Euphytica (2012) 187:437–447
DOI 10.1007/s10681-012-0738-5
Identification of origin and analysis of population structure
of field-selected imidazolinone-herbicide resistant red rice
(Oryza sativa)
Ives Clayton Gomes dos Reis Goulart •
Marcelo Teixeira Pacheco • Anderson Luis Nunes
Aldo Merotto Jr
Received: 14 April 2012 / Accepted: 5 June 2012 / Published online: 17 June 2012
Ó Springer Science+Business Media B.V. 2012
Abstract Several red rice biotypes have evolved
resistance to imidazolinone herbicides. The origin of
resistance has been attributed to gene flow from the
herbicide-resistant rice cultivars, but independent
evolution of spontaneous mutation can also contribute
to the herbicide resistance. The objective of this study
was to quantify the occurrence of gene flow and
independent selection as the mechanisms of origin of
imidazolinone-resistance in red rice to correctly define
the management practices for red rice control. Three
single nucleotide polymorphism markers were used to
identify acetolactate synthase (ALS) gene mutations,
and four simple sequence repeat markers were used to
identify hybrids of imidazolinone-resistant rice culti-
vars and red rice. In addition, genetic diversity and
population structure analyses were performed. Artifi-
cial hybrids were used as controls. Gene flow was the
I. C. G. dos Reis Goulart
Programa de Pós-graduação em Fitotecnia, Federal
University of Rio Grande do Sul. UFRGS, Embrapa
Forestry, Colombo, PR, Brazil
M. T. Pacheco  A. Merotto Jr (&)
Crop Science Department, Federal University of Rio
Grande do Sul. UFRGS, 7712 Bento Goncalves Ave.
Agronomia, Porto Alegre, RS 91501-970, Brazil
e-mail: merotto@ufrgs.br
A. L. Nunes
Programa de Pós-graduação em Fitotecnia, Federal
University of Rio Grande do Sul. UFRGS. IFRS, Sertão,
RS, Brazil
•
main origin of imidazolinone herbicide resistance, but
independent selection occurred in 1.1 % of the
evaluated red rice plants. Two red rice plants that
independently evolved herbicide resistance had the
ALS gene mutation, Gly654Glu. Population structure
analysis also indicated intense gene flow from rice
cultivars to red rice, but some populations maintained
a high genetic identity based on a small amount of
gene introgression from the rice cultivars. These
results indicate the importance of adopting controls of
red rice escapees to avoid gene flow from the
imidazolinone-resistant rice, and the necessity of
biotechnological approaches to mitigating gene flow
in the development of new herbicide-resistant rice
cultivars.
Keywords Acetolactate synthase  Clearfield rice 
Herbicide resistance  Imazethapyr  Outcrossing 
SNP molecular markers
Introduction
Red rice consists of biotypes of Oryza sativa that have
different weed-like traits in comparison to cultivated
rice. These traits are mainly related to higher tillering
rates (Fleck et al. 2008), taller plants (Zhang et al.
2006), more seed shattering (Thurber et al. 2010),
longer seed dormancy (Sweeney and Mccouch 2007),
123
438
and presence of red pericarps (Gross et al. 2010). The
origin of red rice is attributed to the cultivated species,
O. sativa spp. japonica, and the wild species, O. nivara
and O. rufipogon (Vaughan et al. 2001). Later studies,
however, have confirmed that the origin of red rice in
the US is mainly related to O. sativa spp. japonica
instead of the wild species (Gross et al. 2010; Reagon
et al. 2010).
Red rice is considered a troublesome weed in rice
paddy fields because it decreases the rice grain yield
by 20 %, on average, in medium-infested areas, and
has a potential loss of 90 % in high-infested areas
(Fleck et al. 2008). In the 1990s, imidazolinone
herbicide-resistant rice cultivars were developed by
induced mutation of the acetolactate synthase (ALS;
EC 4.1.3.18; also known as acetohydroxyacid syn-
thase, or AHAS) gene (Shivrain et al. 2009). Several
imidazolinone-resistant rice cultivars currently con-
tain the mutations Ala122Thr, Gly654Glu, and Ser653-
Asn in the ALS gene (Roso et al. 2010). These
cultivars, in combination with imidazolinone herbi-
cides, provide selective control of red rice in rice
paddy fields. This technology has been used in
approximately 1.1 million ha in Brazil and the US,
and it is under development in several countries in
Latin America and Central Europe. The continued use
of those herbicides, however, causes high selective
pressure on red rice biotypes and other weeds,
resulting in the evolution of herbicide-resistant pop-
ulations (Shivrain et al. 2007; Gealy et al. 2009;
Menezes et al. 2009). In addition, the gene flow from
imidazolinone-resistant rice cultivars to red rice is
contributing to red rice resistance to ALS-inhibiting
herbicides (Zhang et al. 2006).
Several ALS-inhibiting herbicide-resistant red rice
biotypes have been identified in rice fields in the US
(Zhang et al. 2008) and Brazil (Menezes et al. 2009).
In an assessment in South Brazil, 56 % of 228 red rice
populations were resistant to imazethapyr and imaza-
pic (Menezes et al. 2009). In these populations, the
predominant mechanism of resistance was an altered
target site, and about 80 % of the resistant red rice
plants had the same mutation as the IRGA 422 CL
cultivar, which was the most widely used cultivar
during the sampling period (Roso et al. 2010). These
results indicate that the origin of herbicide resistance
in red rice is related to the occurrence of gene flow
from herbicide-resistant cultivars. Nevertheless, inde-
pendent mutations in the ALS gene may also cause
123
Euphytica (2012) 187:437–447
herbicide resistance in weeds. However, there are no
studies that quantify these processes in red rice plants
naturally originated from in rice paddy fields and in
combination with population structure analysis. Imi-
dazolinone herbicide resistance in red rice is an
increasing problem, and it challenges the use of
herbicide-resistant rice cultivars in areas where this
technology is used. Information about the origin of
resistance is important for determining management
priorities for prevention the herbicide resistance
evolution in red rice and other weeds.
Several molecular markers have been used in
studies of the population dynamics of herbicide-
resistant weeds, and in the identification of gene
mutations related to herbicide resistance. Allele-
specific polymerase chain reaction (AS-PCR) assays
were developed to identify imidazolinone-resistant
rice that contains the ALS gene mutations Gly654Glu
and Ser653Asn (Kadaru et al. 2008). In another study,
single nucleotide polymorphism (SNP) markers were
developed for these same mutations and for the
mutation Ala122Thr (Roso et al. 2010), which is
present in the most important rice cultivar resistant to
imidazolinone herbicides in Brazil and Argentina.
These markers allow fast and precise identification of
herbicide-resistant red rice, whose resistance is related
to changes in nucleotide sequence of the ALS enzyme.
Several other studies report the development of other
molecular markers used in the isolation of the ALS
gene and identification of ALS herbicide-resistant
alleles (Duran Prado et al. 2004; Délye and Boucan-
saud 2008; Délye et al. 2011). Few studies, however,
have used these procedures to address the occurrence
of herbicide-resistant red rice in rice fields, and to
identify herbicide-resistant evolution parameters, such
as gene flow and independent origin of resistance,
which is related to the initial frequency of mutation.
Microsatellite or simple sequence repeat (SSR)
markers have also been developed to identify hybrid-
ization between cultivated rice and red rice. Three
SSR markers were used to identify hybrids of rice and
red rice from rice paddy fields in the southern United
States (Zhang et al. 2006). Currently, more than
72,000 SSR markers are available for rice (Zhang et al.
2007; Singh et al. 2010). This availability facilitates
studies at the genetic level in the genus Oryza because
most of these markers are polymorphic among culti-
vated rice, wild species, and weedy biotypes of this
genus. Several studies have found gene flow from
Euphytica (2012) 187:437–447
imidazolinone-resistant rice cultivars to susceptible
cultivars and red rice (Gealy et al. 2003; Zhang et al.
2006; Shivrain et al. 2009; Goulart et al. 2012). Few
studies, however, have isolated the hybridization to
infer whether the occurrence of mutations in the red
rice ALS gene is related to either independent
evolution of spontaneous mutation or gene flow from
imidazolinone-resistant rice cultivars. These analyses
are important for determination of management prac-
tices that seek to prevent and control herbicide-
resistant red rice, and for risk assessment of new
herbicide-resistant rice varieties developed by either
mutagenetic or transgenic methods.
The correct prevention and control of herbicide-
resistant red rice is dependent on the predominant
origin of the herbicide resistance. If the herbicide
resistance is primarily due to independent selection of
naturally-occurring ALS gene mutations, the preven-
tion strategies should be based on reducing the
herbicide selection pressure. For rice crops and red
rice, this is only achieved through crop rotation that
allows the use of herbicides with different mecha-
nisms of action (Burgos et al. 2008). If red rice
resistance comes from direct gene flow from herbi-
cide-resistant cultivars, the main strategy should be
based on control of red rice escapees. Finally, if the
resistance is due to gene flow from resistant red rice
seeds, the resistance management should be based on
the use of certified seeds that are free of red rice, and
cleaning machinery. In addition, if large proportions
of resistance is originate by gene flow, biotechnolog-
ical methods related to the mitigation of gene flow
(Lin et al. 2008; Gressel and Valverde 2009) should be
used in the development of new herbicide-resistant
rice cultivars in order to maintain the possibility of red
rice control. The objective of this study was to
quantify the occurrence of gene flow and independent
selection as the mechanisms of origin of imidazoli-
none-resistance in red rice to correctly define the
management practices for red rice control.
Materials and methods
Plant material
Plant material was selected from two previous studies.
Initially, approximately 37,000 plants from 228 red
rice populations that escaped control from the
439
herbicides imazethapyr and imazapic collected in rice
paddy fields in southern Brazil were evaluated for
resistance to these herbicides (Menezes et al. 2009).
After that, 481 plants from 38 populations were
analyzed for the mechanism of herbicide resistance
and for the occurrence of target site insensitivity
caused by the ALS gene mutations Gly654Glu,
Ala122Thr, and Ser653Asn (Roso et al. 2010). These
mutations are present in imidazolinone-resistant rice
cultivars IRGA 422 CL (Gly654Glu), PUITÁ INTA CL
(Ala122Thr), and SATOR CL (Ser653Asn). The current
study was based on 176 imidazolinone-resistant red
rice plants from 15 populations (Table 1) selected
from the study described above. In addition, the
cultivars IRGA 422 CL, PUITÁ INTA CL, and
SATOR CL, and artificial hybrids obtained by crosses
between these cultivars and red rice were used as
controls.
Artificial hybridizations used the rice cultivars as
pollen-donor plants and the red rice as pollen-receptor
plants. The panicles of the pollen-receptors were
collected in early morning, identified, and sterilized.
Pollen sterilization was performed by soaking the
panicles in water baths at 45 °C for 5 min. Next, the
spikelets of the upper and lower parts of the panicle
were eliminated. Finally, the upper parts of the
remaining spikelets were cut to remove unviable
anthers that could be physical barriers to the pollen
from the donor plants. The panicles were immediately
protected with paper bags to prevent uncontrolled
pollination. The pollen-donor tillers were also col-
lected in early morning and placed in containers with
distilled water until pollen release, which usually
occurred at 12:00 a.m. The controlled pollination was
performed by exposing the donors to receptor tillers.
Finally, the receptor plant panicles were again
protected and kept in nutrient solution until seed
development.
SSR molecular marker analysis
The genomic DNA samples were obtained from
approximately 150 mg of leaf tissue from each red
rice plant, rice cultivar, and artificial hybrid used as
controls. DNA extraction methodology was adapted
from Haberer et al. (1996). DNA quantification was
performed with a spectrophotometer (Genesys 2TM,
Thermo Spectronic) and in 1 % agarose gel containing
ethidium bromide. Eight SSR loci (Table 2) were
123
440 Euphytica (2012) 187:437–447

Table 1 ALS gene mutations, sample size (n), and genetic Ho observed heterozygosity, PIC polymorphic information
diversity measures of the A average number of alleles, content, and f inbreeding coefficient of red rice populations
P proportion of polymorphic loci, He expected heterozygosity,
Population ALS mutation n A P He Ho PIC f

17 Gly654Glu 15 2.50 0.50 0.29 0.05 0.28 0.84

18 Gly654Glu 8 2.50 1.00 0.37 0.05 0.37 0.91
19 Gly654Glu, Ser653Asn 10 2.50 1.00 0.38 0.16 0.35 0.66
21 Gly654Glu 15 3.25 1.00 0.46 0.09 0.44 0.83
22 Ser653Asn 12 2.75 1.00 0.41 0.45 0.38 -0.01
23 Gly654Glu 12 3.75 1.00 0.42 0.24 0.41 0.51
24 Gly654Glu 14 2.50 1.00 0.38 0.15 0.34 0.65
25 Gly654Glu 15 2.50 1.00 0.45 0.1 0.41 0.81
26 Gly654Glu 15 3.00 1.00 0.49 0.15 0.43 0.74
28 Ser653Asn 13 2.50 0.75 0.36 0.2 0.34 0.52
30 Gly654Glu, Ala122Thr, Ser653Asn 5 1.50 0.50 0.16 0.00 0.16 1.00
31 Gly654Glu 15 2.75 1.00 0.37 0.2 0.34 0.53
33 Gly654Glu 15 2.25 1.00 0.39 0.03 0.37 0.95
35 Gly654Glu 10 3.00 1.00 0.3 0.24 0.3 0.33
36 Gly654Glu 2 1.25 0.25 0.07 0.13 0.08 0.00
SRRa – 9 3.00 1.00 0.41 0.25 0.41 0.49
Mean 11.6 2.59 0.88 0.36 0.15 0.34 0.61
a
Imidazolinone-susceptible red rice

initially evaluated for polymorphism based on com-
parison of alleles found at each locus in rice cultivars,
red rice, and artificial hybrids. These markers were
used to identify rice and red rice hybrids from previous
studies of rice hybridization (Brunes et al. 2007;
Shivrain et al. 2007; Sundaram et al. 2008) and red rice
genetic diversity (Gealy et al. 2009). The selected SSR
markers were those that showed different alleles in
rice and red rice homozygosis, and that demonstrated
the presence of two alleles in the hybrid individuals.
PCR was performed on 12 lL reaction volumes
consisting of 25 gg genomic DNA; 150 lM deoxy-
nucleotide triphosphate (dNTP); 0.6 mM MgCl2;
1 9 buffer; 0.3 lL each primer; and 0.5 U of Taq
DNA polymerase. The PCR amplification consisted of
one cycle at 94 °C for 5 min, followed by 35 cycles of
94 °C for 45 s; 56 °C, 57 °C, or 60 °C for 45 s,
depending on the primer (Table 2); and a final
extension cycle of 72 °C for 10 min. The amplifica-
tion products were measured by comparison with a
100-bp ladder (Invitrogen) in 3 % agarose gel. The gel
was visualized on an ultraviolet transilluminator, and
photographed (KODAK Digital Science 1D). The
markers 4797, RM251, RM253, and RM341 were
polymorphic and used in the following steps.
To increase genotyping accuracy, PCR analyses of
the selected SSR markers were performed with the
M13 Tail PCR technique (Schuelke 2000). The M13
primer, TGTAAAACGACGGCCAGT, was labeled
with 6-FAM. For each marker, the forward primer was
synthesized with the M13 primer as described in
Goulart et al. (2011). The selected SSR markers
adapted with the M13 Tail PCR technique were again
evaluated for maintenance of polymorphism in the red
rice and the controls. In this analysis, the PCR was
performed on 12 lL reaction volumes consisting of
25 gg genomic DNA; 150 lM dNTP; 0.6 mM MgCl2;
19 buffer; 0.2 lM of each M13-tailed forward primer;
0.8 lM of each reverse primer; 0.8 lM of the 6-FAM
labeled M13 primer; and a 0.5 U of Taq DNA
polymerase. The amplification process consisted of
one cycle at 94 °C for 5 min, followed by 30 cycles of
94 °C for 45 s; 56 °C, 57 °C, or 60 °C for 45 s,
depending on the primer (Table 2); 72 °C for 1 min; 8
cycles of 94 °C for 45 s; 53 °C for 45 s; and 72 °C for
10 min. The amplification products were analyzed as
described earlier. All the selected SSR markers
maintained polymorphism and were used in the
genotyping analysis of the 176 red rice plants, rice
cultivars, and hybrids used as controls. Finally, the

123
Euphytica (2012) 187:437–447 441

Table 2 SSR primers used to determine origin of imidazolinone resistance in red rice
Locus C Nucleotide sequences (50 –30 ) Motif MT Reference
SSR (°C)
Forward Reverse

4797 4 GGAGAAGGCAATGCAACACG GCCATTGCCGCCAAGTACTA AGC 60 Brunes et al. (2007)

RM106 2 GCCCCGCTGCTACTACTTCTGC CTCTAGGTGCTGCCCTACCCGG GAA 56 Gealy et al. (2009)
RM180 7 CTACATCGGCTTAGGTGTAG ACTTGCTCTACTTGTGGTGA ATT 57 Zhang et al. (2006)
CAACACG GGGACTG
RM234 7 GGTCCCGGAACCTATGACA GAGGCAGAAACAGAGTGCAC CT 56 Zhang et al. (2006)
RM251 3 GAATGGCAATGGCGCTAG ATGCGGTTCAAGATTCGATC CT 57 Sundaram et al. (2008)
RM253 6 TCCTTCAAGAGTGCAAAACC GCATTGTCATGTCGAAGCC GA 56 Zhang et al. (2006)
RM341 2 CAAGAAACCTCAATCCGAGC CTCCTCCCGATCCCAATC CTT 56 Sundaram et al. (2008)
RM475 2 CCTCACGATTTTCCTCCAAC ACGGTGGGATTAGACTGTGC TATC 57 Sundaram et al. (2008)
C rice chromosome, MT melting temperature

PCR reactions were performed as described above,
and the fragment sizes were evaluated with the
sequencer ABI 3730 XL (Applied Biosystems)
equipped with a 50-cm capillary array filed with a
POP7 polymer. Peaks corresponding to the expected
fragments were visually scored using GeneMapperTM
software v3.5 (Applied Biosystems).
Data analyses
Genetic diversity measures, estimated for each pop-
ulation, included allele frequency; average number of
alleles (A); proportion of polymorphic loci (P);
expected heterozygosity (He; also called gene diver-
sity; Nei 1978); observed heterozygosity (Ho); poly-
morphic information content described by Botstein
et al. (1980); and inbreeding coefficient (f). In
addition, the fixation indices of Wright (1951) were
estimated using a bootstrap procedure with 1,000
replicates and a confidence interval of 95 %. The
analyses were performed using the software Power-
Maker 3.25 (Liu and Muse 2005) and GDA (Lewis and
Zaykin 2001). The population structure of red rice was
determined by the software Structure 2.3.3 (Pritchard
et al. 2000). The model in this analysis was based on
multiple ancestral (admixture) and correlated allele
frequencies. Five independent rounds of 10,000 gen-
erations, and a burn-in of 100,000 random Markov
chain Monte Carlo simulations per ancestral popula-
tion (K) were used. The definition of the ideal K was
performed with the ad hoc statistic Delta K as
proposed by Evanno et al. (2005).
The origin of the resistance of the imidazolinone-
resistant red rice accessions was identified by a
paternity exclusion analysis using SSR alleles adapted
from Van Treuren et al. (2006). In this method, the
genotypes were evaluated and compared with
the potential male parents, which, in this study,
were the imidazolinone-resistant rice cultivar controls
described above. These genotypes carried all three
ALS alleles of the available imidazolinone-resistant
rice cultivars. They were used in approximately 100 %
of the rice fields cultivated with imidazolinone-
resistant rice cultivars in southern Brazil at the time
of red rice sampling. Because SSR markers are co-
dominant, hybrid individuals from rice cultivars and
red rice can be detected by the presence of both
parental alleles. These individuals have one allele
coming from the rice cultivar and another from the red
rice, characterizing marker polymorphism (Shivrain
et al. 2007). The alleles of the red rice individuals were
compared with those observed in both imidazolinone-
resistant rice cultivars and imidazolinone-susceptible
red rice. The origin of the resistance of a red rice
individual characterized as independent selection was
determined by the absence of alleles of the imidazoli-
none-resistant cultivars IRGA 422 CL, PUITÁ INTA
CL, and SATOR CL. The presence of ALS mutations
in individuals with these characteristics indicates
independent evolution originated from spontaneous
mutation followed by selection processes that resulted
from the continued use of imidazolinone herbicides.
In contrast, the origin of resistance from gene flow is
considered when an individual has at least one allele

123
442 Euphytica (2012) 187:437–447

Table 3 Genotyping of imidazolinone-resistant rice cultivars, red rice, and artificial hybrids, based on four SSR markers
Individuala SSR marker ALS mutation
4797 RM341 RM251 RM475

IRGA 422 CL 129/129 157/157 129/129 212/212 Gly654Glu

RR1 135/135 152/152 151/151 202/202 –
RR1 9 IRGA 422 CL 129/135 152/157 129/151 202/212 Gly654Glu
PUITÁ INTA CL 129/129 187/187 129/129 202/202 Ala122Thr
RR2 135/135 152/152 147/147 202/202 –
RR2 9 PUITÁ INTA CL 129/135 152/187 129/147 202/202 Ala122Thr
SATOR CL 129/129 157/187 129/143 202/212 Ser653Asn
RR3 135/135 152/152 143/143 202/202 –
RR3 9 SATOR CL 129/135 152/187 143/143 202/212 Ser653Asn
Susceptible red rice 129/129 175/175 129/129 202/202 –
ALS acetolactate synthase
a
RR1, RR2, and RR3 are red rice individuals used in the artificial crosses

typical of any imidazolinone-resistant rice cultivars.
This was considered because, after the occurrence of
the gene flow event, the hybrid individual would have
mainly heterozygous alleles. Subsequent generations
of inbreeding, however, increases homozygosity and
some alleles may be lost. Furthermore, the ALS gene
mutations identified in each individual through the
SNP markers were auxiliary in the diagnosis of
exclusion paternity analysis.
Results and discussion
Genetic diversity and differentiation in red rice
populations
The markers RM106, RM180 and RM234 were not
polymorphic among the rice cultivars and the red rice,
and were therefore discarded. These markers were
previously used to characterize red rice populations
and to identify natural crosses between red rice and
cultivated rice (Zhang et al. 2006; Sundaram et al.
2008; Gealy et al. 2009). The marker RM253 had no
consistent amplifications and was also discarded
from further analysis. The markers 4797, RM251,
RM341 and RM475 were polymorphic for red rice,
rice cultivars, and artificial hybrids used as controls
(Table 3), and were used in population genetic and
hybrid identification analyses. SATOR CL is a hybrid
cultivar and, as expected, the markers showed hetero-
zygous alleles, except for the 4797 marker, which was
homozygous (Table 3). This indicates that the parental
lines of this cultivar have the same allele for this locus.
The genotypic profile of these markers was used for
the identification of the putative hybrids between the
imidazolinone-resistant rice cultivars and the red rice.
The high discriminatory power and the co-domi-
nance of the SSR markers are the main advantages of
these markers (Kalia et al. 2011). SSR markers have
been used in a large diversity of studies on population
genetics and gene mapping in rice and other species.
Population genetic studies have no predetermined
number of SSR markers and a relatively small amount
of SSR markers have been used in several analyses.
For example, several studies identified hybrids
between cultivated rice and red rice used three (Zhang
et al. 2006), two (Shivrain et al. 2009), and one SSR
marker (Shivrain et al. 2007). In addition, several SSR
markers revealed rare alleles, in both red rice (Gealy
et al. 2002) and rice cultivars (Brunes et al. 2007),
which can be used for the identification of either a
certain red rice biotype or rice cultivar. In this study,
the allele 143 bp of the marker RM251 is unique for
the cultivar SATOR CL in relation to the other rice
cultivars; and the combination of the alleles 157 and
187 bp of the marker RM341 provides identification
for the cultivars IRGA 417, IRGA 422 CL, and PUITA
INTA CL (Table 4).
Genotyping of the 176 red rice accessions indicated
that many alleles are shared with the rice cultivars,
similar to results from the analysis of allele frequen-
cies (Table 4). The 129 bp allele of the marker 4797 is

123
Euphytica (2012) 187:437–447 443

Table 4 Allele frequencies of rice cultivars and red rice biotypes based on four SSR markers
Population 4797 RM251 RM341 RM475

129 135 129 134 139 143 147 151 153 163 152 155 157 175 187 202 212 216

IRGA 422 CL 1.00 – 1.00 – – – – – – – – – 1.00 – – – 1.00 –

PUITA. INTA CL 1.00 – 1.00 – – – – – – – – – – – 1.00 1.00 – –
SATOR CL 1.00 – 0.50 – – 0.50 – – – – – – 0.50 – 0.50 0.50 0.50 –
SRRa 0.28 0.72 0.22 – – 0.44 0.17 0.17 – – 0.67 – 0.06 0.11b 0.17 0.89 0.11 –
17 0.43 0.57 0.30 0.40 – 0.10 – 0.10 – 0.10 – – 1.00 – – 0.04 0.96 –
18 0.71 0.29 0.29 0.43 – 0.14 – – – 0.14 – 0.13 0.88 – – – 0.70 0.30
19 0.56 0.44 – 0.33 – 0.56 0.11 – – – 0.05 – 0.80 – 0.15 – 0.83 0.17
21 0.67 0.33 0.15 0.31 – 0.15 0.08 0.08 – 0.23 0.07 – 0.93 – – 0.13 0.46 0.42
22 0.77 0.23 – – 0.04 0.46 0.29 – – 0.21 0.14 0.14 0.73 – – 0.83 – 0.17
23 0.83 0.17 0.25 0.25 – 0.08 0.08 0.17 0.08b 0.08 0.04 0.08 0.83 – 0.04 – 0.73 0.27
24 0.46 0.54 0.77 0.12 – – – 0.12 – – 0.21 – 0.75 – 0.04 – 0.75 0.25
25 0.67 0.33 0.20 0.20 – – 0.40 0.20 – – 0.20 – 0.80 – – – 0.67 0.33
26 0.63 0.37 0.50 0.04 – – – 0.46 – – 0.20 0.07 0.60 – 0.13 0.04 0.35 0.62
28 1.00 – 0.50 0.08 – 0.25 – – – 0.17 – – 0.23 – 0.77 0.15 0.62 0.23
30 0.80 0.20 – – 1.00 – – – – – – – 0.40 – 0.60 – 1.00 –
31 0.60 0.40 0.53 0.17 – – 0.23 0.07 – – 0.04 0.08 0.88 – – – 0.85 0.15
33 0.50 0.50 – 0.75 – 0.25 – – – – – – 0.87 – 0.13 0.35 0.30 0.35
35 0.85 0.15 0.17 0.44 – 0.06 0.06 0.28 – – 0.05 – 0.95 – – 0.05 0.85 0.10
36 1.00 – – – 1.00 – – – – – – – 0.75 – 0.25 – 1.00 –
a
Imidazolinone-susceptible red rice
b
Private alleles

present in relatively high frequencies in the imidaz-
olinone-resistant cultivars and all red rice populations
(Table 4). In addition, the 135 bp allele of this marker
was found in both the red rice individuals used in the
artificial crosses (Table 3) and the red rice popula-
tions, but not in the rice cultivars (Table 4). The
marker RM251 was absent in the rice cultivars, which
indicated that this marker is typical of red rice
(Table 4). The marker RM475 revealed the 202 bp
allele for the cultivar PUITÁ INTA CL, and the
212 bp allele for IRGA 422 CL. For this marker, the
216 bp allele was considered typical for red rice due to
its absence in the rice cultivars (Table 4). Among all
genotyped accessions, only two alleles were private:
the 153 bp allele of the marker RM251, and the 175 bp
allele of the marker RM341. These results show the
large capacity that the evaluated SSR markers have for
identification of rice cultivars and red rice hybrids.
Similar specificity was also found in studies that used
similar markers in different rice cultivars and red rice
biotypes (Gealy et al. 2002; Singh et al. 2010).
The mean number of alleles (A) found in the red
rice populations was 2.59 (Table 1). However, these
populations had a higher average number of alleles as
compared with the rice cultivars (Table 1). This is
related to the large genetic diversity of red rice in
comparison with cultivated rice (Sundaram et al. 2008;
Reagon et al. 2010). The He and Ho were, on average,
0.36 and 0.15, respectively (Table 1). Furthermore,
the mean f was 0.61, confirming the predominance of
inbreeding in the evaluated populations of red rice.
Some populations, such as populations 22, 35, and 36,
had a very low and even negative f-value, indicating
the occurrence of cross-fertilization (Table 1). This
corroborates with the high value of observed hetero-
zygosity found in these populations. The overall
results showed that red rice populations have rela-
tively high genetic diversity, although there is con-
siderable variation among them. In fact, in natural
populations of autogamous species, a low genetic
diversity is expected due to the high degree of
homozygosity. In the case of populations arising from
agricultural lands (e.g., red rice), however, the diver-
sity within populations may be higher (Xia et al. 2011)
due to the large occurrence of seed migration that is
mainly related to crop seed contamination. This is

123
444
further confirmed through the partitioning of genetic
variability in red rice populations, which was mainly
related to the diversity within each population
(FIT = 0.71), as compared with the differences
between populations (FST = 0.20). In addition, the
high presence of homozygotes (FIS = 0.64) is related
to the self-mating system of red rice, but heterozy-
gosity occurs certainly due to gene flow.
Origin of imidazolinone resistance in red rice
The origin of herbicide resistance in red rice due to
either independent evolution or gene flow was deter-
mined by the absence of alleles of the imidazolinone-
resistant cultivars IRGA 422 CL, PUITÁ INTA CL,
and SATOR CL. Only two red rice individuals
had imidazolinone-herbicide resistance originated by
independent selection, and 174 plants were resistant
due to gene flow, corresponding to 1.1 and 98.9 %,
respectively. The individuals 23.2 and 25.9 did not
share any alleles with the imidazolinone-herbicide
resistant rice cultivars, and their herbicide resistance is
likely originated by spontaneous mutations followed
by independent selection (Table 5). All other 174
individuals shared some alleles with the imidazoli-
none-resistant rice cultivars, and the herbicide resis-
tance in these plants could be related with gene flow
from these cultivars. The individuals 23.2 and 25.9
had the Gly654Glu mutation in the ALS gene. This
mutation naturally occurs in Setaria viridis, causing
resistance to imidazolinone herbicides (Laplante et al.
2009). Among the individuals whose resistance was
due to gene flow, two were heterozygous: one from
population 23 and the other from population 26
(Table 5). These individuals contain the Gly654Glu
ALS mutation and alleles typical of red rice and of
the cultivar IRGA 422 CL. This indicates that these
Table 5 Acetolactate synthase (ALS) gene mutation and genotyping of imidazolinone-resistant red rice individuals originated from
independent selection or after one generation of gene flow
Population ALS gene mutation SSR marker
individual
4797 RM341
23.2 Gly654Glu 135/135 155/155
25.9 Gly654Glu 135/135 152/152
23.3 Gly654Glu 129/135 157/187
26.14 Gly654Glu 129/135 157/187
123
Euphytica (2012) 187:437–447
individuals may be the F1 generation that resulted
from gene flow from the cultivar IRGA 422 CL, which
was largely planted at the time of red rice sampling.
The genotyping performed on other individuals did
not allow identification of the generation in which the
introgression between red rice and rice cultivars
occurred.
The information obtained from the genotyping of
red rice accessions was sufficient enough to identify
the origin of resistance to imidazolinone herbicides;
however, the presence of several common alleles
between the rice cultivars and red rice negatively
affected the diagnosis of the herbicide resistance
caused by independent selection. This finding is
related to an inability to recognize the inheritance of
alleles in homozygosis. Other limiting factors were the
occurrence of homozygous and heterozygous loci in
the same individual, resulting from several genera-
tions of inbreeding, which is a characteristic of the
genus Oryza; and the concomitant occurrence of gene
flow with other genotypes of red rice and rice
cultivars. The experimental procedure and the per-
formed analysis, however, were useful for quantifying
independent evolution of imidazolinone resistance in
red rice. Similar studies, based on similar procedures,
have identified the ALS gene (Kadaru et al. 2008;
Roso et al. 2010) and hybrids for which their herbicide
resistance originated from gene flow (Zhang et al.
2006; Shivrain et al. 2007; Shivrain et al. 2009). The
current study isolated independent evolution as a
source of herbicide resistance in red rice. This
information together with the study of the population
structure of resistant populations provides a more
detailed analysis that can be used for management of
red rice in rice paddy fields.
The analysis of population structure revealed
common ancestry between cultivars and red rice
Resistance origin Estimated
generation
RM251 RM475
147/151 212/216 Independent selection –
134/151 216/216 Independent selection –
129/151 212/216 Gene flow F1
129/151 212/216 Gene flow F1
Euphytica (2012) 187:437–447
Fig. 1 Estimated population structure of 176 red rice acces-
sions from 15 populations, and three rice cultivars and artificial
hybrids placed into three groups (K = 3). Each column
represents an individual, and the colors represent the contribu-
tion of each group, K, where red K1, green K2, and blue K3;
individuals (Fig. 1). Only three different ancestral
groups were determined for all red rice individuals,
corroborating with the high number of shared alleles,
as described above. The greenhouse crosses were
confirmed by the population structure analysis, which
was identified by the intermediate heterozygosity of
the individuals H1, H2, and H3, in relation to their
parents, 422 9 RR1, PUI 9 RR2, and SAT 9 RR3,
respectively (Fig. 1). The population structure analy-
sis with K = 3, resulted in clear distinction of rice
cultivars from artificial crosses used as controls. These
results are the main indication of the biological
significance of the K-value chosen for this analysis
(Chung and Park 2010). The individuals 23.2 and 25.9
which had independent selection resistance were
grouped in the K1 (red rice) ancestral population
(Fig. 1). In addition, the population structure analysis
indicated that populations 24, 28, 30 and 31 had
several red rice individuals with genotypes close to
those of the rice cultivars (K2 = blue), indicating
introgression for many generations (Fig. 1). Popula-
tions 17, 23, 25 and 35 had several red rice plants
(K3 = green) with little relationship to rice cultivars.
Population 22 had large uniformity of plants with the
genetic background K1 (red; Fig. 1), which is typical
of red rice. These results showed intense gene flow
from rice cultivars to red rice, but some red rice
populations maintained high genetic identity based on
a small amount of introgression of genes from the rice
cultivars.
The results of this study show that gene flow from
imidazolinone-resistant rice is the major factor in the
evolution of herbicide-resistance in red rice of South-
ern Brazil. This was expected due to the high likelihood
of out-crossing among rice plants compared to the
445
A IRGA 422 CL, B Red rice 1, C artificial hybrid of IRGA 422
CL and red rice 1, D PUITÁ INTA CL, E red rice 2, F artificial
hybrid of PUITÁ INTA CL and red rice 2, G SATOR CL, H red
rice 3, and I artificial hybrid of Sator CL and red rice 3.
Populations are labeled below the figure according to Table 1
likelihood of spontaneous mutation in the ALS gene.
The ratio between the numbers of resistant individuals,
originated by independent selection against the gene
flow, was 0.011. The theoretical proportional between
independent selection processes and gene flow in rice,
considering the probability of each factor, was
expected to be 0.010 (Gressel and Valverde 2009).
The expected ratio can also be calculated from
parameters of herbicide resistance evolution. If we
considered the parameters from the region where the
this study was performed, which would include a gene
flow of 0.0344 % (Goulart et al. 2011); red rice density
of 15 plants m-2; production of 1,000 seeds per plant;
initial frequency of mutation of 10-6 (Délye et al.
2009); and absence of fitness penalty, the ratio between
the independent selection and gene flow would be
0.029. The theoretical values reported in the literature,
and the calculated values based on the evolution of
herbicide resistance are, therefore, similar to the value
found in this study, which was obtained from plants
collected at field conditions. Several factors, which are
mainly related to the large variability in occurrence of
gene flow from rice cultivars to red rice (Zhang et al.
2006; Shivrain et al. 2009; Xia et al. 2011) are the
causes of the differences between these expected and
measured values.
Implications for resistant red rice management
The determination of the prevalence and magnitude of
gene flow and independent selection is important for
determining the main focus of management practices
related to prevention of evolution of herbicide resis-
tance in red rice. If the predominance of independent
selection of herbicide resistance in red rice is due to
123
446
spontaneous mutants of the ALS gene, management
should be based on reduction of selection pressure by
herbicides. This is achieved through crop rotation that
allows the use of herbicides with different mecha-
nisms of action (Burgos et al. 2008). If resistance of
red rice originates from gene flow from herbicide-
resistant cultivars, management strategies should be
based on control of red rice escapees. Therefore,
management practices such as rouging and application
of herbicides during flowering of red rice should be
emphasized in rice fields cultivated with imidazoli-
none-resistant cultivars. In addition to the conven-
tional control practices of imidazolinone-resistant red
rice described above, biotechnology-based strategies
should be considered to prevent the introgression of
resistance alleles from red rice (Al-Ahmad and
Gressel 2006; Lin et al. 2008; Gressel and Valverde
2009).
The results of this study demonstrate the predom-
inance of gene flow from herbicide-resistant cultivars
to red rice in comparison to independent selection as
the mechanism of resistance to imidazolinone herbi-
cides in red rice. These results also support the
necessity to adopt either management or biotechno-
logical measures that mitigate gene flow to red rice
when developing new herbicide-resistant rice cultivars
through mutagenetic or transgenic procedures.
References
Al-Ahmad H, Gressel J (2006) Mitigation using a tandem con-
struct containing a selectively unfit gene precludes estab-
lishment of Brassica napus transgenes in hybrids and
backcrosses with weedy Brassica rapa. Plant Biotech J
4(1):23–33. doi:10.1111/j.1467-7652.2005.00153.x
Botstein D, White RL, Skolnick M, Davis RW (1980) Con-
struction of a genetic linkage map in man using restriction
fragment length polymorphisms. Am J Hum Genet 32(3):
314–331
Brunes TO, Rangel PHN, Brondani RPV, Neto FM, PdCF
Neves, Brondani C (2007) Fluxo gênico entre arroz ver-
melho e arroz cultivado estimado por meio de marcadores
de microssatélites. Pesq Agropec Trop 37(2):86–92
Burgos NR, Norsworthy JK, Scott RC, Smith KL (2008) Red
rice (Oryza sativa) status after 5 years of imidazolinone-
resistant rice technology in Arkansas. Weed Technol
22(1):200–208. doi:10.1614/wt-07-075.1
Chung JW, Park YJ (2010) Population structure analysis reveals
the maintenance of isolated sub-populations of weedy rice.
Weed Res 50(6):606–620
123
Euphytica (2012) 187:437–447
Délye C, Boucansaud K (2008) A molecular assay for the pro-
active detection of target site-based resistance to herbicides
inhibiting acetolactate synthase in Alopecurus myosuro-
ides. Weed Res 48:97–101. doi:10.1111/j.1365-3180.2007.
00615.x
Délye C, Pernin F, Michel S (2011) Universal PCR assays
detecting mutations in acetyl-coenzyme A carboxylase or
acetolactate synthase that endow herbicide resistance in
grass weeds. Weed Res 51:353–362. doi:10.1111/j.1365-
3180.2011.00852.x
Délye C, Boucansaud K, Pernin F, Le Corre V (2009) Variation
in the gene encoding acetolactate-synthase in Lolium spe-
cies and proactive detection of mutant, herbicide-resistant
alleles. Weed Res 49(3):326–336
Duran Prado M, De Prado R, Franco AR (2004) Design and
optimisation of degenerated universal primers for the
cloning of the plant acetolactate synthase conserved
domains. Weed Sci 52:487–491. doi:10.1614/WS-03-098R
Evanno G, Regnaut S, Goudet J (2005) Detecting the number of
clusters of individuals using the software structure: a
simulation study. Mol Ecol 14(8):2611–2620. doi:10.1111/
j.1365-294X.2005.02553.x
Fleck NG, Agostinetto D, Galon L, Schaedler CE (2008) Com-
petitividade relativa entre cultivares de arroz irrigado e
biótipo de arroz-vermelho. Planta Daninha 26(1):101–111
Gealy DR, Tai TH, Sneller CH (2002) Identification of red rice,
rice, and hybrid populations using microsatellite markers.
Weed Sci 50(3):333–339
Gealy DR, Mitten DH, Rutger JN (2003) Gene flow between red
rice (Oryza sativa) and herbicide-resistant rice (O. sativa):
implications for weed management. Weed Technol 17(3):
627–645. doi:10.1614/WT02-100
Gealy DR, Agrama HA, Eizenga GC (2009) Exploring genetic
and spatial structure of us weedy red rice (Oryza sativa) in
relation to rice relatives worldwide. Weed Sci 57(6):
627–643. doi:10.1614/ws-09-018.1
Goulart ICGR, Merotto A Jr, Nunes AL, Bered F (2011) Otim-
ização da utilização de marcadores moleculares micros-
satélites e sua aplicação em estudos com plantas daninhas.
Planta Daninha 29:1175–1181. doi:10.1590/S0100-835
82011000500025
Gressel J, Valverde BE (2009) A strategy to provide long-term
control of weedy rice while mitigating herbicide resistance
transgene flow, and its potential use for other crops with
related weeds. Pest Manag Sci 65(7):723–731. doi:10.1002/
ps.1754
Gross BL, Reagon M, Hsu SC, Caicedo AL, Jia YL, Olsen KM
(2010) Seeing red: the origin of grain pigmentation in US
weedy rice. Mol Ecol 19(16):3380–3393. doi:10.1111/
j.1365-294X.2010.04707.x
Haberer G, Fischer TC, TorresRuiz RA (1996) Mapping of the
nucleolus organizer region on chromosome 4 in Arabidopsis
thaliana. Mol Gen Genet 250(1):123–128. doi:10.1007/
s004380050058
Kadaru S, Zhang W, Yadav A, Oard J (2008) Development and
application of allele-specific PCR assays for imazethapyr
resistance in rice (Oryza sativa). Euphytica 160(3):431–438.
doi:10.1007/s10681-008-9662-0
Kalia R, Rai M, Kalia S, Singh R, Dhawan A (2011) Micro-
satellite markers: an overview of the recent progress in
Euphytica (2012) 187:437–447
plants. Euphytica 177(3):309–334. doi:10.1007/s10681-
010-0286-9
Lewis P, Zaykin D (2001) Genetic data analysis: computer
program for the analyses of allelic data (software). Version
1.0 (d12). Disponı́vel em:http://alleyn.eeg.uconn.edu/gda/.
Acesso em: 16 maio 2009
Lin C, Fang J, Xu X, Zhao T, Cheng J, Tu J, Ye G, Shen Z (2008)
A built-in strategy for containment of transgenic plants:
creation of selectively terminable transgenic rice. PLoS
One 3(3):e1818. doi:10.1371/journal.pone.0001818
Liu K, Muse SV (2005) PowerMarker: an integrated analysis
environment for genetic marker analysis. Bioinformatics
21(9):2128–2129. doi:10.1093/bioinformatics/bti282
Menezes VG, Mariot CHP, Kalsing A, Goulart ICGR (2009)
Arroz-vermelho (Oryza sativa) resistente aos herbicidas
imidazolinonas. Planta Daninha 27:1047–1052. doi:
10.1590/S0100-83582009000500018
Pritchard JK, Stephens M, Donnelly P (2000) Inference of
population structure using multilocus genotype data.
Genetics 155(2):945–959
Reagon M, Thurber CS, Gross BL, Olsen KM, Jia YL, Caicedo
AL (2010) Genomic patterns of nucleotide diversity in
divergent populations of US weedy rice. BMC Evol Biol
10. doi:10.1186/1471-2148-10-180
Roso AC, Merotto Jr A, Delatorre CA, Menezes VG (2010)
Regional scale distribution of imidazolinone herbicide-
resistant alleles in red rice (Oryza sativa L.) determined
through SNP markers. Field Crops Res 119 (1):175–182.
doi:10.1016/j.fcr.2010.07.006
Schuelke M (2000) An economic method for the fluorescent
labeling of PCR fragments. Nat Biotechnol 18(2):233–234.
doi:10.1038/72708
Shivrain VK, Burgos NR, Anders MM, Rajguru SN, Noore J,
Sales MA (2007) Gene flow between clearfield(TM) rice
and red rice. Crop Prot 26(3):349–356. doi:10.1016/j.cro
pro.2005.09.019
Shivrain VK, Burgos NR, Gealy DR, Sales MA, Smith KL
(2009) Gene flow from weedy red rice (Oryza sativa L.) to
cultivated rice and fitness of hybrids. Pest Manag Sci
65(10):1124–1129. doi:10.1002/ps.1802
Singh H, Deshmukh RK, Singh A, Singh AK, Gaikwad K,
Sharma TR, Mohapatra T, Singh NK (2010) Highly vari-
able SSR markers suitable for rice genotyping using
447
agarose gels. Mol Breed 25(2):359–364. doi:10.1007/s11032-
009-9328-1
Sundaram RM, Naveenkumar B, Biradar SK, Balachandran SM,
Mishra B, IlyasAhmed M, Viraktamath BC, Ramesha MS,
Sarma NP (2008) Identification of informative SSR
markers capable of distinguishing hybrid rice parental lines
and their utilization in seed purity assessment. Euphytica
163(2):215–224
Sweeney M, McCouch S (2007) The complex history of the
domestication of rice. Ann Bot 100(5):951–957. doi:10.1093/
aob/mcm128
Thurber CS, Reagon M, Gross BL, Olsen KM, Jia YL, Caicedo
AL (2010) Molecular evolution of shattering loci in US
weedy rice. Mol Ecol 19(16):3271–3284. doi:10.1111/
j.1365-294X.2010.04708.x
Van Treuren R, Goossens PJ, Sevcikova M (2006) Variation in
effective pollination rates in relation to the spatial and
temporal distribution of pollen release in rejuvenated
perennial ryegrass. Euphytica 147(3):367–382. doi:10.1007/
s10681-005-9033-z
Vaughan LK, Ottis BV, Prazak-Havey AM, Bormans CA,
Sneller C, Chandler JM, Park WD (2001) Is all red rice
found in commercial rice really Oryza sativa? Weed Sci
49(4):468–476. doi:10.1614/0043-1745
Wright S (1951) The genetic structure of populations. Ann
Eugen 15(1):323–354
Xia H-B, Wang W, Xia H, Zhao W, Lu B-R (2011) Conspecific
crop-weed introgression influences evolution of weedy rice
(Oryza sativa f. spontanea) across a geographical range.
PLoS One 6(1):e16189. doi:10.1371/journal.pone.0016189
Zhang W, Linscombe S, Webster E, Tan S, Oard J (2006) Risk
assessment of the transfer of imazethapyr herbicide toler-
ance from clearfield rice to red rice (Oryza sativa). Eu-
phytica 152:75–86. doi:10.1007/s10681-006-9180-x
Zhang ZH, Deng YJ, Tan J, Hu SN, Yu J, Xue QZ (2007) A
genome-wide microsatellite polymorphism database for
the Indica and Japonica rice. DNA Res 14(1):37–45. doi:
10.1093/dnares/dsm005
Zhang WQ, Linscombe SD, Oard JH (2008) Genetic and agro-
nomic analyses of red rice-clearfield hybrids and their
progeny produced from natural and controlled crosses. Eu-
phytica 164(3):659–668. doi:10.1007/s10681-008-9661-1
123