Biomass and Bioenergy 140 (2020) 105677

Contents lists available at ScienceDirect

Biomass and Bioenergy

journal homepage: http://www.elsevier.com/locate/biombioe

Characterization on the aerobic denitrification process of Bacillus strains

Ting Yang, Yu Xin *, Liang Zhang **, Zhenghua Gu, Youran Li, Zhongyang Ding, Guiyang Shi
The Key Laboratory of Industrial Biotechnology of Ministry of Education, National Engineering Laboratory for Cereal Fermentation Technology, Jiangnan University,
Wuxi, 214122, Jiangsu, PR China

A R T I C L E I N F O A B S T R A C T

Keywords: Bioenergy from biomass crops plays an important role as a promising energy source to meet the energy demands.
Bacillus strains However, during the production of biomass crops, water requirement, water quality degradation and the
Nitrogen removal resulting environmental and economic problems are important factors that can affect the development of bio­
Biological treatment
energy worldwide, especially in low- and middle-income countries. In addition, industrial-scale production of
Aerobic denitrification
Wastewater
bioenergy may also cause pollution to water resources. Thus, it is extremely urgent to take effective approaches
to improve the waterbodies. In this study, four novel denitrifying Bacillus strains, JD-005, JD-014, JD-016 and
JD-017, were isolated, characterized and further studied on the properties of nitrogen removal. The four strains
could utilize ammonium, nitrate and nitrite source under aerobic conditions. In a simulated 5 L sewage biore­
actor, four strains also exhibited efficient denitrification performance in multiple nitrogen coexistence, with the
nitrite-N removal rates reached 0.41–1.89 mg/L/h, and the ammonium removal rates reached 0.87–2.07 mg/L/
h. In addition, the denitrification metabolic pathway of Bacillus subtilis JD-014 was confirmed by investigating
the nitrogen balance, gaseous nitrogen production, enzyme activity and functional genes analysis. With
outstanding nitrite tolerance, the nitrogen removal efficiency could up to approximately 50–80% at initial NO2 -
N concentration of 50–200 mg/L. These results showed that JD-014 should be of great potential in bioremedi­
ation of polluted waterbodies and may provide an efficient and eco-friendly way in the future to improve water
resources and realize better sustainable bioenergy application.

1. Introduction
Energy shortage and environmental pollution have become the
constraint of economic development in many countries. The satisfaction
of vast demand of global energy and the per capita energy usage is the
current key point of research [1]. Among the different available
renewable energy sources, bioenergy from the use of biomass is
considered as one of the most potential options worldwide to meet the
energy demands and ensure energy security, due to its easy availability,
widely distribution and inexpensive nature [2]. Although it usually
thought of as harmless, this does not mean that it will be no impact on
the environment. In fact, it exists at the expense of hidden environ­
mental burdens, such as putting great pressure on water consumption
and water quality [3–5].
Nowadays, there is a move towards planting of perennial bioenergy
crops to help reduce the energy shortage around the world, especially in
some low- and middle-income countries, such as India, Pakistan,
Malaysia and China [1,6,7]. These countries are always rich in biomass
resources for energy generation. However, most crops for biofuels have
high irrigation water requirements and compete for already scarce
water. For example, ethanol processing requires more water per unit of
biofuel produced than petroleum refining [8]. It is reported that a liter of
ethanol made from sugarcane in India needs 3500 L of water, while in
China it takes nearly 2400 L of irrigation water when using maize as raw
material [9]. What’s more, to meet the demands of mass production and
increase crop yields, large-scale land would change to produce bio­
energy crops and the application of extra chemicals and fertilizers is
inevitably increased. This will undoubtedly impair water quality, lead­
ing to an accumulation of nitrogen and toxic substances in waterbodies
[10–12]. In addition, industrial-scale production of bioenergy may also
cause pollution to water resources. For example, the major challenge of
large scale micro-algae biofuel production is the enrichment and
leaching of residual nutrients, such as nitrogen and phosphorus, that
increased the risk of water contamination [13]. Thus, it is extremely
urgent to take effective approaches to improve the water quality. While
in water bodies, nitrogen contamination has been considered as the most

* Corresponding author.
** Corresponding author.
E-mail addresses: yuxin@jiangnan.edu.cn (Y. Xin), zhangl@jiangnan.edu.cn (L. Zhang).

https://doi.org/10.1016/j.biombioe.2020.105677
Received 23 July 2019; Received in revised form 31 May 2020; Accepted 28 June 2020
Available online 17 July 2020
0961-9534/© 2020 Elsevier Ltd. All rights reserved.
T. Yang et al.
prevalent and excessive one, which could lead to eutrophication, algal
bloom, impair aquatic habitat of surface waterbodies and further threat
the safety of public health [14,15]. Hence, the removal of nitrogen
compounds is the key point in water management. In response, more
attention is focused on the biological nitrogen removal technologies.
Comparing with other traditional denitrogenation approaches, they
offer the advantages of high efficiency, low cost and do not create sec­
ondary pollution or residues [16].
Generally speaking, a conventional biological treatment process
often includes autotrophic nitrification, in which nitrifiers convert
ammonium to nitrite or nitrate under aerobic conditions, and anaerobic
denitrification, in which denitrifiers reduce nitrate and nitrite to
nitrogenous gas [17]. However, the application of this traditional pro­
cess is limited due to the separation of aerobic and anoxic phases,
time-consuming, cost-intensive and different demands of oxygen and
organic substrates [18]. Consequently, there is still a great demand to
find new techniques to remove nitrogen compounds during wastewater
treatment [19–21]. Aerobic denitrification, a new biological process, is
being investigated recently. Microorganisms with this ability can
simultaneously conduct nitrification and denitrification in one reactor
under identical overall operating conditions and exhibit much higher
growth rate, so that the whole process could be achieved for simple
process, high efficiency, low investment and less operation cost [18,20].
As this new biological nitrogen removal technology is of major
importance to the removal of nitrogen pollution, studies of microbes
that have this function are needed to solve the problem of eutrophica­
tion in water bodies and maintain the nitrogen balance of ecosystems.
Recent research has focused mainly on the screening of microbes with
high nitrogen-removing efficiencies [22,23]. Thus far, a large number of
these functional strains, mainly Gram-negative bacteria, such as Pseu­
domonas sp. [24], Alcaligenes sp. [14], Paracoccus sp. [25] and Acineto­
bacter sp. [18], have been reported. Meanwhile, Bacillus genera, which
are typical Gram-positive probiotics, popularly used in the aquaculture
industry due to their biosecurity, broad environmental adaptation,
improvement of water quality and promotion of the growth of aquatic
animals [26–28]. But compared with other strains, the aerobic deni­
trifying characteristics and the nitrogen removal mechanism of
wild-type Bacillus strains are still poorly understood.
Therefore, four aerobic denitrifying Bacillus strains were isolated and
identified from different environmental samples in our study. Their ni­
trogen removal characteristics were investigated using different nitro­
gen sources. To gain valuable insight into the metabolic pathway of
denitrification in Bacillus strains, nitrogen balance, gaseous nitrogen
production and the analysis of the functional genes were studied in JD-
014. This study may provide an optional and safe microbial resource in
the field of green nitrogen removal and will be beneficial for improving
water resources utilization and enhancing the performance of bioenergy
application.
2. Materials and methods
2.1. Media
Luria Bertani (LB) medium was used for the enrichment and isolation
of denitrifying bacteria, contained (per liter): peptone 10 g, yeast extract
5 g, NaCl 10 g. For LB plate, 20 g agar was added.
Bromothymol Blue (BTB) medium was used for the preliminary
screening of denitrifying bacteria, contained (per liter): NaNO3 0.84 g,
KH2PO4 1.0 g, FeSO4⋅7H2O 0.59 g, CaCl2 0.09 g, MgSO4⋅7H2O 1.0 g,
sodium succinate 8.5 g, BTB (1% alcoholic solution) 1 mL, agar 20 g, pH
7.0–7.3.
Denitrification medium (DM) was used for the determination the
nitrate or nitrite removal ability of isolated strains, contained (per liter):
NaNO3 0.84 g or NaNO2 0.74 g, Na2HPO4 4.0 g, KH2PO4 1.5 g,
MgSO4⋅7H2O 0.2 g, sodium succinate 8.5 g, trace element solution 2 mL,
pH 7.0–7.5.
2
Biomass and Bioenergy 140 (2020) 105677
Nitrification medium (NM) was used for the determination the
ammonium removal ability of isolated strains, contained (per liter):
(NH4)2SO4 0.71 g, Na2HPO4 4.0 g, KH2PO4 1.5 g, MgSO4⋅7H2O 0.2 g,
sodium succinate 8.5 g, trace element solution 2 mL, pH 7.0–7.5.
The trace element solution (per liter) was composed of EDTA 50 g,
ZnSO4⋅7H2O 3.92 g, CaCl2 5.5 g, MnCl2⋅4H2O 5.06 g, FeSO4⋅7H2O 5.0 g,
(NH4)6Mo7O2⋅4H2O 1.1 g, CuSO4⋅5H2O 1.57 g and CoCl2⋅6H2O 1.61 g.
2.2. Isolation and identification of aerobic denitrifying Bacillus strains
Samples were collected from different environments such as forests,
fish, shrimp and crab culture ponds, activated sludge and sediments. 2
mL water samples or 2 g sediments were transferred into 250 mL ster­
ilized conical flasks containing 98 mL liquid LB medium and the flasks
were put into a shaking incubator which kept at 37 � C, 200 rpm. 0.1 mL
of gradient dilutions were then spread on LB plates. Separate colonies
were picked out and purified by repeated streaking on agar plates. Then,
the isolated were transferred and dropped into BTB medium plates at 30
�
C for 3 days. When the BTB medium turned blue, the colonies were
inoculated to 100 mL DM to test the denitrification abilities. The strains
with the highest denitrification rate were selected and stored in 30%
glycerol solution at 80 � C for further analysis. The Gram staining re­
action was determined using the method described by Gerhardt et al.
[29] and the morphology of selected strains were taken with a scanning
electron microscope (SU8220, Hitachi, Japan).
To identify the isolated strains, the genomic DNA of the strains were
extracted from bacterial suspensions in LB medium with Biospin bac­
teria genomic DNA extraction kit (BioFlux, Shanghai, China), according
to the manufacturer’s instructions. The genomic DNA was used as a
template to amplify 16S rRNA gene by PCR using bacterial universal
primers 27F and 1492R. After purification, PCR-amplified product was
sequenced by Sangon Biotech (Shanghai, China) Co. Ltd. The 16S rRNA
sequences were compared with that of other available microorganisms
in GenBank of NCBI by BLAST (http://www.ncbi.nlm.nih.gov/BLAST/
Blast.cgi). A phylogenetic tree was constructed using the neighbor
joining method by MEGA 5.2 software.
2.3. Estimation of nitrogen removal capability of Bacillus strains
The screened strains were cultivated for 16 h at 37 � C, 200 rpm in LB
medium, and the bacterial suspensions were collected by centrifugation
at 5000 rpm for 10 min and washed with sterile water for three times.
Then, 1 mL bacterial suspensions were placed into 100 mL sterile DM or
NM to keep the initial OD600 at approximately 0.1. The conical flasks
were incubated at 37 � C, 200 rpm for 5 days. During the fermentation
period, samples were taken periodically to determine the cell density
(OD600). Then centrifuged at 12,000 rpm for 10 min. The supernatant
was used for analysis of the pH, NO3 -N, NO2 -N, NHþ 4 -N, NH2OH and TN.
All the experiments were performed in triplicate.
2.4. Detection of gaseous nitrogen
The culture suspensions were inoculated into 100 mL sterile DM or
NM with different nitrogen sources and sealed in 250 mL serum bottles.
To simulate the amount of oxygen in the air, the bottles were evacuated
and fully aerated with O2–He (21:79) gas. Then the bottles were culti­
vated at 37 � C and 200 rpm for 5 days. Gas samples from the headspace
were collected by gas tight syringes to detect N2 and N2O using gas
chromatography. The bottle without inoculation was used as a control.
Cultures were sampled for chemical analysis.
2.5. Amplification of functional denitrification genes
The genomic DNA of the isolated strains were used as templates to
amplify the fragments of denitrification functional genes nap, nor and
nos. The primers used in the study were listed in Table 1. The PCR
T. Yang et al. Biomass and Bioenergy 140 (2020) 105677

products were separated by 1.5% agarose gel electrophoresis. Bands removal rate was: RRðmg =L =hÞ ¼ T1 T T2 . Where T1 and T2 represent for
were photographed using the gel imaging system (ChemiDoc XRSþ, Bio- the initial concentration of nitrogen and nitrogen concentration at time
Rad, USA). T, respectively.

2.6. Enzyme assay 3. Results

B.subtilis JD-014 was harvested after cultivation for 60 h in DM by
centrifugation at 4 � C, 12,000 rpm for 10 min, washed three times and
then resuspended in 10 mmol/L phosphate buffer (pH 7.4). Cell-free
extracts were obtained by subjecting the bacterial suspensions to lysis
using ultrasonication and then centrifuged at 12,000 rpm for 10 min.
The activity of nitrate reductase was determined by the reduction of
nitrate with NADH as the electron acceptor [30]. Protein concentration
in the cell-free extract was determined by Bradford reagent kit (Sangon,
Shanghai, China). One unit of enzyme activity (U) was defined as the
amount of enzyme that catalyzed the conversion of 1 μmol of substrate
per minute. The specific activity (U/mg) was defined as the amount of
enzyme units divided by the total amount of protein in mg.
3.1. Isolation and identification of the denitrifying strains
A total of 21 preliminary selected strains from BTB plates were
inoculated in DM to test the denitrification capability. Four Bacillus
strains, named as JD-005, JD-014, JD-016 and JD-017 showed higher
nitrogen removal rate and were chosen for further analysis. Homology
searches of the 16S rRNA gene sequences revealed that the four strains
were most closely related to Bacillus pumilus, Bacillus subtilis, Bacillus
licheniformis and Bacillus subtilis, respectively, and the phylogenetic tree
(Fig. 1) was constructed based on 16S rRNA sequence. The nucleotide
sequences were submitted to GenBank under the accession numbers
MK124647 to MK124650.

2.7. Quantitative real-time PCR analysis

3.2. Estimation of the nitrogen removing of the Bacillus strains
The cells of the B. subtilis JD-014 used for RNA extraction were
collected in DM every 24 h. Total RNAs were obtained with the RNA 3.2.1. Aerobic denitrification of Bacillus strains against nitrate
extraction kit (BioFlux, Shanghai, China) according to the manufac­ The results in Fig. 2 show that when sodium nitrate was used as the
turer’s instructions. cDNA synthesis was carried out using HiScript® II sole nitrogen source, the four Bacillus strains JD-005, JD-014, JD-016
1st Strand cDNA synthesis kit (Vazyme, Nanjing, China) and RT-PCR and JD-017 exhibited efficient nitrogen removal abilities. Strain JD-
was conducted using ChamQ™ universal SYBR® qPCR master mix kit 016 had the highest NO3 -N degrading capacity that reduced 185.34
(Vazyme, Nanjing, China) on CFX96 Bio-Rad Real-Time PCR System to mg/L NO3 -N to 61.39 mg/L with 66.87% efficiency (Fig. 2b), and the
analyze nap, nor, nos. The primers for qRT-PCR analysis were listed in corresponding maximum nitrogen removal rate was 1.03 mg/L/h
Table 1. The relative gene expression results were analyzed by the (Table 2). In the initial period of 24 h, all four strains were in an
2 △△CT method [31] and gyrase B (gyr B) was served as an internal adaptation period (Fig. 2a), and the contents of various nitrogen com­
control to normalize the data [32]. pounds remained stable (Fig. 2b–d); after that the cell density increased
rapidly (Fig. 2a) and the nitrate removal was closely related with the
growth curve of strains. The pH value went up gradually from 7.2 to
2.8. Analytical methods
approximately 9.2 due to the production of alkali during denitrification
(Fig. 2a). The accumulation of nitrite remained at a low level in culti­
The cell density was measured by spectrophotometer at 600 nm.
vation of all four strains, with a maximum of only 3.79 mg/L for strain
Nitrate (NO3 -N), nitrite (NO2 -N), ammonium (NHþ 4 -N), hydroxylamine
JD-014 (Fig. 2c), while the ammonium contents increased to
(NH2OH) and total nitrogen (TN) were determined according to the
12.58–25.43 mg/L, accounting for 6.84–13.79% of the initial nitrogen
standard methods [33]. Intracellular nitrogen content was calculated by
for each strain (Fig. 2d).
subtracting the TN of the inoculated medium following centrifugation
(12,000 rpm, 10 min) from the TN of non-centrifuged medium [18]. The
3.2.2. Aerobic denitrification of Bacillus strains against nitrite
pH values were measured by pH meter (Seven Multi, Shanghai, China).
The results in Fig. 3 show that when sodium nitrite was used as the
N2 was measured by a gas chromatography (GC-14B, Shimadzu, Japan)
sole nitrogen source, the lag phase for the four Bacillus strains JD-005,
equipped with a thermal conductivity detector (TCD) and N2O was
JD-014, JD-016 and JD-017 lasted for approximately 2 days (Fig. 3a).
analyzed using a gas chromatography (6890 N, Agilent, USA) with an
No remarkable changes in cell density were found within the first 2 days,
electron capture detector (ECD). The nitrogen removal efficiency was
corresponding to the OD600 reached only 0.2. Subsequently, the bacte­
calculated by the equation: REð%Þ ¼ T1T1T2 � 100%, and the nitrogen rial biomass increased and reached a peak with the OD600 for each strain
was 0.570, 1.416, 1.582 and 0.940, respectively (Fig. 3a). The content of
Table 1 nitrite began to decrease, and the removal efficiency of nitrite reached
Primer sequences used for PCR analysis. 67.20%, 70.65%, 73.42% and 70.80%, respectively (Fig. 3b). Accord­
Primer Primer sequence (50 to 30 ) Amplicon size (bp) ingly, the maximum nitrite nitrogen removal rates were 0.83, 1.07, 0.67
27F AGAGTTTGATCCTGGCTCAG 1538 and 0.76 mg/L/h, respectively. Meanwhile, 19.13–28.37 mg/L
1492R TACGGTTACCTTGTTACGACTT ammonia nitrogen, accounting for 12.86–19.45% of the initial nitrogen,
nap-F GGGCCATGAA ATCTTTTGCC ACAC 2043 was produced more than that in the DM with the NO3 -N as the sole
nap-R TCATGCTTTT TCAATCTGTA CACGTCC nitrogen source, except for Bacillus strain JD-005 (Fig. 3d).
nor-F GGGCGCTGCGATGAAATTTAT 1917
nor-R GATAAAGGGCTATCCTATGC
nos-F ATGGCTGAATTCATATTAAATGC 1755 3.2.3. Ammonium removal characteristics of Bacillus strains
nos-R TCAGACAATCATATTGCCGTCTAT The results in Fig. 4 demonstrate that the four Bacillus strains JD-005,
RT-napA0-F1 TGCTGCGGGAAGACTTGTTT 139 JD-014, JD-016 and JD-017 exhibited the efficient ability to convert
RT-napA0-R1 TGAATGTAATGGTGCCAGTAGGAG
ammonium to other forms of nitrogen. The maximum removal rates of
RT-norD-F1 GTTGAGGACCTCATGGACGGA 116
RT-norD-R1 TCTTCAAATAACGGCTGTTCTGC ammonium were 0.86, 1.67, 0.70 and 0.71 mg/L/h, respectively
RT-nosD2-F1 TACGGAGAAAACGGAAGAAAGTATG 100 (Table 2). Among the four strains, Bacillus subtilis JD-014 grew the
RT-nosD2-R1 TTGTATGAGCAGTAACCGAACCAC fastest and the OD600 increased quickly to 1.05 at 1 d (Fig. 4a). The
RT-gyrB-F AAGCTGGGCAACTCAGAAGCACGG 138 intermediate NH2OH was hardly detected in the process of ammonium
RT-gyrB-R AGCCATTCTTGCTCTTGCCGCC
removal (Fig. 4b). There was also little NO3 -N accumulation, and only

3
T. Yang et al. Biomass and Bioenergy 140 (2020) 105677

Fig. 1. Phylogenetic tree constructed from 16S rRNA gene sequences of strains JD-005, JD-014, JD-016, JD-017 and comparative reference strains by the neighbor-
joining method. Bar, 0.01 denotes the genetic distance.

Fig. 2. Changes in various substances during fermentation when NO3 -N was the sole nitrogen source. (a) OD600 and pH, (b) NO3 -N, (c) NO2 -N, (d) NHþ
4 -N.

trace concentration of NO2 -N was detected during the entire process 3.2.4. Nitrogen removal characteristics in synthetic wastewater of Bacillus
(Fig. 4c–d). strains
A mixed nitrogen source (50 mg/L NHþ 4 -N and NO2 -N) was used in a

4
T. Yang et al. Biomass and Bioenergy 140 (2020) 105677

Table 2
Comparison of nitrification rates and denitrification rates of Bacillus strains.
Strains Initial nitrifier Nitrification Initial Denitrification Operation Culture Media References
concentration rate denitrifier rate conditions
Carbon Nitrogen source C/N
concentration
source ratio

B. cereus GS-5 100 mg/L NHþ

4- 2.65 mg/L/h 100 mg/L NO3 - 2.69 mg/L/h 100 mL sodium (NH4)2SO4 KNO3 7.5 Rout et al.
N N medium in acetate KNO2 (2017) [22]
50 mg/L NO2 -N 1.18 mg/L/h 250 mL flasks
125 rpm, 35 � C
for 36 h
B. subtilis BRAZ2B ─ ─ 60 mg/L NO3 -N 0.53 mg/L/h 250 mL flasks glucose KNO3 8 Hussain
120 rpm, 25 � C et al. (2011)
for 72 h [40]
B. litoralis N31 20 mg/L NHþ
4- 2.28 mg/L/h 20 mg/L NO3 -N 0.59 mg/L/h 100 mL sodium (NH4)2SO4 18 Huang et al.
N 20 mg/L NO2 -N 0.73 mg/L/h medium in succinate NaNO3 NaNO2 (2017) [17]
250 mL flasks
160 rpm, 28 � C
for 72 h
Bacillus sp. LY 42.5 mg/L 0.42 mg/L/h 20 mg/L NO3 -N 0.35 mg/L/h 100 mL glucose NH4Cl 15 Zhao et al.
NHþ4 -N 20 mg/L NO2 -N 0.44 mg/L/h medium in NaNO3 NaNO2 (2010) [41]
250 mL flasks
120 rpm, 30 � C
for 96 h
B. cereus X7 50 mg/L NHþ
4- 0.77 mg/L/h 50 mg/L NO3 -N 0.32 mg/L/h 300 mL sodium (NH4)2SO4 KNO3 16 Yao et al.
N 50 mg/L NO2 -N 0.40 mg/L/h medium succinate NaNO2 (2014) [42]
200 rpm, 30 � C
for 72 h
B. coagulans YX-6 ─ ─ 10 mg/L NO2 -N 0.71 mg/L/h 100 mL sodium NaNO2 14 Song et al.
medium succinate (2013) [38]
200 rpm, 30 � C
for 24 h
B. megaterium S379 ─ ─ 65 mg/L NO2 -N 0.50 mg/L/h 200 mL glucose NaNO2 20 Gao et al.
synthetic (2018) [22]
wastewater
(SW)
150 rpm, 30 � C
for 5 d
B. cereus PB88 ─ ─ 12 mg/L NO2 -N 0.25 mg/L/h 100 mL sodium NaNO2 14 Barman
medium in succinate et al. (2018)
250 mL flasks [43]
200 rpm, 30 � C
for 39 h
B. methylotrophicus 146.71 mg/L 2.15 mg/L/h 66 mg/L NO2 -N 0.24 mg/L/h 100 mL sodium (NH4)2SO4 KNO3 10 Zhang et al.
L7 NHþ4 -N medium in succinate NaNO2 (2012) [17]
250 mL flasks
160 r/min, 30
�
C for 5 d

B. pumilus JD-005 120 mg/L NHþ

4- 0.86 mg/L/h 180 mg/L NO3 - 0.89 mg/L/h 100 mL sodium (NH4)2SO4NaNO3 10 This study
N N medium in succinate NaNO2
110 mg/L NO2 - 0.83 mg/L/h 250 mL flasks
N 200 rpm, 37 � C
B. paralicheniformis 120 mg/L NHþ
4- 0.70 mg/L/h 180 mg/L NO3 - 1.03 mg/L/h for 5 d
JD-016 N N
110 mg/L NO2 - 0.67 mg/L/h
N
B. subtilis JD-014 120 mg/L NHþ
4- 1.67 mg/L/h 180 mg/L NO3 - 0.80 mg/L/h
N N
110 mg/L NO2 - 1.07 mg/L/h
N
B. subtilis JD-017 120 mg/L NHþ
4- 0.71 mg/L/h 180 mg/L NO3 - 0.62 mg/L/h
N N
110 mg/L NO2 - 0.76 mg/L/h
N

simulated 5 L sewage bioreactor to elucidate the aerobic nitrogen
removing of the four selected Bacillus strains in large-scale application.
The results in Fig. 5 demonstrate that JD-005 grew much slowly and the
OD600 reached a peak value of 2.05 at 72 h, while the biomass of the
other three strains gained the maximum at 28–36 h. For nitrogen
removal, the isolated strains JD-005, JD-016 and JD-017 preferred to
remove ammonium in the mixed N-source, while the strain JD-014
reduced the ammonium nitrogen and nitrite nitrogen nearly at the
same time. Moreover, the ammonium removal efficiency of the four
strains JD-005, JD-014, JD-016 and JD-017 were 73.15%, 69.81%,
69.69% and 77.73%, with the maximum ammonium removal rates were
0.87, 1.86, 2.07 and 1.35 mg/L/h, respectively, while the nitrite
removal efficiency were 74.71%, 99.97%, 99.97% and 56.75%, with the
maximum nitrite removal rates were 0.55, 1.89, 1.56 and 0.41 mg/L/h,
respectively. The results indicate that the strains can significantly alle­
viate the pollutant contents in wastewater with multiple nitrogen
coexistence.

5
T. Yang et al. Biomass and Bioenergy 140 (2020) 105677

Fig. 3. Changes in various substances during fermentation when NO2 -N was the sole nitrogen source. (a) OD600 and pH, (b) NO2 -N, (c) NO3 -N, (d) NHþ
4 -N.

Fig. 4. Changes in various substances during fermentation when NHþ

4 -N was the sole nitrogen source. (a) OD600 and pH, (b) NH4 -N and NH2OH, (c) NO3 -N, (d)
þ

NO2 -N.

3.3. Nitrogen balance analysis and gaseous nitrogen detection nitrogen removal process was calculated. As depicted in Table 3, by
comparing the initial and final N mass of Bacillus JD-014 in the reaction
To study the nitrogen transformation of JD-014, the gaseous nitrogen system, 13.72–22.60% of the initial nitrogen was changed to intracel­
in the headspace were monitored and the nitrogen balance during the lular N when NHþ4 -N, NO2 -N, or NO3 -N were used as the sole nitrogen

6
T. Yang et al. Biomass and Bioenergy 140 (2020) 105677

Fig. 5. Simultaneous nitrification and denitrification characteristics of the four isolated Bacillus strains with mix N-sources in a 5 L bioreactor system. (a) Strain JD-
005, (b) Strain JD-014, (c) Strain JD-016, (d) Strain JD-017.

source, and 25.97–43.14% was converted to gaseous denitrification

products. N2O, a greenhouse gaseous denitrification product, was pro­
duced in a very small proportion.

3.4. Effect of NO2 -N on the denitrification characteristics of JD-014

The effect of nitrite tolerance on cell growth and nitrogen removal

characteristics of the selected strain JD-014 is shown in Fig. 6. The re­
sults indicate that the growth of the strain JD-014 was not affected when
the initial NO2 -N concentration increased from 10 to 200 mg/L. The
higher the initial NO2 -N concentration, the greater bacterial biomass
was obtained. Nonetheless, when the initial NO2 -N concentration
increased to 300 mg/L, the growth of JD-014 was inhibited with the
maximum OD600 of 1.22. And when the concentration continued to rise,
the strain could not grow. The denitrification performance of JD-014
was gradually decreased with the increase of NO2 -N concentration.
The NO2 -N removal efficiency could proximately 100% at the nitrite
concentration of 10 mg/L, and still reached nearly 50–80% at 50–200 Fig. 6. Effect of initial NO2 –N concentration on the denitrification perfor­
mg/L NO2 -N, indicating that strain JD-014 exhibited high tolerance to mance of JD-014.
NO2 -N under aerobic condition.
conducted. The results in Fig. 7 show that fragments of 2040 bp of nap
3.5. Analysis of aerobic denitrification metabolic pathway of JD-014 (GenBank accession number MK140936), 1917 bp of nor (MK140937)
and 1755 bp of nos (MK140938) were amplified from strain JD-014.
To identify the aerobic denitrification pathway of Bacillus subtilis JD- Moreover, the activity of key enzyme nitrate reductase was detected
014, the amplification of the functional denitrification genes was in cell-free extracts and the specific enzyme activity was 1.50 � 0.36

Table 3
Nitrogen balance of the selected strain JD-014 (unit: mg/L).
N sources NHþ
4 -N NO3 -N NO2 -N Intracellular N N2O N2

NHþ
4 -N Initial 48.17 � 1.07 – – – – –
Final 15.83 � 2.42 0.71 � 0.03 0.01 � 0 10.89 � 2.68 0.0022 � 0.0002 20.78 � 3.53
NO¡
3 -N Initial 0.22 � 0.01 62.89 � 0.48 – – – –
Final 24.60 � 1.32 10.36 � 1.65 0.77 � 0.20 10.99 � 1.29 0.0049 � 0.0003 16.39 � 1.33
NO¡
2 -N Initial 0.92 � 0.08 16.28 � 0.10 56.12 � 0.73 – – –
Final 30.76 � 1.02 0.07 � 0 4.24 � 0.16 10.06 � 0.87 0.0002 � 0 29.31 � 1.74

“—” means undetectable.

7
T. Yang et al.
Fig. 7. PCR amplification results of functional genes from Bacillus JD-014. M:
DL10000 DNA Maker; lane 1: The PCR products of nap gene (2040 bp); lane 2:
The PCR products of nor gene (1917 bp); lane 3: The PCR products of nos gene
(1755 bp).
mU/mg protein, when the strain JD-014 was cultivated in DM for 60 h.
The transcriptional analysis of key genes involved in the denitrifi­
cation pathway of B. subtilis JD-014 was carried out by qRT-PCR
(Fig. 8a). With the rapidly degradation of nitrate (Fig. 8b), the expres­
sion level of nap gene decreased compared with that at the first day.
While expression of nor and nos gene significantly increased by 2.73 and
2.85 times at the 3rd day, respectively, which corresponded to the
exponential stage in growth curve of JD-014 (Fig. 8b).
To further investigate potential inducible mechanism of nitrogen
removing associated genes, the effect of initial nitrate concentration on
the removing of NO3 -N was evaluated under aerobic condition (Fig. 9).
As initial NO3 -N concentration increased from 10 to 300 mg/L, the
OD600 value gradually increased from 0.70 to 3.44, while the NO3 -N
removing also increased; The specific NO3 -N degradation per OD600 at
NO3 -N concentration 10, 50, 100, 200, and 300 mg/L was 22.95, 49.30,
49.82, 55.81 and 75.02 mg/L, respectively. These results indicate that
the gene expression in the denitrification should be inducibly controlled
and the expression level varied with the constant change of initial nitrate
concentration.
4. Discussion
Biomass is an emerging renewable source for production of bio­
energy all over the world to alleviate the energy crisis. However, along
Fig. 8. Relative expression levels of genes and denitrification characteristics of B. subtilis JD-014.
8
Biomass and Bioenergy 140 (2020) 105677
with the escalating scale of biomass crops cultivation, large water de­
mand and water quality destruction are two important factors affecting
environmental sustainability [1,4]. While in recent years, more atten­
tion has been paid to achieve the sustainable development of bioenergy,
the environmental aspects should also be taken into consideration [34].
Thus, it is of great significance to take the appropriate technologies to
improve waterbodies.
Water treatment in low- and middle-income countries is facing great
problems, such as high cost, the demand of special skills and profes­
sional equipment [35]. Biotechnology is the most common, efficient,
and cost-effective method in solving the problem of water pollution for
those countries, and the discovery of aerobic denitrifying bacteria opens
a new way for biological denitrogenation technology. The above pre­
sented denitrifying Bacillus strains with promising nitrogen removal
performance, which could be well applied to the purification of inten­
sive polluted water. The treatment of these strains could be achieved for
simple operation, low costs, eco-friendly and to some degree, it will not
put additional burden on the economy for the low- and middle-income
countries.
To understand the denitrification characteristics of the four selected
Bacillus strains, nitrate (NO3 -N) and nitrite (NO2 -N) were separately
used as the sole nitrogen source under aerobic culture conditions. The
accumulation of ammonium was observed during the degradation of
nitrate or nitrite, which might be attributed to the autolysis of some cells
during the later stage of fermentation, so that the intracellular ammo­
nium nitrogen could release into the medium. In addition, the organic
nitrogen of death cells could also convert to ammonium nitrogen.
Similar results were also reported in previous studies [17,36].
As is well-known, nitrite has a significant toxicity that is harmful to
aquatic animals, leading to a large variety of physiological disturbances
and immunosuppression [37,38]. When NO2 -N was used as the sole
nitrogen source, it took a long time for the four selected Bacillus strains
to adapt to such a stressful environment owing to the toxic effect of
nitrite on the cells. Due to the oxidization of NO2 -N, a certain amount of
NO3 -N (approximately 35 mg/L) was detected at the beginning, but
then it decreased because of the utilization by the strains. The same
phenomenon was also found in the study of Klebsiella sp. TN-10 [39],
which detected 15.43 mg/L NO3 -N when NO2 -N was added. Addition­
ally, it is reported that a high nitrite content strongly inhibited denitri­
fication activity and a nitrite concentration of 20 mg/L was the critical
value for bacterial denitrification [38]. The results of our study indicate
that the selected strain JD-014 exhibit strong nitrite toxicity tolerance
and have a good prospect in widely used in high-nitrite wastewater
treatment. The tolerance is much higher than that of another aerobic
denitrifier, Bacillus coagulans YX-6, which maintained highly effective
nitrite removing compared with other Bacillus strains [38]. It was re­
ported that the NO2 -N degradation efficiency of YX-6 could almost
reach 100% at the 20 mg/L initial concentration, and it declined grad­
ually to only 20% with the increase of NO2 -N concentration to 100
mg/L. While the nitrogen removal efficiency of JD-014 could be up to
T. Yang et al.
Fig. 9. The growth (a) and nitrate removal characteristics (b) of Bacillus. JD-014 under different initial NO3 -N concentrations.
approximately 50–80%, at 50–200 mg/L initial NO2 -N level.
The nitrogen removal rates of the isolated strains in this study were
compared with those reported for other Bacillus genera. We summarized
the relevant studies on nitrogen removal rates of Bacillus spp. in Table 2
and found that the nitrate removal rates of the isolated strains in this
study were lower than that of B. cereus GS-5 [22] with nitrate removal
rate of 2.69 mg/L/h, but higher than that of B. subtilis BRAZ2B (0.53
mg/L/h) [40], B. litoralis N31 (0.59 mg/L/h) [17], Bacillus sp. LY (0.35
mg/L/h) [41] and B. cereus X7 (0.32 mg/L/h) [42]. The nitrite removal
rates for each strain were comparable or even higher than those of the
functional Bacillus reported previously (Table 2), such as B. coagulans
YX-6 (0.71 mg/L/h) with initial nitrite 10 mg/L [38], B. cereus GS-5
(1.18 mg/L/h) with initial nitrite 50 mg/L [22], B. megaterium S379
(0.50 mg/L/h) with initial nitrite 65 mg/L [22], B. cereus PB88 (0.25
mg/L/h) with initial nitrite 12 mg/L [43], and Bacillus sp. LY (0.44
mg/L/h) with initial nitrite 20 mg/L [41].
When NHþ 4 -N was used as the sole nitrogen source under aerobic
culture conditions, the maximum nitrogen removal rates were
0.86,1.67, 0.70 and 0.71 mg/h/L for each strain, respectively, which
were higher than that of Bacillus sp. LY (0.42 mg/L/h) when the initial
ammonium was 42.5 mg/L [41] and Bacillus cereus X7 (0.77 mg/L/h)
when the initial ammonium was 50 mg/L [42]. NH2OH, one of the
significant intermediates in the process of ammonium removal, was
hardly detectable in the medium because of its instability and rapid
conversion to other downstream intermediates [44]. There was only
trace concentration of NO2 -N detected during the entire process. The
main reason may be that the processes of nitrification and denitrification
were in a balanced state, so that nitrite did not accumulate in the cul­
tures. This observation was consistent with previous studies on Bacillus
litoralis N31 [17], Klebsiella pneumoniae CF-S9 [45] and Acinetobacter sp.
Y16 [20].
To better understand of the nitrogen removal characteristics of the
selected strains, Bacillus subtilis JD-014, which showed the most efficient
heterotrophic nitrification and aerobic denitrification with nitrite
compared with the other Bacillus strains, was chosen to monitor the gas
nitrogen products and nitrogen balance was also calculated. N2 and N2O
were indeed detected in our closed system. Aboobakar et al. [46] re­
ported that the presence of oxygen can inhibit nitrous oxide reductase
during the denitrification process, leading to large amounts of N2O
generated as the end product instead of N2. While in our study, N2O, a
greenhouse gaseous denitrification product, was produced in a very
small proportion. Taken together, JD-014 indeed convert part of nitro­
gen compounds to gaseous products through aerobic denitrification
pathway and have great advantage in practical application of biological
nitrogen removal with negligible emission of nitrous oxide.
To further investigate the denitrification metabolic pathway of JD-
014, the denitrification functional genes were analyzed. Generally
speaking, the complete denitrification process is catalyzed by four
9
Biomass and Bioenergy 140 (2020) 105677
essential enzymes [47], including nitrate reductase (Nar or Nap), nitrite
reductase (Nir), nitric oxide reductase (Nor) and nitrous oxide reductase
(Nos). However, some isolated strains have exhibited nitrogen removal
abilities via an incomplete denitrification process, meaning that at least
one reductase-encoding gene cluster is missing [48,49]. NO3 -N is con­
verted to NO2 -N by the nitrate reductase Nar or Nap as the first step in
this pathway. Nar locates on the cytoplasmic membrane and is expressed
under anaerobic conditions, whereas Nap, which locates on the peri­
plasmic compartment, is insensitive to O2 and the presence of Nap would
be responsible for the aerobic conversion of nitrate to nitrite [50]. In our
study, the functional nap gene was amplified successfully in Bacillus
JD-014 and the nitrate reductase was also successfully expressed in the
cell free extracts.
For the reaction NO2 -N to NO, catalyzed by nitrite reductase. Ac­
cording to the different structures and catalytic sites, the nitrite reduc­
tase can be divided into a copper type enzyme and a cytochrome cd1-
type enzyme expressed by nirK and nirS, respectively. These two types of
nitrite reductase usually cannot present simultaneously in the same
strain [51]. Unfortunately, both the nirK and nirS were not amplified.
Recently, some new findings have demonstrated that it is insufficient to
gauge denitrification potential, or to predict the production of gaseous
nitrogen, just through the monitor of the nirK and nirS genes. Onley et al.
[52] reported that a common soil bacterium Anaeromyxobacter dehalo­
genans lacked the key denitrification genes nirS and nirK, but still
exhibited nitrogen removal ability with the help of iron. Mauffrey et al.
[49] isolated a methylotrophic marine bacterium JAM1 from a deni­
trification reactor, which was identified as Methylophaga nitratir­
educenticrescens. It could still produce nitrogenous gases such as NO and
N2O under anaerobic conditions, despite the absence of the genes nirS
and nirK. There may exist a new type of nitrite reductase in strain
JD-014, which needs in depth study.
In addition, the expression levels of these key genes involved in the
denitrification pathway of B. subtilis JD-014 were investigated under
different fermentation phases and a similar trend was achieved by
Pseudomonas sp. JQ-H3 [53], showing that high expression levels of nor
and nos could ensure sufficient production of NO or N2O reductase to
maintain low levels of NO and facilitate the reduction of N2O to N2.
Thus, these results provide additional evidence that the nitrogen
removal pathway of the isolated B. subtilis JD-014 was activated through
aerobic denitrification.
5. Conclusions
In order for biomass to be a better alternative to conventional fuels,
negative environmental impacts on water quality and the resulting
economic costs from the biomass production should be reduced as much
as possible. Aerobic denitrification is considered as one of the most
efficient, and cost-effective biotechnologies to improve waterbodies. In
T. Yang et al.
this study, four aerobic Bacillus denitrifying strains were isolated and
characterized. All the selected strains presented great capabilities to
reduce nitrate, nitrite and ammonium under aerobic conditions. It was
found that strain JD-014 exhibited the most efficient aerobic denitrifi­
cation, with little greenhouse gas nitrous oxide emission. Moreover, JD-
014 performed strong resistance to high toxic concentration of nitrite,
the removal efficiency could still up to approximately 50% at an initial
NO2 -N concentration of 200 mg/L, suggesting a great potential for
practical application to treat high-nitrite wastewater. This paper pre­
sented a promising candidate for bioremediation of polluted water­
bodies that may be caused by large-scale cultivation of biomass crops,
which may further promote the sustainable development of bioenergy.
Declaration of competing interest
None.
Acknowledgements
This research was supported by the National Key Research and
Development Program of China (2018YFA0900304), Natural Science
Foundation of Jiangsu Province (BE2018055), Fishery Science and
Technology Projects in Jiangsu Province (Y2018-26) and Wuxi Science
and Technology Project (CLE02N1713).
References
[1] M. Yaseen, F. Abbas, M.B. Shakoor, A.A. Farooque, M. Rizwan, Biomass for
renewable energy production in Pakistan: current state and prospects, Arab. J.
Geosci. 13 (2) (2020).
[2] Z. Qin, Q. Zhuang, X. Cai, Y. He, Y. Huang, D. Jiang, E. Lin, Y. Liu, Y. Tang, M.
Q. Wang, Biomass and biofuels in China: toward bioenergy resource potentials and
their impacts on the environment, Renew. Sust. Energ. Rev. 82 (2018) 2387–2400.
[3] J.Z. Zhu, K. Cheung, Summary of environment impact of renewable energy
resources, Adv. Mat. Res. (2012) 1133–1136.
[4] M. Wu, Z. Zhang, Y.-w. Chiu, Life-cycle water quantity and water quality
implications of biofuels, Curr. Sust. Renewable Energ. Rep. 1 (1) (2014) 3–10.
[5] M. Lee, Y.L. Lin, P.-T. Chiueh, W. Den, Environmental and energy assessment of
biomass residues to biochar as fuel: a brief review with recommendations for future
bioenergy systems, J. Clean. Prod. 251 (2020), 119714.
[6] A.L. Casteli Figueiredo Gallardo, A. Bond, Investigating the effectiveness of
environmental assessment of land use change: a comparative study of the
approaches taken to perennial biomass crop planting in S~ ao Paulo and England,
Biomass Bioenergy 35 (5) (2011) 2285–2297.
[7] N.I.H.A. Aziz, M.M. Hanafiah, S.H. Gheewala, A review on life cycle assessment of
biogas production: challenges and future perspectives in Malaysia, Biomass
Bioenergy 122 (2019) 361–374.
[8] B. Phalan, The social and environmental impacts of biofuels in Asia: an overview,
Appl. Energy 86 (2009) S21–S29.
[9] J. Ruane, A. Sonnino, A. Agostini, Bioenergy and the potential contribution of
agricultural biotechnologies in developing countries, Biomass Bioenergy 34 (10)
(2010) 1427–1439.
[10] B.J. Love, A.P. Nejadhashemi, Water quality impact assessment of large-scale
biofuel crops expansion in agricultural regions of Michigan, Biomass Bioenergy 35
(5) (2011) 2200–2216.
[11] N. Adusumilli, T. Lee, M. Rister, R. Lacewell, The economics of mitigation of water
pollution externalities from biomass production for energy, Resour. 3 (4) (2014)
721–733.
[12] B. Lattimore, C.T. Smith, B.D. Titus, I. Stupak, G. Egnell, Environmental factors in
woodfuel production: opportunities, risks, and criteria and indicators for
sustainable practices, Biomass Bioenergy 33 (10) (2009) 1321–1342.
[13] R. Slade, A. Bauen, Micro-algae cultivation for biofuels: cost, energy balance,
environmental impacts and future prospects, Biomass Bioenergy 53 (2013) 29–38.
[14] J. Chen, S. Gu, H. Hao, J. Chen, Characteristics and metabolic pathway of
Alcaligenes sp. TB for simultaneous heterotrophic nitrification-aerobic
denitrification, Appl. Microbiol. Biotechnol. 100 (22) (2016) 9787–9794.
[15] Z. He, Y. Feng, S. Zhang, X. Wang, S. Wu, X. Pan, Oxygenic denitrification for
nitrogen removal with less greenhouse gas emissions: microbiology and potential
applications, Sci. Total Environ. 621 (2018) 453–464.
[16] R.R. Pal, A.A. Khardenavis, H.J. Purohit, Identification and monitoring of
nitrification and denitrification genes in Klebsiella pneumoniae EG1, Funct. Integr.
Genom. 15 (2015) 63–76.
[17] F. Huang, L. Pan, N. Lv, X. Tang, Characterization of novel Bacillus strain N31 from
mariculture water capable of halophilic heterotrophic nitrification-aerobic
denitrification, J. Biosci. Bioeng. 124 (5) (2017) 564–571.
[18] L. Yang, Y.X. Ren, X. Liang, S.Q. Zhao, J.P. Wang, Z.H. Xia, Nitrogen removal
characteristics of a heterotrophic nitrifier Acinetobacter junii YB and its potential
10
Biomass and Bioenergy 140 (2020) 105677
application for the treatment of high-strength nitrogenous wastewater, Bioresour.
Technol. 193 (2015) 227–233.
[19] P. Chen, J. Li, Q.X. Li, Y. Wang, S. Li, T. Ren, L. Wang, Simultaneous heterotrophic
nitrification and aerobic denitrification by bacterium Rhodococcus sp. CPZ24,
Bioresour. Technol. 116 (2012) 266–270.
[20] X. Huang, W. Li, D. Zhang, W. Qin, Ammonium removal by a novel oligotrophic
Acinetobacter sp. Y16 capable of heterotrophic nitrification-aerobic denitrification
at low temperature, Bioresour. Technol. 146 (2013) 44–50.
[21] Q. Liang, X. Zhang, K.H. Lee, Y. Wang, K. Yu, W. Shen, L. Fu, M. Shu, W. Li,
Nitrogen removal and water microbiota in grass carp culture following
supplementation with Bacillus licheniformis BSK-4, World J. Microbiol. Biotechnol.
31 (11) (2015) 1711–1718.
[22] P.R. Rout, P. Bhunia, R.R. Dash, Simultaneous removal of nitrogen and
phosphorous from domestic wastewater using Bacillus cereus GS-5 strain exhibiting
heterotrophic nitrification, aerobic denitrification and denitrifying phosphorous
removal, Bioresour. Technol. 244 (2017) 484–495.
[23] X.P. Yang, S.-M. Wang, D.W. Zhang, L.X. Zhou, Isolation and nitrogen removal
characteristics of an aerobic heterotrophic nitrifying-denitrifying bacterium,
Bacullus subtilis A1, Bioresour. Technol. 102 (2011) 854–862.
[24] B. Zhao, D.Y. Cheng, P. Tan, Q. An, J.S. Guo, Characterization of an aerobic
denitrifier Pseudomonas stutzeri strain XL-2 to achieve efficient nitrate removal,
Bioresour. Technol. 250 (2018) 564–573.
[25] Z. Shi, Y. Zhang, J. Zhou, M. Chen, X. Wang, Biological removal of nitrate and
ammonium under aerobic atmosphere by Paracoccus versutus LYM, Bioresour.
Technol. 148 (2013) 144–148.
[26] J. Gao, D. Gao, H. Liu, J. Cai, J. Zhang, Z. Qi, Biopotentiality of high efficient
aerobic denitrifier Bacillus megaterium S379 for intensive aquaculture water quality
management, J. Environ. Manag. 222 (2018) 104–111.
[27] H.A. Hong, H. Duc le, S.M. Cutting, The use of bacterial spore formers as probiotics,
FEMS Microbiol. Rev. 29 (4) (2005) 813–835.
[28] S. Ziaei-Nejad, M.H. Rezaei, G.A. Takami, D.L. Lovett, A.R. Mirvaghefi,
M. Shakouri, The effect of Bacillus spp. bacteria used as probiotics on digestive
enzyme activity, survival and growth in the Indian white shrimp Fenneropenaeus
indicus, Aquaculture 252 (2–4) (2006) 516–524.
[29] B. Kamlage, Methods for general and molecular bacteriology, 1994., Food/
Nahrung, in: P. Gerhardt, R.G.E. Murray, W.A. Wood, N.R. Krieg (Eds.), 791 Pages,
Numerous Figures and Tables vol. 40, American Society for Microbiology,
Washington, D.C., 1996, 2, 103.
[30] B. Zhao, Y.L. He, J. Hughes, X.F. Zhang, Heterotrophic nitrogen removal by a
newly isolated Acinetobacter calcoaceticus HNR, Bioresour. Technol. 101 (14)
(2010) 5194–5200.
[31] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods 25 (4) (2001)
402–408.
[32] N. Vinayavekhin, M. Mahipant, A.S. Vangnai, P. Sangvanich, Untargeted
metabolomics analysis revealed changes in the composition of glycerolipids and
phospholipids in Bacillus subtilis under 1-butanol stress, Appl. Microbiol.
Biotechnol. 99 (14) (2015) 5971–5983.
[33] Apha, Awwa, Wef, Standard Methods for the Examination of Water and
Wastewater, twentieth ed., American Public Health Association, Washington, DC,
1998.
[34] A. Padilla-Rivera, M.G. Paredes, L.P. Güereca, A systematic review of the
sustainability assessment of bioenergy: the case of gaseous biofuels, Biomass
Bioenergy 125 (2019) 79–94.
[35] J. Ruane, A. Sonnino, P. Steduto, C. Deane, Coping with Water Scarcity: what Role
for Biotechnologies, Springer Netherlands, 2008.
[36] T. He, Z. Li, Q. Sun, Y. Xu, Q. Ye, Heterotrophic nitrification and aerobic
denitrification by Pseudomonas tolaasii Y-11 without nitrite accumulation during
nitrogen conversion, Bioresour. Technol. 200 (2016) 493–499.
[37] J.A. Camargo, A. Alonso, Ecological and toxicological effects of inorganic nitrogen
pollution in aquatic ecosystems: a global assessment, Environ. Int. 32 (6) (2006)
831–849.
[38] Z.F. Song, J. An, G.H. Fu, X.L. Yang, Isolation and characterization of an aerobic
denitrifying Bacillus sp. YX-6 from shrimp culture ponds, Aquaculture 319 (1–2)
(2011) 188–193.
[39] D. Li, X. Liang, Y. Jin, C. Wu, R. Zhou, Isolation and nitrogen removal
characteristics of an aerobic heterotrophic nitrifying-denitrifying bacterium,
Klebsiella sp. TN-10, Appl. Biochem. Biotechnol. 188 (2) (2019) 540–554.
[40] S.A. Hussain, S.O. Prasher, M. Chenier, G. Arya, Removal of nitrate-N by antibiotic
exposed bacterial isolates from constructed wetlands, World J. Microbiol.
Biotechnol. 27 (9) (2011) 2061–2069.
[41] B. Zhao, Y.L. He, X.F. Zhang, Nitrogen removal capability through simultaneous
heterotrophic nitrification and aerobic denitrification by Bacillus sp. LY, Environ.
Technol. 31 (4) (2010) 409–416.
[42] R.L. Yao, L.N. Qiu, W.W. Zhang, A.J. Gong, Z.Y. Wang, H. Cai, Isolation and
characteristics of heterotrophic nitrification-aerobic denitrification bacterium,
Bacillus cereus X7 at high salinity, Adv. Mat. Res. 864–867 (2013) 111–114.
[43] P. Barman, P. Bandyopadhyay, A. Kati, T. Paul, A.K. Mandal, K.C. Mondal, P.K.
D. Mohapatra, Characterization and strain improvement of aerobic denitrifying
EPS producing bacterium Bacillus cereus PB88 for shrimp water quality
management, Waste Biomass Valorization 9 (8) (2017) 1319–1330.
[44] Q.L. Zhang, Y. Liu, G.M. Ai, L.L. Miao, H.Y. Zheng, Z.P. Liu, The characteristics of a
novel heterotrophic nitrification-aerobic denitrification bacterium, Bacillus
methylotrophicus strain L7, Bioresour. Technol. 108 (2012) 35–44.
[45] S.K. Padhi, S. Tripathy, R. Sen, A.S. Mahapatra, S. Mohanty, N.K. Maiti,
Characterisation of heterotrophic nitrifying and aerobic denitrifying Klebsiella
T. Yang et al.
pneumoniae CF-S9 strain for bioremediation of wastewater, Int. Biodeterior.
Biodegradation 78 (2013) 67–73.
[46] A. Aboobakar, E. Cartmell, T. Stephenson, M. Jones, P. Vale, G. Dotro, Nitrous
oxide emissions and dissolved oxygen profiling in a full-scale nitrifying activated
sludge treatment plant, Water Res. 47 (2) (2013) 524–534.
[47] S. Wongkiew, Z. Hu, K. Chandran, J.W. Lee, S.K. Khanal, Nitrogen transformations
in aquaponic systems: a review, Aquacult. Eng. 76 (2017) 9–19.
[48] B. Kraft, M. Strous, H.E. Tegetmeyer, Microbial nitrate respiration – genes,
enzymes and environmental distribution, J. Biotechnol. 155 (1) (2011) 104–117.
[49] F. Mauffrey, A. Cucaita, P. Constant, R. Villemur, Denitrifying metabolism of the
methylotrophic marine bacterium Methylophaga nitratireducenticrescens strain
JAM1, PeerJ 5 (2017), e4098.
11
Biomass and Bioenergy 140 (2020) 105677
[50] B. Ji, K. Yang, L. Zhu, Y. Jiang, H. Wang, J. Zhou, H. Zhang, Aerobic
denitrification: a review of important advances of the last 30 years, Biotechnol.
Bioprocess Eng. 20 (4) (2015) 643–651.
[51] D.J. Levy-Booth, C.E. Prescott, S.J. Grayston, Microbial functional genes involved
in nitrogen fixation, nitrification and denitrification in forest ecosystems, Soil Biol.
Biochem. 75 (2014) 11–25.
[52] J.R. Onley, S. Ahsan, R.A. Sanford, F.E. Loffler, Denitrification by
anaeromyxobacter dehalogenans, a common soil bacterium lacking nitrite
reductase genes (nirS/nirK), Appl. Environ. Microbiol. 84 (4) (2017) e01985–17.
[53] X. Wang, W. Wang, Y. Zhang, Z. Sun, J. Zhang, G. Chen, J. Li, Simultaneous
nitrification and denitrification by a novel isolated Pseudomonas sp. JQ-H3 using
polycaprolactone as carbon source, Bioresour. Technol. 288 (2019), 121506.