused by the inverted repeat structure that is required for
the formation of hairpin RNA. Here, we present a ligation-independent cloning-based dual vector-
mediated RNAi system for silencing specific genes in plants. This approach is simple, efficient, and cost-
effective and can be readily adapted to other binary vectors for functional analysis of target genes and the
development of sustainable disease and pest control strategies in a broad range of plant species.
Key words RNA Interference (RNAi), Post-Transcriptional Gene Silencing (PTGS), Intron-Contain-
ing Hairpin RNA (ihpRNA), Ligation-Independent Cloning (LIC), Dual Vector System
1 Introduction
RNA interference (RNAi) is an evolutionarily conserved antiviral

defense mechanism and has been utilized as a gene silencing tech-
nology to manipulate the expression of target genes by specific
degradation of the mRNA or inhibition of its translation
[1, 2]. The multi-step RNAi system generally includes the forma-
tion or introduction of double-stranded RNA (dsRNA), generation
of 21–26 nt small interfering RNA (siRNA) via cleavage of the
template dsRNA, incorporation of siRNA into the RNA-induced
silencing complex (RISC), and degradation of the target mRNA or
suppression of its expression via base-pairing [3, 4].
RNAi-based technology offers unique advantages in both fun-
damental and practical research, in particular creating heritable and
stable knockdown lines. Recently, RNAi-based host-induced gene
283
284 Jinping Zhao et al.
silencing of essential genes required by pathogens for survival,

virulence, and toxin production is emerging as an environmentally
friendly approach for disease and insect control [5–8]. The RNAi
strategies in plants are classified into five types: hairpin RNA
(hpRNA), artificial miRNA (amiRNA), artificial trans-acting small
interfering RNA (tasiRNA), phased secondary small interfering
RNAs (phasiRNA), promoter-targeting RNA-directed DNA meth-
ylation (RdDM), and virus-induced gene silencing (VIGS)
[9, 10]. As a stable RNA silencing strategy, the self-complementary
hpRNA has been demonstrated to be effective in inducing RNAi of
target genes [11, 12]. Typically, an intron-containing hpRNA
RNAi (ihpRNA) construct is designed to express a self-
complementary inverted repeat sequence of the target mRNA
separated by a spacer region, which lies between the promoter
and terminator (Fig. 1). The sense and complementary antisense
sequences form the arm of dsRNA with an intron-containing spacer
that has been shown to improve RNAi efficiency by facilitating
stable replication of the ihpRNA vector during cloning [13] and
producing intron-spliced RNA in plants [14].
The inverted repeat structure of ihpRNA construct that forms
hpRNA makes it challenging to construct using conventional
restriction cloning [15]. A series of cloning strategies have been
developed to construct the ihpRNA vectors, such as gateway clon-
ing [13, 15–17], golden gate cloning [18], ligation-independent
cloning (LIC) [19], and Gibson assembly [20]. However, these
approaches are costly, complicated in hairpin design, limited in
adaptability, or require multiple steps.
We here present a LIC-based dual vector strategy to assemble
the self-complementary RNAi construct for targeted stable knock-
down of specific genes in plants. The RNAi approach employs a
dual vector system that simplifies the cloning process with nearly no
background and high assembly efficiency and can be readily
adapted to commonly used binary vectors.
The dual LIC-dependent RNAi system is designed to consist of
two vectors. The binary backbone vector pXJJ8 harbors a dupli-
cated cauliflower mosaic virus (CaMV) 35S promoter, a LIC cas-
sette, which contains the ccdB gene flanked by the LIC1 and LIC2
linkers, and a nopaline synthase (NOS) terminator (Fig. 1). The
LIC cassette was cloned from pTRV2e [21] and ligated into the
SacI and XbaI sites between duplicated 35S promoter and NOS
terminator of the binary vector pYL41 [22]. The pXJJ8 binary
vector harbors the NPTII gene, driven by the NOS promoter, as
a plant selection marker [23]. The pXJJ5 vector contains an intron
of the pyruvate orthophosphate dikinase (PDK) gene from Flaveria
trinervia [14], chloramphenicol resistance gene, classical plant
splice signals, and LIC3 and LIC4 linkers flanking the upstream
and downstream regions of the target gene fragment. The PDK
Development of a Ligation-Independent Cloning-Based Dual Vector System for. . . 285
Fig. 1 Schematic diagram for the design of the dual LIC vector RNAi system. LB T-DNA left border, RB T-DNA
right border, 2 35S duplicate cauliflower mosaic virus 35S promoter, LIC Cassette (ccdB) LIC cassette with
the ccdB gene from E. coli, NOST nopaline synthase terminator, NOS:NPTII nopaline synthase promoter and
neomycin phosphotransferase II gene, which confers kanamycin and geneticin (G418) resistance in plants,
KanR neomycin phosphotransferase III gene, which confers kanamycin resistance, PDK Intron (CmR) PDK
intron with the chloramphenicol resistance gene from E. coli, AmpR ampicillin resistance gene from E. coli
intron was cloned from pRNAi-LIC [19] and ligated into the
pGEM-T Easy vector.
The ihpRNAi construct is made by assembling the sense and
antisense fragments of the target gene produced by PCR together
with the PDK intron generated by restriction digestion of an
intron-containing plasmid. The RNA transcript expressed from
the duplicated 35S promoter is self-complementary and, therefore,
forms a hairpin dsRNA after the intron is spliced out (Fig. 2). After
LIC reaction, the resulting construct harboring dsRNA and the
PDK intron is generated and contains both kanamycin and chlor-
amphenicol resistance markers, which help nearly completely elimi-
nate background colony formation.
The LIC-based dual vector RNAi system represents a simple,
efficient, and cost-effective approach for gene knockdown in plants.
LIC reaction requires an excessive amount of LIC fragments rela-
tive to the linearized backbone vector to achieve optimum effi-
ciency. We designed to use a separate vector to provide the PDK
intron, which ensures that the amount of PDK intron DNA is
sufficiently provided for successful LIC cloning. Since the backbone
vector pXJJ8 was constructed from a classical binary vector
[19, 22], the LIC cassette can be readily introduced into any
other binary vectors, such as pCambia, pBI121, pBinplus, and
pGreenII, together with the intron vector pXJJ5, to generate new
dual RNAi vector systems for gene silencing in a wide range of plant
species.
Fig. 2 Schematic diagram for the assembly of RNAi constructs. The PCR products are treated with T4 DNA
polymerase and dATP to generate 50 sticky ends of LIC1 and LIC4 linkers for the antisense fragment, LIC3 and
LIC2 linkers for the sense fragment. The binary vector pXJJ8 is digested with SmaI to release the LIC cassette
with ccdB from the vector, followed by treatment with T4 DNA polymerase and dTTP to generate 50 sticky ends
of the LIC1 and LIC2 linkers. The intron vector pXJJ5 is digested with SmaI to release the PDK intron with CmR,
followed by treatment with T4 DNA polymerase and dTTP to generate 50 sticky ends of the LIC4 and LIC3
linkers. In LIC cloning reaction, all T4 DNA polymerase-treated DNA products, including the sense and
antisense PCR products, SmaI-linearized binary vector, and PDK intron produced from the intron vector, are
mixed together and incubated for annealing. The LIC product is transformed into E. coli where the annealed
products are repaired and ligated. Only the clones harboring the resulting RNAi construct can grow in medium
with kanamycin and chloramphenicol
2 Materials
2.1 Gene Cloning 1. DNA extraction reagent: CTAB buffer (100 mM Tris–HCl,
and Plasmid 20 mM EDTA, 1.4 M NaCl, 2% CTAB, and 1% PVPP, pH 8.0).
Construction 2. RNAse A (10 mg/mL stock).
3. RNA extraction reagent: RNAzol RT (MilliporeSigma,
MA, USA).
4. Reverse transcription reagent: M-MuLV Reverse Transcriptase
(New England BioLabs, MA, USA).
5. dNTP (Omega Bio-Tek, GA, USA).
6. RNase inhibitor, Murine (New England BioLabs, MA, USA).
7. PCR reagents: KAPA HiFi DNA Polymerase with dNTP (Kapa
Biosystems, MA, USA).
8. SmaI (New England BioLabs, MA, USA).

9. T4 polymerase (New England BioLabs, MA, USA).
10. NEBuffer 2.1 (New England BioLabs, MA, USA).
11. dATP (Omega Bio-Tek, GA, USA).
12. dTTP (Omega Bio-Tek, GA, USA).
13. DTT (1 M stock).
14. Polyethylene glycol 8000, PEG 8000 (VWR, PA, USA).
15. MgCl2 (2 M stock).
16. Ethanol (70%).
17. Phenol: chloroform: isoamyl alcohol (25:24:1) (VWR,
PA, USA).
18. Chloroform: isoamyl alcohol (24:1) (VWR, PA, USA).
19. Escherichia coli strain: DH5α for the transformation of destina-
tion constructs and maintenance of the intron vector pXJJ5;
DB3.1 for maintenance of the binary vector pXJJ8 that con-
tains the ccdB gene (see Note 1).
20. Binary vector: pXJJ8 (see Note 1).
21. Intron vector: pXJJ5 (see Note 2).
22. LB liquid medium and LB plates containing antibiotics.
23. Ampicillin (100 mg/mL stock), chloramphenicol (50 mg/mL
stock), kanamycin (50 mg/mL stock), and rifamycin (50 mg/
mL stock).
24. Centrifuge, water bath, and fume hood.
25. PCR machine and incubator.
26. Vortex mixer and shaker.
2.2 PCR 1. Taq DNA polymerase (MCLAB, CA, USA).

Confirmation of RNAi 2. dNTP (Omega Bio-Tek, GA, USA).
Constructs
3. Reverse CmR primer for antisense fragment: 50 - gctggcgatt-
caggttcatcatg -30 .
4. Forward CmR primer for sense fragment: 50 - tggttataggtacatt-
gagcaac -30 .
5. PCR plates and toothpicks.
2.3 DNA Sequencing 1. Reverse sequencing primer for antisense fragment: 50 -

of RNAi Constructs gttggaacctcttaccggcc -30 .
and Agrobacterium 2. Forward sequencing primer for sense fragment: 50 - tgtaacaaaa-
Transformation cataatctaatgct -30 .
3. Agrobacterium tumefaciens strains: LBA4404, GV3101,
GV2260, or EHA105.
3 Methods
3.1 Construction 1. Acquire the target gene sequence from the NCBI GenBank or
of RNAi Vector specific genomics resources through the BLAST algorithm.
2. Select the fragment for gene silencing using the VIGS tool
provided by the Sol Genomics Network (http://vigs.
solgenomics.net/). Choose the fragment length of
300–500 bp (see Note 3).
3. Design primers for amplifying the selected fragment with Pri-
me3Plus (https://primer3plus.com/cgi-bin/dev/
primer3plus.cgi) using the generic module.
4. Clone the fragment of the target gene. Genomic DNA or
cDNA reverse transcribed from total RNA can be used as a
template (see Note 4).
5. Extract genomic DNA using CTAB or RNA using the RNAzol
RT reagent from plants. Synthesize cDNA with M-MuLV
reverse transcriptase using 0.1–1.0 μg of RNA as a template.
6. PCR amplify the gene fragment with KAPA HiFi DNA poly-
merase and clone it into a cloning vector. Confirm the fragment
by DNA sequencing.
7. Design two pairs of LIC cloning primers. For the first pair, add
the LIC1 and LIC4 linker sequences to the reverse and forward
primers, respectively; for the second pair, add the LIC2 and
LIC3 linker sequences to the reverse and forward primers,
respectively (see Notes 5 and 6).
8. Amplify the sense fragment with LIC1/LIC4 primers and
antisense fragment with LIC2/LIC3 primers using KAPA
HiFi DNA polymerase in a total volume of 100 μL.
9. Purify PCR products by PEG precipitation (see Note 7). Add
100 μL of ddH2O, 100 μL of 30% PEG8000/30 mM MgCl2
to each PCR product, and mix thoroughly. Centrifuge at
18,000 g for 20 min and remove the supernatant
immediately.
10. Add 1 mL of 70% ethanol and vortex vigorously. Centrifuge
immediately at 18,000 g for 20 min. Remove the superna-
tant and dry the pellet in an incubator or fume hood. Dissolve
the pellet with 50 μL of ddH2O.
11. Treat purified PCR products with T4 DNA polymerase. Mix
each PCR product (100 ng to 200 ng) with 0.5 μL of NEB-
uffer 2.1, 0.05 μL of 1 mM DTT, 0.25 μL of 100 mM dATP,
and 0.1 μL of T4 DNA polymerase (3 U/μL), in a total volume
of 5 μL. Incubate at 37 C for 15 min and then at 75 C for
20 min to inactivate T4 DNA polymerase. Keep the products at
4 C for subsequent cloning.
12. Prepare the dual LIC vector plasmids. Digest 2 μg each of the
binary vector pXJJ8 and intron vector pXJJ5 with SmaI (see
Note 8).
13. Purify the digested pXJJ8 and pXJJ5 vectors using phenol/
chloroform extraction followed by ethanol precipitation. Dis-
solve the plasmid DNA with 100 μL of ddH2O.
14. Treat the SmaI-digested dual LIC vector with T4 DNA poly-
merase. In a total volume of 5 μL, add 2.5 μL of digested
plasmid, 0.5 μL of NEBuffer 2.1, 0.05 μL of 1 mM DTT,
0.25 μL of 100 mM dTTP, and 0.1 μL of T4 DNA polymerase
(3 U/μL). Incubate at 37 C for 15 min and inactivate T4
polymerase at 75 C for 20 min.
15. Set up the LIC reaction by mixing 2.5 μL of the T4 DNA
polymerase-treated pXJJ8, 2.5 μL of the T4 DNA polymerase-
treated pXJJ5, 2.5 μL of the antisense PCR product with LIC1
and LIC4 linkers, 2.5 μL of the sense PCR product with LIC2
and LIC3 linkers. Incubate the reaction at 70 C for 5 min,
cool down slowly to 22 C at a ramp of 0.1 C/s to allow
annealing of sticky linkers, and then keep at 22 C for 30 min.
Store the LIC reaction mixture at 4 C (see Note 9).
3.2 PCR 1. Transform 5 μL of the reaction mixture into E. coli strain

Confirmation of RNAi DH5α and plate onto LB plates containing 25 μg/mL kana-
Constructs mycin and 10 μg/mL chloramphenicol. Pick and streak posi-
tive clones onto new LB plates containing 50 μg/mL
kanamycin and 15 μg/mL chloramphenicol.
2. Verify the clones by colony PCR using Taq DNA polymerase.
Set up two PCR reactions for the presence of sense fragment
and antisense fragment together with the PDK intron, respec-
tively. For the sense fragment and PDK intron, use the original
forward primer for fragment cloning and the forward CMR
primer (50 - gctggcgattcaggttcatcatg -30 ); for the antisense frag-
ment and PDK intron, use the original reverse primer for
fragment cloning and the reverse CMR primer (50 - tggttatagg-
tacattgagcaac -30 ). Positive clones that are validated by both
PCR assays are subjected to subsequent plasmid preparation
and DNA sequencing.
3.3 DNA Sequencing 1. Verify the resulting constructs by DNA sequencing. The for-
of RNAi Constructs ward sequencing primer is 50 - gttggaacctcttaccggcc -30 , which
and Agrobacterium is in the PDK intron for sequencing the antisense fragment; the
Transformation reverse sequencing primer is 50 - tgtaacaaaacataatctaatgct 30 ,
which is also in the PDK intron for sequencing the sense
fragment (see Note 10).
2. Transform validated plasmids into Agrobacterium tumefaciens
strain LBA4404 (GV3101, GV2260, or EHA105). Plate the
cells on LB plates containing 50 μg/mL kanamycin and 50 μg/

mL rifampicin. Incubate at 28 C for 2–3 days. Pick positive
clones for subsequent experiments.
4 Notes
1. The LIC cassette of the binary vector pXJJ8 contains the ccdB
gene for efficient selection of recombinant clones and needs to
be maintained and propagated in E. coli strain DB3.1. pXJJ8
harbors a kanamycin resistance gene for plant selection.
2. The pXJJ5 vector contains a chloramphenicol resistance gene
in the PDK intron and an ampicillin resistance gene for bacte-
rial selection. The DH5α bacteria containing pXJJ5 need to be
selected in LB with 100 μg/mL ampicillin and 15 μg/mL
chloramphenicol.
3. The selected fragment for RNAi gene silencing should be at
least 100 bp in length.
4. If the selected fragment is located in a single exon, genomic
DNA can be used as a template; if the fragment contains more
than one exon, cDNA template should be used.
5. For antisense fragment, primer 1: add LIC1 linker to 50 of the
reverse fragment cloning primer, primer 2: add LIC4 linker to
the 50 of the forward fragment cloning primer; for sense frag-
ment, primer 3: add LIC3 linker to 50 of the forward fragment
cloning primer, primer 4: add LIC2 linker to the 50 of the
reverse fragment cloning primer.
6. LIC1 linker: 50 - CgACgACAAgACCgTC -30 ; LIC4 linker: 50 -
AGAGCACACGACCCT -30 ; LIC3 linker: 50 - CCAGCACG
GAACCCT -30 ; and LIC2 linker: 50 - gAggAgAagAgCCgTCG
30 .
7. To purify PCR products of less than 200 bp, adjust the volume
to 500 μL with ddH2O, add 500 μL of phenol: chloroform:
isoamyl alcohol (25:24:1), vortex thoroughly, and centrifuge at
14,000 g for 10 min. Transfer the supernatant to a new
centrifuge tube, add 500 μL of chloroform: isoamyl alcohol
(24:1), vortex thoroughly, and centrifuge at 14,000 g for
10 min. Transfer the supernatant to a new centrifuge tube and
add 2.5 volume of ethanol and 1/10 volume of sodium
acetate. After incubation at 20 C for 1 h, centrifuge at
14,000 g for 10 min, discard the supernatant, rinse the pellet
with 70% ethanol, air dry, and dissolve it in 50 μL of ddH2O.
8. SmaI digestion of the binary vector pXJJ8 produces a 0.8-kb
LIC insert and a 12.8-kb backbone; SmaI digestion of the PDK
intron vector pXJJ5 produces a 2.2-kb PDK intron and a 3.4-
kb linear vector.
9. The LIC reaction mixture can be directly transformed into

E. coli strain DH5α. An extended incubation at 4 C overnight
can significantly increase the LIC cloning efficiency.
10. The antisense fragment sequencing detects the 50 region of
PDK intron and the sense fragment sequencing detects the 30
region of PDK intron.
Acknowledgments
This work was supported by a startup fund from the Texas A&M
AgriLife Research and a Hatch Project from the USDA National
Institute of Food and Agriculture to JS (TEX0-1-9675). We thank
Dr. Yule Liu for providing the pYL41 and pRNAi-LIC vectors.
References
1. Brodersen P, Sakvarelidze-Achard L, Bruun- 10. Guo Q, Liu Q, Smith NA et al (2016) RNA
Rasmussen M et al (2008) Widespread transla- silencing in plants: mechanisms, technologies
tional inhibition by plant miRNAs and siRNAs. and applications in horticultural crops. Curr
Science 320(5880):1185–1190 Genomics 17(6):476–489
2. Waterhouse PM, Helliwell CA (2003) Explor- 11. Stoutjesdijk PA, Singh SP, Liu Q et al (2002)
ing plant genomes by RNA-induced gene hpRNA-mediated targeting of the Arabidopsis
silencing. Nat Rev Genet 4(1):29–38 FAD2 gene gives highly efficient and stable
3. Kim Y-S, Lee Y-H, Kim H-S et al (2008) silencing. Plant Physiol 129(4):1723–1731
Development of patatin knockdown potato 12. Travella S, Klimm TE, Keller B (2006) RNA
tubers using RNA interference (RNAi) tech- interference-based gene silencing as an efficient
nology, for the production of human- tool for functional genomics in Hexaploid
therapeutic glycoproteins. BMC Biotechnol 8 bread wheat. Plant Physiol 142(1):6–20
(1):36 13. Wesley SV, Helliwell CA, Smith NA et al
4. Hamilton A, Voinnet O, Chappell L et al (2001) Construct design for efficient, effective
(2002) Two classes of short interfering RNA and high-throughput gene silencing in plants.
in RNA silencing. EMBO J 21(17):4671–4679 Plant J 27(6):581–590
5. Wuriyanghan H, Falk BW (2013) RNA inter- 14. Smith NA, Singh SP, Wang M-B et al (2000)
ference towards the potato psyllid, Bactericera Total silencing by intron-spliced hairpin RNAs.
cockerelli, is induced in plants infected with Nature 407(6802):319–320
recombinant tobacco mosaic virus (TMV). 15. Helliwell C, Waterhouse P (2003) Constructs
PLoS One 8(6):e66050 and methods for high-throughput gene silenc-
6. Sun K, Wolters A-MA, Vossen JH et al (2016) ing in plants. Methods 30(4):289–295
Silencing of six susceptibility genes results in 16. Wielopolska A, Townley H, Moore I et al
potato late blight resistance. Transgenic Res 25 (2005) A high-throughput inducible RNAi
(5):731–742 vector for plants. Plant Biotechnol J 3
7. Rosa C, Kuo Y-W, Wuriyanghan H et al (2018) (6):583–590
RNA interference mechanisms and applications 17. Miki D, Shimamoto K (2004) Simple RNAi
in plant pathology. Annu Rev Phytopathol 56 vectors for stable and transient suppression of
(1):581–610 gene function in Rice. Plant Cell Physiol 45
8. Zhang J, Khan SA, Heckel DG et al (2017) (4):490–495
Next-generation insect-resistant plants: RNAi- 18. Yan P, Shen W, Gao X et al (2012) High-
mediated crop protection. Trends Biotechnol throughput construction of intron-containing
35(9):871–882 hairpin RNA vectors for RNAi in plants. PLoS
9. Watson JM, Fusaro AF, Wang M et al (2005) One 7(5):e38186
RNA silencing platforms in plants. FEBS Lett 19. Xu G, Sui N, Tang Y et al (2010) One-step,
579(26):5982–5987 zero-background ligation-independent
cloning intron-containing hairpin RNA con- 22. Liu Y, Schiff M, Serino G et al (2002) Role of
structs for RNAi in plants. New Phytol 187 SCF ubiquitin-ligase and the COP9 signalo-
(1):240–250 some in the N gene–mediated resistance
20. Jiang Y, Xie M, Zhu Q et al (2013) One-step response to tobacco mosaic virus. Plant Cell 14
cloning of intron-containing hairpin RNA con- (7):1483–1496
structs for RNA interference via isothermal 23. Barrell PJ, Yongjin S, Cooper PA et al (2002)
in vitro recombination system. Planta 238 Alternative selectable markers for potato trans-
(2):325–330 formation using minimal T-DNA vectors. Plant
21. Sha A, Zhao J, Yin K et al (2014) Virus-based Cell Tissue Organ Cult 70(1):61–68
microRNA silencing in plants. Plant Physiol
164(1):36–47
Chapter 19
Multigene Transformation Through Cre-lox Mediated

Site-Specific Integration in Rice
Bhuvan Pathak, Soumen Nandy, and Vibha Srivastava
Abstract
Plant transformation with multiple genes is a major challenge, rendering multi-trait engineering extremely
difficult in crop plants. One of the hurdles in multigene transformation is the uncontrolled integration
process that leads to low quality transgenic lines that are unsuitable for practical application. Recombinase-
mediated site-specific integration has been tested and validated for developing high quality transgenic lines
expressing one, two, or multiple genes. Of the numerous recombinase systems tested, Cre-lox and
FLP-FRT show high efficiency in plants. Recently, Cre-lox system was successfully used to stack a set of
3 constitutive, 1 heat-induced, and 1 cold-induced gene. A number of transgenic lines were obtained
through a relatively small effort, and the resulting transgenic lines all expressed the genes properly as
determined by their promoter-specificity. Here, a method of Cre-lox mediated stacking of a multigene
construct is described using rice as a model crop.
Key words Site-specific integration, Site-specific recombination, Cre-lox, Genome engineering, Mul-
tigene transformation, Gene stacking
1 Introduction
One of the major bottlenecks of biotechnology is transforming a

plant with multiple genes [1]. Delivery and integration of multiple
gene vectors has long been demonstrated by methods such as
Agrobacterium or gene gun mediated DNA delivery. However,
high rates of gene silencing and/or truncation of the introduced
DNA impede these efforts. In case of gene gun methodology,
multigene stacking could be obtained through co-bombardment
of plasmids that tend to recombine and co-integrate into the plant
genome [2–4]; however, co-expression of the introduced genes, in
this method, occurs at diminishing rates. Agrobacterium-mediated
T-DNA transfer is also an excellent method of multigene transfor-
mation as T-DNA harboring many genes enters into the plant cell
and integrates into the genome [5, 6]. However, integration of
tandem repeats or truncated copies of T-DNA and disruption of
293
294 Bhuvan Pathak et al.
critical genomic regions is frequently observed [7]. In general,

these non-targeted random integration approaches pose major
challenges for multigene transformation, rendering a high number
of the recovered events unsuitable for product development
[8]. Further, since these methods integrate the genes into undeter-
mined chromosomal sites, the transgene position is impossible to
predict.
To address the above limitations, targeted gene integration
approaches have gained attention. These approaches could be
divided into (a) chromosomal DNA double-strand break (DSB)
mediated gene integration and (b) heterologous site-specific
recombination (SSR) mediated integration. The DSB created by
the designed nucleases could capture exogenous DNA during the
repair process. However, since non-homologous end joining out-
paces DNA integration rates, this method is mostly proposed for
generating “landing pads” for SSR-mediated gene integration [9–
11]. In SSR-mediated gene integration, a unique recombination
site is inserted into the genome, which is later targeted to create
site-specific integration. The SSR-mediated gene integration has
mostly been practiced with single genes and shown to be highly
efficient in generating stable transgenic lines in a number of plant
species. Several SSR systems are functional in plants, among which
P1 phage Cre-lox and yeast FLP-FRT are the two most character-
ized systems for the application in plants [12, 13]. Both Cre-lox and
FLP-FRT belong to the Tyrosine family of recombinases that react
with their respective recombination sites, lox or FRT. The recombi-
nation between two sites could generate excision, inversion, or
integration based on the relative orientation of the two sites
[14, 15]. Further, since recombination occurs between two identi-
cal sites producing two identical products, the reaction, in princi-
ple, is freely reversible. In Cre-lox system, the use of mutant lox sites
such as lox75 and lox76 overcomes the reversibility issue by produc-
ing a non-reactive double-mutant site, e.g., lox78 [16]. This strat-
egy was successfully used in efficiently recovering site-specific
integration lines of rice [17–22].
Based on the published literature, Cre-lox site-specific recom-
bination is one of the most attractive systems for recombinase-
mediated genome engineering. Its high efficiency and undetectable
toxicity, in many plant species, are attractive for biotechnology
applications [12]. However, both Cre-lox and FLP-FRT have
been used for the integration of single gene cassettes in tobacco,
Arabidopsis, soybean, or rice [13], and their application in stacking
multiple genes is limited. In a study on soybean, 7 genes were
stacked through 2 rounds of transformation using FLP-FRT sys-
tem; however, integration efficiency declined sharply in the second
round [23]. Further, gene stacking through multiple rounds of
transformation requires development and testing of novel hetero-
specific recombination sites, the differential activities of which
Multigene Transformation Through Cre-lox Mediated Site-Specific. . . 295
could lead to unpredictable efficiencies in subsequent rounds. Gene

stacking through one round of transformation, on the other hand,
will require a larger number of genes to be cloned in a single vector.
This could pose a limitation if a large number of genes are to be
transferred. However, targeting two different genomic sites, in
separate target lines, and then combining the gene stacks through
breeding could serve as a practical solution.
Based on a recent study [20], this chapter describes a method
of gene stacking through the use of Cre-lox recombination in the
rice genome. This method uses lox75 and lox76 to generate site-
specific integration of a multigene cassette. The method was suc-
cessfully used for stacking 3 constitutively expressed and 2 inducible
genes in rice, where all genes were found to be properly regulated
and highly expressed in the site-specific integration lines. The
molecular strategy of Cre-lox mediated site-specific gene integra-
tion has been described earlier [14, 22]. The protocol is based on
the transformation of a rice line harboring a lox76 target site,
embedded in the cre gene (Fig. 1a), by a donor vector containing
genes-of-interest (GOI) flanked by loxP and lox75 (Fig. 1b). The
donor vector presumably undergoes lox75 x lox76 recombination
and integrates into the target site, generating a site-specific integra-
tion (SSI) structure (Fig. 1c). The SSI structure consists of a single
copy of the multigene construct (without vector backbone), which
in turn performs consistently in the recovered lines. Using this
method, a stack of 3 constitutive and 2 inducible genes were
stacked into T5 target site as described by Pathak and Srivastava
[20] and outlined in Fig. 2.
2 Material
2.1 DNA Vectors DNA vectors and target line development are described earlier by
Srivastava [24]. Rice target lines, in Taipei-309 or Nipponbare
background can be obtained from the authors. The donor vector,
pNS64, is described in Pathak and Srivastava [20]. pNS64 was
developed in pAM10 backbone [17], which contains a SpeI cloning
site to introduce the genes. pAM10 can also be obtained from the
authors. Alternatively, the simplified versions of these vectors can be
generated by assembling fragments as described below. Similarly,
and alternative target vector can be developed by adding a lox76 site
between the promoter and the coding sequence of cre gene
(Fig. 1a).
1. A 34 bp loxP sequence (see Note 1).
2. The promoter-less neomycin phosphotransferase II gene con-
sisting of NPT II coding sequence (GenBank: KT184682.1)
and nos transcription termination sequence (NCBI accession
no. NC_003065).
lox76
(a) Target locus Promoter CRE
lox75
loxP
(b) Donor vector SMG GOI-1 GOI-2 GOI-3 GOI-n
loxP
lox78
loxP
(c) Site-specific Integration Promoter CRE

SMG GOI-1 GOI-2 GOI-3 GOI-n
Fig. 1 Molecular strategy of site-specific integration. (a) Structure of the genomic target site harboring lox76
between the promoter and the coding region of the cre gene; (b) donor vector containing genes-of-interest
(GOIs) between loxP and lox75 with a promoter-less selectable marker gene (SMG); (c) the predicted site-
specific integration (SSI) structure. Upon delivery into the target line, the donor vector undergoes intramolec-
ular loxP x lox75 recombination, separating the gene construct from the vector backbone (gray circle with
loxP). Integration of the gene construct circle (not shown) carrying lox75 into the target site generates SSI
locus in which loxP is located at one end and the double-mutant lox, lox78, at the other end. This double-
mutant lox is practically non-reactive, thus preventing the reversal of the SSI. Due to the placement of the
promoter-less SMG downstream of the target site promoter, the resulting SSI clones are selectable on
appropriate selection agent
3. Cloning sites for adding the multigene constructs.

4. A 34 bp lox75 sequence (see Note 2).
2.2 Transformation 1. Bulked mature seeds of the target line.

by Gene Gun 2. Gene gun: PDS1000/He system (Bio-Rad, Inc.).
3. Donor vector DNA (1 μg/μl).
4. Gold particles (1 μm): suspend 60 mg particles in 95% ethanol,
vortex vigorously, centrifuge, remove ethanol, rinse 3 with
sterile water, and add 1 ml of water to the washed particles.
5. Bombardment accessories (Bio-Rad Inc.): macrocarriers, rup-
ture disks (1100 psi), screens.
6. Spermidine: 0.1 M in water stored in 20 C.
7. Calcium chloride (CaCl2·2H2O): 2.5 M in water stored in
20 C.
8. Absolute alcohol (200 proof).
9. Geneticin (Thermo Fisher): 100 mg/ml (store at 4 C).
10. Callus induction medium: 3.98 g Chu (N6) basal salt, 0.1 g of
MS vitamin powder, 2 mg of 2,4-D, 0.5 g casamino acids, 2.5 g
lox76
T5 target site ZmUbi1 CRE
1.0 kb
PCR1
E 3.2 kb E 2.5 kb E 2.0 kb E 2.1 kb E
lox78
Stacked locus ZmUbi1 loxP NPTII 35S:GFP 35S:GUS RD29a:DREB1a HSP:pporRFP CRE
0.5 kb 1 kb
PCR1 PCR3
4 kb
PCR4
Fig. 2 Gene stacking into the rice target site, T5, through Cre-lox recombination. A well-characterized target
site, T5, located in the rice genome was developed through Agrobacterium-mediated transformation of rice
cv. Taipei 309 using pVS52 vector (see Ref. 22). Site-specific integration of the donor vector, pNS64, (see Ref.
20) into the T5 locus generates the stacked locus. ZmUbi1: maize ubi-1 promoter; NPT II: neomycin
phosphotransferase II; 35S: Cauliflower Mosaic Virus 35S promoter; GFP: green fluorescent protein; GUS:
β-Glucuronidase, AtRD29a: Arabidopsis thaliana RD29a promoter; DREB1A: A. thaliana dehydration respon-
sive element 1A; HSP: soybean heat-shock 17.5E gene promoter; pporRFP: sea coral Porites porites red
fluorescent protein. Each gene carries a nopaline synthase (nos 30 ) transcription terminator (not shown). Image
is reproduced from Ref. 20. PCR junction sites and EcoRI (E) sites used for Southern blot analysis are shown
proline, 30 g of sucrose, and 2 g of Gelrite. Adjust pH to 5.8,

bring final volume to 1 L, and autoclave.
11. Bombardment media: Callus induction media with the addi-
tion of 63 g sorbitol per liter.
12. Selection media (N6D-S medium): callus induction media
containing geneticin (100 mg/L). Geneticin should be added
to the cooled media (~55 C) after autoclaving.
13. Regeneration medium: 4.4 g of MS basal salt, 0.1 g of MS
vitamins, 1 g casamino acids, 2 mg of kinetin, 0.1 mg of
α-naphthaleneacetic acid, 30 g of sucrose, 30 g of sorbitol,
3 g Gelrite. Adjust pH to 5.8, bring final volume to 1 L, and
autoclave.
14. Rooting medium: 4.4 g of MS basal salt, 0.1 g of MS vitamin,
30 g of sucrose, and 2 g of Gelrite. Adjust pH to 5.8, add water
to 1 L, and autoclave. Add 100 mg/L geneticin after autoclave.
2.3 Analysis Use your favorite method of isolating genomic DNA and conduct-
of Transgenic Plants ing PCR or Southern blot analysis. The primers for PCR 1, 2, and
3 are given in Note 3. These primers will work with any GOI in
donor vectors as long as nos 30 sequence is used as the transcription
terminator in the rightmost gene in the vector.
3 Methods
3.1 Generation A flowchart of transformation for producing site-specific integra-

of Site-Specific tion lines harboring multiple genes is shown in Fig. 3 and described
Integration Lines below:
3.1.1 Preparation 1. Dehusk about 100 mature seeds of the “target line,” and
of Target Line Callus surface sterilize with 70% ethanol for 1 min followed by 30%
Clorox® containing 0.1% SDS solution for 30 min with con-
tinuous shaking.
2. Remove Clorox® and rinse seeds in sterile water five times. Dry
them on autoclaved paper towels.
3. Using sterile forceps place seeds on callus induction media in
Petri plates.
4. Seal the plates and incubate them at 28 C.
5. After 2–3 weeks, collect the scutellar embryogenic callus
emerging from the seeds for transformation.
6. Select 10 different pieces of embryogenic callus and place them
as a cluster in the middle of the bombardment media on a
60 15 mm Petri plates.
3.1.2 Preparation of Gold 1. In a 1.5 ml microcentrifuge tube, add 50 μl suspension of gold

Particles particles (60 mg/ml). Then add 10 μg of donor vector DNA.
Mix by tapping the tube.
2. Lay the tube on its side and place a 50 μl drop of 2.5 M
CaCl2·2H2O solution on the wall of the tube, followed by a
20 μl drop of 0.1 M spermidine. The two drops should remain
separate.
3. Carefully close the cap of the tube, quickly lift it, and hold it on
vortex for vigorous mixing for 3 min.
4. Centrifuge at full speed, remove all liquid, rinse with 1 ml of
absolute ethanol.
5. Remove ethanol and add 100 μl of absolute ethanol.
3.1.3 Bombardment 1. Rub the tube (containing DNA-coated gold particles) on an

of Callus Plates empty box of pipette tip several times to break the gold particle
pellet and develop an even suspension.
2. Quickly pipette 5 to 10 μl of gold particles on macrocarriers.
3. Let air-dry, and bombard on callus plates using 1100 psi rup-
ture disks.
4. Leave bombarded callus on the bombardment media overnight
at 28 C.
5. Transfer clusters of callus to callus induction media next day
and incubate plates in dark for 7 days at 28 C.
Donor vector
DNA
T5 callus Recovery Selection Regeneration Rooting

Bombarded callus
Bombardment Recovery Geneticin-selection Regeneration media SSI lines
Embryogenic calli Transformed clones
Fig. 3 A flowchart of rice transformation for the generation and of site-specific integration lines harboring
stacked genes
3.1.4 Tissue Culture 1. After 1 week of incubation, transfer callus to selection media
(N6D containing 100 mg/L geneticin) for ~3 weeks.
2. Pick geneticin-resistant clones and transfer to a fresh selection
plate (see Note 4).
3. Transfer proliferated, geneticin-resistant callus to the regenera-
tion media with 100 mg/L geneticin and incubate in dark at
28 C for 2–3 weeks.
4. Transfer regenerated shoots to the rooting media.
5. Transfer well-rooted plants to the potted soil and grow in the
greenhouse.
3.2 Molecular 1. Isolate genomic DNA from each regenerated plant.

Characterization 2. Analyze with the standard PCR using primers described in
Note 4. An example of PCR analysis of gene-stack SSI lines
developed by the transformation of T5 line with pNS64 is
shown in Fig. 4. The target site T5 and the predicted SSI
locus carrying 5 genes are shown in Fig. 2. Primer locations
and predicted amplicon sizes are also shown.
3. Check for the presence of target site and SSI junctions by
PCR1, 2, and 3 as shown in Fig. 4a.
4. Select plant lines showing the predicted PCR2 and PCR3
junctions (see Note 5). Absence of the target site in PCR1
could indicate biallelic integration (see Note 6).
5. Design primers across the gene constructs and perform long
PCR to determine the presence of all stacked genes in the locus.
An example of this PCR on stacked locus developed by pNS64
transformation into T5 site (Fig. 2) is given in Fig. 4b.
6. Use Southern blot analysis or real-time PCR to determine GOI
copy number. Identify single-copy and multi-copy lines (see
Note 7). An example of Southern blot analysis on SSI lines
developed by the transformation of T5 line with pNS64 is
shown in Fig. 4b.
7. Use single-copy SSI lines for gene expression analysis.
SSI lines
Single Copy
Multi-Copy
Truncated
(a) SSI lines (b)
T5
Monoallelic
Monoallelic
Truncated
GFP 5
Biallelic
3.2 kb
NTC
3
T5
1
1 kb PCR1
pporRFP 10
PCR2
0.5 kb 3
2.1 kb
1
1 kb GUS 3
PCR3 2.5 kb
2
4 kb Long- PCR 1
DREB1a 5
2
2.0 kb
Fig. 4 Molecular characterization of the gene stack lines developed through site-specific integration of pNS64
into T5 site as shown in Fig. 2. (a) PCR analysis to identify the presence of site-specific integration or target
site (PCR1–3) and the stacked genes (long PCR); (b) Southern blot analysis to identify single-copy, multi-copy
or truncated site-specific integrations using EcoR1-digested genomic DNA of gene stack lines. Probes used in
the blots are indicated by the gene names. Primer positions, EcoR1 sites, and fragment sizes are given in
Fig. 2. T5, target line; NTC, no template control
4 Notes
1. The lox site contains 8 bp spacer sequence (underlined)

between 13 bp inverted repeats: 50 -ATAACTTCGTATA GCA-
TACAT TATACGAAGTTAT -30 . The lox spacer determines
orientation of the DNA molecules during recombination. For
the successful site-specific integration, all lox sites (one in target
vector and two in donor vector) should bear the same 50 –30
spacer sequence. Inverted sequence will lead to failure of the
strategy.
2. Lox75 and lox76 carry left arm and right arm mutations (shown
in small case letters): lox75: 50 -taccggg CGTATA GCATACAT
TATACGAAGTTAT-30 ; lox76: 50 -ATAACTTCGTATA GCA-
TACAT TATACGcccggta-30 .
3. Primers for PCR1: Ubi1 forward: 50 - GCTCACCCTGTTGT
TTGGTG -30 and Cre reverse: 50 - ATTGCTGT
CACTTGGTCGTG -30 ; PCR2: Ubi forward and NPT
reverse: 50 - CTCGATGCGATGTTTCGCTT-30 ; PCR3: nos30
forward: 50 - GATTAGAGTCCCGCAATTAT -30 and CRE
reverse. The primers used in long PCR (Fig. 4b) are GUS
forward: 50 - ACCTCGCATTACCCTTACGC -30 and Cre
reverse.
4. Another selection step can be added to further purify trans-
formed clones by transferring them to a fresh selection medium
for 3 weeks.
5. PCR2 junction of SSI locus is selectable; therefore, most of the
lines contain this junction. However, a small percentage of lines
may lack the correct PCR3 junction.
6. Presence/absence of PCR1 junction in SSI lines depends on
whether the target line was hemizygous or homozygous. If SSI
is derived from hemizygous target, PCR1 will fail. However,
since most SSI lines contain monoallelic integration, PCR1 will
be successful, if the target was homozygous. A small percentage
of SSI could contain biallelic integration, which could also be
indicated by the failure of PCR1.
7. Random integrations of the donor DNA could occur in addi-
tion to site-specific integration. The two types of integrations
generally segregate independently in the progeny. Thus, multi-
copy SSI lines could be advanced and analyzed in next genera-
tion to identify “clean” SSI lines.
Acknowledgments
Research support from USDA-NIFA 2017-38821-26412 and NSF

(RII Track-2 #1826836) are gratefully acknowledged.
References
1. Altpeter F, Springer NM, Bartley LE et al transgenes in rice plants. Nat Biotechnol 16:
(2016) Advancing crop transformation in the 1060–1064. https://doi.org/10.1038/3511
era of genome editing. Plant Cell 28: 3. Schmidt M, LaFayette P, Artelt B, Parrott W
1510–1520. https://doi.org/10.1105/tpc. (2008) A comparison of strategies for transfor-
16.00196 mation with multiple genes via microprojectile-
2. Chen L, Marmey P, Taylor NJ, Brizard JP, mediated bombardment. In Vitro Cell Dev
Espinoza C, D’Cruz P, Huet H, Zhang S, de Biol-Plant 44:162–168. https://doi.org/10.
Kochko A, Beachy RN, Fauquet CM (1998) 1007/s11627-007-9099-5
Expression and inheritance of multiple
4. Zhu C, Naqvi S, Breitenbach J, Sandmann G, 14. Ow DW (2002) Recombinase-directed plant

Christou P, Capell T (2008) Combinatorial transformation for the post-genomic era.
genetic transformation generates a library of Plant Mol Biol 48:183–200. https://doi.org/
metabolic phenotypes for the carotenoid path- 10.1023/A:1013718106742
way in maize. Proc Natl Acad Sci U S A 105: 15. Sauer B (1994) Site- specific recombination:
18232–18237. https://doi.org/10.1073/ developments and applications. Curr Opin
pnas.0809737105 Biotechnol 5:521–527. https://doi.org/10.
5. Collier R, Thomson JG, Thilmony R (2018) A 1016/0958-1669(94)90068-X
versatile and robust agrobacterium-based gene 16. Albert H, Dale EC, Lee E, Ow DW (1995)
stacking system generates high-quality trans- Site-specific integration of DNA into wild-
genic Arabidopsis plants. Plant J 95:573–583. type and mutant lox sites placed in the plant
https://doi.org/10.1111/tpj.13992 genome. Plant J 7:649–659. https://doi.org/
6. Ruiz-Lopez N, Haslam RP, Usher S, Napier 10.1046/j.1365-313X.1995.7040649.x
JA, Sayanova O (2015) An alternative pathway 17. Akbudak MA, More AB, Nandy S, Srivastava V
for the effective production of the omega-3 (2010) Dosage-dependent gene expression
long-chain polyunsaturates EPA and ETA in from direct repeat locus in rice developed by
transgenic oilseeds. Plant Biotechnol J 13: site-specific gene integration. Mol Biotechnol
1264–1275. https://doi.org/10.1111/pbi. 45:15–23. https://doi.org/10.1007/s12033-
12328 009-9235-z
7. Zaidi M, Cheng X, Altosaar I (2007) Charac- 18. Akbudak MA, Srivastava V (2017) Effect of
terization of left-border flanking sequences of gene order in DNA constructs on gene expres-
T-DNA integration in transgenic rice (Oryza sion upon integration into plant genome. Bio-
sativa L.) expressing cry1Ab. Cereal Res Com- tech 7:94. https://doi.org/10.1007/s13205-
mun 35:1375–1383. https://doi.org/10. 017-0729-2
1556/CRC.35.2007.3.2 19. Chawla R, Ariza-Nieto M, Wilson AJ, Moore
8. Anand A, Jones TJ (2018) Advancing SK, Srivastava V (2006) Transgene expression
Agrobacterium-based crop transformation and produced by biolistic-mediated, site-specific
genome modification technology for agricul- gene integration is consistently inherited by
tural biotechnology. Curr Top Microbiol the subsequent generations. Plant Biotechnol
Immunol 418:489–508. https://doi.org/10. J 4:209–218. https://doi.org/10.1111/j.
1007/82_2018_97 1467-7652.2005.00173.x
9. Anand A, Wu E, Li Z, TeRonde S, Arling M, 20. Pathak B, Srivastava V (2020) Recombinase-
Lenderts B, Mutti JS, Gordon-Kamm W, Jones mediated integration of a multigene cassette
TJ, Chilcoat ND (2019) High efficiency in rice leads to stable expression and inheri-
Agrobacterium-mediated site-specific gene tance of the stacked locus. Plant Direct 4:
integration in maize utilizing the FLP-FRT 1–10. https://doi.org/10.1002/pld3.236
recombination system. Plant Biotechnol J 17: 21. Srivastava V, Ariza-Nieto M, Wilson AJ (2004)
1636–1645. https://doi.org/10.1111/pbi. Cre-mediated site-specific gene integration for
13089 consistent transgene expression in rice. Plant
10. Gao H, Mutti J, Young JK, Yang M, Biotechnol J 2:169–179. https://doi.org/10.
Schroder M, Lenderts B, Wang L, 1111/j.1467-7652.2003.00061.x
Peterson D, St Clair G, Jones S, Feigenbutz L 22. Srivastava V, Ow DW (2002) Biolistic
(2020) Complex trait loci in maize enabled by mediated site-specific integration in rice. Mol
CRISPR-Cas9 mediated gene insertion. Front Breed 8:345–349. https://doi.org/10.1023/
Plant Sci 11:535. https://doi.org/10.3389/ A:1015229015022
fpls.2020.00535
23. Li Z, Moon BP, Xing A, Liu ZB, McCardell RP,
11. Yau Y, Stewart CN (2013) Less is more: stra- Howard G, Damude S, Falco SC (2010) Stack-
tegies to remove marker genes from transgenic ing multiple transgenes at a selected genomic
plants. BMC Biotechnol 13:36. https://doi. site via repeated recombinase-mediated DNA
org/10.1186/1472-6750-13-36 cassette exchanges. Plant Physiol 154:
12. Srivastava V, Gidoni D (2010) Site-specific 622–631. https://doi.org/10.1104/pp.110.
gene integration technologies for crop 160093
improvement. In Vitro Cell Dev Biol-Plant 24. Srivastava V (2013) Site-specific gene integra-
46:219–232. https://doi.org/10.1007/ tion in Rice. In: Yang Y (ed) Rice protocols.
s11627-009-9274-y Methods in molecular biology (methods and
13. Srivastava V, Thomson J (2016) Gene stacking protocols), vol 956. Humana Press, Totowa,
by recombinases. Plant Biotechnol J 14: NJ. https://doi.org/10.1007/978-1-62703-
471–482. https://doi.org/10.1111/pbi. 194-3_7
12459
Chapter 20
An Improvised Hairy Root Transformation Method

for Efficient Gene Silencing in Roots and Nodules of Arachis
hypogaea
Bikash Raul and Senjuti Sinharoy
Abstract
Peanut (Arachis hypogaea) is a major oilseed crop and is widely cultivated in tropical and subtropical climate
zone worldwide. Peanut belongs to the Papilionoid family with an atypical nodule developmental program.
In particular, rhizobia enter through developmental cracks and lead to the formation of aeschynomenoid
subtype determinate nodules. Peanut nodules are efficient nitrogen-fixers and form swollen bacteroid
containing symbiosomes. The allotetraploid genome and recalcitrance to stable transformation used to
be the major bottleneck for peanut biologists. Recent genome sequencing of peanut cultivar Tifrunner has
opened up a huge opportunity for molecular research. A composite plant contains transformed roots with a
non-transformed shoot. The composite plant-based approach has already proven to be a tool of choice for
high throughput studies in root biology. The available protocols failed to generate efficient hairy root
transformation in the genome sequenced cultivar Tifrunner. Here we describe an efficient hairy root
transformation and composite plant generation protocol for the peanut cultivar Tifrunner. Our protocol
generated ~92% plant regeneration efficiency with between 21.8% and 58.6% co-transformed root regener-
ation. We also show that this protocol can be efficiently used for protein localization, promoter GUS
analysis, monitoring hormone response, and RNAi mediated knockdown of the genes using genome
sequenced cultivar Tifrunner.
Key words A. rhizogenes, Peanut, Composite plants, Co-transformation, Hairy root transformation,
Root nodule symbiosis
1 Introduction
Peanut also called groundnut (Arachis hypogaea L.) is a key grain

legume and oilseed, widely cultivated in tropical and subtropical
countries with an annual production of 46 million metric tons in
2018 (http://www.fao.org/faostat/en/). Africa and Asia are lead-
ing peanut producers, accounting for ~90% of the world’s produc-
tion. A single hybridization event between two ancestral diploid
species, A. duranensis and A. ipaensis followed by polyploidization
led to the origin of tetraploid peanut varieties. The
303
304 Bikash Raul and Senjuti Sinharoy
chromosome-scale genome sequence of the A. hypogaea cv. Tifrun-

ner and Fuhuasheng (AABB-type genome; 2n ¼ 4x ¼ 40) pub-
lished recently [1, 2]. A. hypogaea belongs to aeschynomene clade,
more basal in the Papilionoid lineage and diversified ~50–55 million
years ago (mya) from model legumes Medicago truncatula and
Lotus japonicus [3]. A. hypogaea attributes a range of atypical nod-
ule developmental characteristics, such as “crack invasion” of rhi-
zobia as opposed to “infection thread” mediated entry, the
formation of completely infected “infection zone” that devoid of
any uninfected cells unlike a mixture of infected and uninfected cells
in the nitrogen fixation zone and terminally differentiated spherical
bacteroids [4–6].
In general, A. hypogaea is considered as recalcitrant to regener-
ation and genetic modifications. Only a few peanut cultivars have
shown promising transformation efficiencies using particle bom-
bardment and Agrobacterium tumefaciens mediated transformation
for the generation of completely stable transgenic lines [7–9]. Par-
ticle bombardment or biolistic method is a physical mode of genetic
transformation and provides an advantage over the Agrobacterium-
mediated transgenesis for which the genotype and Agrobacterium
strain compatibility is essential [10, 11]. Nonetheless, the above-
mentioned protocols usually take 4–5 months to get the hemizy-
gous T0 lines and are labor-intensive, not feasible to be used in
large-scale gene functional studies. When dealing with genes asso-
ciated with root biology; such as root development, nutrient
uptake, hormone distribution, symbiotic and pathogenic interac-
tions, these problems can be bypassed by using Agrobacterium
rhizogenes, the causative agent of hairy root disease, for DNA
delivery. A. rhizogenes transfers its endogenous T-DNA from the
extrachromosomal replicon, called the root-inducing (Ri) plasmid
that leads to the formation of neoplastic, plagiotropic roots. Addi-
tional binary vector containing genetically modified A. rhizogenes
transfer the border intervening genes along with the Ri plasmid
into the plant chromosome. The use of recombinant A. rhizogenes
leads to the generation of a certain percentage of co-transformed
hairy roots [12, 13]. The co-transformed hairy root can be cultured
independently as root culture [14–17] or composite plant can be
generated with non-transformed shoot and transformed root, for
the execution of full plant experiments [18, 19]. In a composite
plant, every transgenic root represents an independent transforma-
tion event and every co-transformed root needs to be phenotyped
independently. Using the hairy root transformation method high
numbers of root transformants can be obtained and can be analyzed
in a relatively short period of time. Although, it is of little use in
genetic transmission, but it allows a rapid and cheaper way for the
functional identification and validation of genes by overexpression,
localization, promoter GUS analysis, knockdown, and CRISPR-
Cas9 mediated gene knockout studies for root biologists [20–29].
An Improvised Hairy Root Transformation Method for Efficient Gene. . . 305
Chromosomal level genome sequence with gene annotation,

genomic and transcriptomic resources are available for the com-
mercial runner type A. hypogaea cv. Tifrunner [1, 30–32]. Till to
date, several A. rhizogenes mediated hairy root transformation pro-
tocols have been published for A. hypogaea [33–35]. Using the
above-mentioned protocols, we obtained considerably low hairy
root transformation frequency in A. hypogaea cv. Tifrunner. To
conduct a large-scale analysis, a robust transformation protocol is
necessary. In this study, we are providing the protocol, which is
improvised from the already available methods, amazingly simple,
efficient, least tedious, and generates transformation efficiency of
~40% (summarized in Table 1). The workflow of the transforma-
tion protocol has been summarized in Fig. 1. Using this protocol,
we have demonstrated localization of fusion protein, promoter-
GUS assay for a nodule specific gene, auxin responsiveness using
DR5: GFP-NLS construct, and gene silencing using a hairpin con-
struct (shown in Fig. 2). Taken together, our protocol and available
genome sequences will pave a path for the root biology-related
studies in peanut.
2 Materials
2.1 Plant 1. Healthy seeds of A. hypogaea cultivar Tifrunner (Accession

and Bacteria number: ICG 9937).
2. To get root nodules, the compatible Bradyrhizobium spp.
SEMIA 6144.
3. Agrobacterium rhizogenes R1000 to generate composite plants
through hairy root transformation, its chemically competent
cells.
2.2 General 1. Commercial Bleach Solution with 4% Sodium hypochlorite

(RIN, Hindustan Unilever Limited, Mumbai, India).
2. Antifungal Powder (Vitavax, Dhanuka Agritech Ltd., New
Delhi, India).
3. Tween 20.
4. Square Petri plates.
5. Filter paper (Whatman, 460 570 mm).
6. Surgical blade and scalpel holder.
7. Soil components: Agropit, Germination sand, Fire clay balls
(Leca), Vermiculite.
8. Soil testing kit (Himedia Laboratories, India) for soil nitrogen
estimation prior to infection with rhizobia.
9. Lab tools and equipment: PCR thermocycler, water bath, incu-
bator shaker, centrifuge, stereo-fluorescent microscope.
Table 1
Comparison of the composite plant generation and co-transformation efficiency generated via
different protocols
Sinharoy Ex-vitro hairy root induction,

Parameters et al. [34] Guimaraes et al. [33] This Study
Co-cultivation media MS Media No media used, hairy root Fahraeus media
induction in wet cotton or
cotton foam
Time (until the seedlings are ready 25–30 days 20 days 13–15 days
to transfer into soil)
Transformation % of composite 31.11 ~91.7b 92.3b
efficiency plants from
explants
% of transformed NAa 9.33 6.55% 40.19 18.36%
roots
Genotype used in the original study A. hypogaea A. hypogaea Runner IAC-866 A. hypogaea
JL-24 Tifrunner
a
As we obtained only 31% of the composite plants using this protocol, the % transformation was not further determined
systematically. But in this case the resulting plants contain only an exceptionally low percentage of transformation
b
Usually we obtain over 90% of composite plants, the percentage depends on the correct choice of the explant
2.3 Media 1. Luria Bertani (LB) broth and agar for Agrobacterium: 10 g
and Antibiotics tryptone, 10 g sodium chloride, and 5 g yeast extract powder in
1 L deionized water. For LB agar plate preparation, 15 g of
bacteriological agar is added per liter of LB liquid medium.
2. Fahraeus medium [36] for co-cultivation of Arachis embryonal
axes and A. rhizogenes R1000:
Calcium chloride (CaCl2·2H2O) 0.9 mM/L, Magnesium
sulfate (MgSO4) 3 mM/L, Potassium dihydrogen phosphate
(KH2PO4) 0.7 mM/L, Disodium hydrogen phosphate
(Na2HPO4) 0.25 mM/L, Ferric citrate (C6H5FeO7) 20 μM/
L. In addition to these macro-nutrients, in micro-nutrients,
from 1 mg/mL stock of Manganese chloride (MnCl2), Copper
sulfate (CuSO4), Zinc chloride (ZnCl2), Sodium molybdate
(Na2MoO4), Boric acid (H3BO3), 70 μL each is added in 1 L
of the medium. The pH is adjusted to 7.4 with 1 M potassium
hydroxide (KOH) and the total volume is adjusted to 1 L with
deionized water. To make agar plates, 7 g/L CleriGar (Hime-
dia Cat No. PCT0905, a mixture of Agar and Clerigel recom-
mended for plant cell culture) is added.
3. Bradyrhizobium specific AGY medium [37]: MES-HEPES
buffer (5.5 g MES and 6.5 g HEPES in 100 mL water, pH
adjusted to 6.75) 20 mL/L, MgSO4·7H2O 180 mg/L, CaCl2
15 mg/L, Ammonium chloride (NH4Cl) 560 mg/L, KH2PO4
220 mg/L, Sodium sulfate (Na2SO4) 250 mg/L, Ferric
Fig. 1 Schematic representation shows the steps of the improvised hairy root induction and composite plant
generation method. Step (1) remove seed coat from A. hypogaea cv. Tifrunner seeds. Step (2) remove one
cotyledon from the seed and the 1/3 part from the lower portion of the embryonal axis that gives rise to the
radicle. Use the rest of the embryonal axis attached to the other half of the cotyledon as explant. Step
(3) surface sterilize the explants and infect them by scraping on the A. rhizogenes plate. Step (4) co-cultivate
the explants with A. rhizogenes on a Fahraeus media plate in the dark as shown in the picture. The plate
picture by the side of the cartoon shows the half embedding of the embryonic axes in Fahraeus media plates.
Step (5) remove the initial roots with the help of a scalpel, which are mostly non-transformed. Step (6) transfer
the seedlings to fresh Fahraeus media plates. Keep the plates in dark for initial 3–4 days, after which expose
the shoot parts to light. Step (7) after 14–15 days, seedlings are ready to go to the soil. Steps (8) transfer the
seedlings to soil and make a humidity chamber to maintain high humidity which ensures optimum hairy root
growth. Maintain the humidity by spraying water daily from the top. Step (9) after 20 days the composite plants
with transgenic hairy roots are ready for the experiment. For nitrogen sensitive experiments wash the soil
thoroughly to remove soil nitrogen. Step (10) screen the roots for positive transformation with the help of a
fluorescent marker under a stereo-zoom microscope
chloride (FeCl3·6H2O) 6.7 mg/L, Sodium molybdate dihy-

drate (Na2MoO4·2H2O) 10 mg/L, Nickel chloride (NiCl2)
1.2 mg/L, Arabinose, Sodium Gluconate, and yeast extract
powder, 1.0 g/L each. pH of this medium is adjusted to
6.7–6.8. For AGY-agar, 15 g bacteriological agar is added per
liter of the broth.
Fig. 2 The application of the composite plants and hairy roots for protein localization, auxin response analysis,
promoter-GUS assays, and knockdown of genes in roots and nodules. (a, b) Hairy roots transformed with
pKGW-RedRoot containing the fluorescent marker DsRed; (a) bright field, (b) transformed root showing red
fluorescence of DsRed. (c–f) Transgenic roots transformed with pCMU-PDESr expressing mCherry labeled
plasmodesmata-located AtPDLP1; (c) mosaic expression pattern of the tagged protein, (d) transverse section
of A. hypogaea cv. Tifrunner root showing red fluorescence of mCherry tagged AtPDLP1, (e) enlarged view of
d, (f) AtPDLP1 localization suggesting multiple plasmodesmata connections at the junction of cortical cells.
4. Broughton and Dilworth (B&D) nutrient solution: It contains

Potassium dihydrogen phosphate (KH2PO4) 250 μM, Potas-
sium sulfate (K2SO4) 500 μM, Magnesium sulfate
(MgSO4·7H2O) 125 μM, 10 μM Ferric citrate, 1 mM Calcium
chloride (CaCl2·2H2O), along with Manganese (II) sulfate
(MnSO4·H2O) 1 μM, Boric acid (H3BO3) 2 μM, Zinc sulfate
(ZnSO4·7H2O) 0.5 μM, Copper sulfate (CuSO4·5H2O)
0.2 μM, Cobaltous sulfate heptahydrate (CoSO4·7H2O)
0.1 μM, Sodium molybdate (Na2MoO4) 0.1 μM. All these
constitute B&D solution without nitrogen. As nitrogen sup-
plements, 2 mM Potassium nitrate (KNO3) and 2 mM Ammo-
nium nitrate (NH4NO3) are added. All the components are
prepared as separate stock solutions and autoclaved or filter
sterilized. Fe-citrate solution is stored at 4 C in dark. 50
B&D stock solution is prepared by adding together all the
components in respective concentrations except CaCl2·2H2O,
KNO3, and NH4NO3. The working 0.5 solution is prepared
by diluting the 50 stock solution and adding CaCl2·2H2O to
it. The pH is maintained at 6.8 with KOH.
5. Antibiotics: Spectinomycin (100 mg/mL) and Streptomycin
(100 mg/mL) stock solution.
2.4 Plasmids 1. Plasmid vectors: pKGW-RedRoot and pK7GWIWG2_II-

and Primers RedRoot containing DsRed as a fluorescent marker, and
pKGWFS7 were obtained from VIB-UGent Center for Plant
Systems Biology.
DR5-GFP-NLS construct, obtained from S. Takuya, Uni-
versity of Tsukuba, Tsukuba, Japan.
pCMU-PDESr construct containing plasmodesmata-
located protein 1 gene (PDLP1) with mCherry at the C termi-
nus under pAtUBQ10 [38].
2. Primers:
DR5 promoter forward TGCCACCTGACGTCTAAGAAAC

DR5 promoter reverse TGATCCTCTAGAAGCTCGTCC
(continued)
ä
Fig. 2 (continued) (g–i) Auxin distribution shown by DR5:GFP-NLS expressing hairy roots; (g) well-established
auxin maxima observed at the root tip, (h) auxin distribution in A. hypogaea lateral root, (i) zoom-in view of a
cross section of root showing GFP fluorescence corresponds to the nucleus. (j–l) Promoter-GUS assay of a
nodule specific gene after infection with Bradyrhizobium spp. SEMIA 6144; (j) 3 days post-inoculation (dpi)
root showing blue staining, (k, l) GUS activity in 21 dpi nodules. (m–r) Knockdown of a nodule specific gene led
to abnormal nodule shape and patterning on transgenic A. hypogaea cv. Tifrunner roots; (m) transgenic roots,
carrying empty vector pK7GWIWG2(II)-RedRoot which has DsRed in its backbone for visual screening,
generated functional pink nodules, (n) red fluorescence indicates positive transformation, (o–r) hairpin
expressing transformed roots showed impaired nodule development. Scale bars represent 1 mm (a and b),
500 μm (c, j–l), 200 μm (o and p), 100 μm (g, m, n, q, and r), 50 μm (d and h), 10 μm (e, f, and i)
mCherry Forward CAAGCTGAAGGTGACCAAGG

mCherry Reverse AGGTGATGTCCAACTTGATG
DsRed Forward GCTTAACGTAATTCAACAG
DsRed Reverse CATGCGCTTCAAGGTGCGC
These primers were used to screen for positive A. rhizogenes

R1000 transformant colonies after transformation of DR5:
GFP-NLS, pCMU-PDESr and pKGW-RedRoot respectively
into R1000 competent cells.
3 Methods
3.1 Preparation 1. Grow a primary culture of 5 mL in LB broth (Strep 100 μg/

of Chemically mL) from A. rhizogenes R1000 single colony, streaked on LB
Competent Agar plate with strep (100 μg/mL) from glycerol stock. Incu-
A. rhizogenes bate overnight at 28 C in an incubator shaker at 200 rpm.
R1000 Cells 2. By using the primary culture as inoculum, start a secondary
culture of the Agrobacterium strain on a large scale
(50–200 mL of LB broth) and grow at 28 C until the
OD600 reaches0.8.
3. Harvest the cells by centrifuging at 3000 g for 10 min at
4 C.
4. Resuspend the cells in 25 mL of 20 mM sterile chilled CaCl2
(If started with 50 mL secondary culture or scale-up accord-
ingly) after discarding the supernatant.
5. Incubate the tubes containing the suspension in ice for half
an hour.
6. Harvest the cells at 3000 g for 10 min at 4 C. Repeat step 5
to remove residual media.
7. Incubate the suspension again in ice for about 1 h.
8. Pellet down the cells by centrifugation at 3000 g for 5 min at
4 C, and discard the supernatant.
9. Resuspend the pellet in 2–3 mL of pre-chilled sterile 20 mM
CaCl2 containing 15% glycerol.
10. Aliquot the suspension in pre-chilled sterile 1.5 mL micro-
centrifuge tubes, 200 μL in each tube. Flash freeze the tubes
in liquid nitrogen and store them at 80 C for future use.
3.2 Transformation 1. Add about 500 ng of the plasmid vector to one vial of compe-
of Binary Plasmids into tent cells thawed on ice.
R1000 Competent Cells
2. Flash freeze the content in liquid nitrogen for 5 min and then
let it thaw at 37 C in a water bath which generally takes
3–5 min.
3. Quickly put the vial in ice and proceed to add 1 mL LB.
4. Incubate the vial in a 28 C incubator shaker at 200 rpm for
about 3 h.
5. After the incubation period, centrifuge contents at 3000 g
for 10 min. Keep 100–200 μL of the supernatant to suspend
the obtained pellet. Discard rest of the supernatant. Now,
spread the suspension on appropriate antibiotic selection con-
taining LB Agar plates.
6. Keep the plates at 28 C for about 48 h and screen for positive
transformants through colony PCR.
3.3 A. rhizogenes The method described below has been used in this study to gener-
Mediated ate A.hypogaea cv Tifrunner hairy roots expressing pKGW-RedRoot
Transformation binary vector. After surface sterilization of the explants, all the
and Hairy Root steps, prior to the transfer of the seedlings to the soil, should be
Induction done in a sterile condition.
1. First of all, prepare a lawn of A. rhizogenes R1000 containing
the desirable construct from its glycerol stock on LB agar plates
with appropriate antibiotics (in our case, Spectinomycin and
Streptomycin, both 100 μg/mL) and containing 10 mM MES
(pH 5.6) and 20 μM acetosyringone (see Note 1).
2. Alternatively, prepare a broth culture of the Agrobacterium in
LB with appropriate antibiotics and the above-mentioned con-
centrations of MES and acetosyringone. The pellet of this
culture can be used to induce hairy roots.
3. As the plant material or explant for transformation, use the
embryonal axis of the A. hypogaea cv Tifrunner seed with a part
of the cotyledon. First, remove the cotyledon which is loosely
attached to the embryonal axis, and cut the other one into the
half with a surgical blade as shown in Fig. 1 (see Note 2).
4. Surface sterilize the embryonal axes with their attached cotyle-
donary parts with 15% commercial bleach and 1% Tween 20 for
15 min. After which wash them thoroughly with sterile deio-
nized water, at least 5–6 times.
5. Place these in a Petri plate, soak the water with a filter paper,
and remove the seed coats with sterile forceps. Proceed for
transformation.
6. Cut the end of the embryonal axes that give rise to the radicle
with a sterile surgical blade as shown in Fig. 1.
7. Scrape the lawn of Agrobacterium or the culture pellet against
the cut surface of the embryonal axis and remove the excess of
the Agrobacterium by pressing gently the cut surface on a

sterile filter paper.
8. Now, embed the infected embryonal axis in the Fahraeus media
plate with a sterile forceps in such a way that half of the
longitudinal portion of the embryonal axis remains above the
media. (Fig. 1) (see Note 3).
9. Seal the plates with surgical tapes, wrap them completely with
aluminum foil to allow the co-cultivation of the explant and
Agrobacterium in dark. Keep the plates in the vertically upright
position so that roots will grow in the direction of gravity, for
about 7 days at 25 C (see Note 4).
10. Roots should start to emerge and grow from the cut surface
infected with A. rhizogenes after 3–4 days. After 7 days, chop
off these roots which are generally non-transformed. Now,
transfer the seedlings to new Petri plates containing Fahraeus
media (see Notes 5 and 6).
11. Cover the bottom half of the plates with aluminum foil and
allow the shoot part of the seedlings to start photosynthesis.
Place the plates in a growth chamber set at 28–26 C day temp
(14 h) and 22 C in dark (10 h), for 7 more days, after which
the seedlings are transferred to soil.
12. To prepare the substrate/soil for seedling transfer, mix agropit,
germination sand, and fire clay balls in 1:1:1 ratio. Break down
the clay balls with a hammer or mallet before adding them into
the mixture. Wash the mix thoroughly with distilled water to
remove ammoniacal and nitrate nitrogen (see Note 7). Then,
check the available nitrogen content in the mix with a soil
testing kit. Repeat the washing steps if necessary. Autoclave
the mixture twice to remove any fungal spores. Let the soil cool
down before use.
13. Transfer the seedling from the plates to soil carefully to avoid
any damage to the seedling especially the root system which at
this stage is very fragile. Before transfer, wash the roots with
sterile water to remove any media attached to them (see Note
8). Water the pots with 0.5 B&D nutrient solution with full
nitrogen supplements, at the time of transfer. Cover each tray
with a humidity chamber or with clear plastic wraps to maintain
high humidity inside the chamber, which is a prerequisite for
hairy root growth.
14. Open the humidity chamber daily for about 20 min and water
the pots by spraying sterile distilled water from the top.
15. After 10–12 days, start the opening of the humidity chamber
slowly, and by 15th–17th days remove the chambers
completely. After 20 days from the seedling transfer, the com-
posite plants are ready for experiments (see Note 9).
3.4 Infection 1. To infect the composite plants with Bradyrhizobia, first streak
of Composite Plants the Bradyrhizobium spp. SEMIA 6144 from glycerol stock on
with Bradyrhizobia AGY-agar plate with chloramphenicol 40 μg/mL and genta-
mycin 14 μg/mL. Incubate the plates at 28 C for 3–4 days.
2. From the plate, prepare a starter culture of 5 mL in AGY media
with the above antibiotics and grow it for 48 h at 28 C.
3. Grow a secondary large culture of the Bradyrhizobia and allow
it to reach OD600 of 0.8–1 which usually takes from 36–48 h.
4. The cells are harvested by centrifuging at 3500 g for 10 min
after the culture reaches the appropriate OD. Suspend the
pellet in half-strength B&D medium without nitrogen and
dilute the suspension to final OD600 of 0.02–0.05 (see Note
10).
5. Use 100 mL of the suspension to infect each plant. The plant
should be watered from the bottom thrice a week with sterile
distilled water during the entire span of the experiment.
3.5 Screening 1. Presence of a fluorescent marker protein in the destination

for Transformed Roots vector backbone eases the process of screening transformed
and Transformation roots from the composite plants under a stereo-fluorescence
Efficiency Calculation microscope. DsRed, the red fluorescent protein is better suited
for this purpose, that is why A. rhizogenes mediated transfor-
mation should always be performed using a fluorescent marker-
based vector preferable having DsRed in their backbone.
2. So to screen the transformed hairy roots, look for the fluores-
cent marker protein in the roots under a stereo-fluorescent
microscope.
3. Calculate the percentage of transformation efficiency from the
number of transformed roots showing the fluorescence and the
total number of roots per composite plant.
4 Notes
1. R1000 is a more vigorous strain than A. rhizogenes ARqua1

which is used to induce hairy roots in model legume
M. truncatula. In our experimental setup, the transformation
efficiency with ARqua1 is found to be considerably lower than
when R1000 is used.
2. Instead of the only embryonic axis, the use of the embryonic
axis with the fragment of cotyledon allows us to grow the
explant in Fahraeus media plates without supplementation of
the sucrose. The absence of sucrose in the plate restricts the
A. rhizogenes growth during the co-cultivation time which is
the major reason why we obtained 92% composite plants over
33% which was described previously.
3. Half embedding of the embryonal axis in Fahraeus media

plates, during co-cultivation with Agrobacterium, increases
aeration of the tissue thereby facilitating efficient root growth.
4. Parafilm should not be used to seal the plates as it will prevent
aeration.
5. Keeping the seedlings more than 7 days in the dark increases
the hypocotyl length.
6. All the roots should be cut off from the seedlings during
transfer to fresh Fahraeus media plates, because the initial
roots, emerged from the cut surface of the embryonal axis,
are mostly tap roots and non-transformed. If not cut, they
reduce the formation of transformed hairy roots, thereby
reducing overall transformation efficiency.
7. It is recommended to wash the soil thoroughly to wash out all
the nitrogen if planning any nitrogen sensitive experiment such
as studies on root nodule symbiotic interactions or nitrogen
deficiency-related studies.
8. During the transfer of seedlings from plates to the soil, any
residual media attached to any part of the seedling should be
removed. Otherwise, they can lead to fungal contamination.
9. For nitrogen sensitive experiments, after 20 days from seedling
transfer to soil, the soil should be made nitrogen-free. It can be
done in two ways, either wash the soil in the pots with excess
distilled water and change the tray or replace the soil all
together with fresh soil containing no nitrogen or in trace
amount.
10. Bradyrhizobium spp. SEMIA 6144 forms a diffused pellet as it
produces a lot of slime during growth.
Acknowledgments
We thank Janila Pasupuleti and Vania C. R. Azevedo, ICRISAT,

India for providing A. hypogaea cultivar Tifrunner seeds, Michael
Udvardi, Nobel Research Institute, Oklahoma, USA for
A. rhizogenes ARqua1 strain, M. DasGupta, Department of Bio-
chemistry, University of Calcutta, for providing A. rhizogenes
R1000 strain, Fernando Ibáñez, Departamento de Ciencias Natur-
ales, Universidad Nacional de Rı́o Cuarto, Argentina, for Bradyr-
hizobium SEMIA 6144, S. Takuya, University of Tsukuba,
Tsukuba, Japan, for providing the DR5-GFP-NLS construct,
NIPGR for their confocal facilities; CIF-NIPGR; NIPGR-DEL-
CON for their support. This work is supported by core research
grant from National Institute of Plant Genome Research, Rama-
lingaswami Re-entry grant, DBT (BT/RLF/Re-entry/41/2013)
and SERB ECR grant (ECR/2018/001215) and Mr. Bikash
Raul’s fellowship is supported by CSIR (File No. 09/803(0141)/
2017-EMR-I).
References
1. Bertioli DJ, Jenkins J, Clevenger J et al (2019) 14. Tschofen M, Knopp D, Hood E et al (2016)
The genome sequence of segmental allotetra- Plant molecular farming: much more than
ploid peanut Arachis hypogaea. Nat Genet 51 medicines. Annu Rev Anal Chem 9
(5):877–884 (1):271–294. https://doi.org/10.1146/
2. Chen X, Lu Q, Liu H et al (2019) Sequencing annurev-anchem-071015-041706
of cultivated peanut, Arachis hypogaea, yields 15. Gutierrez-Valdes N, H€akkinen ST, Lemasson
insights into genome evolution and oil C et al (2020) Hairy root cultures—a versatile
improvement. Mol Plant 12(7):920–934 tool with multiple applications. Front Plant Sci
3. Sprent JI, James EK (2007) Legume evolution: 11:33
where do nodules and mycorrhizas fit in? Plant 16. Mano Y, Nabeshima S, Matsui C et al (1986)
Physiol 144(2):575–581 Production of tropane alkaloids by hairy root
4. Boogerd FC, van Rossum D (1997) Nodula- cultures of Scopolia japonica. Agric Biol Chem
tion of groundnut by Bradyrhizobium: a sim- 50(11):2715–2722
ple infection process by crack entry. FEMS 17. Georgiev MI, Agostini E, Ludwig-Müller J
Microbiol Rev 21(1):5–27 et al (2012) Genetically transformed roots:
5. Sharma V, Bhattacharyya S, Kumar R et al from plant disease to biotechnological
(2020) Molecular basis of root nodule Symbi- resource. Trends Biotechnol 30(10):528–537
osis between Bradyrhizobium and ‘crack- 18. Sinharoy S, DasGupta M (2009) RNA interfer-
Entry’Legume groundnut (Arachis hypogaea ence highlights the role of CCaMK in dissemi-
L.). Plants 9(2):276 nation of endosymbionts in the
6. Ibáñez F, Wall L, Fabra A (2017) Starting Aeschynomeneae legume Arachis. Mol Plant-
points in plant-bacteria nitrogen-fixing sym- Microbe Interact 22(11):1466–1475
bioses: intercellular invasion of the roots. J 19. Qiu W, Wang N, Dai J et al (2019) AhFRDL1-
Exp Bot 68(8):1905–1918 mediated citrate secretion contributes to adap-
7. Krishna G, Singh BK, Kim EK et al (2015) tation to iron deficiency and aluminum stress in
Progress in genetic engineering of peanut peanuts. J Exp Bot 70(10):2873–2886
(Arachis hypogaea L.)—a review. Plant Biotech- 20. Sonti R, Chiurazzi M, Wong D et al (1995)
nol J 13(2):147–162 Arabidopsis mutants deficient in T-DNA inte-
8. Lacorte C, Mansur E, Timmerman B et al gration. Proc Natl Acad Sci U S A 92
(1991) Gene transfer into peanut (Arachis (25):11786–11790
hypogaea L.) by Agrobacterium tumefaciens. 21. Stougaard J, Petersen TE, Marcker KA (1987)
Plant Cell Rep 10(6–7):354–357 Expression of a complete soybean leghemoglo-
9. Gantait S, Mondal S (2018) Transgenic bin gene in root nodules of transgenic Lotus
approaches for genetic improvement in corniculatus. Proc Natl Acad Sci U S A 84
groundnut (Arachis hypogaea L.) against (16):5754–5757
major biotic and abiotic stress factors. J Genet 22. Sinharoy S, Pislariu CI, Udvardi MK (2015) A
Eng Biotechnol 16(2):537–544 high-throughput RNA interference (RNAi)-
10. Ozias-Akins P, Schnall JA, Anderson WF et al based approach using hairy roots for the study
(1993) Regeneration of transgenic peanut of plant–rhizobia interactions. In: Plant gene
plants from stably transformed embryogenic silencing. Springer, New York, pp 159–178
callus. Plant Sci 93(1–2):185–194 23. Limpens E, Ramos J, Franken C et al (2004)
11. Chu Y, Bhattacharya A, Wu C et al (2013) RNA interference in Agrobacterium rhizogenes-
Improvement of peanut (Arachis hypogaea L.) transformed roots of Arabidopsis and Medicago
transformation efficiency and determination of truncatula. J Exp Bot 55(399):983–992
transgene copy number by relative quantitative 24. Kumagai H, Kouchi H (2003) Gene silencing
real-time PCR. In Vitro Cell Dev Biol Plant 49 by expression of hairpin RNA in Lotus japoni-
(3):266–275 cus roots and root nodules. Mol Plant-Microbe
12. Chilton M-D, Tepfer DA, Petit A et al (1982) Interact 16(8):663–668
Agrobacterium rhizogenes inserts T-DNA into 25. Cai Y, Chen L, Liu X et al (2015) CRISPR/
the genomes of the host plant root cells. Cas9-mediated genome editing in soybean
Nature 295 (5848):432–434 hairy roots. PLoS One 10(8):e0136064
13. Nilsson O, Olsson O (1997) Getting to the 26. Butler NM, Jansky SH, Jiang J (2020) First-
root: the role of the Agrobacterium rhizogenes generation genome editing in potato using
rol genes in the formation of hairy roots. hairy root transformation. Plant Biotechnol J
Physiol Plant 100(3):463–473
18(11):2201–2209. https://doi.org/10. 33. Guimaraes LA, Pereira BM, Araujo ACG et al

1111/pbi.13376 (2017) Ex vitro hairy root induction in
27. Bonaldi K, Gherbi H, Franche C et al (2010) detached peanut leaves for plant–nematode
The nod factor–independent symbiotic signal- interaction studies. Plant Methods 13(1):25
ing pathway: development of Agrobacterium 34. Sinharoy S, Saha S, Chaudhury SR et al (2009)
rhizogenes–mediated transformation for the Transformed hairy roots of Arachis hypogea: a
legume Aeschynomene indica. Mol Plant- tool for studying root nodule symbiosis in a
Microbe Interact 23(12):1537–1544 non–infection thread legume of the Aeschyno-
28. Wang L, Wang L, Tan Q et al (2016) Efficient meneae tribe. Mol Plant-Microbe Interact 22
inactivation of symbiotic nitrogen fixation (2):132–142
related genes in Lotus japonicus using 35. Liu S, Su L, Liu S et al (2016) Agrobacterium
CRISPR-Cas9. Front Plant Sci 7:1333 rhizogenes-mediated transformation of Arachis
29. Ron M, Kajala K, Pauluzzi G et al (2014) Hairy hypogaea: an efficient tool for functional study
root transformation using Agrobacterium rhi- of genes. Biotechnol Biotechnol Equip
zogenes as a tool for exploring cell type-specific 30 (5):869–878
gene expression and function using tomato as a 36. Boisson-Dernier A, Chabaud M, Garcia F et al
model. Plant Physiol 166(2):455–469 (2001) Agrobacterium rhizogenes-transformed
30. Agarwal G, Clevenger J, Pandey MK et al roots of Medicago truncatula for the study of
(2018) High-density genetic map using nitrogen-fixing and endomycorrhizal symbi-
whole-genome resequencing for fine mapping otic associations. Mol Plant-Microbe Interact
and candidate gene discovery for disease resis- 14 (6):695–700
tance in peanut. Plant Biotechnol J 16 37. Streeter J (2007) Factors affecting the survival
(11):1954–1967 of Bradyrhizobium applied in liquid cultures to
31. Chopra R, Burow G, Farmer A et al (2015) soya bean [Glycine max (L.) Merr.] seeds. J
Next-generation transcriptome sequencing, Appl Microbiol 103(4):1282–1290
SNP discovery and validation in four market 38. Ivanov S, Harrison MJ (2014) A set of fluores-
classes of peanut, Arachis hypogaea L. Mol cent protein-based markers expressed from
Gen Genomics 290(3):1169–1180 constitutive and arbuscular mycorrhiza-
32. Clevenger J, Chu Y, Scheffler B et al (2016) A inducible promoters to label organelles, mem-
developmental transcriptome map for allotetra- branes and cytoskeletal elements in Medicago
ploid Arachis hypogaea. Front Plant Sci 7:1446 truncatula. Plant J 80(6):1151–1163
Chapter 21
A Method to Reduce off-Targets in CRISPR/Cas9 System

in Plants
Ali Movahedi, Zahra Hajiahmadi, Hui Wei, Liming Yang, Honghua Ruan,
and Qiang Zhuge
Abstract
One of the strategies to reduce the off-target mutations in CRISPR/Cas9 system is to use the temperature-
independent gene transformation method. Mesoporous silica nanoparticles (MSNs)-gene delivery system is
temperature-independent; thus, it can transfer the interesting plasmid (pDNA) to the target plant at
different temperatures, including 37 C. Due to the high activity of SpCas9 at 37 C compared to lower
temperatures, on-target mutagenesis increases at 37 C. Therefore, we describe the synthesis of the
functionalized MSNs with the particle size of less than 40 nm, binding pDNA to the MSNs, and
transferring of the pDNA-MSNs into the target plants.
Key words Cas9, CRISPR, Mesoporous silica nanoparticles, On-target mutation, pDNA-MSNs
delivery, Temperature-independent gene transformation method
1 Introduction
The clustered regularly interspaced short palindromic repeat-

associated protein (CRISPR)/CRISPR associated protein
9 (Cas9) system has been widely employed to edit plants, animals,
and human genomes. This system uses two elements, Cas9 and
single-guide RNA (sgRNA), which leads to direct mutagenesis of
the target gene [1]. The Cas9/sgRNA complex cleaves the target
DNA resulting in gene mutations arising from one of the DNA
repair mechanisms (nonhomologous end joining or homology-
directed repair). Therefore, CRISPR/Cas9 can produce targeted
mutations in the plant genome. This system is convenient and cost-
effective compared with conventional genome editing systems such
as TALENs and ZFNs [1, 2]. However, the major concern about
this system is unintended (off-target) mutations. When the sgRNA
binds to a sequence with partial mismatch instead of on-target sites,
then off-target mutations will occur. Nonspecific mutations in
317
318 Ali Movahedi et al.
plants could destruct protein synthesis, change metabolic pathways,

reduce photosynthesis and plant growth, induce cytotoxicity and
genotoxicity, and lead to undesirable phenotypic changes [3]. Up
to now, various methods have been applied to reduce unwanted
changes in plants including the use of highly specific sgRNAs [4–6],
appropriate promoter [7–9], Cas9 nickase [10–12], geminiviral
replicon [13], CRISPR/Cas9 ribonucleoprotein [14–17],
truncated sgRNAs [18, 19], different variants or altered versions
of Cas9 [20, 21], and temperature-controlled genome editing
[22]. Based on the results of these studies, applying a combination
of different methods can significantly reduce off-target effects.
Therefore, we suggest the use of temperature-independent
methods such as nanoparticles-mediated gene transformation. In
this method, mesoporous silica nanoparticles (MSNs) containing
CRISPR constructs can quickly transfer into the target plant at the
transformation temperature of 37 C, which reduces unintended
mutations [22–24]. On the other hand, designing highly specific
sgRNAs and using appropriate promoters can also improve the
efficiency of this system and decrease off-target changes.
2 Materials
2.1 Functionalized 1. MSNs buffer solution: Add 1.74 g of NaOH and 10.2 g of
Mesoporous Silica KH2PO4 to 1.5 L of deionized water (pH ¼ 7.2).
Nanoparticles (MSNs) 2. Phosphate-buffered saline (PBS): Add 4 g of NaCl, 0.1 g of
KCl, 0.72 g of Na2HPO4, 0.12 g of KH2PO4 to 500 mL of
distilled water and adjust pH 7.4 and then autoclave (Store at
4 C).
3. Cetyltrimethylammonium bromide: CTAB, Merck, Germany,
Catalog number, 219374.
4. Tetraethyl orthosilicate: TEOS, Merck, Germany, 99 purity,
Catalog number, 800658.
5. Absolute ethanol.
6. Hydrochloric acid.
7. Dimethylformamide: DMF.
8. Aminopropyl triethoxysilane: APTES, Merck, Germany, Cata-
log number, 821619.
9. Field emission scanning electron microscope: FE-SEM, Mira
3-XMU, Czech Republic.
10. Transmission electron microscope: TEM, Zeiss, Germany.
11. Small-angle X-ray scattering: SAXS, PANalytical X’Pert MPD
instrument, Netherland.
12. Belsorp-Mini II, Gemini 2375: BEL Japan Inc., Osaka, Japan.
A Method to Reduce off-Targets in CRISPR/Cas9 System in Plants 319
2.2 Plasmid 1. Solution I: 50 mM Glucose, 25 mM Tris–HCl (pH ¼ 8), and

Midipreparation 250 mM EDTA (Autoclave and store at 4 C).
2. Solution II (Fresh): 5 mL of NaOH (2 N), 5 mL of SDS (10%),
and 90 mL of double-distilled water.
3. Solution III: 11.5 mL of acetic acid 100%, 60 mL of potassium
acetate (5 M), and 28.5 mL of double-distilled water.
4. Phosphate-buffered saline (PBS): Add 4 g of NaCl, 0.1 g of
KCl, 0.72 g of Na2HPO4, 0.12 g of KH2PO4 to 500 mL of
distilled water and adjust pH 7.4 and then autoclave (Store at
4 C).
5. LB plus suitable antibiotic: Add 10 g/L peptone, 5 g/L yeast
extract, 10 g/L NaCl, and 15 g/L agar in 1 liter of deionized
water. Adjust the pH to 7.0 with 5 N NaOH and autoclave the
medium. Cool it to about 40 C and add suitable antibiotic
based on the selected construct (Store at 4 C).
6. Escherichia coli: DH5a strain.
7. Syringe: Apply a needle-free syringe and a syringe with needle
to inject the pDNA-MSN solution into the abaxial surface of
leaves and shoots, respectively.
8. Spray bottle: Use a small spray bottle to spray the pDNA-MSN
solution on the abaxial surface of leaves.
3 Methods
3.1 Synthesis Preparation of the functionalized MSNs (~40 nm) based on the
of MSNs modified method of Hussain et al. [25]:
1. To achieve a homogenous solution, dissolve 3.71 g cetyltri-
methylammonium bromide in 100 mL of the MSNs buffer at
30 C and 550 rpm for 1 h using a magnetic stirrer.
2. Add 1.86 mL of tetraethyl orthosilicate (TEOS) dropwise to
the above solution and stir at room temperature and 550 rpm
for 8 h to obtain white sediment.
3. Centrifuge the solution at 8500 g for 20 min and wash the
pellet with 30 mL ethanol for three times to remove excess
template and TEOS.
4. Dissolve the MSNs in a solution containing 100 mL of ethanol
and 1 mL of HCl at 550 rpm and 60 C for 20 h using a
magnetic stirrer.
5. Centrifuge the solution at 8500 g for 10 min and discard the
supernatant.
6. Wash the pellet with 30 mL of absolute ethanol and centrifuge
at 8500 g for 10 min.
7. Wash the pellet with 30 mL of deionized water and centrifuge
at 8500 g for 10 min.
8. Dissolve pellet in absolute ethanol and store at room

temperature.
9. Disperse the final products in pure ethanol and store them at
room temperature.
3.2 Functionalization 1. Resuspend 20 mg of the synthesized MSNs in 20 mL of DMF.

of the MSNs 2. Add 100 μL of APTES dropwise to the above solution.
3. Store the suspension at room temperature for 24 h to eliminate
the unreacted APTES.
4. Centrifuge the solution at 8500 g for 10 min and discard the
supernatant.
5. Wash the pellet with 30 mL of absolute ethanol for three times
to remove excess APTES.
6. Weigh the pellet and resuspend in 30 mL sterilized PBS buffer.
7. Store at room temperature.
3.3 Characterization 1. Apply FE-SEM with an accelerating voltage of 15 kV and TEM

of by 100 kV to study the MSNs morphology and size.
Functionalized MSNs 2. Belsorp-Mini II, Gemini 2375 can be used to assess the synthe-
sized MSNs pore volume and specific surface area (see Note 1).
3. Record SAXS for phase identification of the MSNs by applying
PANalytical X’Pert MPD instrument operating at 40 kV and
40 mA with Cu Ka (k¼1.5406 Å) as an X-ray source.
3.4 Minipreparation 1. Grow overnight E. coli DH5a containing interested plasmid

of Plasmid containing Cas 9 protein (pDNA) in 15 mL of LB plus suitable
antibiotic. Incubate at 37 C with shaking.
2. Pour 15 mL of the culture into a falcon and centrifuge at
18,000 g for 10 min.
3. Discard the supernatant and resuspend the pellet in 1 mL of
chilled solution I by the vortex—store for 5 min at room
temperature.
4. Add 2 mL of solution II. Mix gently and store at 4 C for
10 min.
5. Add 2 mL of solution III and mix gently by inverting—store
for 15 min on ice.
6. Centrifuge at 21,000 g for 10 min and transfer supernatant
fluid to a new microcentrifuge tube.
7. Add an equal volume of chloroform: isoamyl alcohol (24:1)
solution, vortex and centrifuge at 21,000 g for 2 min.
8. Transfer supernatant to a new 1.5 mL microcentrifuge tube
and add 800 μL of isopropanol—store for 20 min at 20 C.
9. Centrifuge at 21,000 g for 10 min (4 C) and remove

supernatant.
10. Wash the pellet with cold 70% ethanol twice by 1 min centrifu-
gation at 5000 g.
11. Allow the pellet to dry at room temperature for 15 min. Then,
resuspend the pellet in 200 μL of PBS buffer.
3.5 Plasmid Binding 1. Mix 1 μg of the interested plasmid with various amounts of the
to the functionalized MSN at a mass ratio of plasmid DNA to MSN
Functionalized MSNs (1:10 to 1:100) at 250 rpm and room temperature for 2 h
using an orbital shaker.
2. To determine the optimal binding ratio, load 5 μL of each
solution onto 1% agarose gel, including naked plasmid DNA
as the control (see Note 2).
3.6 Plant Transient 1. Inject or infiltrate 1–2 mL of the solution containing pDNA:
Transformation Using MSNs (Optimal ratio) into the plant shoot and abaxial surface
MSNs of leaves, respectively, using a syringe (Fig. 1) (see Note 3).
Containing pDNA 2. Spray 1 mL of the above solution on the abaxial surface of
leaves using a small spray bottle (Fig. 1), as well (see Note 4).
Fig. 1 Transient transformation of tomato plants using pDNA:MSNs. (a) pDNA:MSN solution is infiltrated (using
a needless syringe) to the lower surface of the leaf, (b) pDNA:MSN solution sprayed on the lower surface of the
leaf using a small spray bottle, and (c) pDNA:MSN solution is injected into the shoot using the syringe
Fig. 2 Stable gene transformation of tomato plants using pDNA:MSNs. (a) injection of the pDNA:MSN solution
into open flower after pollination, (b) injection of the pDNA:MSN solution into red fruit before ripening stage
3. Use PBS buffer containing MSNs without plasmid as a negative

control.
4. Incubate treated plants at 23 C for 72 h (see Note 5).
3.7 Plant Stable 1. Inject the pDNA-MSN solution into red color fruits at the
Transformation Using early ripening stage (four drops per fruit) and open flowers
MSNs (one drop per flower) of tomato plants (Fig. 2).
Containing pDNA 2. Use PBS containing the MSNs with no plasmid as a negative
control.
3. Incubate treated plants at 23 C in the growth chamber with a
photoperiod of 16:8 h light/dark (see Note 5).
4. After the injected fruits have fully ripened, collect seeds from
them and store them at 4 C for further analysis of transgenic
plants (see Notes 6 and 7).
5. Select transgenic plants using conventional methods, including
media containing suitable antibiotic, polymerase chain reaction
(PCR), quantitative RT-PCR, western blot, and southern blot
analyses.
4 Notes
1. The N2 adsorption–desorption isotherm of the synthesized

MSNs is expected to show type IV of adsorption curves as
expected for mesoporous silica (IUPAC classification) [26].
2. The optimal binding ratio of pDNA: MSN is 1:100.
3. The stomatal density in the adaxial surface of dicot plant leaves
is lower than the abaxial surface. Therefore, it is better to use
the lower surface of the leaves to transfer pDNA-MSNs.
4. We find that the best method in the introduced transient

transformation system is the injection of pDNA: MSN solution
into the abaxial surface of the leaf [27].
5. MSN-mediated gene delivery system is temperature-
independent. Therefore, in the CRISPR/Cas9 system, it is
better to transfer pDNA: MSN solution into the target plants
at a transformation temperature of 37 C to decrease off-target
effects [22].
6. Based on our results, transformation by the injection of pDNA:
MSN solution into the red color fruit is more efficient than
injection to the open flower (Unpublished data).
7. We believe that the floral-dip method (as used in Agrobacter-
ium-mediated transformation) can also be used to transfer
nanoparticles into the target plants such as Arabidopsis
thaliana.
Acknowledgments
This work was supported by the foundation of Nanjing Forestry

University (163108059).
References
1. Sander JD, Joung JK (2014) CRISPR-Cas sys- mutants for multiple target genes in Arabidop-
tems for editing, regulating and targeting gen- sis in a single generation. Genome Biol 16
omes. Nat Biotechnol 32(4):347 (1):144
2. Liu X, Wu S, Xu J et al (2017) Application of 9. Zhang F, LeBlanc C, Irish VF et al (2017)
CRISPR/Cas9 in plant biology. Acta Pharm Rapid and efficient CRISPR/Cas9 gene edit-
Sin B 7(3):292–302 ing in citrus using the YAO promoter. Plant
3. Zhao H, Wolt JD (2017) Risk associated with Cell Rep 36(12):1883–1887
off-target plant genome editing and methods 10. Brocken DJ, Tark-Dame M, Dame RT (2017)
for its limitation. Emerg Top Life Sci 1 dCas9: a versatile tool for epigenome editing.
(2):231–240 Curr Issues Mol Biol 26:15–32
4. Ren C, Liu X, Zhang Z et al (2016) CRISPR/ 11. Komor AC, Kim YB, Packer MS et al (2016)
Cas9-mediated efficient targeted mutagenesis Programmable editing of a target base in geno-
in chardonnay (Vitis vinifera L.). Sci Rep mic DNA without double-stranded DNA
6:32289 cleavage. Nature 533(7603):420
5. Ueta R, Abe C, Watanabe T et al (2017) Rapid 12. Lu Y, Zhu J-K (2017) Precise editing of a
breeding of parthenocarpic tomato plants target base in the rice genome using a modified
using CRISPR/Cas9. Sci Rep 7(1):507 CRISPR/Cas9 system. Mol Plant 10
6. Upadhyay SK, Kumar J, Alok A et al (2013) (3):523–525
RNA-guided genome editing for target gene 13. Dahan-Meir T, Filler-Hayut S, Melamed-
mutations in wheat. G3 (Bethesda) 3 Bessudo C et al (2018) Efficient in planta
(12):2233–2238 gene targeting in tomato using geminiviral
7. Sun X, Hu Z, Chen R et al (2015) Targeted replicons and the CRISPR/Cas9 system.
mutagenesis in soybean using the CRISPR- Plant J 95(1):5–16
Cas9 system. Sci Rep 5:10342 14. Liang Z, Chen K, Li T et al (2017) Efficient
8. Wang Z-P, Xing H-L, Dong L et al (2015) Egg DNA-free genome editing of bread wheat
cell-specific promoter-controlled CRISPR/ using CRISPR/Cas9 ribonucleoprotein com-
Cas9 efficiently generates homozygous plexes. Nat Commun 8:14261
15. Malnoy M, Viola R, Jung M-H et al (2016) variants and gRNAs. Plant Cell Physiol 60
DNA-free genetically edited grapevine and (10):2255–2262
apple protoplast using CRISPR/Cas9 ribonu- 22. LeBlanc C, Zhang F, Mendez J et al (2018)
cleoproteins. Front Plant Sci 7:1904 Increased efficiency of targeted mutagenesis by
16. Murovec J, Guček K, Bohanec B et al (2018) CRISPR/Cas9 in plants using heat stress. Plant
DNA-free genome editing of Brassica oleracea J 93(2):377–386
and B. rapa protoplasts using CRISPR-Cas9 23. Lee K, Zhang Y, Kleinstiver BP et al (2019)
ribonucleoprotein complexes. Front Plant Sci Activities and specificities of CRISPR/Cas9
9:1594 and Cas12a nucleases for targeted mutagenesis
17. Svitashev S, Schwartz C, Lenderts B et al in maize. Plant Biotechnol J 17(2):362–372
(2016) Genome editing in maize directed by 24. Moreno-Mateos MA, Fernandez JP, Rouet R
CRISPR–Cas9 ribonucleoprotein complexes. et al (2017) CRISPR-Cpf1 mediates efficient
Nat Commun 7:13274 homology-directed repair and temperature-
18. Nishitani C, Hirai N, Komori S et al (2016) controlled genome editing. Nat Commun 8
Efficient genome editing in apple using a (1):1–9
CRISPR/Cas9 system. Sci Rep 6:31481 25. Hussain HI, Yi Z, Rookes JE et al (2013)
19. Wyvekens N, Topkar VV, Khayter C et al Mesoporous silica nanoparticles as a biomole-
(2015) Dimeric CRISPR RNA-guided FokI- cule delivery vehicle in plants. J Nanopart Res
dCas9 nucleases directed by truncated gRNAs 15(6):1676
for highly specific genome editing. Hum Gene 26. Sing KS (1985) Reporting physisorption data
Ther 26(7):425–431 for gas/solid systems with special reference to
20. Wolter F, Klemm J, Puchta H (2018) Efficient the determination of surface area and porosity
in planta gene targeting in Arabidopsis using (recommendations 1984). Pure Appl Chem 57
egg cell-specific expression of the Cas9 nucle- (4):603–619
ase of Staphylococcus aureus. Plant J 94 27. Hajiahmadi Z, Shirzadian-Khorramabad R,
(4):735–746 Kazemzad M et al (2019) Enhancement of
21. Yamamoto A, Ishida T, Yoshimura M et al tomato resistance to Tuta absoluta using a
(2019) Developing heritable mutations in Ara- new efficient mesoporous silica nanoparticle-
bidopsis thaliana using a modified CRISPR/ mediated plant transient gene expression
Cas9 toolkit comprising PAM-altered Cas9 approach. Sci Hortic 243:367–375
INDEX
A Cis-regulatory elements .................................................. 57

Coat protein (CP) ....................................................26–28,
Acetosyringone.................................. 100, 102, 105, 110, 47–49, 85, 137, 143, 151, 166, 167, 171, 175
113, 119, 121, 126, 129, 135, 140, 152, 156, Cold stress ....................................................................... 50
160, 170, 174, 183, 195, 196, 202, 203, 208,
Composite plants .........................................304–308, 312
260, 311 Conidial suspension ............................................. 244, 247
Agrobacterium-mediated transformation .............. 15, 48, Co-transformation ...........................................50, 51, 306
50–54, 323
Cotton infection................................................... 245–247
Agrobacterium rhizogenes .............................50, 304–307, Cowpea ..........................................................29, 191–193,
310–312, 314 196, 197, 199–208
Agrobacterium tumefaciens..................................... 50, 52,
Cre-lox .................................................................. 293–301
97–100, 102, 103, 105, 110, 112, 113, 120, 121, CRISPR associated protein 9 (Cas9) ............................ 15,
125–127, 129, 130, 134–135, 139–141, 144, 24, 317–323
148, 150, 151, 153, 155–158, 160, 161, 166,
CRISPR-Cas9...................................................... 1, 15, 24,
170, 173, 174, 176, 183, 184, 193, 195, 199, 39, 43, 45, 47, 50, 53, 55, 57, 133, 304
208, 230, 234, 259, 260, 271, 272, 274–276, Crop improvements ................................ 38–57, 133, 227
278, 287, 289, 304 Czapek-Dox medium........................................... 245–247
Agroinoculation ........................................... 96, 119, 126,
127, 129, 193, 200 D
Arabidopsis thaliana .................................. 4, 7–9, 11, 12,
15, 24, 47, 48, 50, 57, 228, 240, 297, 323 Degradome ................................................... 31, 254, 259,
Artificial miRNA (amiRNA)........................................8, 9, 268–270, 275, 277, 278
13, 241, 284 Detached leaf assay...................................... 185, 187, 218
Artificial small RNAs (art-sRNAs) ...................... 227, 228 Detection .................................................. 72, 75–82, 121,
137, 193, 204–207, 244, 254
B Diagnostics .......................................................75, 76, 204
DICER-like (DCL)............................................. 3, 24, 25,
Barley stripe mosaic virus (BSMV) .........................85–92,
73, 166, 192, 193, 227, 243
97–99, 101, 104–106, 166 DNA virus ................................................. 25, 28, 47, 118
Biosafety .......................................................................... 58 Double-stranded multi siRNA ....................................148,
Brome mosaic virus (BMV).................. 97, 109–115, 166
166, 243
Drought avoidance .............................................. 185, 187
C
dsRNA synthesis...................................... 4, 213–218, 220
Calotropis gigantean ..................................................... 152 Dual vector system ............................................... 283, 284
CaMV 35S .......................................................12, 96, 151,
193, 269, 274, 275, 279 E
Catharanthus roseus ............................................ 148, 149, Eco-real time PCR ............................................... 137, 143
151, 152, 156–158 Electroporation ............................ 99, 102, 183, 184, 199
cDNA......................................................26, 96, 101, 111, Escherichia coli ............................................ 15, 43, 45, 88,
112, 114, 119, 121, 123, 128, 129, 137, 142,
99, 102, 105, 106, 110, 120, 150, 154, 160, 169,
143, 149, 152, 158, 159, 168, 172, 175, 177, 173, 212–214, 228, 233, 241, 256, 259, 261,
184, 206, 213–215, 255–259, 266, 267, 269, 285–287, 289–291, 319, 320
272, 275–278, 288, 290
Etiology ........................................................................... 72
Chenopodium ................................................110, 112–114
Methods in Molecular Biology, vol. 2408, https://doi.org/10.1007/978-1-0716-1875-2,
325
PLANT GENE SILENCING: METHODS AND PROTOCOLS
326 Index
F Mesoporous silica nanoparticles............................ 60, 318
Methyl-viologen (MV) ................................................. 187
Fine-tuning gene expression ........................................ 228 Microprojectile bombardment ....................................... 96
Fluorescent microscopy ...................................... 220, 279, MicroRNA-induced gene silencing
305, 307, 312 (MIGS) ................................................... 4, 7, 8, 13
Functional genomics........................................... 1, 85, 97, MicroRNAs (miRNAs) ........................................... 8, 192,
117–130, 133, 134, 147–161, 256, 265 243, 253–279
Functional genomics approaches ................................. 133 Mir173...............................................................4, 7, 8, 13,
Fungal hyphae recovery ................................................ 244 228–230, 233, 235–238, 240
miRNA sensor .....................................269, 271–273, 279
G
mMESSAGE....................................................... 87, 90, 91
Geminiviruses ...................................................... 9, 27, 28, Monoterpene indole alkaloids (MIAs)......................... 148
43, 47, 51, 191–209 Multigene transformation.................................... 293–301
Gene editing ...............................2, 15, 40, 42, 43, 46, 55 Multiple abiotic stresses ....................................... 181–187
Gene silencing methods.............................................. 1–17 Mungbean yellow mosaic India virus
Gene stacking ........................................38, 294, 295, 297 (MYMIV)................................................... 29, 192,
Genetic transformation ........................... 44, 85, 149, 304 193, 198, 201, 206, 207
Genome engineering .................................................... 294
Germination medium (GM)................................... 38, 58, N
61, 196, 202, 203 Next generation sequencing (NGS) ............................. 24,
Green fluorescent protein (GFP) ......................... 44, 106, 59, 60, 71, 76, 77, 147, 254–256, 262
184, 260, 269, 273, 278, 279, 297, 309 Nicotiana benthamiana ........................................ 7–9, 11,
45, 48, 97, 98, 100, 103, 105, 106, 110, 112,
H
113, 115, 183–185, 255, 260, 261, 269, 272,
Hairpin RNAi (hp-RNAi)............................6, 26–30, 202 276, 278
Hairy root transformation ................................... 303–314 Nitrogen ....................................................... 50, 103, 111,
Helper-component protease (HC-Pro) ...................26, 27 113, 121, 122, 125, 127, 134, 136, 139, 141,
Hemocytometer .......................................... 218, 245, 247 150, 152, 154–157, 223, 248, 304, 305, 307,
Hordeivirus...................................................................... 97 309–312, 314
Host-induced gene silencing (HIGS)............................. 9, Nutrient acquisition ............................................. 165–178
13, 244, 283
Hydrogen peroxide (H2O2) ......................................... 187 O
Hydroponics ...................... 126, 127, 167, 168, 175, 177 Ocimum basilicum .......................................................149,
151, 152, 156–159
I
Off-target gene silencing ...............................15, 104, 186
Insertional mutagenesis ......................................... 16, 133 On-target mutation .................................... 255, 274, 317
In silico tools ...............................................................8, 16 Osmotic stress ...................................................... 183, 187
Intron-containing hairpin RNA (ihpRNA) .............9, 284 Oxidative stresses ........................................ 184, 185, 187
L P
Leaf disks .............................................................. 181–187 pDNA-MSNs delivery ......................................... 321, 322
Leaf wilt disease............................................................. 250 Peanuts ................................................................. 303–305
Ligation-independent cloning (LIC).............................. 6, Phosphorus.................................................................... 170
99, 101, 102, 105, 284–286, 288–291 Photosynthetic photon flux density
Luria-Bertani medium ........................................ 110, 120, (PPFD)...................................................... 202, 208
134, 183, 214, 256, 306 Phytoene desaturase (PDS) .................................... 45, 86,
92, 105, 110, 118, 119, 126, 127, 134–137,
M 141–143, 149, 153, 155, 156, 158, 159, 167,
175, 184
Magnesium chelatase (Mg-chelatase) .........................105,
Phytophthora infestans ..................................218–221, 223
110, 118, 184
Plant Small RNA Maker Suite
Meganucleases (MN) ................................................38–40
(P-SAMS)........................229, 236, 238, 240, 241
Menadione............................................................ 184, 185
Index 327
Plant-specific small non-coding RNAi tool 148, 166, 184, 186, 192, 193, 205, 212,
(pssRNAit) ..........................................32, 111, 184 214–216, 222, 243, 244, 249, 250, 283
Plant virus ........................................................... 26, 27, 79 Small nuclear RNA (snRNA) ......................................... 74
Pleiotropic effect of a gene ........................................... 182 Soluble Pi....................................................................... 176
Polyethylene glycol (PEG) ............................................ 53, Specialized metabolism ........................................ 147–161
183, 187, 287, 288 Stomatal behavior ......................................................... 187
Positive-sense RNA ......................................................... 85 Synthetic trans-acting small interfering RNA
Post transcriptional gene silencing (syn-tasiRNA) ........................................... 227–242
(PTGS)................................................... 2, 4–6, 12, Syringe infiltration ............................................. 9, 11, 153
16, 23, 26, 27, 134, 148, 165, 192, 212
Potassium.................................................... 100, 103, 111, T
113, 150, 195, 306, 309, 319
Target cleavage .............................................................255,
Potato cyst nematode .......................................... 218–221 259–260, 269–271, 273, 278
Potato virus X (PVX) .................................. 7, 11, 28, 166 TargetFinder......................................................... 239, 241
Purple acid phosphatase (PAP) .................................... 167
T-DNA insertion mutagenesis ......................................... 1
Tobacco mosaic virus (TMV)....................................7, 26,
R
27, 47, 166
Rauwolfia serpentina................................... 147, 148, 159 Tobacco rattle virus (TRV)........................................7, 11,
Read alignment ............................................................... 77 133–145, 149, 166, 175, 187
Resistant target....................................255, 261, 275, 276 Tomato ....................................................... 11, 24, 27–29,
Rice tungro bacilliform virus 31, 43–45, 47, 49, 53, 55, 133–145, 166, 167,
(RTBV) ....................................................... 97, 118 169–172, 174, 176, 177, 191, 192, 255–257,
5’ RLM-RACE ............................................ 255, 259, 271 260, 263–266, 271–275, 321, 322
RNA-dependent RNA polymerase Tomato golden mosaic virus (TGMV) ........................ 166
(RdRP)......................................................... 25, 73, Tomato yellow leaf curl virus
148, 151, 166, 167, 228, 243 (TYLCV)..................................24, 28, 29, 47, 192
RNA-induced silencing complex Transcription activator-like effector nuclease
(RISC)..................................................2–4, 72, 73, (TALEN) ............................ 2, 38, 42–44, 58, 317
148, 192, 193, 212, 243, 283 Transcriptional gene silencing
RNA interference (RNAi) ...........................................1, 2, (TGS) ................................................... 1–6, 11–14,
8–10, 16, 23, 24, 26–32, 71–73, 96, 98, 133, 165, 16, 26, 27, 148, 165
166, 192, 193, 201, 202, 204–208, 211–215, Trans-kingdom small RNA.................................. 243–250
217, 227, 243–245, 283–291 Triticum aestivum ....................................... 49, 54, 55, 97
RNA silencing ..................................................... 3, 23, 24, T7 express cell ............................................................... 222
26, 27, 30, 31, 71, 243–251, 284 T7 promoter........................................................ 212, 213,
RNA Virus ........................................................... 7, 25, 27, 215, 216, 222, 251
32, 47, 73, 97, 134
Rolling circle amplification U
(RCA).......................................197–199, 206, 207 Ubiquitin ............................................................... 54, 110,
Root nodule symbiosis ................................................. 314
111, 114, 128, 206, 207
Untranslated region (UTR) .......................................... 55,
S
104, 160, 186, 269, 277
Salt stress ......................................................................... 50
Shoot induction and selection medium V
(SISM) ...................................................... 196, 203 Verticillium dahliae............................................. 244, 245,
Short Tandem Target Mimic (STTM)........................255,
247, 248, 250
260, 261, 271–275, 279 Vigna unguiculata ......................................................... 200
Single Nucleotide Polymorphism (SNP)....................... 59 Viral-derived small interfering RNAs
SiRNA target finder ............................................. 214–216
(vsiRNAs).............................24, 25, 29–32, 71–82
Site-specific integration (SSI) .............................. 293–301 Viral propagation .......................................................... 161
Site-specific recombination (SSR) ................................ 294 Viral transcripts ........................................... 25, 30, 31, 91
Small-interfering RNAs (siRNA) ................................3, 4, Viroids ......................................................... 72, 75, 76, 79
9, 11, 14, 23, 24, 28, 30–32, 73, 74, 81, 98, 104,
Virus-derived small RNAs (vsRNAs) ............................. 24
328 Index
Virus-induced gene silencing (VIGS) ............................. 1, Z
2, 4, 6, 7, 9, 12, 13, 16, 25, 71, 85–92, 95–99,
101, 102, 104–106, 110–112, 114, 117–130, Zinc finger nucleases (ZFNs) ........................................ 38,
133–145, 147–149, 152, 154–161, 165–168, 40–42, 58, 317
170–176, 178, 182, 284, 288 Zoospores ................................................ 40–42, 218, 220
Virus vectors .............................................. 7, 97, 106, 166
W
Whiteflies .............................................................. 191, 201

Plant Gene Silencing

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Plant Gene Silencing

Uploaded by

Copyright:

Available Formats

Methods in

Molecular Biology 2408

For further volumes:

Methods and Protocols

ISSN 1064-3745 ISSN 1940-6029 (electronic)

© Springer Science+Business Media, LLC, part of Springer Nature 2022

Ardmore, OK, USA Kirankumar S. Mysore

14 In Vitro Method for Synthesis of Large-Scale dsRNA Molecule

EASWARAN KOKILADEVI • Department of Plant Biotechnology, Centre for Plant Molecular

Recent Advances in Plant Gene Silencing Methods

The field of functional genomics is expanding with new tools and

posttranscriptional gene silencing or PTGS) [1–3]. Few examples

2 Posttranscriptional and Transcriptional Gene Silencing

TGS occurs by chromatin re-modeling and DNA methylation [9].

complex following the ATP dependent unwinding of the RNA

tasiRNAs belong to the category of secondary siRNAs, which

siRNAs Induced by The production of siRNAs in plants is also induced by foreign

3 Methods of Gene Silencing

viral vectors based on Potato Virus X (PVX), Tobacco mosaic virus

3.1.3 MicroRNA-induced MicroRNA-induced gene silencing (MIGS) is a newly developed

MIGS in different systems. For example, miR173 co-expressing

A. thaliana wherein silencing of Flowering time (FT) gene was

3.1.6 Host-induced Gene Host-induced gene silencing (HIGS) is a cross-kingdom RNAi

The preliminary step for HIGS consists of the identification of

of an 18 amino acid copolymer of histidine and lysine (HK9) and

4 Limitations of the Gene Silencing Methods

(endonuclease dead Cas9; dCas9) still capable of forming

5 Conclusions and Future Perspectives

tools with wide applicability is needed. Alternate and widely appli-

51. Hamilton A, Voinnet O, Chappell L, Baul- 64. Carrillo-Tripp J, Shimada-Beltrán H, Rivera-

Strategies for Efficient RNAi-Based Gene Silencing of Viral

RNA silencing, also known as posttranscriptional gene silencing

degradation [1]. In plants, RNAi acts as a major natural defence

2 Antiviral Plant Defence Responses

Plant RNAi pathway is well established in the model plant species

fragments of 21–26 nucleotides (nt). The non-coding RNAs

3 Engineering Based on Pathogen-Derived Resistance

The concept of pathogen-derived resistance (PDR) or parasite-

against invasion by the same pathogen. The seminal work by

almost 100% efficiency when directed against virus or endogenous

4 Designing Effective Antiviral hp-RNAi Construct

Identification of viral genes: Retrieve sequence from NCBI nucleotide database

NCBI BLAST search: Viral gene 1 Viral gene 2 Viral gene 3

Off-target search: Blast search Gene 1 Gene 2 Gene 3

Clone sense – RE 1 & 2

non-transgenic controls were 96–100% symptomatic [48]. Trans-

level of transgene-derived siRNA accumulation with dominant

4.5 Identification A major drawback in the identification of antiviral effective siRNAs

5 Approaches for Reducing Off-Target Silencing

Apart from vsiRNAs targeting viral transcripts/genome, vsiRNAs

complementary host transcripts. The vsiRNA were shown to target

RNAi-based technology was successfully used for the control of

Support from DBT-BIRAC, DBT-NER and ICAR-NPFGGM are

Genome Editing and Designer Crops for the Future

Agriculture and food security have emerged as a subject of global

conventional breeding has been expedited to a great extent in past

CRISPR Associated protein 9 (Cas9). CRISPR/Cas9 is more pre-

2 Genome Editing Approaches in Plants and Their Application in Crop Improvement

[19, 24]. Altogether, these limitations impose restrictions to use

or NHEJ repair (Fig. 2). NHEJ can disrupt a gene structure as it

2.3 Transcription TALENs are the combination of the transcriptional activator-like

[13]. In tomato, copy number and efficiency of homologous

improved quality of sugarcane was generated by TALEN-mediated

2.4 Clustered CRISPR-Cas9 technology has gained popularity in the scientific