Aquaculture and Fisheries 7 (2022) 121–130

Contents lists available at ScienceDirect

Aquaculture and Fisheries

journal homepage: www.keaipublishing.com/en/journals/aquaculture-and-fisheries

CRISPR-Cas9 sgRNA design and outcome assessment: Bioinformatics tools

and aquaculture applications
Mingkun Luo a, 1, Jun Wang b, 1, Zaijie Dong a, Chenghui Wang b, Guoqing Lu c, *
a
Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Freshwater Fisheries Research Centre of Chinese Academy of Fishery Sciences, Ministry of
Agriculture and Rural Affairs, Wuxi, 214081, China
b
Key Laboratory of Freshwater Aquatic Genetic Resources, Ministry of Agriculture and Rural Affairs / National Demonstration Center for Experimental Fisheries Science
Education / Shanghai Engineering Research Center of Aquaculture, Shanghai Ocean University, Shanghai, 201306, China
c
Department of Biology, University of Nebraska at Omaha, Omaha, NE, 68182, USA

A R T I C L E I N F O A B S T R A C T

Keywords: The CRISPR-Cas9 genome editing has many advantages over its counterparts and could ultimately assist in
CRISPR-Cas9 disease control and molecular breeding in aquaculture. Single-guide RNA (sgRNA) design is presumably the most
Genome editing crucial task in a typical CRISPR-Cas9 experiment; an understanding of algorithms behind sgRNA design programs
sgRNA design
is thus essential for improved efficacy and specificity. We focus this review on the bioinformatics aspects in
Outcome assessment
genome editing experiments and describe commonly used computational approaches and tools of sgRNA design
Bioinformatics tools
Aquaculture applications and outcome assessment. We show an example of sgRNA design with optimal parameter settings and appropriate
interpretation of results and present a brief overview of CRISPR-Cas9 applications, such as genetic improvement
and sustainability in aquaculture. We discuss challenging issues, particularly in the context of computational
biology, in the use of computational tools in CRISPR-based genome editing. This review provides a synthesis of
bioinformatics tools used for CRISPR-Cas9 sgRNA design and outcome assessment and offers a general view of
CRISPR-based applications in farmed fish, which are expected to facilitate genome editing programs and hence
improve aquaculture breeding, production, and sustainability.

1. Introduction
Genome editing can modify DNA in a targeted manner and holds
grand promise for improved aquaculture breeding and production
(Canário, 2019). The commonly used genome editing technologies
include, but not limited to, ZFNs (Zink-finger nucleases), TALENs
(transcription activator-like effector-based nucleases), and CRISPR-Cas
(clustered regularly interspaced short palindromic repeats, CRISPR
and its associated endonuclease, Cas) (Kim & Kim, 2014; LaFountaine
et al., 2015). The CRISPR-Cas9, recognizing DNA by a programmable
guide RNA and cleaving by a structurally bonded enzyme, has many
practical advantages over its counterpart genome editing tools (Canário,
2019; Cui et al., 2018). However, there are challenges encountered by
practical scientists in the CRISPR experiments, including how to design
optimal guide RNAs with high on-target activity and low off-target ef­
fects. Fish, known for whole-genome duplication and diverse types of
eggs (transparent vs. opaque, sticky vs. non-sticky), add more challenges
in the sgRNA design. A review of sgRNA design tools is thus essential,
and a subsequent guideline of how to choose from many existing tools
and use the most suitable ones can assist genome editing applications in
aquaculture.
The CRISPR-based genome editing can rapidly introduce genomic
changes and thus has many applications in aquaculture, including ge­
netic improvement and disease resistance (Blix et al., 2021; Gratacap
et al., 2019; Wargelius, 2019). The editing of genes underlying aqua­
culture traits such as growth and reproduction has the potential to
improve aquaculture breeding and production (Blix et al., 2021; War­
gelius, 2019). CRISPR has enabled the production of a breed of red sea
bream with an increase of skeletal muscle mass and reduced body length
(Kishimoto et al., 2018; Ohama et al., 2020), muscle mass enhancement
in the olive flounder (Kim et al., 2019) and yellow catfish (Zhang et al.,
2020), and the effective disruption of reproductive competence in Nile
tilapia (Jin, 2018). A recent meta-analysis of CRISPR-based genome
editing studies found more than half of the studies attempted to deal

* Corresponding author.
E-mail address: glu3@unomaha.edu (G. Lu).
1
These authors contributed equally to this work.

https://doi.org/10.1016/j.aaf.2021.10.002
Received 10 August 2021; Received in revised form 8 October 2021; Accepted 13 October 2021
Available online 17 November 2021
2468-550X/© 2021 Shanghai Ocean University. Publishing services by Elsevier B.V. on behalf of KeAi Communications Co. Ltd. This is an open access article
under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
M. Luo et al.
with aquaculture challenges while the rest aimed to address funda­
mental questions in genetics, physiology, or technology (Blix et al.,
2021). Multiple reviews on the application of CRISPR-based genome
editing in aquaculture are available (Gratacap et al., 2019; Wargelius,
2019; Yang et al., 2021); however, less effort has been made on the
computation approaches and associated tools involved in the
experiments.
Two important bioinformatics predictions in CRISPR-Cas9 genome
editing experiments are sgRNA design and outcome assessment (Hanna
& Doench, 2020). The CRISPR-Cas9, adopted from the prokaryotic im­
mune system and used in the laboratory, uses a sgRNA and the Cas9
protein guided by sgRNA to recognize and cleave the target DNA
sequence (Jinek et al., 2012). The sgRNA made in vitro or in vivo consists
of a custom-designed CRISPR RNA (crRNA) sequence fused to a trans-­
activating crRNA (tracrRNA) (Mojica & Rodriguez-Valera, 2016). The
tracrRNA is a constant part of sgRNA, forms several stem-loops and is
required for Cas9 binding, crRNA processing, and Cas9-mediated target
cleavage (Jiang & Doudna, 2017). The crRNA sequence, a 5′ - end 20
nucleotides variable part known as gRNA spacer, is complementary to
the target DNA sequence with a protospacer adjacent motif (PAM) - an
essential targeting component. Although the design of sgRNAs appears
to be an intuitive task, a number of challenges exist and may affect the
efficacy and specificity of genome editing. For example, the Cas9
endonuclease was found to exhibit variable efficiency at different target
sites and accept few base mismatches and DNA/RNA bulges (Lee et al.,
2016). In addition, once cellular DNA is cleaved, the cellular repair
machinery can add or delete pieces of genetic material or make changes
to the DNA by replacing an existing segment with a customized DNA
sequence, resulting in a variety of genome editing outcomes (Choudhary
et al., 2020; Cui et al., 2018). Assessing genomic editing outcomes is
often critical for follow-up experiments.
Fig. 1. A typical workflow of genome editing using CRISPR-Cas9 and microinjection in fish. The three phases are sgRNA design, CRISPR experiment, and selection
and application.
122
Aquaculture and Fisheries 7 (2022) 121–130
Extensive research has been conducted to identify nucleotide fea­
tures associated with sgRNA efficiency and develop corresponding
models for on-target prediction (Doench et al., 2014, 2016; Hanna &
Doench, 2020). Many computational tools related to CRISPR-Cas9
sgRNA design have been developed, and a number of reviews on
commonly used tools and resources are made available (Alkhnbashi
et al., 2020; Chuai et al., 2017; Cui et al., 2018; Graham & Root, 2015;
Liu et al., 2020). In this review, we focus on bioinformatics aspects of
CRISPR-Cas9 genome editing with relevance to aquaculture applica­
tions. We introduce a workflow in genome editing experiments, describe
major bioinformatics resources related to sgRNA design and outcome
prediction in the CRISPR-Cas9 system, demonstrate a case study of
sgRNA design, and briefly summarize applications of CRISPR-Cas9 in
aquaculture. We discuss areas that need to be considered or improved
for the efficient use of genome editing in aquaculture. This review is
expected to provide a glimpse of computational approaches and tools
used in the CRISPR genome editing experiments, through which we
expect to promote further genome editing research and applications in
aquaculture.
2. CRISPR-Cas9 experimental design
A minimum of three phases are involved in a CRISPR-Cas9 genomic
editing experiment, including sgRNA design, CRISPR-Cas9 laboratory
experiment, and selection and application (Fig. 1) (Yang et al., 2021).
The design and synthesis of sgRNA consists of target gene selection,
sgRNA design, sgRNA synthesis. The CRISPR laboratory experiment
contains processes of artificial fertilization, sgRNA and Cas9 delivery
whereas the selection and application stage includes mutagenesis anal­
ysis, selection of phenotypes with CRISPR-induced mutations, and the
establishment of new varieties with improved quality or quantity values
M. Luo et al. Aquaculture and Fisheries 7 (2022) 121–130

Table 1
Major features and models used for on-target and off-target prediction.
Name Features and Models Comments/references/tools

Algorithm for on-target activity prediction

Rule set 1 Full set of features included individual nucleotides and all pairs of adjacent 1841 sgRNAs of six mouse and three human genes / (Doench et al., 2014)
nucleotides indexed by position in the 30 mer target site, with 120 single / CRISPOR, CHOPCHOP, E-CRISP
nucleotide features, 464 dinucleotide features, and the two GC-count
features 72 features, identified by a supervised learning method – support
vector machine, were related to on-target efficacy A logistic regression
model was created to estimate the sgRNA on-target score
Wang et al. (2014) Single-guide sequences with very high or low GC content were less 73,000 sgRNAs, screens in two human cell lines / (Wang et al., 2014) /
effective against their targets sgRNAs targeting the last coding exon were CRISPOR
less effective than those targeting earlier exons sgRNAs targeting the
transcribed strand were less effective than those targeting the non-
transcribed strand
Gagnon et al. (2014) a positive correlation between G/C content and indel frequency sgRNAs Mutagenesis of over a hundred genomic loci in a zebrafish, 85% of target
with a guanine adjacent to the PAM motifs exhibited significantly higher genes with mutation rates varying across several orders of magnitude / (
indel frequencies than other bases 5′ GG may be sufficient to improve the Gagnon et al., 2014) / CRISPOR
mutagenic activity of poor 5′ AG or 5′ GA sgRNAs
Rule Set 2 486 non-zero feature in the 30 mer target site 80 order 1 features, 320 The ability of Rule Set 2 to predict performance extends to CRISPRa and
order 2 features, GC content, melting temperature 16 features of two CRISPRi screens / (Doench et al., 2016) / CRISPOR, CHOPCHOP,
nucleotides in the N and N positions relative to the PAM “NGGN” Guide CRISPick
positional features, e.g., amino acid cut position
Moreno-Mateos et al. Guanine enrichment and adenine depletion increase sgRNA stability, with In vivo zebrafish experiment / (Moreno-Mateos et al., 2015) / CRISPRscan,
(2015) a strong guanine enrichment and a cytosine depletion in positions 3 and 20 CRISPOR, Moreno-Mateos
Guanine enriched in nucleotides distal to the PAM (positions 1–14) and
cytosine enriched in positions 15–18 a cytosine/guanine enrichment
overlapping the first nucleotide of the PAM and a guanine depletion one
nucleotide downstream of the PAM
Xu et al. (2015) Known features be Doench et al. (2014) and Wu et al. (2014) New features Published data sets by (Wang et al., 2014), (Koike-Yusa et al., 2014;
including a preference for cytosine at the cleavage site A regularized Shalem et al., 2014) / (Xu et al., 2015) / CRISPOR, CHOPCHOP
regression model, the Elastic-Nets established for sgRNA targeting scoring
Heigwer et al. (2014) Features by Doench et al. (2014) and Xu et al. (2015) Add 1 if the last 6 bp (Heigwer et al., 2014) / E-CRISP and CLD
have a CG content higher than 70 %Subtract 1 if the entire sequence has
GC content >80% Add 1 if sequence is preceded by a G Add 1 if there are
GG in front of the target sequence (opposite the PAM) Add micro
-homology score (is higher when sequence tends to give out of frame
deletions)
Algorithm for off-target effects prediction
CFD (cutting frequency Score calculated using the percent activity values provided in a matrix of (Doench et al., 2014) / CRISPRscan, CRISPOR, CRISPick
determination) penalties based on mismatches of each possible type at each position
within the guide RNA sequence.A value of 0 indicates no predicted off-
target activity whereas a value of 1 indicates a perfect match; in contrast
Mismatch count Search for mismatches only in the 20 bp upstream of the PAM (Mali et al., 2013) / E-CRISP, ZiFiT, CHOPCHOP, CRISPRdirect
(CHOPCHOP) Start with 100 for every off-target substract (20-
mismatches) per iteration (E-CRISP)
Cong et al. (2013) Single-base mismatches up to 11 bp 5′ of the PAM completely abolish (Cong et al., 2013) / CHOPCHOP
cleavage by Cas9. However, mutations further upstream of the PAM retain
cleavage activity. Search for mismatches only in the first 9 bp (a mismatch
further towards the PAM motif is predicted to cause no cleavage)
MIT specificity Hsu Measures the uniqueness of a guide in the genome using a positon (Hsu et al., 2013) / CRISPOR, CHOPCHOP, CCTop
et al. (2013) mismatch weight matrix by Hsu et al. (2013). The higher the specificity
score, the lower are off-target effects in the genome. The specificity score
ranges from 0 to 100 Recommend values by CRISPOR are >50

in aquaculture. Several protocols have been published for guiding
CRISPR genome editing experiments (Li et al., 2021; Vejnar et al., 2016).
Using an optimized CRISPR-Cas9 genome editing system in zebra­
fish, Vejnar et al. (2016) describes how to generate and genotype mu­
tants. It explains how to construct extremely efficient sgRNAs through
the web application CRISPRscan, how to manufacture sgRNAs in vitro,
and how to identify heterozygous fish with the desired mutations. Li
et al. (2021) detailed a procedure for CRISPR-Cas9 mediated gene
editing in tilapia. Selection of target sites, in vitro RNA transcription,
artificial insemination, and microinjection of one cell stage embryos are
all part of this process. This protocol facilitates application of
CRISPR-Cas9 in studies of other aquaculture fishes. Graham and Root
(2015) reviewed major considerations in the design of genome editing
experiments, and surveyed tools and resources available to assist users
of CRISPR technology (Graham & Root, 2015). Computational methods
and resources for CRISPR-Cas investigations, including sgRNA design,
repair outcome prediction, editing outcome evaluation, and sgRNA
associated repositories and databases, were also discussed (Sledzinski
et al., 2020).
3. CRISPR-Cas9 sgRNA design
sgRNA design is presumably the most critical step in CRISPR-Cas9
experiments. In principle, it is relatively easy to predict sgRNA candi­
dates simply by finding the PAM site (i.e., 5′ -NGG-3′ ) and identifying the
20 nucleotides upstream (Doudna & Charpentier, 2014; Jinek et al.,
2012). However, in practice, only a certain number of sgRNA can effi­
ciently target DNA on the desired site in genome editing, and nucleotide
mismatch in sgRNA and the PAM motif may result in off-target editing
(Doench et al., 2016; Hsu et al., 2013). It is thus essential to take into
consideration the cleavage efficiency of sgRNA and the potential for
off-target activity in CRISPR-Cas9 genome editing (Doench, 2018;
Hanna & Doench, 2020).

123
M. Luo et al.
3.1. On-target prediction: efficacy
CRISPR-Cas9 systems exhibit a variable degree of variability in their
cleavage activity. The likelihood of Cas9 enzyme precisely cutting target
DNA is determined by a number of variables, including nucleotide
composition, chromatin accessibility, and thermodynamic stability
(Table 1) (Doench et al., 2014; Lee et al., 2016; Wilson et al., 2018).
Doench et al. (2014) analyzed sgRNA sequences of several mouse and
human genes in cellular assays, identified sequence features, and
developed a prediction model called Rule Set1 for sgRNA on-target ef­
ficacy. Several new features, such as the number of
position-independent nucleotides, target location in the corresponding
gene, and melting temperature, were incorporated later into Rule Set 2
(Table 1) (Doench et al., 2016). A number of additional nucleotide
features affecting efficiency were observed (Gagnon et al., 2014;
Heigwer et al., 2014; Moreno-Mateos et al., 2015; Wang et al., 2014; Xu
et al., 2015) (Table 1). These features have been implemented in tools
such as E-CRISP (Heigwer et al., 2014), CHOPCHOP (Labun et al., 2016,
2019; Montague et al., 2014), and CRISPOR (Haeussler et al., 2016) for
predicting sgRNA on-target efficiency (Table 1).
Based on a large-scale analysis of sgRNA mutagenesis activity in
zebrafish, Moreno-Mateos et al. (2015) found guanine enrichment and
adenine depletion contribute to the stability, loading and activity of
sgRNA (Table 1). The logistic regression analysis was conducted to find
features, mononucleotide and dinucleotide, associated with sgRNA ac­
tivity and a regression linear model was implemented in CRISPRscan for
sgRNA efficacy prediction (Moreno-Mateos et al., 2015). CHOPCHOP
and CRISPOR also use this model to predict sgRNA activity (Table 1).
The effect of sequence context on sgRNA efficiency was found to differ
significantly between CRISPR knock-out and CRISPR activation/inhi­
bition (Xu et al., 2015). The corresponding model was implemented in
SSC (Xu et al., 2015), CRISPR-FOCUS (Cao et al., 2017), and CRISPR-DO
(Ma et al., 2016).
3.2. Off-target effects: specificity
Specificity is another critical factor affecting in vitro and in vivo
genome editing. CRISPR-Cas9 can tolerate nucleotide mismatches,
which means sgRNA may guide Cas9 to other possible loci in addition to
its targets, leading to unexpected gene knockout or knock-in activity
(Hsu et al., 2013; Park et al., 2017; Wu et al., 2014). There are two
widely used methods in specificity prediction of CRISPR sgRNAs,
alignment-based and scoring-based (Liu et al., 2020). The offen used
approaches to estimate sgRNA specificity is to compare off-target se­
quences, identify the number, position and distribution of mismatches,
and come up with a penalty matrix (Hsu et al., 2013). This penalty
matrix corresponds to each position and can be used to estimate a score
for each sgRNA according to its potential off-target sites, an indicator to
choose appropriate sgRNAs. It has been used to calculate sgRNA speci­
ficity by tools such as CRISPRscan (Moreno-Mateos et al., 2015),
CHOPCHOP (Montague et al., 2014), CCTop (Stemmer et al., 2015), and
CRISPOR (Labun et al., 2016; Montague et al., 2014).
Cutting frequency determination (CFD) is another popular score for
off-target evaluation. Sung et al. (2014) profiled the off-target activity of
thousands of sgRNAs and developed a metric to predict off-target sites.
Doench et al. (2016) added PAM and other features in the scoring
matrices for CFD estimation. Validation with GUIDE-seq showed the
CFD score performed better than those proposed by Doench et al. (2016)
and Hsu et al. (2013). The CFD was included in CRISPRscan (Mor­
eno-Mateos et al., 2015) and CRISPOR (Labun et al., 2016; Montague
et al., 2014). It has been found that a single off-target model is not
enough to design reliable sgRNA (Haeussler et al., 2016). Most tools
offer advanced options for the off-target detection model or show several
scores accepted by the community. For example, CRISPOR (Haeussler
et al., 2016) offers scoring models by Hsu et al. (2013) and Doench et al.
(2016).
124
Aquaculture and Fisheries 7 (2022) 121–130
3.3. sgRNA design tools
Many sgRNA design tools have been developed to support the
CRISPR-Cas9 experiments and a number of resource reviews are avail­
able (Chuai et al., 2017; Cui et al., 2018; Graham & Root, 2015; Hanna &
Doench, 2020; Liu et al., 2020; Sledzinski et al., 2020). Cui et al. (2018)
reviewed various sgRNA tools, with a focus on-target efficiency pre­
diction and off-target algorithm. Liu et al. (2020) compared computa­
tional methodologies for effective CRISPR sgRNA design and evaluation,
finding that the majority scores are empirical or trained on experimental
datasets, and that scores are implemented using a variety of computa­
tional methods. Yan et al. (2018) benchmarked CRISPR on-target sgRNA
design and concluded that the reported sgRNA design guidelines are not
reproducible across different sgRNA libraries, cell types and organisms.
CRIPRScan was the only tool with predicted on-target efficiency scores
correlating with in vitro observed cleavage activities, according to a
zebrafish evaluation of CRISPR genome editing tools. There is no sur­
prise with this observation because the bulk of on-target prediction
systems were developed based on rules inferred from datasets of human
or mouse cells whereas CRISPRScan based on in vivo zebrafish knockout
experiments. Table 2 lists commonly used web tools for sgRNA design in
the CRISPR-Cas9 experiments with detailed information of input,
parameter settings, output and comments; an extended list is available
in Table S1 (Supplementary File 1).
4. Genome editing outcome assessment: Sanger or next-
generation sequencing
CRISPR-Cas9 genome editing often causes uniform biallelic and
heterozygous mutations in diploid organisms (Liu et al., 2015). The
assessment of editing outcomes is based on the alignment or mapping of
resulting sequences to the template and conducted by computing the
proportion of indels and repair types (NHEJ or HDR). Direct sequencing
of PCR products containing such mutations results in superimposed
sequencing chromatograms, which can be analyzed by TIDE or ICE
(Fig. 2). TIDE estimates the frequency of targeted small nucleotide
changes introduced by CRISPR and reports the identity of the detected
indels and their frequencies (Brinkman et al., 2018). The
next-generation sequencing (NGS) data can be used for assessing
genome editing results with tools such as CRISPResso2 and CRISPR
RGEN tools. CRISPResso2 is a web tool designed to enable rapid and
intuitive interpretation of genome editing results produced by amplicon
sequencing (Clement et al., 2019). CRISPR Cas-Analyzer is another on­
line tool that uses NGS data to assess genome editing results. It is a
JavaScript-implementation that runs on a client-side web browser and
eliminates the need to upload huge NGS datasets to a server, which is a
time-consuming step in genome editing analysis with other applications
such as CRISPR-GA or CRISPResso (Park et al., 2017).
5. Use of bioinformatics tools for sgRNA design of the Tyr gene:
an example
To illustrate how to use sgRNA design tools effectively, we further
show a case study of tyrosinase gene (tyr) and compare the results and
comment on their different features. The tyr gene of zebrafish has five
exons and the first protein-coding exon was used. We used four sgRNA
design tools, ZiFit, CRISPRscan, CRISPOR, and CHOPCHOP. For the
input, all tools accept raw sequences, ZiFit also accepts in FASTA format,
and others accept gene names, gene IDs, or genomic coordinates. For
parameter setting, only CHOPCHOP allows users to upload their own
reference genome if the genome of interest is not on the list. Currently,
there are only nine and 18 reference genomes, respectively, in the ZiFit
and CRISPRscan genome databases. More reference genomes are avail­
able in CRISPOR and CHOPCHOP. Users can have the option to select
Cas9 nucleases (e.g., PAM-NGG) and promoter information (e.g., T7
promoter) according to the experimental needs. The program ZiFit
M. Luo et al. Aquaculture and Fisheries 7 (2022) 121–130

Table 2
Representative online tools for sgRNA design in the CRISPR-Cas9 experiment.
Name (host) Input Options Output Features Web link and References

ZiFiT (Zinc Sequences (Raw Target length Promotor, (T7, Target site, oligo sequences Off- Ease of use Oligos for gRNA https://zifit.partners.
Finger or FASTA).No U6, none), Genome for off- target sites with 0–3 constructs No on-target or off- org/ZiFiT/ ; (Hwang et al.,
Consortium) repeats (checked target prediction mismatches, genomic positions target scores 2013; Mali et al., 2013)
with Repeat
Masker)
CRISPRscan Gene or Genome (zebrafish etc.) Cas9- CRISPRscan score Locus & Trained with large-scale http://www.crisprscan.org (
(Giraldez Lab, transcript ID NGG Promoter (T7, U6, none) Target sequence Off-targets: zebrafish sgRNA mutagenesis Cong et al., 2013; Doench
Yale (Ensembl) (CFD, all, seed) Zoom/select data Recommended for et al., 2016; Hsu et al., 2013;
University) Sequences (raw (genomic region, oligo, target zebrafish Genome browser track Moreno-Mateos et al., 2015)
or FASAT) isoform, top off-targets) for major model organisms
Detailed protocol and help page
CRISPOR Sequences Genome (686 genomes, Guides, PAM, restriction Integrated prediction tool http://crispor.org/ (Chari
(University of (length <2300 including zebrafish)PAM enzymes 10 efficiency and 2 Annotated input sequence with et al., 2015; Doench et al.,
California at bp)Genome selection specificity scores Off-targets for sgRNA specificity 10 on-target 2014, 2016; Housden et al.,
Santa Cruz) Coordinates 0–4 mismatches Genome and 2 off-target scores PCR 2015; Hsu et al., 2013; Xu
browser linked to matches primer design Outcome et al., 2015)
prediction (out of frame and
frame shift)
CHOPCHOP RefSeq/ Genome (i.e., zebrafish, Rank, target sequence, genomic Ease of use, flexible options, https://chopchop.cbu.uib.no (
(University of ENSEMBL gene rainbow trout, tilapia)Guide location, strand, GC content, downloadable results Design Chari et al., 2015; Cong et al.,
Bergen ID or genomic length, PAM Knock-out, self-complementarity, MM0, purposes: Knock-out, knock-in, 2013; Doench et al., 2014,
Harvard coordinates knock-in, activation, MM1, MM2, MM3, efficiency activation, repression Repair 2016; Hsu et al., 2013;
University) repression, nonopore View in UCSC genome browser Profile prediction Moreno-Mateos et al., 2015;
enrichment Methods for Primers Xu et al., 2015)
determining off-targets and
estimating efficiency score
Primer design

appears to have a strict 5′ requirement of sgRNA, “GG” present at 5′ -end
of sgRNA. The output of sgRNA design varies depending on the software
used (Supplementary File 2). The output by ZiFit contains the sequences
of sgRNA and oligos used for PCR validation and provides concise in­
formation related to sgRNA, which contains the fewest number of sgRNA
compared to other tools (Supplementary File 2: Table S2). The program
CRISPRScan outputs detailed information about the designed sgRNAs,
including CRISPRScan score, target sequences, off-target CFD score, off-
target numbers, and so on (Supplementary File 2: Table S3). The output
by CRISPOR contains the most comprehensive information including
sgRNAs along with MIT specificity Score, CFD score, predicted effi­
ciency, predicted outcome, and off-target information; it also provides
enzyme and cloning information for sgRNA synthesis and PCR primers
for the evaluation of sgRNA efficiency (Supplementary File 2: Table S4).
The output by CHOPCHOP has information of sgRNA, mismatch (off-
target), efficiency, and PCR primers for evaluation. In short, the output
by CHOPCHOP consists of most of the sgRNA information needed and is
more concise than those by CRISPRScan and CRISPOR (Table 3). We
suggest multiple sgRNA design tools be used to improve on-target effi­
ciency and off-target specificity.
6. Applications of CRISPR-Cas9 in aquaculture
Multiple excellent reviews on genome editing and its broad appli­
cation in aquaculture have been published (Gratacap et al., 2019; Luo
et al., 2021; Yang et al., 2021). Zhu and Ge (2018) described advance­
ments and applications of genome editing technologies, with a focus on
understanding reproductive gene functions. Blix et al. (2021) conducted
a literature mining on the current status of genome editing in farmed
finfish species and concluded that there remained a focus on reproduc­
tive traits, but this had been expanded to include genes related to other
traits such as disease resistance. They also found more than half of the
studies focused on practical aquaculture problems and the rest belonged
to basic genetic, physiological or technological research (Blix et al.,
2021). The potential of genome editing to improve aquaculture breeding
and production discussed by Gratacap et al. (2019) highlighted that the
high fecundity and external fertilization of most aquaculture species
were suitable for the application of CRISPR-Cas9 technologies,
functional disease resistance alleles could be identified through in vivo
and in vitro screenings for functional testing and application, and using
sterilized fish in aquaculture could prevent interbreeding of genome
edited individuals with wild stocks (Gratacap et al., 2019). Yang et al.
(2021) reviewed genome editing and its application in genetic
improvement in aquaculture and were convinced that the application of
CRISPR-Cas9 technologies would transform aquaculture breeding that
will produce more, high-quality seafood. While research progress and
important findings about the applications of genome editing in aqua­
culture were detailed in the above reviews, we provide below a glimpse
of CRISPR-based applications in aquaculture.
The CRISPR-based genome editing technologies have been applied to
more than 20 economically important, aquaculture fish species,
including Atlantic salmon, tilapia, common carp and grass carp (Table 4)
(Lu et al., 2021; Yang et al., 2021). The aquaculture traits studied in
these genome editing experiments include pigmentation, disease resis­
tance, reproduction, feed utilization, growth, muscle development, etc.
Most studies used ZiFit, CRISPRScan, and CRISPOR for sgRNA design.
We observed the mutation efficiency of CRISPR-Cas9 varies largely
depending on the species and genes. For example, the tyr gene has an
efficiency of 22% in Atlantic salmon but 60% in white crucian carp
(Edvardsen et al., 2014; Liu et al., 2019). Mstn (myostatin) a and b,
muscle growth-related genes that prevent the formation of skeletal
muscle, appear to have a relatively high mutation efficiency, 94% and
88%, respectively (Kishimoto et al., 2018). Among many applications,
the most exciting case is the complete knockout of muscle growth in­
hibitor (Pm-mstn) with CRISPR-Cas9 has allowed creating a new breed of
red seabream (Pagrus major). The pure genetic mutant breed were
established within two years, which is much faster than the time needed
with traditional breeding methods (Kishimoto et al., 2018).
Sexual dimorphism observed in at least 20 farmed fish is another
important trait in aquaculture, since males and females grow at different
rates with dissimilar body sizes (Mei & Gui, 2015). Molecular mecha­
nisms underlying sex determination and differentiation were studied
with genome editing of sex-related genes in yellow catfish, tilapia, and
Atlantic salmon (Dan et al., 2018; Li et al., 2014, 2020; Wargelius et al.,
2016). In addition, fish exhibit a wide variety of pigment cells and the
CRISPR editing of genes involved in the functional regulation such as

125
M. Luo et al. Aquaculture and Fisheries 7 (2022) 121–130

Fig. 2. An example pipeline of sgRNA design and outcome assessment of genome editing in aquaculture, with prediction programs denoted.

Table 3
Top 10 predicted sgRNAs by CHOPCHOP too. Full lists of the predicted sgRNAs can be found in Supplementary File 2.
Rank Target sequence Genomic location Strand GC (%) SC MM0 MM1 MM2 MM3 Efficiency

1 AGTGCGCCGGAAACTACATGGGG seq:272 + 55 1 1 0 0 0 75.34

2 TCCAGCTGTCCACTACCGAGAGG seq:374 + 60 0 1 0 0 0 72.67
3 ACTCCTGAGTGAGGATACTGCGG seq:202 – 50 0 1 0 0 0 68.88
4 GATGTTGGCGAACATTGGCGTGG seq:491 – 55 0 1 0 0 0 68.16
5 CTGTTACGATCATATAATCGGGG seq:441 – 35 1 1 0 0 0 66.27
6 GCAGTATCCTCACTCAGGAGTGG seq:204 + 55 1 1 0 0 0 63.56
7 GTGTGTACGATTTATTCGTGTGG seq:515 + 40 1 1 0 0 0 63.12
8 AGCAGATACACCCGATGCCAAGG seq:631 – 55 0 1 0 0 0 59.46
9 GCGGCGTCCAGTCAGGTCGAGGG seq:140 + 70 0 1 0 0 0 59.13
10 GGGCCGCAGTATCCTCACTCAGG seq:199 + 65 0 1 0 0 0 59.09

SC: Self-complementarity; MM0: No mismatch, MM3: 3 mismatches.

pigment cell formation, migration and pigmentation is a research area farmed fish, there are challenges in its practical applications. For
with much attention (Luo et al., 2021). For example, Du et al. (2021) example, the success rate of microinjection in embryos of many fish
knocked out the Scarb1 and Scarb1-like genes and observed the gene species remains very low. In addition, the genome editing efficiency
disruption induced a break of the red coloration and a decrease of needs to be improved while decreasing the off-target effects.
astaxanthin and lutein, suggesting the two Scarb1 genes might act as a
“switch” in the red carotenoid ornamentation in Oujiang color common
carp. Although much progress has been made in genome editing of

126
M. Luo et al. Aquaculture and Fisheries 7 (2022) 121–130

Table 4
Application of CRISPR/cas9 genome editing in major aquaculture fish species.
Traits Species Target genes Mutation efficiency sgRNA design Tools References

Pigmentation Atlantic salmon (Salmo salar) Tyr/Slc45a2 22%/45% ZiFiT Edvardsen et al. (2014)
Common carp (Cyprinus carpio) Mc1r, Asip, Mlpha, 80%, 80%, ZiFiT, Breaking-Cas (Chen et al., 2019, 2021; Du et al., 2021;
Scarb1, Tyrp1 67.74–68.97%, >60%, Hu et al., 2021; Mandal et al., 2020)
85%
White crucian carp (Carassius Tyr 60%–90% ZiFiT Liu et al. (2019)
auratus civieri)
Loach (Paramisgurnus 89.4% and 96.1% CasOT Xu et al. (2019)
dabryanus)
Various salmonid cell lines Slc45a2 >90% CRISPOR Gratacap et al. (2020)
Northern Chinese lamprey, Slc24a5 84%–99% ZiFiT Zu et al. (2016)
(Lethenteron morii)
Medaka fishes (genus Oryzias) Csf1 – ZiFiT Ansai et al. (2021)
Growth Sea bream (Sparus aurata) Mstna, Mstnb 94%, 88% ZiFiT Kishimoto et al. (2018)
Channel catfish, (lctalarus Mstn 88%–100% CRISPRscan Khalil et al. (2017)
punctatus)
Tiger pufferfish (Takifugu – ZiFiT Kishimoto et al. (2019)
rubripes)
Olive flounder (paralichthys 76% CRISPRscan Kim et al. (2019)
olivaceus)
Rainbow trout, (Oncorhynchus Igfbp-2b1/2b2 – CRISPRscan Cleveland et al. (2018)
mykiss)
Sterlet (Acipenser ruthenus) ntl 46%–55% ZiFiT Chen et al. (2018)
Reproduction Nile tilapia, (Oreochromis Dmrt1/nanaos2/ 95% ZiFiT Li et al. (2014)
niloticus) nanaos3/foxl2
Igf3 27%–95% ZIFIT Li et al. (2020)
Aldh1a2/Cyp26a1 37% and 50% ZiFiT Feng et al. (2015)
Esr1/esr2a/esr2b – ZIFIT Yan et al. (2019)
Sf-1 82%–90.9% ZiFiT Xie et al. (2016)
Dmrt6 – ZiFiT Zhang et al. (2014)
Amh/Amhy 18% and 62% ZIFIT Li et al. (2015)
Pgr – ZIFIT Fang et al. (2018)
Rln3a/Rln3b – ZIFIT Yang et al. (2020)
Wt1a/Wt1b – ZiFiT Jiang et al. (2017)
Foxh1 49% ZiFiT Tao et al. (2020)
eEF1A1b 97% ZiFiT Chen et al. (2017)
Mozambique tilapia OmBAct 81% ZIFIT Hamar and Kültz (2021)
(Oreochromis mossambicus)
Atlantic salmon (Salmo salar) Dnd 40% ZiFiT Wargelius et al. (2016)
Gibel carp (Carassius gibelio) Cgfoxl2a-B/ 96%/77 ± 1%/54 ± 14% ZIFIT Gan et al. (2021)
Cgfoxl2b-A/
Cgfoxl2b-B
Yellow catfish (Pelteobagrus Pfpdz1 28% ZIFIT Dan et al. (2018)
fulvidraco)
Trans-GFP Chinook salmon (Oncorhynchus Egfp 70% CRISPOR Gratacap et al. (2020)
tshawytscha) Megfp 65% ZIFIT Dehler et al. (2016)
Disease Grass carp (Ctenopharyngodon Jam-a 61% CRISPR design Ma et al. (2018)
resistance idella)
Chinook salmon (Oncorhynchus Stat2 – CRISPRscan Dehler et al. (2019)
tshawytscha)
Rohu carp (labeo rohita) Tlr22 – CRISPRdirect Chakrapani et al. (2016)
Channel catfish (Ictalarus Cath 78% CRISPR Guide RNA Simora et al. (2020)
punctatus) Design Tool
Ticam1/Rbl – CRISPRscan Elaswad et al. (2018)
Olive flounder (Paralichthys PoMaf1 – CRISPR RGEN Tools Kim et al. (2021)
olivaceus)
Germ cell Southern catfish (Silurus Cyp26a1 37% ZIFIT Li et al. (2016)
development meridionalis)
Nile tilapia (Oreochromis Cyp11c1 71% ZiFiT Zheng et al. (2020)
niloticus)
Muscle Common carp (Cyprinus carpio) Sp7a/Sp7b/Mstn 70%/50%/40% ZiFiT Zhong et al. (2016)
development
Omega-3 Atlantic salmon, (Salmo salar) Elov-2 >50% ZiFiT Datsomor, Zic, et al. (2019)
metabolism Slc45a2 50%–100% ZiFiT Datsomor, Olsen, et al. (2019)

7. Discussion
The CRISPR-Cas9 genome editing has become a dominant technol­
ogy for genetic perturbations, including gene knock-out and knock-in,
regulatory activation and inference (Graham & Root, 2015). This re­
view focused on two fundamental aspects related to the computational
analysis in the CRISPR-Cas9 experiments, i.e., sgRNA design and
outcome assessment. We reviewed the nucleotide rules and models of
sgRNA, which will help understand the underlying algorithms of
different sgRNA prediction tools (Doench et al., 2014, 2016; Gagnon
et al., 2014; Heigwer et al., 2014; Lee et al., 2016; Moreno-Mateos et al.,
2015; Wang et al., 2014; Wilson et al., 2018; Xu et al., 2015). The pre­
diction models created based mainly on two types of datasets, in vitro
human and mouse cell lines versus in vivo zebrafish, were implemented
in popular sgRNA design programs CHOPCHOP and CRISPRScan,
respectively (Labun et al., 2016, 2019; Montague et al., 2014). Gene
editing outcome assessment is based mainly on the alignment or map­
ping of resulting sequences to the target (Liu et al., 2015). The

127
M. Luo et al.
underlying algorithms of alignment or mapping can be different, and the
results may vary among various tools. A rule of thumb with sgRNA
design in aquaculture-related CRISPR experiments is to use CRISPRScan
for sgRNA design in companion with other similar tools such as ZiFit,
CRISPOR, or CHOPCHOP.
Future sgRNA designs should consider cell-type heterogeneity, the
epigenetic environment of different cell types, and personalized sgRNA
design rules for specific cell types to achieve better sgRNA design per­
formance (Chuai et al., 2017). Benchmark analysis of CRISPR sgRNA
design demonstrated sgRNA prediction results varied largely among
different tools using the same set of sequences, highlighting the
importance of understanding features adopted by each tool (Uribe-Sa­
lazar et al., 2020, pp. 2020–10). The design rules derived from specific
cell types or organisms may not be applied well to others (Yan et al.,
2018); the quality of the assays where the training data came from is
important to build models (Haeussler et al., 2016). Heuristic methods
currently used for sgRNA prediction shall be improved with data-driven
models through comprehensive experimental evaluation of on-target
modification efficacy and target-site specificity across many contexts
(Graham & Root, 2015). The integration of multiple assays and data
sources likely lead to more comprehensive and accurate sgRNA pre­
diction (Yan et al., 2018).
Regarding the genome editing outcome assessment, TIDE appears to
be the most straightforward and practical tool; however, it may not be
well suited for the analysis of sequences containing tandem repeats and
does not seem to be applicable in the analysis of larger rearrangements
(Sledzinski et al., 2020). The latest NGS technology has made it easy to
assess genome editing outcomes, which has been broadly used in model
organisms but has not been well adopted for genome editing in aqua­
culture (Park et al., 2017). The limitation with NGS is its cost,
time-consuming process and often the need for external service (Sled­
zinski et al., 2020).
There are many aspects of genome editing beyond the focus of this
review, including nuclease systems other than CRISPR-Cas9, genome
wide CRISPR screen, and base editing. Studies have considered the
design of a double nickases system, the modification of existing Cas9
protein (Chuai et al., 2017). The desire to expand the list of recognized
PAM sequences spurred both the development of Cas variants engi­
neered to recognize more flexible PAM sequences as well as the char­
acterization of additional Cas enzymes (Graham & Root, 2015). A major
recent focus has been the development of comprehensive tools for use on
data from large-scale CRISPR-based genetic screens (Hanna & Doench,
2020). Another direction of genome editing, which consist of deacti­
vated Cas9 (dCas9) or Cas9 nickase (nCas9) linked with a cytidine or a
guanine deaminase, is precise base editing and the corresponding tools
were discussed in (Hwang et al., 2018).
Current research of genome editing in aquaculture focuses on the
knockout experiments with the disruption of gene functions. However,
CRISPR technology can be designed for gene knock-in, CRISPR inter­
ference (CRISPRi), CRISPR activation (CRISPRa), or base-editing, which
shall benefit more to aquaculture selection programs as compared to the
gene knock-out, because this could take full advantage of the phenotype
and genotype association results from previous genetic mapping and
GWAS studies (Houston & Macqueen, 2019). Almost all the current
research in aquaculture focuses on single gene knockouts; however,
most aquaculture-related traits such as growth and reproduction are
determined by many genes. Due to the availability of genomic resources
(Lu & Luo, 2020), whole-genome CRISPR screening technology is of
great promise in aquaculture in that it produces many mutants for future
selection and breeding (Cuellar et al., 2018, p. 209; Uribe-Salazar et al.,
2020, pp. 2020–10; Zhao et al., 2020). It is critical to reduce possibilities
of off-target effects and minimize the issue of mosaicism in the founder
generation (Yang et al., 2021). As this technology improves, we hope
that researchers will be able to continuously update and improve the
CRISPR/Cas9 system, which will benefit research and practice in
aquaculture.
128
Aquaculture and Fisheries 7 (2022) 121–130
8. Conclusions
The CRISPR-Cas9 has revolutionized genome editing technologies
and brought great promise into aquaculture selection and breeding.
Besides technical challenges, sgRNA design and knockout outcome
assessment are two significant computational problems. We reviewed
nucleotide features and the learned rules or models of sgRNA and
described commonly used tools for sgRNA design and genome editing
assessment. We presented a case study of sgRNA design with several web
tools, compared their results and commented on their pros and cons
from a practical point of view. We overviewed the applications of
CRISPR-Cas9 in aquaculture, which is still at its early stage compared to
its use in biomedical research. Taking advantages of ongoing genetic
mapping and GWAS results, the CRISPR technology can be improved to
promote aquaculture selection and breeding programs.
Declaration of competing interest
The authors declare no conflict of interest.
Acknowledgments
We thank Dr. G Yue for his invitation to submit this review. This
publication was made possible through funding support from the Na­
tional Science Foundation (DBI-1919574) and the University of
Nebraska at Omaha.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.aaf.2021.10.002.
References
Alkhnbashi, O. S., Meier, T., Mitrofanov, A., Backofen, R., & Voß, B. (2020). CRISPR-Cas
bioinformatics. Methods (San Diego, Calif.), 172, 3–11.
Ansai, S., Mochida, K., Fujimoto, S., Mokodongan, D. F., Sumarto, B. K. A.,
Masengi, K. W., et al. (2021). Genome editing reveals fitness effects of a gene for
sexual dichromatism in Sulawesian fishes. Nature Communications, 12(1), 1–13.
Blix, T. B., Dalmo, R. A., Wargelius, A., & Myhr, A. I. (2021). Genome editing on finfish:
Current status and implications for sustainability. Reviews in Aquaculture, 13,
2344–2363.
Brinkman, E. K., Kousholt, A. N., Harmsen, T., Leemans, C., Chen, T., Jonkers, J., et al.
(2018). Easy quantification of template-directed CRISPR/Cas9 editing. Nucleic Acids
Research, 46(10), e58.
Canário, A. V. M. (2019). Editorial: Aquaculture genomics. Aquaculture and Fisheries, 4
(1), 1–2.
Cao, Q. Y., Ma, J., Chen, C. H., Xu, H., Chen, Z., Li, W., et al. (2017). CRISPR-FOCUS: A
web server for designing focused CRISPR screening experiments. PLoS One, 12(9),
Article e0184281.
Chakrapani, V., Patra, S. K., Panda, R. P., Rasal, K. D., Jayasankar, P., & Barman, H. K.
(2016). Establishing targeted carp TLR22 gene disruption via homologous
recombination using CRISPR/Cas9. Developmental & Comparative Immunology, 61,
242–247.
Chari, R., Mali, P., Moosburner, M., & Church, G. M. (2015). Unraveling CRISPR-Cas9
genome engineering parameters via a library-on-library approach. Nature Methods,
12(9), 823–826.
Chen, J., Jiang, D., Tan, D., Fan, Z., Wei, Y., Li, M., et al. (2017). Heterozygous mutation
of eEF1A1b resulted in spermatogenesis arrest and infertility in male tilapia,
Oreochromis niloticus. Scientific Reports, 7(1), 1–15.
Chen, H., Wang, J., Du, J., Mandal, B., Si, Z., Xu, X., et al. (2021). Analysis of recently
duplicated TYRP1 genes and their effect on the formation of black patches in
Oujiang-color common carp (Cyprinus carpio var. color). Animal Genetics, 52(4),
451–460.
Chen, H., Wang, J., Du, J., Si, Z., Yang, H., Xu, X., et al. (2019). ASIP disruption via
CRISPR/Cas9 system induces black patches dispersion in Oujiang color common
carp. Aquaculture, 498, 230–235.
Chen, J., Wang, W., Tian, Z., Dong, Y., Dong, T., Zhu, H., et al. (2018). Efficient gene
transfer and gene editing in sterlet (Acipenser ruthenus). Frontiers in Genetics, 9, 117.
Choudhary, S., Ubale, A., Padiya, J., & Mikkilineni, V. (2020). Application of
bioinformatics tools in CRISPR/Cas. In A. Bhattacharya, V. Parkhi, & B. Char (Eds.),
CRISPR/Cas genome editing. concepts and strategies in plant sciences (pp. 31–52). Cham:
Springer. https://doi.org/10.1007/978-3-030-42022-2_2.
Chuai, G. H., Wang, Q. L., & Liu, Q. (2017). In silico meets in vivo: Towards
computational CRISPR-based sgRNA design. Trends in Biotechnology, 35(1), 12–21.
M. Luo et al.
Clement, K., Rees, H., Canver, M. C., Gehrke, J. M., Farouni, R., Hsu, J. Y., et al. (2019).
CRISPResso2 provides accurate and rapid genome editing sequence analysis. Nature
Biotechnology, 37(3), 224–226.
Cleveland, B. M., Yamaguchi, G., Radler, L. M., & Shimizu, M. (2018). Editing the
duplicated insulin-like growth factor binding protein-2b gene in rainbow trout
(Oncorhynchus mykiss). Scientific Reports, 8(1), 1–13.
Cong, L., Ran, F. A., Cox, D., Lin, S. L., Barretto, R., Habib, N., et al. (2013). Multiplex
genome engineering using CRISPR/Cas systems. Science, 339(6121), 819–823.
Cuellar, T. L., Callow, M., Lau, T., Watanabe, C., Bainer, R., Costa, M., et al. (2018).
Application of CRISPR for pooled, vector-based functional genomic screening in
mammalian cell linesG Church (Ed.). . In Genome Editing and Engineering: From
TALENs, ZFNs and CRISPRs to Molecular Surgery (pp. 209–222). Cambridge:
Cambridge University Press.
Cui, Y., Xu, J., Cheng, M., Liao, X., & Peng, S. (2018). Review of CRISPR/Cas9 sgRNA
design tools. Interdisciplinary Sciences : Computational Life Sciences, 10(2), 455–465.
Dan, C., Lin, Q., Gong, G., Yang, T., Xiong, S., Xiong, Y., et al. (2018). A novel PDZ
domain-containing gene is essential for male sex differentiation and maintenance in
yellow catfish (Pelteobagrus fulvidraco). Science Bulletin, 63(21), 1420–1430.
Datsomor, A. K., Olsen, R. E., Zic, N., Madaro, A., Bones, A. M., Edvardsen, R. B., et al.
(2019). CRISPR/Cas9-mediated editing of Δ5 and Δ6 desaturases impairs Δ8-
desaturation and docosahexaenoic acid synthesis in Atlantic salmon (Salmo salar L.).
Scientific Reports, 9(1), 1–13.
Datsomor, A. K., Zic, N., Li, K., Olsen, R. E., Jin, Y., Vik, J. O., et al. (2019). CRISPR/
Cas9-mediated ablation of elovl2 in Atlantic salmon (Salmo salar L.) inhibits
elongation of polyunsaturated fatty acids and induces Srebp-1 and target genes.
Scientific Reports, 9(1), 1–13.
Dehler, C. E., Boudinot, P., Martin, S. A., & Collet, B. (2016). Development of an efficient
genome editing method by CRISPR/Cas9 in a fish cell line. Marine Biotechnology, 18
(4), 449–452.
Dehler, C. E., Lester, K., Della Pelle, G., Jouneau, L., Houel, A., Collins, C., et al. (2019).
Viral resistance and IFN signaling in STAT2 knockout fish cells. The Journal of
Immunology, 203(2), 465–475.
Doench, J. G. (2018). Am I ready for CRISPR? A user’s guide to genetic screens. Nature
Reviews Genetics, 19(2), 67–80.
Doench, J. G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E. W., Donovan, K. F., et al.
(2016). Optimized sgRNA design to maximize activity and minimize off-target
effects of CRISPR-Cas9. Nature Biotechnology, 34(2), 184–191.
Doench, J. G., Hartenian, E., Graham, D. B., Tothova, Z., Hegde, M., Smith, I., et al.
(2014). Rational design of highly active sgRNAs for CRISPR-Cas9–mediated gene
inactivation. Nature Biotechnology, 32(12), 1262–1267.
Doudna, J. A., & Charpentier, E. (2014). The new frontier of genome engineering with
CRISPR-Cas9. Science, 346(6213), 1258096.
Du, J., Chen, H., Mandal, B. K., Wang, J., Shi, Z., Lu, G., et al. (2021). HDL receptor/
Scavenger receptor B1-Scarb1 and Scarb1-like mediate the carotenoid-based red
coloration in fish. Aquaculture, 545, 737208.
Edvardsen, R. B., Leininger, S., Kleppe, L., Skaftnesmo, K. O., & Wargelius, A. (2014).
Targeted mutagenesis in Atlantic salmon (Salmo salar L.) using the CRISPR/Cas9
system induces complete knockout individuals in the F0 generation. PLoS One, 9(9),
Article e108622.
Elaswad, A., Khalil, K., Ye, Z., Liu, Z., Liu, S., Peatman, E., et al. (2018). Effects of
CRISPR/Cas9 dosage on TICAM1 and RBL gene mutation rate, embryonic
development, hatchability and fry survival in channel catfish. Scientific Reports, 8(1),
1–17.
Fang, J., Chen, T., Pan, Q., & Wang, Q. (2018). Generation of albino medaka (Oryzias
latipes) by CRISPR/Cas9. Journal of Experimental Zoology Part B: Molecular and
Developmental Evolution, 330(4), 242–246.
Fang, X., Wu, L., Yang, L., Song, L., Cai, J., Luo, F., et al. (2018). Nuclear progestin
receptor (Pgr) knockouts resulted in subfertility in male tilapia (Oreochromis
niloticus). The Journal of Steroid Biochemistry and Molecular Biology, 182, 62–71.
Feng, R., Fang, L., Cheng, Y., He, X., Jiang, W., Dong, R., et al. (2015). Retinoic acid
homeostasis through aldh1a2 and cyp26a1 mediates meiotic entry in Nile tilapia
(Oreochromis niloticus). Scientific Reports, 5(1), 1–12.
Gagnon, J. A., Valen, E., Thyme, S. B., Huang, P., Ahkmetova, L., Pauli, A., et al. (2014).
Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-
scale assessment of single-guide RNAs. PLoS One, 9(5), Article e98186.
Gan, R. H., Wang, Y., Li, Z., Yu, Z. X., Li, X. Y., Tong, J. F., et al. (2021). Functional
divergence of multiple duplicated foxl2 homeologs and alleles in a recurrent
polyploid fish. Molecular Biology and Evolution, 38(5), 1995–2013.
Graham, D. B., & Root, D. E. (2015). Resources for the design of CRISPR gene editing
experiments. Genome Biology, 16(1), 260-260.
Gratacap, R. L., Jin, Y. H., Mantsopoulou, M., & Houston, R. D. (2020). Efficient genome
editing in multiple salmonid cell lines using ribonucleoprotein complexes. Marine
Biotechnology, 22(5), 717–724.
Gratacap, R. L., Regan, T., Dehler, C. E., Martin, S. A., Boudinot, P., Collet, B., et al.
(2020). Efficient CRISPR/Cas9 genome editing in a salmonid fish cell line using a
lentivirus delivery system. BMC Biotechnology, 20(1), 1–9.
Gratacap, R. L., Wargelius, A., Edvardsen, R. B., & Houston, R. D. (2019). Potential of
genome editing to improve aquaculture breeding and production. Trends in Genetics,
35(9), 672–684.
Haeussler, M., Schönig, K., Eckert, H., Eschstruth, A., Mianné, J., Renaud, J.-B., et al.
(2016). Evaluation of off-target and on-target scoring algorithms and integration
into the guide RNA selection tool CRISPOR. Genome Biology, 17(1), 1–12.
Hamar, J., & Kültz, D. (2021). An efficient vector-based CRISPR/Cas9 system in an
Oreochromis mossambicus cell line using endogenous promoters. Scientific Reports, 11
(1), 1–17.
129
Aquaculture and Fisheries 7 (2022) 121–130
Hanna, R. E., & Doench, J. G. (2020). Design and analysis of CRISPR–Cas experiments.
Nature Biotechnology, 38(7), 813–823.
Heigwer, F., Kerr, G., & Boutros, M. (2014). E-CRISP: Fast CRISPR target site
identification. Nature Methods, 11(2), 122–124.
Housden, B. E., Valvezan, A. J., Kelley, C., Sopko, R., Hu, Y., Roesel, C., et al. (2015).
Identification of potential drug targets for tuberous sclerosis complex by synthetic
screens combining CRISPR-based knockouts with RNAi. Science Signaling, 8(393),
rs9.
Houston, R., & Macqueen, D. (2019). Atlantic salmon (Salmo salar L.) genetics in the 21st
century: Taking leaps forward in aquaculture and biological understanding. Animal
Genetics, 50(1), 3–14.
Hsu, P. D., Scott, D. A., Weinstein, J. A., Ran, F. A., Konermann, S., Agarwala, V., et al.
(2013). DNA targeting specificity of RNA-guided Cas9 nucleases. Nature
Biotechnology, 31(9), 827–832.
Hu, X., Chen, H., Yu, L., Chen, X., Mandal, B. K., Wang, J., et al. (2021). Functional
differentiation analysis of duplicated mlpha gene in Oujiang color common carp (Cyprinus
carpio var. color) on colour formation. https://doi.org/10.1111/are.15295.
Aquaculture Research.
Hwang, W. Y., Fu, Y. F., Reyon, D., Maeder, M. L., Tsai, S. Q., Sander, J. D., et al. (2013).
Efficient genome editing in zebrafish using a CRISPR-Cas system. Nature
Biotechnology, 31(3), 227–229.
Hwang, G. H., Park, J., Lim, K., Kim, S., Yu, J., Yu, E., et al. (2018). Web-based design
and analysis tools for CRISPR base editing. BMC Bioinformatics, 19(1), 542-542.
Jiang, D., Chen, J., Fan, Z., Tan, D., Zhao, J., Shi, H., et al. (2017). CRISPR/Cas9-induced
disruption of wt1a and wt1b reveals their different roles in kidney and gonad
development in Nile tilapia. Developmental Biology, 428(1), 63–73.
Jiang, F., & Doudna, J. A. (2017). CRISPR–Cas9 structures and mechanisms. Annual
Review of Biophysics, 46, 505–529.
Jin, Y. (2018). Research towards the effective disruption of reproductive competence in Nile
tilapia Oreochromis niloticus. Doctoral dissertation, University of Stirling.
Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012).
A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial
immunity. Science, 337(6096), 816–821.
Khalil, K., Elayat, M., Khalifa, E., Daghash, S., Elaswad, A., Miller, M., et al. (2017).
Generation of myostatin gene-edited channel catfish (Ictalurus punctatus) via zygote
injection of CRISPR/Cas9 system. Scientific Reports, 7(1), 1–12.
Kim, J., Cho, J. Y., Kim, J. W., Kim, D. G., Nam, B. H., Kim, B. S., et al. (2021). Molecular
characterization of Paralichthys olivaceus MAF1 and its potential role as an anti-viral
Hemorrhagic septicaemia virus factor in Hirame natural embryo cells. International
Journal of Molecular Sciences, 22(3), 1353.
Kim, J., Cho, J. Y., Kim, J. W., Kim, H. C., Noh, J. K., Kim, Y. O., et al. (2019). CRISPR/
Cas9-mediated myostatin disruption enhances muscle mass in the olive flounder
Paralichthys olivaceus. Aquaculture, 512, 734336.
Kim, H., & Kim, J.-S. (2014). A guide to genome engineering with programmable
nucleases. Nature Reviews Genetics, 15(5), 321–334.
Kishimoto, K., Washio, Y., Murakami, Y., Katayama, T., Kuroyanagi, M., Kato, K., et al.
(2019). An effective microinjection method for genome editing of marine
aquaculture fish: Tiger pufferfish Takifugu rubripes and red sea bream Pagrus major.
Fisheries Science, 85(1), 217–226.
Kishimoto, K., Washio, Y., Yoshiura, Y., Toyoda, A., Ueno, T., Fukuyama, H., et al.
(2018). Production of a breed of red sea bream Pagrus major with an increase of
skeletal muscle mass and reduced body length by genome editing with CRISPR/Cas9.
Aquaculture, 495, 415–427.
Koike-Yusa, H., Li, Y., Tan, E.-P., Velasco-Herrera, M. D. C., & Yusa, K. (2014). Genome-
wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide
RNA library. Nature Biotechnology, 32(3), 267–273.
Labun, K., Montague, T. G., Gagnon, J. A., Thyme, S. B., & Valen, E. (2016). CHOPCHOP
v2: A web tool for the next generation of CRISPR genome engineering. Nucleic Acids
Research, 44(W1), W272–W276.
Labun, K., Montague, T. G., Krause, M., Cleuren, Y. N. T., Tjeldnes, H., & Valen, E.
(2019). CHOPCHOP v3: Expanding the CRISPR web toolbox beyond genome editing.
Nucleic Acids Research, 47(W1), W171–W174.
LaFountaine, J. S., Fathe, K., & Smyth, H. D. C. (2015). Delivery and therapeutic
applications of gene editing technologies ZFNs, TALENs, and CRISPR/Cas9.
International Journal of Pharmaceutics, 494(1), 180–194.
Lee, C. M., Cradick, T. J., Fine, E. J., & Bao, G. (2016). Nuclease target site selection for
maximizing on-target activity and minimizing off-target effects in genome editing.
Molecular Therapy, 24(3), 475–487.
Li, M., Dai, S., Liu, X., Xiao, H., & Wang, D. (2021). A detailed procedure for CRISPR/
Cas9-mediated gene editing in tilapia. Hydrobiologia, 848(16), 3865–3881.
Li, M., Feng, R., Ma, H., Dong, R., Liu, Z., Jiang, W., et al. (2016). Retinoic acid triggers
meiosis initiation via stra8-dependent pathway in Southern catfish, Silurus
meridionalis. General and Comparative Endocrinology, 232, 191–198.
Li, M., Liu, X., Dai, S., Xiao, H., Qi, S., Li, Y., et al. (2020). Regulation of spermatogenesis
and reproductive capacity by Igf3 in tilapia. Cellular and Molecular Life Sciences,
1–18.
Li, M., Sun, Y., Zhao, J., Shi, H., Zeng, S., Ye, K., et al. (2015). A tandem duplicate of anti-
Müllerian hormone with a missense SNP on the Y chromosome is essential for male
sex determination in Nile tilapia, Oreochromis niloticus. PLoS Genetics, 11(11), Article
e1005678.
Liu, Q., Qi, Y., Liang, Q., Song, J., Liu, J., Li, W., et al. (2019). Targeted disruption of
tyrosinase causes melanin reduction in Carassius auratus cuvieri and its hybrid
progeny. Science China Life Sciences, 62(9), 1194–1202.
Liu, H., Wei, Z., Dominguez, A., Li, Y., Wang, X., & Qi, L. S. (2015). CRISPR-ERA: A
comprehensive design tool for CRISPR-mediated gene editing, repression and
activation. Bioinformatics, 31(22), 3676–3678.
M. Luo et al.
Liu, G., Zhang, Y., & Zhang, T. (2020). Computational approaches for effective CRISPR
guide RNA design and evaluation. Computational and Structural Biotechnology Journal,
18, 35–44.
Li, M., Yang, H., Zhao, J., Fang, L., Shi, H., Li, M., et al. (2014). Efficient and heritable
gene targeting in tilapia by CRISPR/Cas9. Genetics, 197(2), 591–599.
Lu, J., Fang, W., Huang, J., & Li, S. (2021). The application of genome editing technology
in fish. Marine Life Science & Technology, 3(3), 326–346.
Lu, G., & Luo, M. (2020). Genomes of major fishes in world fisheries and aquaculture:
Status, application and perspective. Aquaculture and Fisheries, 5(4), 163–173.
Luo, M., Lu, G., Yin, H., Wang, L., Atuganile, M., & Dong, Z. (2021). Fish pigmentation
and coloration: Molecular mechanisms and aquaculture perspectives. Reviews in
Aquaculture, 13, 2395–2440.
Ma, J., Fan, Y., Zhou, Y., Liu, W., Jiang, N., Zhang, J., et al. (2018). Efficient resistance to
grass carp reovirus infection in JAM-A knockout cells using CRISPR/Cas9. Fish &
Shellfish Immunology, 76, 206–215.
Ma, J., Koster, J., Qin, Q., Hu, S. G., Li, W., Chen, C. H., et al. (2016). CRISPR-DO for
genome-wide CRISPR design and optimization. Bioinformatics, 32(21), 3336–3338.
Mali, P., Yang, L. H., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., et al. (2013). RNA-
guided human genome engineering via Cas9. Science, 339(6121), 823–826.
Mandal, B. K., Chen, H., Si, Z., Hou, X., Yang, H., Xu, X., et al. (2020). Shrunk and
scattered black spots turn out due to MC1R knockout in a white-black Oujiang color
common carp (Cyprinus carpio var. color). Aquaculture, 518, 734822.
Mei, J., & Gui, J. F. (2015). Genetic basis and biotechnological manipulation of sexual
dimorphism and sex determination in fish. Science China Life Sciences, 58(2),
124–136.
Mojica, F. J. M., & Rodriguez-Valera, F. (2016). The discovery of CRISPR in archaea and
bacteria. FEBS Journal, 283(17), 3162–3169.
Montague, T. G., Cruz, J. M., Gagnon, J. A., Church, G. M., & Valen, E. (2014).
CHOPCHOP: A CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids
Research, 42(W1), W401–W407.
Moreno-Mateos, M. A., Vejnar, C. E., Beaudoin, J. D., Fernandez, J. P., Mis, E. K.,
Khokha, M. K., et al. (2015). CRISPRscan: Designing highly efficient sgRNAs for
CRISPR-cas9 targeting in vivo. Nature Methods, 12(10), 982–988.
Ohama, M., Washio, Y., Kishimoto, K., Kinoshita, M., & Kato, K. (2020). Growth
performance of myostatin knockout red sea bream Pagrus major juveniles produced
by genome editing with CRISPR/Cas9. Aquaculture, 529, 735672.
Park, J., Childs, L., Kim, D., Hwang, G. H., Kim, S., Kim, S. T., et al. (2017). Digenome-seq
web tool for profiling CRISPR specificity. Nature Methods, 14(6), 548–549.
Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., et al.
(2014). Genome-scale CRISPR-Cas9 knockout screening in human cells. Science, 343
(6166), 84–87.
Simora, R. M. C., Xing, D., Bangs, M. R., Wang, W., Ma, X., Su, B., et al. (2020). CRISPR/
Cas9-mediated knock-in of alligator cathelicidin gene in a non-coding region of
channel catfish genome. Scientific Reports, 10(1), 1–14.
Sledzinski, P., Nowaczyk, M., & Olejniczak, M. (2020). Computational tools and
resources supporting CRISPR-Cas experiments. Cells, 9(5), 1288.
Stemmer, M., Thumberger, T., Del Sol Keyer, M., Wittbrodt, J., & Mateo, J. L. (2015).
CCTop: An intuitive, flexible and reliable CRISPR/Cas9 target prediction tool. PLoS
One, 10(4), Article e0124633.
Sung, Y. H., Kim, J. M., Kim, H.-T., Lee, J., Jeon, J., Jin, Y., et al. (2014). Highly efficient
gene knockout in mice and zebrafish with RNA-guided endonucleases. Genome
Research, 24(1), 125–131.
Tao, W., Shi, H., Yang, J., Diakite, H., Kocher, T. D., & Wang, D. (2020). Homozygous
mutation of foxh1 arrests oogenesis causing infertility in female Nile tilapia. Biology
of Reproduction, 102(3), 758–769.
130
Aquaculture and Fisheries 7 (2022) 121–130
Uribe-Salazar, J. M., Sekar, A., Kaya, G., Weyenberg, K., Ingamells, C., & Dennis, M.
(2020). Evaluation of CRISPR gene-editing tools in zebrafish identifies spurious mutations
in ‘mock’control embryos. https://doi.org/10.1101/2020.10.19.345256. bioRxiv.
Vejnar, C. E., Moreno-Mateos, M. A., Cifuentes, D., Bazzini, A. A., & Giraldez, A. J.
(2016). Optimized CRISPR-Cas9 system for genome editing in zebrafish, 2016 Cold
Spring Harbour Protocols, (10). pdb-prot086850.
Wang, T., Wei, J. J., Sabatini, D. M., & Lander, E. S. (2014). Genetic screens in human
cells using the CRISPR-Cas9 system. Science, 343(6166), 80–84.
Wargelius, A. (2019). Application of genome editing in aquatic farm animals: Atlantic
salmon. Transgenic Research, 28(Suppl 2), 101–105.
Wargelius, A., Leininger, S., Skaftnesmo, K. O., Kleppe, L., Andersson, E., Taranger, G. L.,
et al. (2016). Dnd knockout ablates germ cells and demonstrates germ cell
independent sex differentiation in Atlantic salmon. Scientific Reports, 6(1), 1–8.
Wilson, L. O. W., O’Brien, A. R., & Bauer, D. C. (2018). The current state and future of
CRISPR-Cas9 gRNA design tools. Frontiers in Pharmacology, 9, 749.
Wu, X., Kriz, A. J., & Sharp, P. A. (2014). Target specificity of the CRISPR-Cas9 system.
Quantitative biology, 2(2), 59–70.
Xie, Q. P., He, X., Sui, Y. N., Chen, L. L., Sun, L. N., & Wang, D. S. (2016).
Haploinsufficiency of SF-1 causes female to male sex reversal in Nile tilapia,
Oreochromis niloticus. Endocrinology, 157(6), 2500–2514.
Xu, X., Cao, X., & Gao, J. (2019). Production of a mutant of large-scale loach
Paramisgurnus dabryanus with skin pigmentation loss by genome editing with
CRISPR/Cas9 system. Transgenic Research, 28(3), 341–356.
Xu, H., Xiao, T. F., Chen, C. H., Li, W., Meyer, C. A., Wu, Q., et al. (2015). Sequence
determinants of improved CRISPR sgRNA design. Genome Research, 25(8),
1147–1157.
Yan, J., Chuai, G., Zhou, C., Zhu, C., Yang, J., Zhang, C., et al. (2018). Benchmarking
CRISPR on-target sgRNA design. Briefings in Bioinformatics, 19(4), 721–724.
Yan, L., Feng, H., Wang, F., Lu, B., Liu, X., Sun, L., et al. (2019). Establishment of three
estrogen receptors (esr1, esr2a, esr2b) knockout lines for functional study in Nile
tilapia. The Journal of Steroid Biochemistry and Molecular Biology, 191, 105379.
Yang, L., Li, Y., Wu, Y., Sun, S., Song, Q., Wei, J., et al. (2020). Rln3a is a prerequisite for
spermatogenesis and fertility in male fish. The Journal of Steroid Biochemistry and
Molecular Biology, 197, 105517.
Yang, Z., Yu, Y., Tay, Y. X., & Yue, G. H. (2021). Genome editing and its applications in
genetic improvement in aquaculture. Reviews in Aquaculture, 1–14.
Zhang, X. C., Wang, F., Dong, Z. J., Dong, X. H., Chi, J., Chen, H. G., et al. (2020). A new
strain of yellow catfish carrying genome edited myostatin alleles exhibits double
muscling phenotype with hyperplasia. Aquaculture, 523, 735187.
Zhang, X., Wang, H., Li, M., Cheng, Y., Jiang, D., Sun, L., et al. (2014). Isolation of
doublesex-and mab-3-related transcription factor 6 and its involvement in
spermatogenesis in tilapia. Biology of Reproduction, 91(6), 136, 131-110.
Zhao, C., Liu, H., Xiao, T., Wang, Z., Nie, X., Li, X., et al. (2020). CRISPR screening of
porcine sgRNA library identifies host factors associated with Japanese encephalitis
virus replication. Nature Communications, 11(1), 1–15.
Zheng, Q., Xiao, H., Shi, H., Wang, T., Sun, L., Tao, W., et al. (2020). Loss of Cyp11c1
causes delayed spermatogenesis due to the absence of 11-ketotestosterone. Journal of
Endocrinology, 244(3), 487–499.
Zhong, Z., Niu, P., Wang, M., Huang, G., Xu, S., Sun, Y., et al. (2016). Targeted disruption
of sp7 and myostatin with CRISPR-Cas9 results in severe bone defects and more
muscular cells in common carp. Scientific Reports, 6(1), 1–14.
Zhu, B., & Ge, W. (2018). Genome editing in fishes and their applications. General and
Comparative Endocrinology, 257, 3–12.
Zu, Y., Zhang, X., Ren, J., Dong, X., Zhu, Z., Jia, L., et al. (2016). Biallelic editing of a
lamprey genome using the CRISPR/Cas9 system. Scientific Reports, 6(1), 1–9.