Author's Proof

Author’s Proof
Carefully read the entire proof and mark all corrections in the appropriate place, using the Adobe Reader commenting tools (Adobe Help). Do
not forget to reply to the queries.
We do not accept corrections in the form of edited manuscripts.
In order to ensure the timely publication of your article, please submit the corrections within 48 hours.
If you have any questions, please contact microbiology.production.office@frontiersin.org.
Author Queries Form
Q1 The citation and surnames of all of the authors have been highlighted.
Please check all of the names carefully and indicate if any are
incorrect. Please note that this may affect the indexing of your article
in repositories such as PubMed.
Q2 Confirm that the email address in your correspondence section is

accurate.
Q3 Please ask the following authors to register with Frontiers (at https://
www.frontiersin.org/Registration/Register.aspx) if they would like their
names on the article abstract page and PDF to be linked to a
Frontiers profile. Please ensure to provide us with the profile link(s)
when submitting the proof corrections. Non-registered authors will
have the default profile image displayed.
“Rosario Cerrato”
“Joaquin Rey”
“Pedro Fernandez-Llario”
Q4 If you decide to use previously published, copyrighted figures in your

article, please keep in mind that it is your responsibility, as the author,
to obtain the appropriate permissions and licenses and to follow any
citation instructions requested by third-party rights holders. If
obtaining the reproduction rights involves the payment of a fee, these
charges are to be paid by the authors.
Q5 Ensure that all the figures, tables and captions are correct.
Q6 Verify that all the equations and special characters are displayed
correctly.
Q7 Ensure to add all grant numbers and funding information, as after

publication this is no longer possible.
Q8 Ensure, if it applies to your study, the ethics statement is included in

the article.
Q9 Please ensure that any supplementary material is correctly published
at this link: https://www.frontiersin.org/articles/10.3389/
fmicb.2019.01663/full#supplementary-material. Please provide new
files if you have any corrections. Note that ALL supplementary files
will be deposited to FigShare and receive a DOI. Notify us of any
previously deposited material.
Q10 Could you please confirm if all author affiliations are fine as listed?
Q11 Please provide department names for Affiliations 1–3.
Q12 Please cite “Table 4” inside the text.
Q13 We have split the “Acknowledgments” section to “Acknowledgments”

and “Funding” as per style. Please confirm.
Q14 Reference “Marranzino et al. (2012)” was not cited anywhere in the
text. Please provide a citation. Alternatively, delete the item from the
list.
Q15 Please provide article ID for “Aktas et al., 2015; Golneshin et al.,
2015; Han et al., 2016; Hevia et al., 2015; Leonard et al., 2014;
Mackenzie et al., 2014; Stefanovic et al., 2016.”
Q16 Please provide DOI for the following references: “Ayele et al., 2004,
Sosunov et al., 2007.”
Q17 Please provide the publisher location for “Liu et al., 2014.”
Q18 Please provide volume number and page range for “Martens et al.,
2018.”
Q19 Please provide the volume number for reference “Xiao et al., 2016.”
Q20 Please provide high resolution Figure files for all the Figures. Please
make sure to use the original/source files when generating the new
figures.
ORIGINAL RESEARCH
published: xx July 2019
doi: 10.3389/fmicb.2019.01663
1 58
2 59
3 60
4 61
5 62
6 63
7 64
8 65
9 66
10 67
11 68
12 69
13 70
14 71
15 72
16
17
Lactobacilli Isolated From Wild 73
74
18
19
Boar (Sus scrofa) Antagonize 75
76
Mycobacterium bovis Bacille

Edited by:
20 77
M. Pilar Francino,
21 78
Calmette-Guerin (BCG) in a
Fundación para el Fomento de la
22 Investigación Sanitaria y Biomédica 79
23 de la Comunitat Valenciana 80
24
25
(FISABIO), Spain
Reviewed by:
Species-Dependent Manner 81
82
26 Maria Laura Boschiroli, 83
Maria Bravo1,2†, Theo Combes 3†, Fernando Martinez-Estrada 3, Rosario Cerrato1, Q1
National Agency for Sanitary Safety 84
27
of Food, Environment and Labor Joaquín Rey 2, Waldo Garcia-Jimenez1, Pedro Fernandez-Llario1, David Risco1 and Q3
28 85
(ANSES), France Jorge Gutierrez-Merino3*
29 86
Iñaki Comas,
30 Center for Public Health 1
Innovación en Gestión y Conservación de Ungulados SL, Cáceres, Spain, Facultad de Veterinaria, Universidad de
2 87
Q10
31 Research - FISABIO Extremadura, Cáceres, Spain, 3School of Biosciences and Medicine, University of Surrey, Guildford, United Kingdom 88 Q11
32 Anita Luise Michel, 89
33 University of Pretoria, South Africa 90
Background: Wildlife poses a significant burden for the complete eradication of bovine
Q2 34 *Correspondence: 91
35 Jorge Gutierrez-Merino tuberculosis (bTB). In particular, wild boar (Sus scrofa) is one of the most important 92
36 j.gutierrez@surrey.ac.uk reservoirs of Mycobacterium bovis, the causal agent of bTB. Wild boar can display from 93
37 †
These authors have contributed mild TB lesions, usually found in head lymph nodes, to generalized TB lesions distributed 94
38 equally to this work 95
in different anatomical regions; but rarely clinical signs, which complicates the diagnosis
39 96
40 Specialty section: of Mycobacterium bovis infection and bTB control. Among the possibilities for this variability 97
41
This article was submitted to in lesion distribution is the influence of the host-beneficial commensal-primed immune 98
Microbial Symbioses,
42
a section of the journal
barrier. In this respect, beneficial microbes may delay bTB dissemination as a consequence 99
43 Frontiers in Microbiology of an antagonistic competition for nutrients and phagocytes. In order to explore this 100
44 101
Received: 22 December 2018 possibility, we have tested whether typical commensals such as lactobacilli have the
45 102
Accepted: 04 July 2019
46
capacity to reduce the survival rate of the surrogate M. bovis strain Bacillus Calmette- 103
Published: xx July 2019
47 Guerin (BCG); and to modulate its phagocyte intake. 104
Citation:
48 105
Bravo M, Combes T, Results: Three Lactobacillus species, L. casei, L. plantarum, and L. salivarius, isolated
49 Martinez-Estrada F, Cerrato R, Rey J, 106
50 Garcia-Jimenez W, Fernandez-Llario P,
from wild boar feces displayed a pH-dependent inhibitory activity against BCG and 107
51 Risco D and Gutierrez-Merino J influenced its intake by porcine blood phagocytes in a species-dependent manner. All 108
(2019) Lactobacilli Isolated From
52 lactobacilli showed a very significant bactericidal effect against BCG at low pH, but 109
Wild Boar (Sus scrofa) Antagonize
53 110
Mycobacterium bovis Bacille only isolates of L. plantarum and L. casei displayed such antimycobacterial activity at
54 111
55
Calmette-Guerin (BCG) in a neutral pH. The genomes of these isolates revealed the presence of two-peptide 112
Species-Dependent Manner.
56 Front. Microbiol. 10:1663.
bacteriocins whose precursor genes up-regulate in the presence of BCG cells. 113
57 doi: 10.3389/fmicb.2019.01663 Furthermore, L. plantarum reduced significantly the BCG phagocytic intake, whereas 114
Frontiers in Microbiology | www.frontiersin.org 1 July 2019 | Volume 10 | Article 1663

Bravo et al. Commensal Bacteria as TB Antagonists
115 L. casei had the opposite effect. L. salivarius had no significant influence on the 172
116 phagocytic response to BCG. 173
117 174
118 Conclusions: Our in vitro results show that lactobacilli isolated from wild boar antagonize 175
119 BCG as a consequence of their antimycobacterial activity and a competitive phagocytic 176
120 response. These findings suggest that commensal bacteria could play a beneficial role in 177
121 178
influencing the outcome of bTB dissemination. Further work with lactobacilli as a potential
122 179
123
competitive pressure to control bTB will need to take into account the complex nature of 180
124 the commensal microbiome, the specific immunity of the wild boar and the in vivo infection 181
125 context with pathogenic strains of M. bovis. 182
126 183
127 Keywords: antagonism, Bacillus Calmette-Guerin, bovine tuberculosis, lactobacilli, Mycobacterium bovis, 184
probiotics, wild boar
128 185
129 186
130 187
131 INTRODUCTION The absence of clinical symptoms in wild boar with generalized 188
132 bTB, which usually shed a large amount of M. bovis cells to 189
Q6 133 Bovine tuberculosis (bTB) is a chronic infectious disease caused the environment (Santos et al., 2015), and the fact that bTB-like 190
134 by Mycobacterium bovis that affects livestock production, leading lesions are present in more than one anatomical region, complicate 191
135 to significant economic losses worldwide (Ayele et al., 2004; diagnosis, the understanding of the infection route, and, 192
136 Naranjo et al., 2008). Despite decades-long eradication campaigns subsequently, disease control. It is assumed that M. bovis enters 193
137 bTB is still very prevalent in some European countries including through the oral mucosa and tonsils via food, water or air 194
138 Spain, where wildlife reservoirs of Mycobacterium bovis have borne, and disseminate from the mandibular lymph nodes 195
139 been confirmed (Corner, 2006; Naranjo et al., 2008). Wild (Martin-Hernando et al., 2007; Menin et al., 2013; Matos et al., 196
140 ungulates such as the European wild boar (Sus scrofa) have 2016). However, the variable distribution of lesions suggests 197
141 been reported to show a high bTB prevalence across Spain that; first, it is not possible to elucidate whether the respiratory 198
142 (Parra et al., 2006). In this respect, the scientific evidence or the digestive route is more relevant for bTB infection in 199
143 suggests that the cases of bTB infection occur more frequently wild boar; and, second, the immune response of each individual 200
144 in regions with higher densities of wild boar (Aranaz et al., may have an influence on the outcome of the disease. Although 201
145 2004). Therefore, wild boar seems to be an additional obstacle the reasons for this variability in lesion distribution have not 202
146 for complete bTB eradication in Spain. been accounted for conclusively, one explanation could be due 203
147 Together with epidemiological and ecological studies, a to the contribution of the wild boar genetic variability (Acevedo- 204
148 better knowledge on the pathology and transmission of Whitehouse et al., 2005). Another possibility that has not been 205
149 M. bovis infection is essential to determine the significant explored before is the influence of the host-beneficial commensal- 206
150 role of wildlife as a bTB reservoir. Like any other species primed immune barrier. 207
151 of the Mycobacterium tuberculosis complex, M. bovis cells are Pathogenic mycobacteria have evolved to evade host defenses 208
152 initially phagocytized by macrophages, where they are able in order to reach and exploit its replicative niche. However, 209
153 to survive, replicate and disseminate into different anatomical this evasion may be unsuccessful if host commensal bacteria 210
154 parts of the body (Cosma et al., 2004). When the macrophages exert an extra immune-competitive pressure (Cambier et al., 211
155 transport the bacteria into deeper tissues, additional 2014). The host-commensal alliance forms a barrier that 212
156 macrophages gather around the individual infected foci to pathogens such as M. bovis must circumvent to survive and 213
157 form granulomas, which are organized immune complexes replicate. Commensal bacteria populate abundantly the mucosal 214
158 of differentiated macrophages, lymphocytes, and neutrophils. surfaces of pigs and are composed of different species that 215
159 Neutrophils are also present at early stages of the infection. predominantly belong to two dominant bacterial phyla: firmicutes 216
160 Despite the formation of granulomas in response to M. bovis and bacteroidetes (Xiao et al., 2016). In particular, one of the 217
161 infection, bacterial persistence and reinfection occur, but with most abundant beneficial groups within firmicutes is the genus 218
162 no clear symptoms, which is the central paradox of bTB Lactobacillus (Mann et al., 2014). Lactobacilli are normal 219
163 immunity (Cosma et al., 2003). Some studies have revealed inhabitants of the intestinal tract of humans and mammals 220
164 that a significant number of animals within a M. bovis- but also of the tonsillar crypts, nasopharynx, and upper 221
165 infected cattle group display no clinical signs, but present respiratory tract, among others (Martens et al., 2018). Several 222
166 generalized bTB lesions at post-mortem examination (Menin species of Lactobacillus modulate immune responses as they 223
167 et al., 2013). In this respect, wild boars are likely to be no interact regularly with epithelial cells and antigen-presenting 224
168 different. Very recently, generalized bTB has been reported cells such as macrophages (Mohamadzadeh et al., 2005; Rocha- 225
169 in wild boar, including cases with thoracic and abdominal Ramirez et al., 2017). The specific mechanisms of such immune 226
170 lesions, usually in the bronchial and mesenteric lymph nodes modulations are unknown but it has been demonstrated that 227
171 (Martin-Hernando et al., 2007; Matos et al., 2016). components of the cell wall and membrane of lactobacilli, 228

229 such as pili (fimbriae), peptidoglycans, lipoteichoic acids, and These three states are surrounded by areas with a significant 286
230 exopolysaccharides play an important role in activating phagocytic clinical history of bTB. In all cases, the fecal samples were 287
231 innate immune cells (Hevia et al., 2015). taken using rectal swabs with AMIES transport medium 288
232 The functional involvement of lactobacilli in the modulation (Deltalab) and stored at 4°C for a maximum of 1–2 days 289
233 of immune responses is critical to maintain homeostasis, until further processing. The collected rectal swabs were immersed 290
234 particularly in the gut (Diep et al., 2009; Gueimonde et al., 2013; in sterile peptone water (Oxoid) to prepare serial dilutions 291
235 Liu et al., 2014). Furthermore, Lactobacillus spp. are also essential that were spread onto De Man, Rogosa, and Sharpe (MRS) 292
236 to support a beneficial microbial balance in the host as they agar plates for the isolation of Lactobacillus spp. Plates were 293
237 prevent against colonization of opportunistic pathogens (Martin incubated under microaerophilic conditions at 37°C for 48–60 h 294
238 et al., 2013). It is very well documented that lactobacilli produce and 50 colonies showing different morphologies (where possible) 295
239 antimicrobial metabolites such as organic acids, hydrogen peroxide, were then selected of each sample from plates containing 20–100 296
240 ethanol, and bacteriocins to compete for nutrients (Pessione, colonies. Individual colonies were inoculated to Thermo 297
241 2012); and some of these compounds can be active against M. Scientific™ Nunc™ MicroWell™ 96-well plates with MRS broth 298
242 bovis (Stedman et al., 2018). In particular, bacteriocins produced at 37°C for 48 h under microaerophilic conditions. 299
243 by Lactobacillus spp. have been reported to display antimicrobial 300
244 activity against M. tuberculosis (Todorov et al., 2008, 2014). Antimycobacterial Screening and 301
Bacteriocins are antimicrobial peptides that can be classified
245
Identification of Lactobacilli Isolates 302
246 into three different classes depending on their chemical structure 303
Isolates propagated in MRS broth were tested against
247 and size: (1) class I, post-translationally modified peptides (e.g. 304
Mycobacterium smegmatis mc2155, a non-pathogenic fast-growing
248 nisin); (2) class II, unmodified peptides smaller than 10 kDa, 305
mycobacteria species that facilitates rapid antimycobacterial
249 including the pediocin-like (class IIa); the two peptide- (class 306
screening (Stedman et al., 2018). The MRS cultures present
IIb); the leaderless (class IIc); and the single peptide-(class IId)
in the 96-well plates were replica plated with a Scienceware®
250 307
251 bacteriocins; and (3) class III, unmodified peptides larger than 308
96-well replicator (Sigma-Aldrich) onto Tryptone Soya Agar
252 10 kDa with bacteriolytic (bacteriolysins) or non-lytic mechanism 309
(TSA, Oxoid) plates that had previously been swabbed with
253 of action (Alvarez-Sieiro et al., 2016). Furthermore, it has been 310
a culture of M. smegmatis mc2155 (Supplementary Figure S1).
254 reported that bacteriocins from lactobacilli contribute to 311
M. smegmatis was cultured in Tryptone Soya Broth (TSB,
255 immunomodulatory effects on peripheral blood mononuclear 312
Oxoid) supplemented with 0.05% of Tween 80 (Sigma) in an
256 cells and dendritic cells (Hegarty et al., 2016). 313
orbital shaker at 37°C for 48 h. The TSA plates were then
257 The fact that M. bovis may encounter lactobacilli in the 314
incubated at 37°C for 48 h and the cultures displaying
258 gut or respiratory tract of the host while exploiting macrophages 315
antimycobacterial activity selected for colony isolation on MRS
259 as its optimal niche for survival and replication and the evidence 316
agar plates following an incubation of 48 h at 37°C. Colonies
260 that lactobacilli are able to interact with macrophages and 317
were identified using gram-staining (positive rods), oxidase/
261 display antimycobacterial activity, suggest that lactobacilli could 318
catalase tests (negative) and 16S rRNA sequencing (LGC
262 act as a key beneficial microbe against bTB dissemination as 319
Genomics) before a final selection of the most representative
263 a consequence of an antagonistic competition for nutrients 320
lactobacilli isolates comprising different strains and species
264 and macrophages. The aim of this study was to determine 321
from different animals belonging to different estates.
265 whether Lactobacillus spp. isolated from wild boar are capable 322
266 of displaying this antagonistic role against the surrogate 323
267 M. bovis strain Bacillus Calmette-Guerin (BCG). We isolated Growth Conditions for Lactobacilli Isolates 324
268 three Lactobacillus species from wild boar feces (L. plantarum, and Mycobacterium Bovis Bacillus 325
269 L. salivarius and L. casei) that were co-cultured with BCG to Calmette-Guerin Strains 326
270 evaluate their potential antagonistic influence on the survival Colonies from the selected lactobacilli isolates were grown in 327
271 rate of M. bovis. To study their potential as macrophage MRS broth/agar (Oxoid) at 37°C without any aeration for 328
272 competitors, porcine blood phagocytes were exposed to BCG 24–48 h. Two Mycobacterium bovis Bacillus Calmette-Guérin 329
273 in the presence of the three Lactobacillus species to quantify (BCG) strains were used to determine the antagonistic effect 330
274 the BCG intake. Our in vitro results demonstrate that lactobacilli of the lactobacilli isolates against M. bovis: BCG Pasteur and 331
275 isolated from wild boar have the capacity to influence the BCG ΔleuD pASOriMXF (Brosch et al., 2000; Stedman, 2017). 332
276 phagocytic response to BCG and its survival in a species- Both BCG strains were cultured in Middlebrook 7H9 (Difco) 333
277 dependent manner. broth supplemented with 10% Oleic acid-Albumin-Dextrose- 334
278 Catalase enrichment (OADC, Sigma-Aldrich), 0.05% Tween 335
279 80 (Sigma-Aldrich), 0.2% glycerol and 40 μg/ml kanamycin 336
280 MATERIALS AND METHODS at 37°C in an orbital shaker at 225 rpm for 5–7 days. BCG 337
281 ΔleuD pASOriMXF was generated by transforming the BCG 338
282 Isolation of Lactobacilli From Wild Boar Pasteur ΔleuD strain with pASOriMXF as previously described 339
283 Fecal Samples (Stedman, 2017). pASOriMXF is a mycobacterial episomal vector 340
284 Fecal samples were collected from a total of 30 wild boar that complements the leucine mutation to correct auxotrophy, 341
285 from three fenced game estates located in mid-western Spain. and enable stable expression of GFP under the control of the 342

343 constitutively expressed promoter pL5X (Borsuk et al., 2007). (log10 CFU/ml) and GFP expression (FU) from the two BCG 400
344 All bacterial strains were maintained as −80°C frozen stocks strains as explained above. 401
345 in their appropriate media with the addition of 15% glycerol. 402
346
Accumulation of Anti-mycobacterial 403
347
Co-cultures of Lactobacilli and Bacillus Metabolites From Lactobacilli in Mono-
404
348
Calmette-Guerin Cultures and Co-cultures With Bacillus
405
349 406
Cell pellets of the selected lactobacilli and the BCG strains Calmette-Guerin
350 407
were obtained from cultures at their early stationary phase of In order to determine the effect of antimicrobial compounds
351 408
growth following centrifugation at 8,000 rpm for 5 min. The produced by the lactobacilli isolates on BCG growth, cell pellets
352 409
BCG pellets were resuspended with each Lactobacillus pellet of BCG ΔleuD pASOriMXF were resuspended in cell-free
353 410
using Mueller-Hinton (MH) broth supplemented with 10% supernatants collected from 24 h cultures of lactobacilli in
354 411
Oleic acid-Albumin-Dextrose-Catalase (OADC) enrichment, MH-OADC-Tw80-Gly at a concentration of 5 × 108 CFU/ml.
355 412
0.1% Tween 80 (Tw80) and 0.2% glycerol (Gly) (MH-OADC- BCG pellets were also resuspended in cell-free supernatants
356 413
Tw80-Gly), to generate co-cultures at an initial concentration obtained from 24 h co-cultures of lactobacilli and BCG at the
357 414
of 5 × 108 CFU/ml for BCG and 5 × 106 CFU/ml for the same final concentration using the same supplemented MH broth
358 415
lactobacilli. In a previous study we reported that MH to evaluate the influence of BCG on the production of
359 416
supplemented with OADC, tween, and glycerol is the optimal antimycobacterial compounds by the lactobacilli isolates. For
360 417
broth to support the growth of both lactobacilli and BCG both sets of experiments cell pellets were obtained after
361 418
when grown as mono-cultures for 48 h (Stedman et al., 2018). centrifugation at 8,000 rpm for 5 min, and the pH of the
362 419
The co-cultures were then grown in an orbital shaker at 37°C supernatants was adjusted to 7 and 4.5 to consider any possible
363 420
for 48 h and samples were collected at 0, 24, and 48 h post- synergistic antimicrobial effects at low pH. The controls consisted
364 421
incubation to determine BCG survival rate. of BCG cultures in cell-free supernatants obtained from
365 422
366 24 h-incubated MH-OADC-Tw80-Gly broth or 24 h-BCG 423
367
Bacillus Calmette-Guerin Survival Rate in monocultures in MH-OADC-Tw80-Gly. The survival rate of BCG 424
368 Co-cultures was then determined as GFP expression (FU) as indicated above. 425
369 The survival rate of BCG in co-cultures with the lactobacilli 426
isolates was determined simultaneously by total bacterial counts
370 Nutrient Alteration Caused by Lactobacilli 427
and GFP expression. Total bacterial counts were calculated
371
from co-cultures of the two selected BCG strains using a
in Mono-Cultures and Co-cultures With 428
372
volume of 100 μl on mycobacteria-selective agar plates Bacillus Calmette-Guerin 429
373 430
(Middlebrook 7H10 supplemented with 5% OADC and 0.2% Additional GFP experiments with the collected supernatants
374 431
glycerol). Bacterial counts were also carried out for lactobacilli indicated above were carried out at pH7 but mixed with
375 432
on their corresponding selective MRS agar plates and presented MH-OADC-Tw80-Gly at a ratio of 1:1 to evaluate the influence
376 433
as log10 CFU/ml. Colony forming units (CFU)/ml were calculated of nutrient alteration on the survival rate of BCG. In this
377 434
by dividing the number of colonies present on a plate by the case, the supernatants for the controls were also adjusted to
378 435
dilution factor of the sample and the volume transferred to pH7 and supplemented with MH-OADC-Tw80-Gly at 1:1.
379 436
380 the selected plate. The GFP expression was monitored in 437
381 co-cultures with the auxotrophy correction leucine auxotrophic Influence of Bacillus Calmette-Guerin 438
382 strain BCG ΔleuD pASOriMXF, which maintains the GFP plasmid Metabolites on the Production of Anti- 439
383 in broth without using any antibiotics (Stedman et al., 2018). mycobacterial Metabolites by Lactobacilli 440
384 Aliquots of 100 μl were transferred into Thermo Scientific In order to test whether the antimycobacterial activity observed 441
385 Nunc MicroWell™ 96-well plates to measure fluorescence from co-cultures of BCG with our lactobacilli isolates could be 442
386 emission at 485/535 nm in a DTX 880 Multimode Detector due to an inducing effect from BCG metabolites we monitored 443
387 microplate reader (Beckman Coulter). GFP expression was then the survival rate of BCG-GFP strain in supernatants derived 444
388 indicated as fluorescence units (FU). from lactobacilli cultures in supernatants from BCG cultures. 445
389 Briefly, BCG-GFP cells were resuspended in cell-free supernatants 446
390 pH in Co-cultures collected from cultures of lactobacilli after 24 h of incubation 447
391 The pH of all co-cultures was measured using a Hanna pH in supernatants from a 5 day-old BCG culture. Our controls 448
392 meter at time points 0 and 48 h, starting from an initial pH consisted of BCG-GFP cells resuspended in cell-free supernatants 449
393 of 7 for the media, to determine the effect of pH on the obtained from 24 h cultures of lactobacilli in BCG supernatants 450
394 survival rate of BCG while co-culturing with lactobacilli samples. supplemented with MH-OADC-Tw80-Gly at a ratio of 1:1, 451
395 Furthermore, the survival rate of BCG was monitored as a and also in MH-OADC-Tw80-Gly. For the three sets of 452
396 monoculture at pH7 and pH4.5 in MH-OADC-Tw80-Gly to experiments the pH of the supernatants was adjusted to 7. 453
397 evaluate the influence of acidic pH on the growth of BCG. The survival rate of BCG was then determined as GFP expression 454
398 The monitoring was carried out based on bacterial counts (FU) as indicated above. 455
399 456

457 Genome Sequencing, Assembly, and (LTA), wall teichoic acid (WTA), and adhesins, as previously 514
458 Annotation of the Lactobacilli Isolates described for lactobacilli (Van Tassell and Miller, 2011; Sengupta 515
459 The lactobacilli isolates were sent as pure isolated colonies on et al., 2013; Hevia et al., 2015). 516
460 MRS agar plates to MicrobesNG, University of Birmingham, 517
461 UK, where genome sequencing was carried out using Level of Expression of Genes Encoding for 518
462 the Illumina MiSeq platform. The DNA was extracted using the Hypothetical Bacteriocin Precursors 519
463 EZNA® Bacterial DNA kit (Omega Bio-Tek, USA) and the Identified in the Lactobacilli Genomes
520
464 library preparation was carried out with the Nextera™ XT The level of expression of transcripts from bacteriocin
521
465 Library Prep Kit. The DNA from each isolate was sequenced precursor genes was determined by Reverse Transcription-PCR
522
466 using 2 × 250 bp paired-end reads and put through a standard (RT-PCR) analysis. Total RNA was extracted from cultures of
523
467 analysis pipeline. The quality of the generated reads, which lactobacilli in the absence or presence of BCG cells
524
468 were first trimmed using Trimmomatic, was assessed using at two different concentrations (106 and 107 CFU/ml)
525
469 in-house scripts. Genomes were assembled from the paired-end using the High Pure RNA Isolation Kit (Roche Diagnostics
526
470 reads using Shovill version 1.0.41 with SPAdes 3.13.0 as assembly Limited) as recommended by the manufacturer’s instructions.
527
471 module (Bankevich et al., 2012), using default settings. Assembly All culture samples were collected during exponential
528
472 quality was assessed by N50 and L50, using Quast version 4.5 growth at an OD600nm of 0.6. RNA was treated with TURBO
529
473 (Gurevich et al., 2013), and the genome assemblies were DNase (Ambion) to eliminate traces of contaminating genomic
530
474 annotated using Prokka version 1.13 (Seemann, 2014). Sequencing DNA and the DNA-free RNA was reverse transcribed using
531
475 reads, genome assemblies and metadata have been uploaded the SuperScript® III First-Strand Synthesis System from
532
476 onto Genbank in BioProject PRJNA544176. Invitrogen. Reverse transcription (RT)-PCR analyses were
533
477 534
performed on the QuantStudio 7 Flex Real-Time PCR system
478 535
479
Identification of Genes and Clusters (Applied Biosystems) using the SYBR Master Mix (Applied
536
480
Associated With the Synthesis of Biosystems) and the specific primers for the selected transcripts.
537
481
Antimicrobial Metabolites and Transcripts were amplified on a 96-well format plate
538
Macrophage Activation in Lactobacilli by using three technical replicates of samples obtained
482 539
The genome assemblies were uploaded on the online BAGEL3 from at least two biological replicates. We then used the ΔΔCT
483 540
software (van Heel et al., 2013) to identify gene clusters involved method to calculate the relative quantification of mRNA
484 541
in the biosynthesis of bacteriocins. This software allows for a expression from cultures exposed to BCG cells by comparison
485 542
rapid and reliable identification of all classes of bacteriocin with those with no BCG added. The levels of gene expression
486 543
clusters, which are usually composed of genes encoding for were normalized using the housekeeping transcripts gyrA and
487 544
the bacteriocin precursor (pre-bacteriocin), proteins involved dnaG for each of the selected species as previously recommended
488 545
in the transport and processing of the pre-bacteriocin as an (Rocha et al., 2015) and indicated as log2.
489 546
490 active bacteriocin, posttranslational modification enzymes and 547
491 immunity proteins. Furthermore, the genome annotations were Phagocytosis Assay With Porcine 548
492 used to confirm the presence or absence of fructose-6-phosphate Blood Cells 549
493 aldolase and phosphoketolase, 2 enzymes that are involved in Whole fresh blood was collected in heparinized tubes from 550
494 the 2 main glycolytic pathways in LAB: the Embden-Meyerhof healthy pigs at the Pirbright Institute (UK), where all animal 551
495 pathway (EMP) and the phosphoketolase pathway (PKP), procedures are covered by a license issued by the UK Home 552
496 respectively (Papagianni, 2012a). In general, homofermentative Office under the Animal (Scientific Procedures) Act1986. About 553
497 LAB convert carbohydrates into lactate using EMP, whereas 100 μl of whole blood, which is equivalent to approximately 554
498 heterofermentative LAB produce lactate, acetate, ethanol, and 106 leukocytes, were mixed 1:1 with 10 mM EDTA (EDTA- 555
499 carbon dioxide as antimicrobial metabolites via PKP. The genome PBS) and challenged with BCG in combination with lactobacilli 556
500 annotations were also used to identify genes associated with at a multiplicity of infection (MOI) of 10 bacteria per 1 blood 557
501 hydrogen peroxide (H2O2) production, including genes that cell. The bacterial combinations were prepared in PBS and 558
502 encode for pyruvate oxidase (Pox), lactate oxidase (Lox), and contained the GFP-expressing BCG strain ΔleuD pASOriMXF 559
503 NADH oxidases. Genes encoding for NADH peroxidases were and each of the three Lactobacillus species. The same MOI 560
504 also included in the search for H2O2 production markers as was used for the preparation of control samples, which were 561
505 H2O2 may accumulate is species that lack these hydrogen obtained using monocultures of BCG ΔleuD pASOriMXF, BCG 562
506 peroxide-scavenging enzyme (Hertzberger et al., 2014). We finally Pasteur and lactobacilli. The blood cells and bacteria were 563
507 carried out a search on the genome annotations to detect cell incubated in an orbital shaker at 37°C for 30 min and 564
508 wall and membrane compounds associated with macrophage subsequently lysed with 1x RBC lysis solution (Biolegend) 565
509 activation via TLR and/or phagocytic receptors, including following incubation at room temperature for 15 min. The 566
510 exopolysaccharides (EPS), fimbrial precursors, lipoteichoic acid cells were then washed twice with EDTA-PBS, resuspended 567
511 in PBS and acquired on the flow cytometer BD FACS Celesta. 568
512 https://github.com/tseemann/shovill
1
FACS sorting based on forward (FSC) and side (SSC) scatter 569
513 570

571 was used to distinguish the main blood cell populations based lactobacilli on the survival rate of M. bovis. We monitored the 628
572 on their size and granularity (lymphocytes vs. phagocytes), survival rate of BCG by measuring total BCG Pasteur counts 629
573 while the FITC channel let us measure the GFP levels in and GFP emission from BCG ΔleuD pASOriMXF for 48 h, as 630
574 blood cells that bind (e.g. lymphocytes) and/or phagocytize illustrated in Figure 1. All the lactobacilli reduced BCG counts 631
575 (e.g. phagocytes including monocytes and PMNs such as and GFP emission significantly after 24 and 48 h (Figures 1A,B). 632
576 neutrophils). The resulting SCC/GFP plot was then used to The pH of the co-cultures was also recorded in all the co-cultures 633
577 evaluate the influence of lactobacilli on the BCG intake after 48 h. We observed a pH decrease below 4.5, with no 634
578 by phagocytes. significant differences between co-cultures (Figure 1C). As pH 635
579 of BCG monocultures slightly decreased from 7 to 6.8 we next 636
580
Statistical Analysis tested whether acidic pH could account for the reduction observed 637
581
Statistical analysis was performed using GraphPad Prism in BCG viability. However, both total bacterial counts and GFP 638
582
version 7.00 for Windows (GraphPad Software, La Jolla California emission of BCG as a monoculture showed no detrimental 639
583
USA, www.graphpad.com). Data are mean ± SD, representing changes at pH7 or pH4.5 after 24 and 48 h (Figures 1D,E). 640
584
three biological replicates, unless indicated. Differences between These results confirm that low pH may be insufficient on its 641
585
time-points for the same samples were analyzed by the Student own to cause a negative effect on BCG survival. 642
586
t-test. 643
587 Metabolites From Lactobacilli Reduce 644
588
Survival Rate of Bacillus Calmette-Guerin 645
589
RESULTS at Low pH 646
590 647
In order to test whether the antimicrobial effects observed
591
Lactic Acid Bacteria Isolated From Wild against BCG in the presence of lactobacilli was due to an 648
592
Boar Show Anti-mycobacterial Activity and accumulation of toxic metabolites, we monitored the survival 649
593 650
594
Are Identified as Lactobacilli rate of the GFP-BCG strain in cell-free supernatants obtained
651
A total of 16 strains isolated from wild boar feces on MRS from mono-cultures of lactobacilli and co-cultures of lactobacilli
595 652
selective agar displayed antimicrobial activity against and BCG after 24 h of incubation (Figure 2). For these
596 653
M. smegmatis mc2155 as illustrated in Supplementary Figure S1. experiments the survival rate was recorded as GFP emission
597 654
These 16 isolates were identified as L. plantarum, L. salivarius, as the anti-mycobacterial effect observed in the co-cultures
598 655
L. paracasei, of which 6 were selected for further experiments resulted in a very significant positive correlation between total
599 656
as they represented 3 different species, with two strains of the bacterial counts and GFP emission (Supplementary Figure S2).
600 657
same species (where possible) from at least two different animals Cell-free supernatants were collected from both mono-cultures
601 658
and 3 different game estates. The six selected lactobacilli were of lactobacilli and co-cultures of lactobacilli and BCG to
602 659
L. plantarum C1, L. plantarum EML1, L. plantarum SA3, determine whether the presence of BCG may act as an inducer
603 660
L. salivarius C2, L. salivarius C12, and L. paracasei SA5. Further on the production of antimicrobial compounds by lactobacilli.
604 661
species identification was carried out using StrainSeeker and We established 24 h as the collection time point for the
605 662
ANItools (Han et al., 2016; Roosaare et al., 2017), two internet supernatants since lactobacilli experience a significant log
606 663
tools that allow for fast species identification by genome increase in bacterial counts over the first 24 h (Supplementary
607 664
comparison with closely-related bacterial strains. With the Figure S3). The bacterial counts recorded for all lactobacilli
608 665
exception of isolate SA5, the species of all isolates were confirmed. cultures, either as mono-cultures or co-cultures, were no
609 666
The genomes of our L. plantarum isolates form a phylogenetic significantly different. No significant differences were observed
610 667
clade with those of L. plantarum WCFS1 and B21 (isolates in the pH recorded for both lactobacilli culture conditions
611 668
C1 and EML1) (Kleerebezem et al., 2003; Golneshin et al., after 24 h either (data not shown). As illustrated in Figure 2,
612 669
2015) and L. plantarum P-8 (isolate SA3) (Golneshin et al., very significant reductions were observed with all the culture
613 670
2015). We also observed two more clades between our isolates supernatants, either from mono-cultures or co-cultures with
614 671
C2 and C12 and the L. salivarius strains JCM1046 and CECT5713 BCG, especially after 48 h. This demonstrated that the anti-
615 672
(Jimenez et al., 2010; Raftis et al., 2014), respectively. With mycobacterial activity of lactobacilli in co-cultures could be due
616 673
regards to isolate SA5 this was finally determined to be to the combined effect of acidic pH and accumulation of
617 674
L. casei instead of L. paracasei as its genome shares a phylogenetic antimicrobial metabolites derived from lactobacilli.
618 675
clade with the genome of L. casei BL23 (Maze et al., 2010).
619 676
620
Metabolites From L. plantarum 677
621 Lactobacilli Reduce Survival Rate of Co-cultures With Bacillus Calmette-Guerin 678
622 M. bovis Bacillus Calmette-Guerin and Reduce the Survival Rate of Bacillus 679
623 Lower pH in Co-cultures Calmette-Guerin Regardless of pH and 680
624 The selected isolates L. plantarum C1/EML1/SA3, L. salivarius Nutrient Supplementation 681
625 C2/C12 and L. casei SA5 were cultured simultaneously with In order to confirm the anti-mycobacterial effect of metabolites 682
626 BCG Pasteur and the GFP-BCG strain ΔleuD pASOriMXF (Brosch produced by lactobacilli, we carried out the same experiments 683
627 et al., 2000; Stedman, 2017) to determine the influence of as described above with the supernatants, either from 684

685 742
686 A 743
687 744
688 745
689 746
690 747
691 748
692 749
693 750
694 751
695 752
696 753
697
B 754
698 755
699 756
700 757
701 758
702 759
703 760
704 761
705 762
706 763
707 764
708
C D E 765
709 766
710 767
711 768
712 769
713 770
714 771
715 772
716 773
717 774
718 775
Q4 719 FIGURE 1 | Survival rate and acidity of BCG cultures after 48 h (h) of incubation in MH broth with OADC (10%), Tween 80 (0.1%) and glycerol (0.2%).The 776
Q5 survival rate was monitored as bacterial counts (log10CFU/ml indicated with black bars) and GFP expression (FU indicated with gray bars), while acidity was
720 777
Q20 measured as pH values. Data are mean ± SD with statistical analysis (Student’s t-test, **p < 0.01, ***p < 0.005, ****p < 0.001). (A) Survival rate of BCG in
721 778
co-cultures with the L. plantarum strains C1, EML1 and SA3 after 0, 24 and 48 h of incubation. (B) Survival rate of BCG in co-cultures with the L. salivarius
722 strains C2, C12 and L. casei SA5 after 0, 24 and 48 h of incubation. (C) Acidity of BCG co-cultures with lactobacilli strains C1, EML1, SA3, C2, C12 and 779
723 SA5 (indicated as circles from left to right) and BCG monocultures (indicated as a square) after 0 and 48 h of incubation. (D) Survival rate of BCG 780
724 mono-cultures after 0, 24 and 48 h of incubation from an initial pH of 7. (E) Survival rate of BCG mono-cultures after 0, 24 and 48 h of incubation from an 781
initial pH of 4.5.
725 782
726 783
727 mono-cultures or co-cultures with BCG, but at pH 7 to exclude the presence of BCG. Furthermore, this induced antimicrobial 784
728 the positive antimicrobial effect of acidic pH. We also included activity seems to be stable at different ranges of pH and 785
729 a third experimental condition by supplementing the supernatants nutrient composition. 786
730 with fresh co-culture media to determine the influence of 787
731 nutrient alteration caused by lactobacilli metabolism. Due to 788
732 logistic reasons we started with the L. plantarum strains. As The Anti-mycobacterial Effect of 789
733 illustrated in Figure 3, no significant reductions were observed Metabolites From L. salivarius and L. casei 790
734 in BCG survival using the supernatants obtained from the Depends on pH but Also on the Presence 791
735 L. plantarum mono-cultures, either with or without nutrient of Bacillus Calmette-Guerin if Derived 792
736 supplementation. However, the reduction was very significant From L. casei 793
737 when we used the supernatants from the co-cultures of the As observed with the L. plantarum supernatants no significant 794
738 three L. plantarum strains with BCG, especially with reductions were observed in BCG survival using the supernatants 795
739 supplementation after 24 h, but also after 48 h without any obtained from mono-cultures of L. salivarius and L. casei at 796
740 supplementation. These results suggest that our L. plantarum pH7, either with or without nutrient supplementation (Figure 4). 797
741 strains over-produce certain anti-mycobacterial metabolites in In fact, the BCG survival increased in the supernatants from 798

799 856
800 A 857
801 858
802 859
803 860
804 861
805 862
806 863
807 864
808 865
809 866
810 867
811 868
812 869
813 870
B
814 871
815 872
816 873
817 874
818 875
819 876
820 877
821 878
822 879
823 880
824 881
825 882
826 883
827 884
828 FIGURE 2 | Survival rate of BCG after 48 h (h) of incubation in acidic cell-free supernatants (pH 4.5) that were obtained from 24 h mono-cultures of lactobacilli (left 885
829 hand side) or 24 h co-cultures of BCG with lactobacilli (right hand side) in MH broth with OADC (10%), Tween 80 (0.1%) and glycerol (0.2%). The BCG survival rate 886
830 for both conditions was monitored as GFP expression (FU indicated with gray bars) and compared to their corresponding controls represented with black bars. The 887
controls were BCG grown in cell-free supernatants obtained from a 24 h-incubated MH broth with OADC (10%), Tween 80 (0.1%) and glycerol (0.2%) (left hand
831 888
side) and 24 h BCG monocultures in MH broth with OADC (10%), Tween 80 (0.1%) and glycerol (0.2%) (right hand side), both at pH 4.5. Data are mean ± SD with
832 statistical analysis (Student’s t-test, **p < 0.01, ***p < 0.005, ****p < 0.001). (A) Survival rate of BCG after 0, 24 and 48 h of incubation in supernatants from mono- 889
833 cultures of L. plantarum C1, EML1, SA3 (left hand side) or co-cultures of BCG with the L. plantarum strains (right hand side). (B) Survival rate of BCG after 0, 24 and 890
834 48 h of incubation in supernatants from mono-cultures of L. salivarius C2 and C12 and L. casei SA5 (left hand side) or co-cultures of BCG with the strains of 891
835
L. salivarius and L. casei (right hand side). 892
836 893
837 894
838 the L. salivarius mono-cultures without supplementation. The and L. casei SA5 was dependent on the presence of BCG 895
839 same observation was recorded with the supernatants collected metabolites rather than cells, we monitored the survival rate 896
840 from the co-cultures of L. salivarius and BCG, confirming a of BCG-GFP strain in cell-free supernatants derived from 897
841 pH-dependency on the anti-mycobacterial effect from the cultures of L. plantarum and L. casei that were propagated for 898
842 L. salivarius strains. On the contrary, the survival rate of BCG 24 h in cell-free supernatants from 5 day-old BCG cultures. 899
843 decreased slightly in the supernatants derived from co-cultures We also included two additional experimental conditions by 900
844 of L. casei and BCG, suggesting a role of BCG as an inducer supplementing the supernatants with fresh co-culture media 901
845 on the production of antimicrobial compounds in L. casei. but also by growing the lactobacilli in complete fresh co-culture 902
846 Nevertheless this induction seems to be significantly lower than broth to consider the possible negative influence of nutrient 903
847 that observed with L. plantarum. alteration in the growth of lactobacilli. The bacterial counts 904
848 recorded for the 3 different types of lactobacilli cultures were 905
849 not significantly different (Supplementary Figure S4). The pH 906
850
Metabolites From Bacillus Calmette- of the supernatants from lactobacilli cultures propagated in 907
851 Guerin Have No Influence on the BCG supernatants was slightly above 4.5 but no significant 908
852 Production of Anti-mycobacterial differences were observed when compared to the other lactobacilli 909
853 Metabolites by L. plantarum and L. casei cultures (data not shown). As illustrated in Supplementary 910
854 In order to test whether the induced antimycobacterial activity Figure S5, no significant reductions were observed in BCG 911
855 observed from co-cultures of BCG with the L. plantarum strains survival using the supernatants obtained from the L. plantarum 912

913 970
914 A 971
915 972
916 973
917 974
918 975
919 976
920 977
921 978
922 979
923 980
924 981
925 982
926 983
927 984
928 985
929 986
930 B 987
931 988
932 989
933 990
934 991
935 992
936 993
937 994
938 995
939 996
940 997
941 998
942 999
943 1000
944 1001
945 1002
946 1003
947 FIGURE 3 | Survival rate of BCG after 48 h (h) of incubation in neutralized cell-free supernatants (pH 7) that were obtained from 24 h mono-cultures of L. plantarum 1004
948 C1, EML1 and SA3 (left hand side) or 24 h co-cultures of BCG with the L. plantarum strains (right hand side) in MH broth with OADC (10%), Tween 80 (0.1%) and 1005
949
glycerol (0.2%). The BCG survival rate for both conditions was monitored as GFP expression (FU as gray bars) and compared to their corresponding controls 1006
represented with black bars, with or without nutrient supplementation. The controls were BCG grown in cell-free supernatants obtained from a 24 h-incubated MH
950 1007
broth with OADC (10%), Tween 80 (0.1%) and glycerol (0.2%) (left hand side) and 24 h BCG monocultures in MH broth with OADC (10%), Tween 80 (0.1%) and
951 glycerol (0.2%) (right hand side), both at pH 7. Data are mean ± SD with statistical analysis (Student’s t-test, *p < 0.05, **p < 0.01). (A) Survival rate of BCG after 1008
952 0, 24 and 48 h of incubation in supernatants from L. plantarum mono-cultures (left hand side) or co-cultures of BCG with the L. plantarum strains (right hand side). 1009
953 (B) Survival rate of BCG after 0, 24 and 48 h of incubation in supernatants from L. plantarum mono-cultures (left hand side) or co-cultures of BCG with the 1010
L. plantarum strains (right hand side) that were supplemented with MH broth with OADC (10%), Tween 80 (0.1%) and glycerol (0.2%) at a ratio of 1:1. The
954 1011
supernatants for the controls were also supplemented with MH broth with OADC (10%), Tween 80 (0.1%) and glycerol (0.2%) at 1:1.
955 1012
956 1013
957 cultures grown in supernatants from BCG cultures, either with the lactobacilli isolates, demonstrating their role as facultative 1014
958 or without nutrient supplementation. These data suggest that heterofermenters. Therefore, our isolates are able to convert 1015
959 BCG metabolites have no inducing effect on the anti- carbohydrates into lactate using the EMP pathway and/or 1016
960 mycobacterial activity from L. plantarum and L. casei. produce lactate in combination with ethanol, acetate and 1017
961 Subsequently, the higher antimicrobial effect observed in carbon dioxide as antimicrobial metabolites via the PKP 1018
962 co-cultures of BCG with L. plantarum and L. casei when pathway. Furthermore, all the isolates harbor genes associated 1019
963 compared to mono-cultures could be due to the presence of with H2O2 production, e.g. including Pox, Lox, and/or NADH 1020
964 BCG cells. oxidases as well as genes encoding for the H2O2-scavenging 1021
965 enzyme NADH peroxidase. Interestingly, the BAGEL3 genome 1022
966 Lactobacilli Harbor Genes Associated With analysis identified gene clusters involved in the hypothetical 1023
967 the Synthesis of Antimicrobial Metabolites synthesis of class II and class III bacteriocins, including 1024
968 The genome annotations let us identify the genes encoding single-peptide bacteriocins in L. salivarius C2 (Table 1); 1025
969 for fructose-6-phosphate aldolase and phosphoketolase in all two-peptide bacteriocins in all L. plantarum strains and 1026

1027 1084
1028 A 1085
1029 1086
1030 1087
1031 1088
1032 1089
1033 1090
1034 1091
1035 1092
1036 1093
1037 1094
1038 1095
1039 1096
1040 1097
1041 1098
1042 1099
1043 1100
1044 B 1101
1045 1102
1046 1103
1047 1104
1048 1105
1049 1106
1050 1107
1051 1108
1052 1109
1053 1110
1054 1111
1055 1112
1056 1113
1057 1114
1058 1115
1059 1116
1060 1117
1061 FIGURE 4 | Survival rate of BCG after 48 h (h) of incubation in neutralized cell-free supernatants obtained from 24 h mono-cultures of L. salivarius C2 and C12 and 1118
1062 L. casei SA5 (left hand side) or 24 h co-cultures of BCG with the strains of L. salivarius and L. casei (right hand side) in MH broth with OADC (10%), Tween 80 (0.1%) 1119
1063
and glycerol (0.2%). The BCG survival rate for both conditions was monitored as GFP expression (FU as light gray bars for L. salivarius and dark gray bars for 1120
L. casei) and compared to their corresponding controls represented with black bars, with or without supplementation. The controls were BCG grown in cell-free
1064 1121
supernatants obtained from a 24 h-incubated MH broth with OADC (10%), Tween 80 (0.1%) and glycerol (0.2%) (left hand side) and 24 h BCG monocultures in MH
1065 broth with OADC (10%), Tween 80 (0.1%) and glycerol (0.2%), both at pH 7 (right hand side). Data are mean ± SD with statistical analysis (Student’s t-test, 1122
1066 *p < 0.05, **p < 0.01) and significant GFP differences are indicated in green (increase) or red (decrease). (A) Survival rate of BCG after 0, 24 and 48 h of incubation 1123
1067 in supernatants from mono-cultures of L. salivarius and L. casei (left hand side) or co-cultures of BCG with the strains of L. salivarius and L. casei (right hand side). 1124
(B) Survival rate of BCG after 0, 24 and 48 h of incubation in supernatants from mono-cultures of L. salivarius and L. casei (left hand side) or co-cultures of BCG
1068 1125
with the strains of L. salivarius and L. casei (right hand side) that were supplemented with MH broth with OADC (10%), Tween 80 (0.1%) and glycerol (0.2%) at a
1069 1126
ratio of 1:1. The supernatants for the controls were also supplemented with MH broth with OADC (10%), Tween 80 (0.1%) and glycerol (0.2%) at 1:1.
1070 1127
1071 1128
1072 L. casei SA5 (Table 2), and bacteriolysins in all lactobacilli Lactobacillus casei UCD174 (Broadbent et al., 2012). On the 1129
Q12 1073 isolates (Table 3). The two single-peptide bacteriocin precursors other hand, the bacteriolysin genes that we identified in all 1130
1074 identified in the genome of L. salivarius C2 (Tα, Tβ) show the genomes encode for enzymes that hydrolyse cell wall 1131
1075 a very high homology with two class II bacteriocins of peptidoglycans between N-acetylmuramic acid and N-acetyl- 1132
1076 L. salivarius BGH01 (Busarcevic and Dalgalarrondo, 2012), D-glucosamide, or N-acetylmuramoyl and L-aa residues. These 1133
1077 while the two-peptide bacteriocin precursors of the enzymes normally have target recognition site and a catalytic 1134
1078 L. plantarum genomes (plnE, plnF) are identical to the domain that shows homology to endopeptidases, muramidases, 1135
1079 plantaricin precursor genes plnE and plnF of L. plantarum or amidases (Cotter et al., 2005). Furthermore, unlike the 1136
1080 C11 (Anderssen et al., 1998). The two-peptide bacteriocin class II bacteriocin clusters, the bacteriolysins have no specific 1137
1081 precursors found in the genome of L. casei SA5 (A, B) were immunity genes that accompany the bacteriocin precursor 1138
1082 also identical to two hypothetical class II bacteriocins of genes as they rely on modifications of the producer cell 1139
1083 Lactobacillus casei DPC6800 (Stefanovic et al., 2016) and wall to impart resistance. The identified bacteriolysins were 1140

1141 TABLE 1 | Proteins encoded by the hypothetical single peptide-bacteriocin cluster of Lactobacillus salivarius C2. 1198
1142 1199
ORF (gene) Size (aa) Function Homologue % Reference
1143 1200
1144 1 (T2) 87 Putative protein Lactobacillus salivarius CCUG47825 96 (Harris et al., 2017) 1201
1145 2 (T3) 57 Bacteriocin-like peptide Lactobacillus salivarius UCC118 96 (Flynn et al., 2002) 1202
1146 3 (T4) 85 Bacteriocin-like peptide Lactobacillus salivarius ATCC11741 96 (Harris et al., 2017) 1203
4 (Ta) 80 Subunit A bacteriocin ThmA Blp1a, Lactobacillus salivarius BGH01 96 (Busarcevic and Dalgalarrondo, 2012)
1147 1204
5 (T1 M1) 59 Immunity Lactobacillus salivarius BGH01 82 (Busarcevic and Dalgalarrondo, 2012)
1148 1205
6 (Tb) 69 Subunit B bacteriocin TmhB Blp1b, Lactobacillus salivarius BGH01 100 (Busarcevic and Dalgalarrondo, 2012)
1149 7 (T1 M2) 54 Immunity Lactobacillus salivarius BGH01 100 (Busarcevic and Dalgalarrondo, 2012) 1206
1150 8 (TIP) 39 Induction peptide Lactobacillus salivarius ATCC11741 79 (Harris et al., 2017) 1207
1151 9 (TK) 429 Histidine kinase Lactobacillus salivarius ATCC11741 87 (Harris et al., 2017) 1208
10 (TR) 264 Response regulator Lactobacillus salivarius UCC118 99 (Flynn et al., 2002)
1152 1209
11 (orf1) 76 Putative protein Lactobacillus salivarius ATCC11741 99 (Harris et al., 2017)
1153 1210
12 (orf2) 65 Putative protein Lactobacillus salivarius ATCC11741 100 (Harris et al., 2017)
1154 13 (orf3) 44 Putative protein Lactobacillus salivarius ATCC11741 100 (Harris et al., 2017) 1211
1155 14 (orf4) 237 Putative protein Lactobacillus salivarius ATCC11741 98 (Harris et al., 2017) 1212
1156 15 (orf5) 88 Putative protein Lactobacillus salivarius CCUG47825 99 (Harris et al., 2017) 1213
16 (orf6) 273 Integrase Lactobacillus salivarius UCC118 99 (Flynn et al., 2002)
1157 1214
1158 1215
1159 1216
TABLE 2 | Proteins encoded by the hypothetical two peptide-bacteriocin clusters of Lactobacillus plantarum C1, EML1 & SA3; and L. paracasei SA5.
1160 1217
1161 Strains ORF (gene) Size (aa) Function Homologue (100%) Reference 1218
1162 1219
1 (W) 228 CAAX protease self-immunity PlnW, Lactobacillus plantarum C11 (Diep et al., 1996, 2009)
1163 1220
2 (V) 226 CAAX protease self-immunity PlnV, Lactobacillus plantarum C11 (Diep et al., 1996, 2009)
1164 1221
3(U) 222 CAAX family putative protein PlnU, Lactobacillus plantarum C11 (Diep et al., 1996, 2009)
1165 4 (T) 149 CAAX family putative protein PlnT, Lactobacillus plantarum C11 (Diep et al., 1996, 2009) 1222
C1/EML1/
1166 5 (S) 99 Putative protein PlnS, Lactobacillus plantarum C11 (Diep et al., 1996, 2009) 1223
SA3
1167 6 (H) 458 ABC-transporter accessory factor PlnH, Lactobacillus plantarum C11 (Diep et al., 1996, 2009) 1224
7 (G) 716 ABC transporter PlnG, Lactobacillus plantarum C11 (Diep et al., 1996, 2009)
1168 1225
8 (E) 56 Plantaricin E PlnE, Lactobacillus plantarum C11 (Diep et al., 1996, 2009)
1169 9 (F) 52 Plantaricin F PlnF, Lactobacillus plantarum C11 (Diep et al., 1996, 2009) 1226
1170 1 (A) 77 Class IIb bacteriocin Lactobacillus casei DPC6800 (Stefanovic et al., 2016) 1227
1171 2 (B) 71 Class IIb bacteriocin Lactobacillus casei UCD174 (Broadbent et al., 2012) 1228
1172
3(C) 102 Putative protein Lactobacillus casei W56 (Hochwind et al., 2012) 1229
4 (AT) 198 Acetyltransferase Lactobacillus casei W56 (Hochwind et al., 2012)
1173 SA5 1230
5 (D) 111 Immunity Lactobacillus casei DPC6800 (Stefanovic et al., 2016)
1174 6 (E) 225 Metalloprotease Lactobacillus casei W56 (Hochwind et al., 2012) 1231
1175 7 (F) 110 Putative protein Lactobacillus casei W56 (Hochwind et al., 2012) 1232
1176 8 (G) 52 Putative membrane protein Lactobacillus casei BL23 (Maze et al., 2010) 1233
1177 1234
1178 1235
1179
very abundant in L. salivarius C2, followed by L. salivarius increase by comparison with L. plantarum cultures on their 1236
1180
C12 and L. casei SA5. The L. plantarum strains only share own. We observed similar results with A/B genes of L. casei 1237
1181
two of them with the remainder of the isolates. SA5 although the increase was much lower. By contrast, 1238
1182
the expression of genes Tα/Tβ in L. salivarius C2 was not 1239
1183
The Genes Encoding for the Two-Peptide affected by the presence of BCG cells (Figure 5). These 1240
1184 Bacteriocins of L. plantarum and L. casei data confirm not only the inducing effect of BCG cells on 1241
1185 Over-Express in the Presence of Bacillus the anti-microbial activity displayed by L. plantarum and 1242
1186 Calmette-Guerin Cells L. casei in co-cultures with BCG but also the possible role 1243
1187 In order to determine whether the presence of BCG cells of two-peptide bacteriocins is such antimicrobial activity 1244
1188 may regulate the level of expression of the identified class against BCG. 1245
1189 II bacteriocins we carried out an RT-PCR to quantify the 1246
1190 amount of transcripts derived from the genes encoding for Lactobacilli Influence Bacillus Calmette- 1247
1191 the hypothetical precursor bacteriocins in all L. plantarum Guerin Phagocytosis in a Species- 1248
1192 strains, L. salivarius C2 and L. casei SA5 (indicated in green Dependent Manner 1249
1193 on top of Figure 5). The RNA was isolated from cultures Representative FSC-SSC plots indicating the presence of 1250
1194 of lactobacilli exposed to increasing concentrations of BCG lymphocytes, monocytes and PMNs (neutrophils) in porcine 1251
1195 cells during exponential growth. As illustrated in Figure 5, blood are illustrated in Figure 6A. Unlike BCG and 1252
1196 the level of expression of genes plnE and plnF was dependent L. salivarius, the presence of L. plantarum and L. casei alters 1253
1197 on the amount of BCG cells used, with a very significant significantly the blood scatter profile, which complicated 1254

1255 TABLE 3 | Proteins encoded by the hypothetical bacteriolysin genes identified in the lactobacilli genomes. 1312
1256 1313
Protein Gene Size (aa) Conserved catalytic domain Lactobacillia Homologue (100%) Reference
1257 1314
1258 Phage lysin acm 245–772 M23 endopeptidase GH25- C1, EML1, SA3 C2, Lactobacillus sp. CBA3606 NCBI Complete Genomes 1315
1259 PlyB-like muramidase C12, SA5 L. paracasei ATCC 25302 (Ward and Timmins, 1999) 1316
1260 L. salivarius CECT 5713 (Martin et al., 2006) 1317
Lysozyme lyc 309–921 GH25-LysA-like endolysin C2, C12, SA5 L. reuteri TD1 (Leonard et al., 2014)
1261 1318
L. casei 32G (Aktas et al., 2015)
1262 1319
Autolysin 1 lytA_1 486 C39 endopeptidase C2 L. salivarius cp400 (Mackenzie et al., 2014)
1263 Autolysin 2 lytA_2 350–468 PGRP-family amidase C2, C12, SA5 L. salivarius ACS-116-V-Col5a NCBI Complete Genomes 1320
1264 L. casei 32G (Aktas et al., 2015) 1321
1265 Amidase lytC 282–350 MurNAc-LAA C1, EML1, SA3 C2, Lactobacillus sp. CBA3606 NCBI Complete Genomes 1322
C12, SA5 Lactobacillus sp. DS22_6
1266 1323
Toxin 1 toxA_1 125 Amidase C2 L. salivarius cp400 (Mackenzie et al., 2014)
1267 1324
Toxin 2 toxA_2 523 M23 endopeptidase C2, C12 L. salivarius cp400 (Mackenzie et al., 2014)
1268 1325
1269
a
Lactobacilli strains in which the genes have been identified. 1326
1270 1327
1271 1328
1272 TABLE 4 | Primers used for the amplification of transcritps derived from the class II bacteriocin precursor genes of L. plantarum, L. casei, and L. salivarius. 1329
1273 1330
Gene Bacteriocin Primers
1274 1331
1275 plnE Plantaricin E, L. plantarum Fw: caatattccaggttgccgca Rv: gaatgcctgcaactgaacca 1332
1276 plnF Plantaricin F, L. plantarum Fw: atttcaggtggcgttttcca Rv: aatcctcggacagcgctaat 1333
1277 plnJ Plantaricin J, L. plantarum Fw: gccagcttcgccatcataaa Rv: aggatttggatgtagtagatgca 1334
plnK Plantaricin K, L. plantarum Fw: ttgaaccaccaagcacgg Rv: ttgaagaattaactgctgacgc
1278 1335
A Class IIb bacteriocin, L. casei Fw: agttgtcaggggtttcaggt Rv: ccgccgattatcccaaaagg
1279 1336
B Class IIb bacteriocin, L. casei Fw: gagccaagcgacgcaataaa Rv: cgcctgcaacagttgtaaatg
1280 Tα Class IId bacteriocin, L. salivarius Fw: gcaatcagaggaggaatggc Rv: ccgatacaagccaatccacc 1337
1281 Tβ Class IId bacteriocin, L. salivarius Fw: gggaatggcattaattgggga Rv: ggattaccgaaagctgcacc 1338
1282 gyrA DNA topoisomerase, L. plantarum Fw: tttaagtcgcaacaccgtgg Rv: gattcctttggccgtacgac 1339
dnaG DNA primase, L. plantarum Fw: agttggtagtcggtctggtg Rv: cgcacctaaggatcagcaac
1283 1340
gyrA DNA topoisomerase, L. paracasei Fw: cttccacgcatgatgtcctg Rv: cgccttcatgcacgttgata
1284 dnaG DNA primase, L. paracasei Fw: cagttcggccaattgatcgt Rv: cgactcgatccaggaatcca 1341
1285 gyrA DNA topoisomerase, L. salivarius Fw: gttttgccagcacgttttcc Rv: tcccattacaattgcgccag 1342
1286 dnaG DNA primase, L. salivarius Fw: gcacaaagattcaacgtcgc Rv: cgttctgctttctctgcctt 1343
1287 1344
gyrA and dnaG were selected as housekeeping transcripts as previously recommended (Rocha et al., 2015).
1288 1345
1289 1346
1290 1347
1291 1348
1292 1349
1293 1350
1294 1351
1295 1352
1296 1353
1297 1354
1298 1355
1299 1356
1300 1357
1301 1358
1302 1359
1303 FIGURE 5 | Class II bacteriocin gene clusters identified in the genome of the lactobacilli strains and level of expression of genes encoding for the hypothetical 1360
1304
precursor bacteriocins in lactobacilli cultures exposed to increasing concentrations of BCG cells. The nomenclature for the bacteriocin clusters follows specific 1361
recommendations (Diep et al., 2009; O’Shea et al., 2011) and represents precursor bacteriocins (green), posttranslational modification enzymes (blue), transport/
1305 1362
immunity proteins (red) and other hypothetical proteins (gray). C1. Two peptide-bacteriocin cluster of L. plantarum strains C1 (as a representative of all L. plantarum
1306 strains) and level of expression of its corresponding precursor bacteriocin genes plnE and plnF in cultures exposed to BCG cells at 106 CFU/ml (light gray bars) and 1363
1307 107 CFU/ml (dark gray bars). SA5. Two peptide-bacteriocin cluster of L. casei SA5 and level of expression of its corresponding precursor bacteriocin genes A and B 1364
1308 in cultures exposed to increasing concentrations of BCG cells at 106 CFU/ml (light gray bars) and 107 CFU/ml (dark gray bars). C2. Single-peptide bacteriocin cluster 1365
of L. salivarius C2 and level of expression of its corresponding precursor bacteriocin genes Tα and Tβ in cultures exposed to BCG cells at 106 CFU/ml (light gray
1309 1366
bars) and 107 CFU/ml (dark gray bars).
1310 1367
1311 1368

1369 1426
A
1370 1427
1371 1428
1372 1429
1373 1430
1374 1431
1375 1432
1376 1433
1377 1434
1378 1435
1379 1436
1380 1437
1381 1438
1382
B C 1439
1383 1440
1384 1441
1385 1442
1386 1443
1387 1444
1388 1445
1389 D 1446
1390 1447
1391 1448
1392 1449
1393 1450
1394 1451
1395 1452
1396 1453
1397 1454
FIGURE 6 | Lactobacilli interact with porcine blood cells, interfering with BCG phagocytosis in a species-dependent manner. (A) SSC/FSC plot areas representing
1398 1455
porcine blood cells and their corresponding SSC/GFP areas when exposed to non-stimulated conditions (mock), BCG, L. salivarius C12, L. plantarum C1 and
1399 1456
L. casei SA5. For the mock experimental conditions the blood cells are indicated in green (lymphocytes), orange (monocytes) and red (PMNs). (B) SSC/GFP plot
1400 areas illustrating the response of porcine blood cells to BCG-GFP alone (−) or in combination (+) with L. salivarius C12, L. plantarum C1 and L. casei SA5. The SSC/ 1457
1401 FSC areas for each of the conditions are included above and the GFP intensity recorded from phagocytes is indicated on the BCG-GFP experimental condition as 1458
1402 negative (−), positive (+) and very positive (++). (C) Percentage of phagocytes that bind BCG when tested alone (black bar) or in combination (gray bars) with 1459
L. salivarius C12, L. plantarum C1 and L. casei SA5. Data are mean ± SD with Student’s t-test statistical analysis (***p < 0.001). (D) Percentage of phagocytes that
1403 1460
phagocytize BCG when tested alone (black bar) or in combination (gray bars) with L. salivarius C12, L. plantarum C1 and L. casei SA5. Data are mean ± SD with
1404 Student’s t-test statistical analysis (**p < 0.01, ***p < 0.001). 1461
1405 1462
1406 1463
1407 the identification of monocytes and neutrophils. Nevertheless, DISCUSSION 1464
1408 the different distribution of lymphocytes and phagocytes 1465
1409 that we observed on the SCC-GFP plots under all bacterial To the best of our knowledge, this is the second study 1466
1410 conditions, let us distinguish between blood cells that reporting the isolation of Lactobacillus spp. from wild boar. 1467
1411 are positive for BCG binding or BCG intake based on the The only previous publication is focused on the antibiotic 1468
1412 GFP intensity. Lymphocytes and some phagocytes were susceptibility of lactobacilli isolates and the authors found 1469
1413 found to be GFP positive but the highest GFP intensity Lactobacillus species are different from this study, including 1470
1414 was only observed in the phagocytic cells (Figure 6B). L. mucosae, L. reuteri, L murinus, and L. fermentus (Klose 1471
1415 L. salivarius (C12) had no significant effect on the BCG et al., 2014). In our study we describe, for the first time, 1472
1416 binding (Figure 6C); neither on the phagocytic response that wild boar carry Lactobacillus spp. such as L. plantarum, 1473
1417 to BCG (Figure 6D). However, the percentage of phagocytes L. salivarius and L. casei that exert antimycobacterial activity 1474
1418 positive for BCG binding and BCG intake changed significantly when they compete against M. bovis BCG in co-cultures. 1475
1419 in the presence of L. plantarum (C1) and L. casei (SA5) Our results are consistent with previous studies that found 1476
1420 Although both lactobacilli increased the binding between that BCG and M. bovis are inhibited by lactobacilli isolated 1477
1421 BCG and phagocytes (Figure 6C) their effect on BCG from badger feces or present in fermented milk products 1478
1422 phagocytosis was completely different (Figure 6D). L. plantarum (Mariam, 2009; Macuamule et al., 2016; Stedman et al., 1479
1423 reduced the BCG intake, whereas L. casei caused the 2018). We initially suspected that the antimicrobial activity 1480
1424 opposite effect. that our lactobacilli isolates display against BCG was due 1481
1425 1482

1483 to acidic pH but low pH was insufficient to induce a decrease The genes that encode for the two-peptide bacteriocin that 1540
1484 in the survival of BCG when grown as a mono-culture as we identified in the genome of the three L. plantarum strains 1541
1485 previously reported (de la Rua-Domenech, 2006; Stedman are identical to the two genes of operon plnEF. Genes plnE 1542
1486 et al., 2018). In fact, M. bovis naturally resist acidic pH and plnF allow the expression of two peptides, plantaricins E 1543
1487 due to their the ability to adopt intracellular homeostasis and F, that interact together to form a helix-helix structure 1544
1488 (Rao et al., 2001), that binds to a specific membrane protein of the target bacteria, 1545
1489 Overall the lactobacilli isolates that we have isolated in this presumably a transporter of the APC superfamily, leading to 1546
1490 study seem to produce metabolites that display a very significant membrane leakage and cell death (Ekblad et al., 2016; Oppegard 1547
1491 antimicrobial activity against BCG, but only at low pH, suggesting et al., 2016). The remainder of the genes that we detected in 1548
1492 a synergistic effect at acidity conditions. All our isolates contain the L. plantarum genomes are identical to operon plnWVUTSHG, 1549
1493 genes associated with the synthesis of lactate and acetate, which which are thought to be involved in transport, processing and 1550
1494 inhibit active transport in other bacteria by causing interference self-protection (Diep et al., 2009). The operons plnEF and 1551
1495 on the membrane potential; as well as ethanol, CO2 and plnWVUTSHG are frequently found in many L. plantarum 1552
1496 hydrogen peroxide, additional antimicrobial compounds that strains, along with other two-peptide bacteriocin clusters such 1553
1497 may prevent bacterial growth by creating a hostile environment as plantaricin JK, although it has been reported to be on their 1554
1498 (Pessione, 2012). It has been well-documented that the own in certain isolates (Saenz et al., 2009; Tai et al., 2015). 1555
1499 antibacterial activity of lactobacilli is multifactorial, including Furthermore, we detected a gene cluster involved in the 1556
1500 lowering of the pH with simultaneous production of lactic hypothetical synthesis of a novel two-peptide bacteriocin in 1557
1501 acid and of non-lactic acid metabolites (Fayol-Messaoudi et al., L. casei. The gene cluster is composed of two genes that encode 1558
1502 2005). These antimicrobial metabolites could even act in synergy for 2 bacteriocins that show certain similarity with thermophilin 1559
1503 since lactic acid permeabilizes the outer membrane of bacteria, A (Ward and Somkuti, 1995) and carnocin CP51 (Herbin et al., 1560
1504 allowing the non-lactic acid metabolites to enter the bacterial 1997), followed by a galactoside O-acetyltransferase gene prior 1561
1505 cells (Alakomi et al., 2000). This potential synergistic effect to two additional genes involved in immunity and transport. 1562
1506 between acidic pH and antimicrobial metabolites was further Carnocin CP51 is expressed with the complementary peptide 1563
1507 supported by the lack of antimycobacterial activity that carnocin CP52 in Carnobacterium and thermophilin A glycosylates 1564
1508 we observed at neutral pH. All the lactobacilli mono-cultures as it occurs with some plantaricins (Diep et al., 2009). 1565
1509 provided with metabolites that were incapable of inhibiting As a very interesting fact we observed that the two gene 1566
1510 the growth of BCG at pH 7. operons that encode for the two-peptide bacteriocins in 1567
1511 The reasons why metabolites from the lactobacilli mono- L. plantarum and L. casei over-express in the presence of BCG 1568
1512 cultures display no activity against BCG at pH7 could also cells in a dose-dependent manner. These results could explain 1569
1513 lie on the fact that some bacteriocins are only fully functional why metabolites that derive from co-cultures of BCG with 1570
1514 at acidic conditions. The genome of all the lactobacilli isolates L. plantarum and L. casei, show anti-mycobacterial activity. 1571
1515 showed genes related to the biosynthesis of bacteriolytic class Neither monocultures of these two Lactobacillus spp. or their 1572
1516 III bacteriocins known as bacteriolysins, especially in L. salivarius. metabolites after propagation in supernatants containing BCG 1573
1517 Bacteriolysins are enzymes that have been adapted to the host metabolites displayed any antimycobacterial activity. In fact, 1574
1518 habitat of acidification, with an optimal bactericidal activity the regulation of plantaricin production had been previously 1575
1519 that ranges between pH values of 4 and 6 (Sable and Lortal, described in co-cultures of L. plantarum (Maldonado et al., 1576
1520 1995; Ribelles et al., 2012). This could also explain the absence 2004b; Maldonado-Barragan et al., 2013). In agreement with 1577
1521 of antimicrobial activity that we recorded against BCG using our transcriptional data, a previous study has reported that 1578
1522 metabolites from all the L. salivarius co-cultures at pH7. operon of the two-peptide bacteriocin plantaricin NC8 of 1579
1523 However, neutral pH had no influence on the antimycobacterial L. plantarum NC8 is up-regulated in broth only after cultivation 1580
1524 activity observed with the metabolites derived from co-cultures with other gram-positive bacteria or the addition of heat-killed 1581
1525 of BCG with L. plantarum and L. casei. This remarkable cells from some of the inducing bacteria (Maldonado et al., 1582
1526 observation suggests that, first, such antimycobacterial activity 2004a). Whether two-peptide bacteriocins such as plantaricins 1583
1527 is dependent on the lactobacilli species and is not associated are involved in the antimycobacterial activity that we have 1584
1528 with low pH; and, second, BCG triggers its own bactericidal observed in this study is a question that remains unanswered. 1585
1529 effect. Interestingly, we found that the strains of L. plantarum Based on our results it is too early to speculate about the 1586
1530 and L. casei carry gene clusters associated with the production possible role of plantaricins as antimicrobials against 1587
1531 of two-peptide bacteriocins, also known as class IIb bacteriocins, mycobacteria; mainly because of their relatively narrow inhibitory 1588
1532 which consist of two different peptides that confer optimal spectra, which includes other species of lactobacilli as well as 1589
1533 antimicrobial activity if both peptides are present in equal gram-positive closely related bacteria such as Pediococcus (Diep 1590
1534 amounts (Nissen-Meyer et al., 2010). Two-peptide bacteriocins et al., 2009). However, this potential anti-mycobacterial role 1591
1535 often display an antibacterial activity that is very stable at a is worthy of further investigation due to the promising 1592
1536 very broad range of pH (1–11); and the genes that encode contribution of plantaricins to probiotic functionality when 1593
1537 for the two peptides are next to each other in the same colonizing the gut (Maldonado-Barragan et al., 2013) and the 1594
1538 operon where other genes associated with processing, transport fact that class II bacteriocins have antimicrobial activity against 1595
1539 and immunity are located. M. tuberculosis (Sosunov et al., 2007). 1596

1597 Unlike the two-peptide bacteriocins, the two identified single- Marakalala et al., 2018). In this respect, very recent studies 1654
1598 peptide bacteriocins of L. salivarius showed no transcriptional have described that lactobacilli are able to express adhesins 1655
1599 up-regulation in the presence of BCG cells, which is in accordance that bind to C-type lectin receptors (Bene et al., 2017). 1656
1600 with the evidence that metabolites from L. salivarius have no Interestingly, the genomes of our L. plantarum isolates have 1657
1601 influence on the survival of BCG at pH7. The two bacteriocins revealed the presence of cna, a gene that encodes a collagen 1658
1602 that we found in the genome of L. salivarius show similarities adhesin (cna) and that is absent in the L. casei genome. As 1659
1603 with multiple class IIb bacteriocins previously described in other this collagen adhesive protein has also been reported to block 1660
1604 L. salivarius strains (O’Shea et al., 2011) but also with bacteriocins the C1-dependent complement activation (Kang et al., 2013), 1661
1605 blp1α/blp1β of L. salivarius BGHO1 (Busarcevic and Dalgalarrondo, the antagonism that L. plantarum shows against BCG intake 1662
1606 2012) and ThmA/ThmB (Thermophilin 13) of Streptococcus could be caused by competition not only for lectin receptors 1663
1607 thermophilus (Marciset et al., 1997). Our two L. salivarius but also for the classical complement activation pathway. 1664
1608 bacteriocins contain the double-glycine leader sequence of class The reason why L. casei increases BCG phagocytosis is intriguing 1665
1609 II bacteriocins but, in contrast to two-peptide bacteriocins (class and could be due to many different factors including the expression 1666
1610 IIb), their operons carry immunity genes for each of the bacteriocin of spaD, a fimbrial protein gene that we have identified in its 1667
1611 precursors. As these bacteriocins also lack the YGNGV-C consensus genome. This protein shows a very high similarity with the 1668
1612 sequence of class IIa bacteriocins the bacteriocin cluster was backbone-pilin subunit spaD, and fimbriae (or pili) of lactobacilli 1669
1613 classified as a single-peptide bacteriocin (class IId). The evidence have been reported to facilitate phagocytosis in macrophages 1670
1614 that bacteriocins blp1α/blp1β are produced only after culturing via integrin CD11b/CD18 (Vargas Garcia et al., 2015), also known 1671
1615 in a very chemically defined medium and that bacteriocins as complement receptor 3 (CR3). On the other hand, CR3 may 1672
1616 ThmA/ThmB function without a bacterial membrane receptor act as a negative regulator of C-type lectin receptors (Zhang 1673
1617 may also explain the absence of antimycobacterial activity observed et al., 2018) and seems not to alter the progression of 1674
1618 with the L. salivarius metabolites at neutral pH. M. tuberculosis infection (Hu et al., 2000). Therefore, fimbriae 1675
1619 Another important aspect that is worth mentioning is the could promote BCG macrophage uptake through indirect positive 1676
1620 fact that nutrient deprivation caused by lactobacilli metabolism collaboration with main bTB phagocytic receptors such as lectins. 1677
1621 seems to have no influence on the survival of BCG. The viability Phagocytic receptors that could have no significant influence 1678
1622 of BCG that we have recorded following incubation in on BCG intake might include sensors for sialic acid recognition 1679
1623 pH7-adjusted supernatants from lactobacilli cultures, remains as both L. plantarum and casei contain the serin-rich adhesin 1680
1624 unaffected. In addition, lactobacilli grow well in the presence gene sraP in their corresponding genomes (Kline et al., 2009). 1681
1625 of BCG metabolites, suggesting that the metabolic pathways Isolates of L. salivarius seem to have no interaction with 1682
1626 of Lactobacillus and M. bovis have no cross-interference. phagocytes as they caused no significant effects on the BCG 1683
1627 Lactobacilli, as many other lactic acid bacteria, have a relatively intake, neither on the BCG binding. By contrast, L. plantarum 1684
1628 simple metabolism that converts sugars to pyruvate via the and L. casei clearly stimulated phagocytosis, as explained above, 1685
1629 glycolytic pathway, generating energy (Papagianni, 2012b), as well as BCG binding. These two lactobacilli species also 1686
1630 whereas mycobacteria shows a very complex, but flexible, central altered significantly the porcine blood profile. Lactobacilli are 1687
1631 carbon metabolism that generates energy from glycolysis, known to activate macrophages via Toll-like Receptors (TLR) 1688
1632 gluconeogenesis, the pentose phosphate pathway, and the TCA and our 3 Lactobacillus species contain the genes ltaS1 and 1689
1633 pathway depending on the resources available (Cumming and ltaS2 involved in the synthesis of lipoteichoic acid (LTA), a 1690
1634 Steyn, 2015). These metabolic facts, together with the evidence major constituent of the cell wall that acts as a TLR2 stimulator 1691
1635 that acidic pH has no in vitro anti-mycobacterial effect, reinforce (Sengupta et al., 2013). However, L. plantarum and L. casei 1692
1636 our hypothesis that lactobacilli exert antimicrobial activity also harbor genes encoding other components of the cell wall 1693
1637 against BCG through synergistic mechanisms that include and the cytoplasmic membrane that are absent in L. salivarius, 1694
1638 combination of acidity with different metabolites such as organic such as the L. casei spaD-like fimbrial protein and the genes 1695
1639 acids, hydrogen peroxide, ethanol and bacteriocins. tagBFGH associated with the biosynthesis of cell wall teichoic 1696
1640 We finally determined the phagocytic response to BCG in acids (WTA) in L. plantarum. Fimbriae and WTA are capable 1697
1641 the presence of lactobacilli. Isolates of L. plantarum and L. to activate macrophages via TLR5 and 2, respectively (Ganguli 1698
1642 casei had a significantly opposite effect on BCG phagocytosis. et al., 2015; Hevia et al., 2015; Yu et al., 2015) and, under 1699
1643 L. plantarum decreased the BCG intake, whereas L. casei our experimental conditions, their contribution towards phagocyte 1700
1644 increased the phagocytic response, suggesting a completely stimulation could be much more significant than LTA. TLR 1701
1645 different interaction between these two species and the activation may collaborate with phagocytic receptors with 1702
1646 phagocytes. Therefore, we believe that L. plantarum and L. subsequent implications on the uptake process (Gordon, 2016). 1703
1647 casei may be recognized by different phagocytic receptors that, 1704
1648 to a greater or lesser extent, could also be involved in the 1705
1649 recognition of BCG. Phagocyte internalization is clearly beneficial CONCLUSIONS 1706
1650 to the survival of M. tuberculosis complex species, which may 1707
1651 enter macrophages via different receptor molecules, including We started from the premise that commensal bacteria such as 1708
1652 complement receptors involved in the classical and alternative lactobacilli could play an important, and hitherto underappreciated 1709
1653 pathways such as C1 and C-type lectin receptors (Pieters, 2008; role in the outcome of bTB in wild boar. In our study we have 1710

1711 found that lactobacilli isolated from wild boar influence the the Pirbright Institute (UK), where all animal procedures are 1768
1712 viability of M. bovis BCG and modify its phagocytic intake in covered by a license issued by the UK Home Office under 1769
1713 a species-dependent manner. In particular, isolates of L. plantarum the Animal (Scientific Procedures) Act1986. 1770
1714 showed antimicrobial and immunomodulatory properties that 1771
1715 could antagonize M. bovis survival. The genome of these isolates 1772
1716 revealed the presence of two-peptide bacteriocins and a collagen AUTHOR CONTRIBUTIONS 1773
1717 adhesive protein that could act as antimycobacterials and innate 1774
1718 immunomodulators; a very important question that remains MB and TC planned, performed experiments, and edited the 1775
1719 to be elucidated. Our preliminary results have been generated manuscript. FM-E designed experiments, aided in data analysis, 1776
1720 from reductionist in vitro assays, but bring positive prospects and aided in preparing and editing the manuscript. WG-J and 1777
1721 with regards to the potential use of lactobacilli as an additional PF-L conducted the sampling and edited the manuscript. JR 1778
1722 competitive pressure to control bTB in wild boar. In this respect, and DR designed experiments and aided in preparing and 1779
1723 in vitro and in vivo work with pathogenic M. bovis will be needed editing the manuscript. JG-M designed and performed 1780
1724 to further explore this possibility. Oral administration of experiments, aided in data analysis, and prepared and edited 1781
1725 lactobacilli with antimycobacterial activity could reduce the gut the manuscript. All authors read and approved the 1782
1726 burden of M. bovis, thus reducing the risk of transmission of final manuscript. 1783
1727 bTB between domestic and wild animals, provided that fecal 1784
1728 shedding is one of the main excretion routes of mycobacteria 1785
1729 (Santos et al., 2015). FUNDING 1786 Q7
1730 1787 Q13
1731 This study was funded by the following Spanish institutions: 1788
Q8 1732 ETHICS STATEMENT Fundación Tatiana Pérez de Guzmán el Bueno, Ministerio de 1789
1733 Economía, Industria y Competitividad and CDTi (Centro para 1790
1734 All experiments included in this study involve no animals and el Desarrollo Tecnológico Industrial; IDI-20170896). 1791
1735 the sampling procedures were performed under safe and 1792
1736 protective legal regulations. Fecal samples were collected from 1793
1737 30 wild boar of which 20 were live animals and the remainder ACKNOWLEDGMENTS 1794
1738 10 dead after being hunted in legal recreational events on 1795
1739 which we did not take any participation at all. The samples We would like to express our gratitude to Dr. Arnoud Van 1796
1740 from the 20 live animals were taken from young wild boars Vliet (School of Veterinary Medicine, University of Surrey) 1797
1741 aged between 4 and 8 months using feeding-traps under safe for helping us with the assembly and annotation of the genomes. 1798
1742 and protective legal regulations in accordance with the required 1799
1743 animal husbandry procedures that meet the guidelines set by 1800
1744 the appropriate Regional College of Veterinary Surgeons. The SUPPLEMENTARY MATERIAL 1801
Q9
1745 samples from the 10 dead animals were randomly collected 1802
1746 among others aging between 1 and 3 years old by registered The Supplementary Material for this article can be found online 1803
1747 veterinary surgeons at official certified abattoirs. The porcine at: https://www.frontiersin.org/articles/10.3389/fmicb.2019.01663/ 1804
1748 blood was collected in heparinized tubes from healthy pigs at full#supplementary-material 1805
1749 1806
1750
1807
1751
REFERENCES Aranaz, A., De Juan, L., Montero, N., Sanchez, C., Galka, M., Delso, C.,
1808
1752 et al. (2004). Bovine tuberculosis (Mycobacterium bovis) in wildlife in 1809
1753 Acevedo-Whitehouse, K., Vicente, J., Gortazar, C., Hofle, U., Fernandez-De-Mera, Spain. J. Clin. Microbiol. 42, 2602–2608. doi: 10.1128/JCM.42.6.2602- 1810
1754 I. G., and Amos, W. (2005). Genetic resistance to bovine tuberculosis in the 2608.2004 1811
Iberian wild boar. Mol. Ecol. 14, 3209–3217. doi: 10.1111/j.1365-294X.2005.02656.x Ayele, W. Y., Neill, S. D., Zinsstag, J., Weiss, M. G., and Pavlik, I. (2004). Q16
1755 1812
Q15 Aktas, B., De Wolfe, T. J., Tandee, K., Safdar, N., Darien, B. J., and Steele, J. L. Bovine tuberculosis: an old disease but a new threat to Africa. Int. J. Tuberc.
1756 1813
(2015). The effect of Lactobacillus casei 32G on the mouse cecum microbiota Lung Dis. 8, 924–937.
1757 and innate immune response is dose and time dependent. PLoS One 10. Bankevich, A., Nurk, S., Antipov, D., Gurevich, A. A., Dvorkin, M., Kulikov, A. S., 1814
1758 doi: 10.1371/journal.pone.0145784 et al. (2012). SPAdes: a new genome assembly algorithm and its applications 1815
1759 Alakomi, H. L., Skytta, E., Saarela, M., Mattila-Sandholm, T., Latva-Kala, K., to single-cell sequencing. J. Comput. Biol. 19, 455–477. doi: 10.1089/ 1816
and Helander, I. M. (2000). Lactic acid permeabilizes gram-negative bacteria cmb.2012.0021
1760 1817
by disrupting the outer membrane. Appl. Environ. Microbiol. 66, 2001–2005. Bene, K. P., Kavanaugh, D. W., Leclaire, C., Gunning, A. P., Mackenzie, D. A.,
1761 1818
doi: 10.1128/aem.66.5.2001-2005.2000 Wittmann, A., et al. (2017). Lactobacillus reuteri surface mucus adhesins
1762 Alvarez-Sieiro, P., Montalban-Lopez, M., Mu, D., and Kuipers, O. P. (2016). upregulate inflammatory responses through interactions with innate 1819
1763 Bacteriocins of lactic acid bacteria: extending the family. Appl. Microbiol. C-type lectin receptors. Front. Microbiol. 8:321. doi: 10.3389/fmicb. 1820
1764 Biotechnol. 100, 2939–2951. doi: 10.1007/s00253-016-7343-9 2017.00321 1821
Anderssen, E. L., Diep, D. B., Nes, I. F., Eijsink, V. G., and Nissen-Meyer, J. Borsuk, S., Mendum, T. A., Fagundes, M. Q., Michelon, M., Cunha, C. W.,
1765 1822
(1998). Antagonistic activity of Lactobacillus plantarum C11: two new two- McFadden, J., et al. (2007). Auxotrophic complementation as a selectable
1766 peptide bacteriocins, plantaricins EF and JK, and the induction factor marker for stable expression of foreign antigens in Mycobacterium bovis 1823
1767 plantaricin A. Appl. Environ. Microbiol. 64, 2269–2272. BCG. Tuberculosis 87, 474–480. doi: 10.1016/j.tube.2007.07.006 1824

1825 Broadbent, J. R., Neeno-Eckwall, E. C., Stahl, B., Tandee, K., Cai, H., Morovic, W., Han, N., Qiang, Y., and Zhang, W. (2016). ANItools web: a web tool for fast 1882
1826
et al. (2012). Analysis of the Lactobacillus casei supragenome and its influence genome comparison within multiple bacterial strains. Database 2016. doi: 1883
in species evolution and lifestyle adaptation. BMC Genomics 13:533. doi: 10.1093/database/baw084
1827 1884
10.1186/1471-2164-13-533 Harris, H. M. B., Bourin, M. J. B., Claesson, M. J., and O’toole, P. W. (2017).
1828 Brosch, R., Gordon, S. V., Buchrieser, C., Pym, A. S., Garnier, T., and Cole, S. T. Phylogenomics and comparative genomics of Lactobacillus salivarius, a mammalian 1885
1829 (2000). Comparative genomics uncovers large tandem chromosomal gut commensal. Microb. Genom. 3:e000115. doi: 10.1099/mgen.0.000115 1886
1830 duplications in Mycobacterium bovis BCG Pasteur. Yeast 17, 111–123. doi: Hegarty, J. W., Guinane, C. M., Ross, R. P., Hill, C., and Cotter, P. D. (2016). 1887
10.1002/1097-0061(20000630)17:2<111::AID-YEA17>3.0.CO;2-G Bacteriocin production: a relatively unharnessed probiotic trait? F1000Res.
1831 1888
Busarcevic, M., and Dalgalarrondo, M. (2012). Purification and genetic 5:2587. doi: 10.12688/f1000research.9615.1
1832 1889
characterisation of the novel bacteriocin LS2 produced by the human oral Herbin, S., Mathieu, F., Brule, F., Branlant, C., Lefebvre, G., and Lebrihi, A.
1833 strain Lactobacillus salivarius BGHO1. Int. J. Antimicrob. Agents 40, 127–134. (1997). Characteristics and genetic determinants of bacteriocin activities 1890
1834 doi: 10.1016/j.ijantimicag.2012.04.011 produced by Carnobacterium piscicola CP5 isolated from cheese. Curr. 1891
1835 Cambier, C. J., Falkow, S., and Ramakrishnan, L. (2014). Host evasion and Microbiol. 35, 319–326. doi: 10.1007/s002849900262 1892
exploitation schemes of Mycobacterium tuberculosis. Cell 159, 1497–1509. Hertzberger, R., Arents, J., Dekker, H. L., Pridmore, R. D., Gysler, C.,
1836 1893
doi: 10.1016/j.cell.2014.11.024 Kleerebezem, M., et al. (2014). H(2)O(2) production in species of the
1837 1894
Corner, L. A. (2006). The role of wild animal populations in the epidemiology Lactobacillus acidophilus group: a central role for a novel NADH-dependent
1838 of tuberculosis in domestic animals: how to assess the risk. Vet. Microbiol. flavin reductase. Appl. Environ. Microbiol. 80, 2229–2239. doi: 10.1128/ 1895
1839 112, 303–312. doi: 10.1016/j.vetmic.2005.11.015 AEM.04272-13 1896
1840 Cosma, C. L., Humbert, O., and Ramakrishnan, L. (2004). Superinfecting Hevia, A., Delgado, S., Sanchez, B., and Margolles, A. (2015). Molecular players 1897
mycobacteria home to established tuberculous granulomas. Nat. Immunol. involved in the interaction between beneficial bacteria and the immune
1841 1898
5, 828–835. doi: 10.1038/ni1091 system. Front. Microbiol. 6. doi: 10.3389/fmicb.2015.01285
1842 Cosma, C. L., Sherman, D. R., and Ramakrishnan, L. (2003). The secret lives Hochwind, K., Weinmaier, T., Schmid, M., Van Hemert, S., Hartmann, A., 1899
1843 of the pathogenic mycobacteria. Annu. Rev. Microbiol. 57, 641–676. doi: Rattei, T., et al. (2012). Draft genome sequence of Lactobacillus casei W56. 1900
1844 10.1146/annurev.micro.57.030502.091033 J. Bacteriol. 194:6638. doi: 10.1128/JB.01386-12 1901
1845
Cotter, P. D., Hill, C., and Ross, R. P. (2005). Bacteriocins: developing innate Hu, C., Mayadas-Norton, T., Tanaka, K., Chan, J., and Salgame, P. (2000). 1902
immunity for food. Nat. Rev. Microbiol. 3, 777–788. doi: 10.1038/nrmicro1273 Mycobacterium tuberculosis infection in complement receptor 3-deficient
1846 1903
Cumming, B. M., and Steyn, A. J. (2015). Metabolic plasticity of central carbon mice. J. Immunol. 165, 2596–2602. doi: 10.4049/jimmunol.165.5.2596
1847 metabolism protects mycobacteria. Proc. Natl. Acad. Sci. USA 112, 13135–13136. Jimenez, E., Martin, R., Maldonado, A., Martin, V., Gomez De Segura, A., 1904
1848 doi: 10.1073/pnas.1518171112 Fernandez, L., et al. (2010). Complete genome sequence of Lactobacillus 1905
1849 de la Rua-Domenech, R. (2006). Human Mycobacterium bovis infection in the salivarius CECT 5713, a probiotic strain isolated from human milk and 1906
United Kingdom: incidence, risks, control measures and review of the infant feces. J. Bacteriol. 192, 5266–5267. doi: 10.1128/JB.00703-10
1850 1907
zoonotic aspects of bovine tuberculosis. Tuberculosis 86, 77–109. doi: 10.1016/j. Kang, M., Ko, Y. P., Liang, X., Ross, C. L., Liu, Q., Murray, B. E., et al. (2013).
1851 1908
tube.2005.05.002 Collagen-binding microbial surface components recognizing adhesive matrix
1852 Diep, D. B., Havarstein, L. S., and Nes, I. F. (1996). Characterization of the molecule (MSCRAMM) of Gram-positive bacteria inhibit complement 1909
1853 locus responsible for the bacteriocin production in Lactobacillus plantarum activation via the classical pathway. J. Biol. Chem. 288, 20520–20531. doi: 1910
1854 C11. J. Bacteriol. 178, 4472–4483. 10.1074/jbc.M113.454462 1911
Diep, D. B., Straume, D., Kjos, M., Torres, C., and Nes, I. F. (2009). An Kleerebezem, M., Boekhorst, J., Van Kranenburg, R., Molenaar, D., Kuipers, O. P.,
1855 1912
overview of the mosaic bacteriocin pln loci from Lactobacillus plantarum. Leer, R., et al. (2003). Complete genome sequence of Lactobacillus plantarum
1856 1913
Peptides 30, 1562–1574. doi: 10.1016/j.peptides.2009.05.014 WCFS1. Proc. Natl. Acad. Sci. USA 100, 1990–1995. doi: 10.1073/pnas.0337704100
1857 Ekblad, B., Kyriakou, P. K., Oppegard, C., Nissen-Meyer, J., Kaznessis, Y. N., Kline, K. A., Falker, S., Dahlberg, S., Normark, S., and Henriques-Normark, B. 1914
1858 and Kristiansen, P. E. (2016). Structure-function analysis of the two-peptide (2009). Bacterial adhesins in host-microbe interactions. Cell Host Microbe 1915
1859 bacteriocin plantaricin EF. Biochemistry 55, 5106–5116. doi: 10.1021/acs. 5, 580–592. doi: 10.1016/j.chom.2009.05.011 1916
biochem.6b00588 Klose, V., Bayer, K., Kern, C., Goelß, F., Fibi, S., and Wegl, G. (2014). Antibiotic
1860 1917
Fayol-Messaoudi, D., Berger, C. N., Coconnier-Polter, M. H., Lievin-Le Moal, V., resistances of intestinal lactobacilli isolated from wild boars. Vet. Microbiol.
1861 and Servin, A. L. (2005). pH-, Lactic acid-, and non-lactic acid-dependent 168, 240–244. doi: 10.1016/j.vetmic.2013.11.014 1918
1862 activities of probiotic Lactobacilli against Salmonella enterica Serovar Leonard, M. T., Valladares, R. B., Ardissone, A., Gonzalez, C. F., Lorca, G. L., 1919
1863 Typhimurium. Appl. Environ. Microbiol. 71, 6008–6013. doi: 10.1128/AEM.71.10. and Triplett, E. W. (2014). Complete genome sequences of Lactobacillus 1920
1864
6008-6013.2005 johnsonii strain N6.2 and Lactobacillus reuteri strain TD1. Genome Announc 1921
Flynn, S., Van Sinderen, D., Thornton, G. M., Holo, H., Nes, I. F., and 2. doi: 10.1128/genomeA.00397-14
1865 1922
Collins, J. K. (2002). Characterization of the genetic locus responsible for Liu, W., Pang, H., Zhang, H., and Cai, Y. (2014). “Biodiversity of lactic acid Q17
1866 the production of ABP-118, a novel bacteriocin produced by the probiotic bacteria” in Lactic Acid Bacteria (Springer), 103–203. 1923
1867 bacterium Lactobacillus salivarius subsp. salivarius UCC118. Microbiology Mackenzie, D. A., McLay, K., Roos, S., Walter, J., Swarbreck, D., Drou, N., 1924
1868 148, 973–984. doi: 10.1099/00221287-148-4-973 et al. (2014). Draft genome sequence of a novel Lactobacillus salivarius 1925
Ganguli, K., Collado, M. C., Rautava, J., Lu, L., Satokari, R., Von Ossowski, I., strain isolated from piglet. Genome Announc. 2. doi: 10.1128/genomeA.01231-13
1869 1926
et al. (2015). Lactobacillus rhamnosus GG and its SpaC pilus adhesin modulate Macuamule, C., Wiid, I., Van Helden, P., Tanner, M., and Witthuhn, R. (2016).
1870 1927
inflammatory responsiveness and TLR-related gene expression in the fetal Effect of milk fermentation by kefir grains and selected single strains of
1871 human gut. Pediatr. Res. 77, 528–535. doi: 10.1038/pr.2015.5 lactic acid bacteria on the survival of Mycobacterium bovis BCG. Int. J. 1928
1872 Golneshin, A., Adetutu, E., Ball, A. S., May, B. K., Van, T. T., and Smith, A. T. Food Microbiol. 217, 170–176. doi: 10.1016/j.ijfoodmicro.2015.10.024 1929
1873 (2015). Complete genome sequence of Lactobacillus plantarum strain B21, Maldonado, A., Jimenez-Diaz, R., and Ruiz-Barba, J. L. (2004a). Induction of 1930
a bacteriocin-producing strain isolated from Vietnamese fermented sausage plantaricin production in Lactobacillus plantarum NC8 after coculture with
1874 1931
Nem Chua. Genome Announc 3. doi: 10.1128/genomeA.00055-15 specific Gram-positive bacteria is mediated by an autoinduction mechanism.
1875 1932
Gordon, S. (2016). Phagocytosis: an immunobiologic process. Immunity 44, J. Bacteriol. 186, 1556–1564. doi: 10.1128/jb.186.5.1556-1564.2004
1876 463–475. doi: 10.1016/j.immuni.2016.02.026 Maldonado, A., Ruiz-Barba, J. L., and Jimenez-Diaz, R. (2004b). Production 1933
1877 Gueimonde, M., Sanchez, B., G de Los Reyes-Gavilán, C., and Margolles, A. of plantaricin NC8 by Lactobacillus plantarum NC8 is induced in the presence 1934
1878 (2013). Antibiotic resistance in probiotic bacteria. Front. Microbiol. 4:202. of different types of gram-positive bacteria. Arch. Microbiol. 181, 8–16. doi: 1935
doi: 10.3389/fmicb.2013.00202 10.1007/s00203-003-0606-8
1879 1936
Gurevich, A., Saveliev, V., Vyahhi, N., and Tesler, G. (2013). QUAST: quality Maldonado-Barragan, A., Caballero-Guerrero, B., Lucena-Padros, H., and
1880 assessment tool for genome assemblies. Bioinformatics 29, 1072–1075. doi: Ruiz-Barba, J. L. (2013). Induction of bacteriocin production by coculture 1937
1881 10.1093/bioinformatics/btt086 is widespread among plantaricin-producing Lactobacillus plantarum strains 1938

1939 with different regulatory operons. Food Microbiol. 33, 40–47. doi: 10.1016/j. Papagianni, M. (2012b). Recent advances in engineering the central carbon 1996
1940
fm.2012.08.009 metabolism of industrially important bacteria. Microb. Cell Factories 11:50. 1997
Mann, E., Schmitz-Esser, S., Zebeli, Q., Wagner, M., Ritzmann, M., and Metzler- doi: 10.1186/1475-2859-11-50
1941 1998
Zebeli, B. U. (2014). Mucosa-associated bacterial microbiome of the Parra, A., Garcia, A., Inglis, N. F., Tato, A., Alonso, J. M., Hermoso De Mendoza, M.,
1942 gastrointestinal tract of weaned pigs and dynamics linked to dietary calcium- et al. (2006). An epidemiological evaluation of Mycobacterium bovis infections 1999
1943 phosphorus. PLoS One 9:e86950. doi: 10.1371/journal.pone.0086950 in wild game animals of the Spanish Mediterranean ecosystem. Res. Vet. 2000
1944 Marakalala, M. J., Martinez, F. O., Pluddemann, A., and Gordon, S. (2018). Sci. 80, 140–146. doi: 10.1016/j.rvsc.2005.05.010 2001
Macrophage heterogeneity in the immunopathogenesis of tuberculosis. Front. Pessione, E. (2012). Lactic acid bacteria contribution to gut microbiota complexity:
1945 2002
Microbiol. 9:1028. doi: 10.3389/fmicb.2018.01028 lights and shadows. Front. Cell. Infect. Microbiol. 2:86. doi: 10.3389/
1946 2003
Marciset, O., Jeronimus-Stratingh, M. C., Mollet, B., and Poolman, B. (1997). fcimb.2012.00086
1947 Thermophilin 13, a nontypical antilisterial poration complex bacteriocin, Pieters, J. (2008). Mycobacterium tuberculosis and the macrophage: maintaining 2004
1948 that functions without a receptor. J. Biol. Chem. 272, 14277–14284. a balance. Cell Host Microbe 3, 399–407. doi: 10.1016/j.chom.2008.05.006 2005
1949 Mariam, S. H. (2009). Interaction between lactic acid bacteria and Mycobacterium Raftis, E. J., Forde, B. M., Claesson, M. J., and O’toole, P. W. (2014). Unusual 2006
bovis in Ethiopian fermented milk: insight into the fate of M. bovis. Appl. genome complexity in Lactobacillus salivarius JCM1046. BMC Genomics
1950 2007
Environ. Microbiol. 75, 1790–1792. doi: 10.1128/AEM.01943-08 15:771. doi: 10.1186/1471-2164-15-771
1951 2008
Q14 Marranzino, G., Villena, J., Salva, S., and Alvarez, S. (2012). Stimulation of Rao, M., Streur, T. L., Aldwell, F. E., and Cook, G. M. (2001). Intracellular
1952 macrophages by immunobiotic Lactobacillus strains: influence beyond the pH regulation by Mycobacterium smegmatis and Mycobacterium bovis BCG. 2009
1953 intestinal tract. Microbiol. Immunol. 56, 771–781. doi: 10.1111/j.1348-0421. Microbiology 147, 1017–1024. doi: 10.1099/00221287-147-4-1017 2010
1954 2012.00495.x Ribelles, P., Rodriguez, I., and Suarez, J. E. (2012). LysA2, the Lactobacillus 2011
Q18 Martens, K., Pugin, B., De Boeck, I., Spacova, I., Steelant, B., Seys, S. F., et al. casei bacteriophage A2 lysin is an endopeptidase active on a wide spectrum
1955 2012
(2018). Probiotics for the airways: potential to improve epithelial and immune of lactic acid bacteria. Appl. Microbiol. Biotechnol. 94, 101–110. doi: 10.1007/
1956 homeostasis. Allergy. doi: 10.1111/all.13495 s00253-011-3588-5 2013
1957 Martin, R., Jimenez, E., Olivares, M., Marin, M. L., Fernandez, L., Xaus, J., Rocha, D. J., Santos, C. S., and Pacheco, L. G. (2015). Bacterial reference genes 2014
1958 et al. (2006). Lactobacillus salivarius CECT 5713, a potential probiotic strain for gene expression studies by RT-qPCR: survey and analysis. Antonie Van 2015
1959
isolated from infant feces and breast milk of a mother-child pair. Int. J. Leeuwenhoek 108, 685–693. doi: 10.1007/s10482-015-0524-1 2016
Food Microbiol. 112, 35–43. doi: 10.1016/j.ijfoodmicro.2006.06.011 Rocha-Ramirez, L. M., Perez-Solano, R. A., Castanon-Alonso, S. L., Moreno
1960 2017
Martin, R., Miquel, S., Ulmer, J., Kechaou, N., Langella, P., and Bermudez- Guerrero, S. S., Ramirez Pacheco, A., Garcia Garibay, M., et al. (2017).
1961 Humaran, L. G. (2013). Role of commensal and probiotic bacteria in human Probiotic Lactobacillus strains stimulate the inflammatory response and 2018
1962 health: a focus on inflammatory bowel disease. Microb. Cell Factories 12:71. activate human macrophages. J. Immunol. Res. 2017:4607491. doi: 2019
1963 doi: 10.1186/1475-2859-12-71 10.1155/2017/4607491 2020
Martin-Hernando, M. P., Hofle, U., Vicente, J., Ruiz-Fons, F., Vidal, D., Barral, M., Roosaare, M., Vaher, M., Kaplinski, L., Mols, M., Andreson, R., Lepamets, M.,
1964 2021
et al. (2007). Lesions associated with Mycobacterium tuberculosis complex et al. (2017). StrainSeeker: fast identification of bacterial strains from raw
1965 2022
infection in the European wild boar. Tuberculosis 87, 360–367. doi: 10.1016/j. sequencing reads using user-provided guide trees. PeerJ 5:e3353. doi: 10.7717/
1966 tube.2007.02.003 peerj.3353 2023
1967 Matos, A. C., Andrade, S., Figueira, L., Matos, M., Pires, M. A., Coelho, A. C., Sable, S., and Lortal, S. (1995). The lysins of bacteriophages infecting lactic 2024
1968 et al. (2016). Mesenteric lymph node granulomatous lesions in naturally acid bacteria. Appl. Microbiol. Biotechnol. 43, 1–6. 2025
infected wild boar (Sus scrofa) in Portugal–histological, immunohistochemical Saenz, Y., Rojo-Bezares, B., Navarro, L., Diez, L., Somalo, S., Zarazaga, M.,
1969 2026
and molecular aspects. Vet. Immunol. Immunopathol. 173, 21–26. doi: 10.1016/j. et al. (2009). Genetic diversity of the pln locus among oenological Lactobacillus
1970 2027
vetimm.2016.03.012 plantarum strains. Int. J. Food Microbiol. 134, 176–183. doi: 10.1016/j.
1971 Maze, A., Boel, G., Zuniga, M., Bourand, A., Loux, V., Yebra, M. J., et al. ijfoodmicro.2009.06.004 2028
1972 (2010). Complete genome sequence of the probiotic Lactobacillus casei strain Santos, N., Almeida, V., Gortazar, C., and Correia-Neves, M. (2015). Patterns 2029
1973 BL23. J. Bacteriol. 192, 2647–2648. doi: 10.1128/JB.00076-10 of Mycobacterium tuberculosis-complex excretion and characterization of 2030
Menin, A., Fleith, R., Reck, C., Marlow, M., Fernandes, P., Pilati, C., et al. super-shedders in naturally-infected wild boar and red deer. Vet. Res. 46:129.
1974 2031
(2013). Asymptomatic cattle naturally infected with Mycobacterium bovis doi: 10.1186/s13567-015-0270-4
1975 present exacerbated tissue pathology and bacterial dissemination. PLoS One Seemann, T. (2014). Prokka: rapid prokaryotic genome annotation. Bioinformatics 2032
1976 8:e53884. doi: 10.1371/journal.pone.0053884 30, 2068–2069. doi: 10.1093/bioinformatics/btu153 2033
1977 Mohamadzadeh, M., Olson, S., Kalina, W. V., Ruthel, G., Demmin, G. L., Sengupta, R., Altermann, E., Anderson, R. C., McNabb, W. C., Moughan, P. J., 2034
1978
Warfield, K. L., et al. (2005). Lactobacilli activate human dendritic cells and Roy, N. C. (2013). The role of cell surface architecture of lactobacilli 2035
that skew T cells toward T helper 1 polarization. Proc. Natl. Acad. Sci. USA in host-microbe interactions in the gastrointestinal tract. Mediat. Inflamm.
1979 2036
102, 2880–2885. doi: 10.1073/pnas.0500098102 2013:237921. doi: 10.1155/2013/237921
1980 Naranjo, V., Gortazar, C., Vicente, J., and De La Fuente, J. (2008). Evidence Sosunov, V., Mischenko, V., Eruslanov, B., Svetoch, E., Shakina, Y., Stern, N., 2037
1981 of the role of European wild boar as a reservoir of Mycobacterium tuberculosis et al. (2007). Antimycobacterial activity of bacteriocins and their complexes 2038
1982 complex. Vet. Microbiol. 127, 1–9. doi: 10.1016/j.vetmic.2007.10.002 with liposomes. J. Antimicrob. Chemother. 59, 919–925. doi: 10.1093/jac/ 2039
Nissen-Meyer, J., Oppegard, C., Rogne, P., Haugen, H. S., and Kristiansen, P. E. dkm053
1983 2040
(2010). Structure and mode-of-action of the two-peptide (Class-IIb) Stedman, A. (2017). BCG as a vaccine vehicle to deliver porcine immunity to
1984 2041
bacteriocins. Probiotics Antimicrob. Proteins 2, 52–60. doi: 10.1007/ african swine fever virus.
1985 s12602-009-9021-z Stedman, A., Maluquer De Motes, C., Lesellier, S., Dalley, D., Chambers, M., 2042
1986 Oppegard, C., Kjos, M., Veening, J. W., Nissen-Meyer, J., and Kristensen, T. and Gutierrez-Merino, J. (2018). Lactic Acid Bacteria isolated from European 2043
1987 (2016). A putative amino acid transporter determines sensitivity to the badgers (Meles meles) reduce the viability and survival of Bacillus Calmette- 2044
two-peptide bacteriocin plantaricin JK. Microbiology 5, 700–708. doi: 10.1002/ Guerin (BCG) vaccine and influence the immune response to BCG in a
1988 2045
mbo3.363 human macrophage model. BMC Microbiol. 18:74. doi: 10.1186/
1989 2046
O’Shea, E. F., O’connor, P. M., Raftis, E. J., O’toole, P. W., Stanton, C., Cotter, P. D., s12866-018-1210-z
1990 et al. (2011). Production of multiple bacteriocins from a single locus by Stefanovic, E., Casey, A., Cotter, P., Cavanagh, D., Fitzgerald, G., and McAuliffe, O. 2047
1991 gastrointestinal strains of Lactobacillus salivarius. J. Bacteriol. 193, 6973–6982. (2016). Draft genome sequence of Lactobacillus casei DPC6800, an isolate 2048
1992 doi: 10.1128/JB.06221-11 with the potential to diversify flavor in cheese. Genome Announc. 4. doi: 2049
Papagianni, M. (2012a). Metabolic engineering of lactic acid bacteria for the 10.1128/genomeA.00063-16
1993 2050
production of industrially important compounds. Comput. Struct. Biotechnol. J. Tai, H. F., Foo, H. L., Abdul Rahim, R., Loh, T. C., Abdullah, M. P., and
1994 3:e201210003. doi: 10.5936/csbj.201210003 Yoshinobu, K. (2015). Molecular characterisation of new organisation of 2051
1995 2052

2053 plnEF and plw loci of bacteriocin genes harbour concomitantly in Lactobacillus Xiao, L., Estelle, J., Kiilerich, P., Ramayo-Caldas, Y., Xia, Z., Feng, Q., et al. 2110 Q19
2054
plantarum I-UL4. Microb. Cell Factories 14:89. doi: 10.1186/s12934-015-0280-y (2016). A reference gene catalogue of the pig gut microbiome. Nat. 2111
Todorov, S. D., Botes, M., Guigas, C., Schillinger, U., Wiid, I., Wachsman, M. B., Microbiol.:16161. doi: 10.1038/nmicrobiol.2016.161
2055 2112
et al. (2008). Boza, a natural source of probiotic lactic acid bacteria. Yu, X., Jaatinen, A., Rintahaka, J., Hynonen, U., Lyytinen, O., Kant, R., et al.
2056 J. Appl. Microbiol. 104, 465–477. doi: 10.1111/j.1365-2672.2007.03558.x (2015). Human gut-commensalic Lactobacillus ruminis ATCC 25644 displays 2113
2057 Todorov, S. D., Franco, B. D., and Wiid, I. J. (2014). In vitro study of beneficial sortase-assembled surface piliation: phenotypic characterization of its fimbrial 2114
2058 properties and safety of lactic acid bacteria isolated from Portuguese fermented operon through in silico predictive analysis and recombinant expression 2115
meat products. Benef. Microbes 5, 351–366. doi: 10.3920/BM2013.0030 in Lactococcus lactis. PLoS One 10:e0145718. doi: 10.1371/journal.
2059 2116
van Heel, A. J., De Jong, A., Montalban-Lopez, M., Kok, J., and Kuipers, O. P. pone.0145718
2060 2117
(2013). BAGEL3: automated identification of genes encoding bacteriocins Zhang, Q., Lee, W. B., Kang, J. S., Kim, L. K., and Kim, Y. J. (2018). Integrin
2061 and (non-)bactericidal posttranslationally modified peptides. Nucleic Acids CD11b negatively regulates Mincle-induced signaling via the Lyn-SIRPalpha- 2118
2062 Res. 41, W448–W453. doi: 10.1093/nar/gkt391 SHP1 complex. Exp. Mol. Med. 50:e439. doi: 10.1038/emm.2017.256 2119
2063 Van Tassell, M. L., and Miller, M. J. (2011). Lactobacillus adhesion to mucus. 2120
Nutrients 3, 613–636. doi: 10.3390/nu3050613 Conflict of Interest Statement: The authors declare that the research was conducted
2064 2121
Vargas Garcia, C. E., Petrova, M., Claes, I. J., De Boeck, I., Verhoeven, T. L., in the absence of any commercial or financial relationships that could be construed
2065 2122
Dilissen, E., et al. (2015). Piliation of Lactobacillus rhamnosus GG promotes as a potential conflict of interest.
2066 adhesion, phagocytosis, and cytokine modulation in macrophages. Appl. 2123
2067 Environ. Microbiol. 81, 2050–2062. doi: 10.1128/AEM.03949-14 Copyright © 2019 Bravo, Combes, Martinez-Estrada, Cerrato, Rey, Garcia-Jimenez, 2124
2068 Ward, D. J., and Somkuti, G. A. (1995). Characterization of a bacteriocin Fernandez-Llario, Risco and Gutierrez-Merino. This is an open-access article distributed 2125
produced by Streptococcus thermophilus ST134. Appl. Microbiol. Biotechnol. under the terms of the Creative Commons Attribution License (CC BY). The use,
2069 2126
43, 330–335. distribution or reproduction in other forums is permitted, provided the original
2070 Ward, L. J., and Timmins, M. J. (1999). Differentiation of Lactobacillus casei, author(s) and the copyright owner(s) are credited and that the original publication 2127
2071 Lactobacillus paracasei and Lactobacillus rhamnosus by polymerase chain in this journal is cited, in accordance with accepted academic practice. No use, 2128
2072 reaction. Lett. Appl. Microbiol. 29, 90–92. doi: 10.1046/j.1365-2672.1999.00586.x distribution or reproduction is permitted which does not comply with these terms. 2129
2073 2130
2074 2131
2075 2132
2076 2133
2077 2134
2078 2135
2079 2136
2080 2137
2081 2138
2082 2139
2083 2140
2084 2141
2085 2142
2086 2143
2087 2144
2088 2145
2089 2146
2090 2147
2091 2148
2092 2149
2093 2150
2094 2151
2095 2152
2096 2153
2097 2154
2098 2155
2099 2156
2100 2157
2101 2158
2102 2159
2103 2160
2104 2161
2105 2162
2106 2163
2107 2164
2108 2165
2109 2166

Author&#39;s Proof

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Author&#39;s Proof

Uploaded by

Copyright:

Available Formats

Author’s Proof

We do not accept corrections in the form of edited manuscripts.

If you have any questions, please contact microbiology.production.office@frontiersin.org.

Author Queries Form

Q2 Confirm that the email address in your correspondence section is

Q4 If you decide to use previously published, copyrighted figures in your

Q7 Ensure to add all grant numbers and funding information, as after

Q8 Ensure, if it applies to your study, the ethics statement is included in

Q11 Please provide department names for Affiliations 1–3.

Q12 Please cite “Table 4” inside the text.

Q13 We have split the “Acknowledgments” section to “Acknowledgments”

Mycobacterium bovis Bacille

Frontiers in Microbiology | www.frontiersin.org 1 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 2 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 3 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 4 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 5 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 6 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 7 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 8 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 9 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 10 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 11 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 12 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 13 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 14 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 15 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 16 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 17 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 18 July 2019 | Volume 10 | Article 1663

Frontiers in Microbiology | www.frontiersin.org 19 July 2019 | Volume 10 | Article 1663

You might also like

Author's Proof

Author's Proof