2020 04 09 20058966 Full

medRxiv preprint doi: https://doi.org/10.1101/2020.04.09.20058966; this version posted April 14, 2020.
The copyright holder for this preprint

(which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
All rights reserved. No reuse allowed without permission.
DETECTION OF EARLY HIV-1 INFECTION AMONG
FEBRILE PERSONS AND BLOOD DONORS IN OYO STATE,
NIGERIA
Babatunde A. Olusola1, David O. Olaleye1, Georgina N. Odaibo1*

1
Department of Virology, College of Medicine, University of Ibadan, Ibadan, Oyo State,
Nigeria.
*
Correspondence
Prof Georgina N. Odaibo
Abstract
About 37.9 million persons are infected with HIV globally resulting in 770,000 deaths. Over
50% of this infection and deaths occur in Sub-Saharan Africa with countries like Nigeria
greatly affected. The country also has one of the highest rate of new infections globally.
Diverse HIV-1 subtypes have been identified in the country. Febrile persons and blood
donors pose a great transmission risk in the country especially during the early stages of
infection. HIV-1 rapid kits are routinely used for diagnosis among the general population and
high risk groups. However, there is limited information on the usefulness of HIV rapid kits
for early detection especially in areas where diverse HIV-1 subtypes circulate. In this study,
the prevalence of early HIV-1 infection as well as circulating HIV-1 subtypes among febrile
persons and blood donors were determined. Furthermore, the sensitivity of a widely used
HIV-1 rapid antibody kit was compared with those of Antigen/Antibody ELISA based
methods. Participants were recruited from selected hospitals in Ibadan and Saki, Nigeria. The
prevalence of early HIV infection among 1028 febrile persons (Ibadan: 2.22%; Saki: 1.36%)
and blood donors (5.07%) studied were significantly different (P<0.03674). CRF02_AG was
the predominant subtype detected with more diverse HIV-1 subtypes observed among febrile
NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice.
medRxiv preprint doi: https://doi.org/10.1101/2020.04.09.20058966; this version posted April 14, 2020. The copyright holder for this preprint
persons compared to blood donors. About 1.2% of the samples detected on Antibody based
ELISA methods were undetectable on the HIV-1 rapid antibody kit. Genetic diversity of
HIV-1 strains among infected individuals in Oyo State, Nigeria is still relatively high. This
diversity is likely impacting on diagnosis.

Introduction
As at 2018, about 37.9 million persons are infected with HIV globally with 21% of these
people not aware of their status1. This rate of infection resulted in 770,000 deaths. Also, in
the same year, 1.7 million (4.4%) individuals became newly infected with the virus. Over
50% of HIV infection and AIDS-related deaths occur in Sub-Saharan Africa making the
region the highest hit with the infection1. Apart from several HIV-1 subtypes and
recombinant forms circulating in Africa, more than a few high risk groups are also present in
the continent1,2. Although HIV prevalence is controlled in the general population in most
countries in Africa, there is still high prevalence of the virus among high risk groups. To
control the HIV epidemic and achieve the 95-95-95 target, it is important that new HIV
infections are quickly diagnosed and high risk groups are continuously identified and
monitored3. Furthermore, it is pertinent that circulating subtypes within these groups are
determined. Previous studies have showed that HIV-1 subtypes have differing impacts on
diagnosis, transmission, pathogenesis and vaccine designs2,4,5.
In Nigeria, over 1.9 million people are infected with HIV and around 33% of these people
don’t know their status. Although there is reduction in the prevalence of HIV infection, the
country still has one of the highest number of new HIV infections (130,000) and AIDS-
related deaths (53,000) globally1. Diverse HIV-1 subtypes and recombinant forms
(CRF02_AG, G, A, B, C, D, CRF06_cpx, URFs etc.) have been characterized in the country
previously6. Several HIV-1 high risk groups such as commercial sex workers7,8, voluntary
blood donors9,10, long distance drivers11–13, mammy markets contiguous to military facilities14
etc. have also been identified. We as well as other authors have previously identified persons
with febrile symptoms as a group to be screened for early HIV infection15–17. Most of these
individuals are unaware of their status, hence, they pose an even higher transmission risk.
The same applies to voluntary blood donors. Most blood screening centers in the country use
HIV-1 Rapid antibody kits for pre-donation diagnosis. These kits miss out on infected
persons at the early stages of infection. In order to sustain the gains of HIV control in the
country, there is the need to diagnose persons at the early stages of HIV-1 infection as well as
monitor high risk groups such as voluntary blood donors. Voluntary blood donors may fuel
the spread of the virus as there is still high prevalence of unscreened or improperly screened
HIV infected blood in Nigeria and other developing countries18,19.
Despite concerted efforts in the country to control HIV infection, an appreciable number of
persons do not know their status and there is very limited data on circulating HIV-1 subtypes
among febrile persons and voluntary blood donors. Although opportunities for HIV-1 testing
have improved in the country, most testing centers use HIV-1 Rapid Antibody kits for
diagnosis. These kits increase access by reducing turnaround time. However, their usefulness
in eliminating samples with HIV-1 antibodies during early HIV infection diagnosis is not
known. It is uncertain whether these kits’ sensitivities are not reduced in areas with high
HIV-1 prevalence and diverse HIV-1 subtypes. Therefore, the aim of this study was to
determine the prevalence and circulating subtypes of early HIV-1 infection among voluntary
blood donors and febrile persons referred by clinicians for malaria antigen testing in hospitals
in Ibadan and Saki, Oyo State, Nigeria. The performance characteristics of an HIV Rapid
Antibody Point of Care test kit (Alere™ Determine™ HIV-1/2 set) for HIV-1 antibody
detection was also determined.
Materials and Methods
Study sites and patient population
This study was conducted in two major cities in Oyo state, namely Ibadan and Saki as
previously described15. Ibadan is the capital city of Oyo State and one of the most populated
cities in Africa while Saki is a town 100 miles west of Ibadan, toward the border with the
republic of Benin. Multiple HIV-1 subtypes and circulating recombinant forms (CRFs) have
been shown previously to be circulating in these two cities20. Government, missionary and
private owned hospitals in these cities were selected based on accessibility and availability of
resident Physicians and laboratory staff. The Government hospitals were primary and
secondary health care centers and services at these hospitals for outpatients were provided
almost at little or no costs. Voluntary blood donors as well as persons referred by clinicians
for malaria antigen test from selected hospitals in Ibadan and Saki were recruited for the
study.
Recruitment of participants, sample collection and processing
Participants were recruited for this study after obtaining informed consent. Data on patient
age, gender and contact details were collected. They were given feedback on their results
within a week of sample collection. Individuals infected with HIV were counseled and
integrated into existing HIV point of care centers. We screened 1028 participants for this
study out of which 890 were referred by Physicians to on-site laboratories for malaria antigen
test. This study was a continuation of an initial study started in 2015. Initial findings from the
study have been previously reported15. Five milliliters of whole blood were collected in
EDTA bottles from participants. Plasma was separated from the samples immediately after
collection, stored at -20°C and transported in cold chain to a central laboratory for analysis.
The samples were then stored at -80°C until analyzed. Blood samples were analyzed for HIV
antigen/antibody and HIV-1 Gag DNA.
Identification of early and chronic HIV-1 infections
The updated CDC algorithm of laboratory testing for the diagnosis of early and chronic HIV-
1 infection was used for this study as previously described15. Briefly, samples were identified
as early HIV infection if HIV-1 DNA was detected after being positive with a 4th generation
HIV ELISA (detection of both antigen and antibody) and negative with 3rd generation HIV
ELISA (detection of HIV antibody only) while those from which HIV-1 DNA scored positive
with both 4th and 3rd generation ELISA, were classified as chronic HIV infection.
GenscreenTM ULTRA HIV-Ag-Ab ELISA kit (Biorad, Hercules, California) was used as the
4th generation ELISA kit while AiDTM anti-HIV 1+2 ELISA kit (Wantai, Beijing, China) was
used as the 3rd generation ELISA kit. All assays were performed under strict biosafety
conditions and according to the manufacturer’s recommendation. Furthermore, HIV-1
antibodies was also determined using Alere™ Determine™ HIV-1/2 Rapid Antibody Test kit
(HIV Rapid Ab POC) (Alere, Chiba, Japan) in a subset of the samples. This test kit is
approved for routine HIV diagnosis in the country.
PCR amplification and sequencing
Total DNA was extracted from whole blood using guanidium thiocyanate in house protocol.
A fragment of the gag-pol region (900 base pairs) of the virus was amplified using previously
21
published primers and cycling conditions with slight modifications. Briefly, PCR was
performed using a SuperScript III One-step RT-PCR system with platinum TaqDNA High
fidelity polymerase (Jena Bioscience). Each 25µl reaction mixture contained 12.5µl reaction
mix (2x), 4.5µl RNase-free water, 1µl each of each primer (20pmol/µl), 1µl Superscript III
RT/Platinum Taq High Fidelity mix, and 5µl of template DNA. Pan-HIV-1_1R (CCT CCA
ATT CCY CCT ATC ATT TT) and Pan-HIV-1_2F (GGG AAG TGA YAT AGC WGG
AAC) were used. Cycling conditions were 94°C for 5min; 35 cycles of 94°C for 15s, 58°C
for 30s, and 68°C for 1min 30s; and finally, 68°C for 10mins.
Positive HIV samples that was undetectable using the above stated primers were retested
using another set of GAG primers for nested PCR as described previously22. Briefly, a 700-bp
fragment corresponding to the p24 region was amplified using G00 and G01 for first round
and G60-G25 for the second round. The PCR conditions were as follows: an initial
denaturation step for 3 min at 92°C, followed by 30 cycles of 92°C for 10 s, 55°C for 30 s,
and 1 min at 72°C, with a final extension for 7 min at 72°C. Amplicons were detected by gel
electrophoresis. Furthermore, HIV-1 VIF gene of some samples were also detected and
sequenced. As described previously23, Vif-1 (ATTCAAAATTTTCGGGTTTATTACAG)
and TATED3-1 (AATTCTGCAACAACTGCTGTTTAT) primers were used for first round
while Vif-2 (AGGTGAAGGGGCAGTAGTAATACA) and TATED-
1(GCAGGAGTGGAAGCCATAATAAG) primers used for second round. The PCR
conditions were as follows: 94oC for 5mins, followed by 35 cycles of 94oC for 30s, 60oC for
30s, 68oC for I min with a final extension for 4min at 68oC for 1minPositive PCR reactions
were shipped on ice to Macrogen, South Korea for Big Dye sequencing using the same
amplification primers (Pan-HIV-1_1R and Pan-HIV-1_2F; or G60 and G25; or Vif-2 and
TATED-1 for VIF).
Detection of HIV-1 subtypes and recombination
The sequences were cleaned and edited using Chromas and Bioedit softwares. Subtyping was
performed using a combination of four subtyping tools: The Rega HIV-1 Subtyping Tool,
version 3.0 (http://dbpartners.stanford.edu/RegaSubtyping/), Comet, version 2.2
(http://comet.retrovirology.lu), National Center for Biotechnology Information, Bethesda,
MD (http://www.ncbi.nlm.nih.gov /Blast.cgi) and jpHMMM: Improving the reliability of
recombination prediction in HIV-1 (http: //jphmm.gobics.de/submission_hiv). The first three
tools were used simultaneously while jpHMMM was used to resolve discordant subtypes.
Phylogenetic analyses were performed using MEGA software version 10. All consensus
nucleotide sequences obtained in this study were submitted to GenBank. Database and
assigned accession numbers KY786266-272 and MN943617-635.

Ethical approval
Ethical approvals for this research were obtained from the University of Ibadan/ University
College Hospital (UI/UCH) Research and Ethics Committee (UI/EC/15/0076) and the Oyo
State Ministry of Health Committee on Human Research (AD13/479/951). All results were
delinked from patient identifiers and anonymized.
Eligibility/ Exclusion criteria
Only individuals between 18 and 65 years of age were included in the study. Individuals who
already knew their HIV status were excluded from the study.
Data management and statistical analysis
Statistical analyses were performed using SPSS version 20 and graphpad prism. Categorical
variables were compared using Z and chi-square tests while quantitative variables were
compared using ANOVA. Test of significance was set at P<0.05.
Results
Patient characteristics
One thousand and twenty-eight (1028) individuals participated in this study out of which 890
were outpatients referred for malaria antigen testing. Voluntary blood donors were only
recruited in Ibadan. Five hundred and ninety four (57.7%) of these individuals were female.
The mean (±SD) ages for participants referred for malaria antigen test in Ibadan, Saki and
voluntary blood donors were 37.2 (±9.1), 36.1 (±14.3) and 35.1 (±14.3) years respectively
(Table 1).
Prevalence of early and chronic HIV infection
A total of 55 persons were HIV positive, giving a rate of infection of 5.35%. The HIV
prevalence varied by location and groups tested. Twenty three (2.23%) individuals were at
the early stages of HIV infection with an higher rate among voluntary blood donors (5.07%)
compared to those referred for malaria antigen test (Ibadan: 2.22%; Saki: 1.36%)
(P<0.03674). Differences in prevalence by gender were not significant for either early or
chronic HIV infection (Table 1).
Proportions of HIV reactive samples based on serological assays
Table 2 shows the proportions of HIV reactive sample based on serological assays. This
analysis was carried out on a subset of samples (671) collected from persons referred for
malaria antigen test in Ibadan and Saki. Using 4th generation HIV Ag-Ab ELISA as the gold
standard, HIV Rapid Ab POC (Ibadan: 1.95%; Saki: 2.95%) had significantly higher rates of
false negative results in both locations compared to 3rd generation ELISA (HIV Ab ELISA)
(Ibadan: 1.29%; Saki: 1.36%). The performance characteristics of HIV Rapid Ab POC are
also presented. The sensitivity (95% CI) of HIV Rapid Ab POC is 52.38% (29.78-74.29). As
shown in Figure 1, 14 samples were reactive on all serological assays while no sample was
reactive on HIV Ab ELISA alone nor on HIV Ab ELISA and HIV Rapid Ab POC. Eight
samples with HIV-1 antibodies (1.2%) were undetectable on HIV Rapid Ab POC.
Subtyping
Twenty out of the 23 isolates with early HIV infection were successfully sequenced. The
predominant subtype detected was CRF02_AG (9; 45%). Other subtypes detected were A (5;
25%), G (3; 15%), K (1; 5%) and Recombinant GD (1; 5%). One of the sequenced viruses
did not align with any subtype and was reported as unassigned (Table 3). Based on groups,
CRF02-AG was the most predominant strain among persons referred for malaria antigen test
(Saki: 50%; Ibadan 40%). Voluntary blood donors had the same number of HIV-1 subtypes
A, G as well as CRF02-AG. Subtype K, recombinants and unassigned subtypes were found
among persons referred for malaria antigen test.
Discussion
This study indicates that the prevalence of early HIV-1 infection is significantly high among
febrile persons referred for malaria antigen testing (Ibadan: 2.22%; Saki: 1.36%) and
voluntary blood donors (5.07%). Presently, the prevalence of HIV-1 among the general
population in Nigeria is about 1.9%24. This then means that high prevalence of HIV-1
infection among high risk groups is masked by low prevalence in the general population as
previously hypothesized25. To effectively control the prevalence and incidence of HIV-1
infection in the country, it is important that persons at the early stages of infection are
identified and placed on treatment early. The strategy used in this study to identify early HIV-
1 infection seems applicable for other high risk groups’ aside febrile persons. Identifying and
treating HIV-1 infected individuals during the early stages of infection will go a long way in
reducing new HIV-1 infections as well as decrease the number AIDS- related deaths in the
country, since undetectable equals untransmittable26. Furthermore, results of this study show
that CRF02-AG, subtypes A and G in that order still remains the predominant circulating
HIV-1 subtypes in Oyo state as well as among high risk groups in the state. These strains
have been shown to be circulating in the region since 199520,27. We also showed that HIV-1
Rapid antibody kit is not advisable for use as a diagnostic tool for early HIV-1 infection. A
previous study in Nigeria that characterized acute HIV-1 infection among high risk groups
had a lower prevalence (0.05%) compared to what was observed in this study28. This may be
due to the fact that HIV-1 Rapid Antibody was used to eliminate seroconversion in the study.
Results of HIV-1 prevalence in this study is very similar to what was obtained from our
previous study among persons referred for malaria antigen test15. Furthermore, our results on
the prevalence of HIV-1 infection among blood donors is not different from previous studies
on this group that used ELISA based tests for diagnosis9,19,29. Previous studies on HIV-1
prevalence among blood donors in Nigeria have reported varying proportions9,30–38. Aside the
fact that various regions in the country have varying HIV-1 prevalence24, the method used for
HIV-1 diagnosis played a significant role in the numbers of infected persons detected. In
2008, Odaibo39 et al., reported that 6(1.2%) out of 500 antibody-negative blood donor
samples had HIV-1 antigens and cDNA. This report is not different from what was observed
in this study in which 8(1.2%) samples positive on HIVAg/Ab ELISA were undetectable on
Antibody based testing kits (see Figure 1). The case is really worsened for HIV-1 Rapid POC
used in this study in which 16 (2.4%) samples positive on either HIV Ag/Ab ELISA and/or
HIV Ab ELISA were undetectable on the platform. The average score of HIV Rapid POC
sensitivity observed in this study is similar to what was observed by Mba et al., 201840. In the
study which was carried out among blood donors in Gabon, the authors argued that Rapid
antibody kits may not be very useful for pre-donation HIV diagnosis.
It is important that blood donation testing centers use HIV Antigen and Antibody based
ELISA tests for pre donation screening at the minimum. Other authors have showed the cost
benefits of using only HIV antigen and antibody based ELISA test kits for pre donation blood
screening rather than the two step algorithm involving the use of HIV Rapid antibody kits41.
Findings from this study suggest that missed opportunities for HIV-1 diagnosis still occur
even after the presence of detectable antibodies in blood samples. Reasons for this may be
that serological methods for detecting HIV-1 infection have different sensitivities across
various circulating subtypes. Although we could not associate specific sensitivity scores to
HIV-1 screening methods against the various subtypes identified in this study, we have
showed that HIV-1 Rapid antibody kits may not be very effective in detecting HIV-1
antibodies in areas where multiple HIV-1 subtypes circulate. This missed diagnosis leads to
further transmission of the virus to susceptible individuals. It is unadvisable to use HIV-1
Rapid antibody kits for pre-donation screening in regions with diverse circulating HIV-1
subtypes40.
We have previously reported the detection of CRF02_AG, subytpe K, recombinant strain GD
and an unassigned subtype among persons referred for malaria parasite testing (KY786266-
272)15. In this study, more CRF02_AG, subtypes A and G were identified among febrile
persons and blood donors. As earlier stated, CRF02_AG remains the predominant subtype
among high risk groups in Oyo State. The strain is the predominant circulating virus in West
Africa6,20,27,42,43. Although CRF02_AG was first described in Ibadan, Nigeria, the origin of
the virus is still not known especially now that the strain is prevalent in several regions of the
world. Subtypes A and G have also been previously reported as circulating in Oyo state as
well as in other parts of Nigeria. A recent study identified CRF02_AG, as well as subtypes G
and A as the predominant circulating HIV-1 strains in Ibadan, Nigeria6.
It is important that in depth analysis of HIV-1 viral diversities in geographical regions are
carried out. This is because subtypes differences have been associated with varying patterns
of replicative capacities, diagnosis, transmission and pathogenesis. In another study, we have
showed that HIV-1 strains circulating in Oyo State are associated with renal dysfunctions and
reduced proportions of T cells in infected individuals during early stages of HIV-1
infection44. Findings in this study observed more subtypes in Ibadan metropolis (urban
settlement) compared to Saki town (rural settlement). Recent studies using phylodynamic
tools have suggested that HIV-1 strains originate and expand in urban areas before migrating
to smaller rural centers6. There is the need to describe the phylodynamics of HIV-1 subtypes
in other states of the country as this will shed further light into the diversity of the virus.
In summary, we have showed that the genetic diversity of HIV-1 strains among infected
individuals in Oyo State, Nigeria is still relatively high. This diversity is likely impacting on
diagnosis. Our study also suggests that screening persons for early HIV-1 infection is best
done using Antigen/Antibody based ELISA techniques for elimination of seroconversion.
Early HIV-1 infected individuals are the major drivers of new infections. Hence, the need to
use highly sensitive diagnostic tools for HIV-1 identification among them. This is particularly
important for high risk groups such as voluntary blood donors. Studies examining the impact
of host immune pressures on the generation of HIV-1 immune escape mutants during the
early stages of infection are ongoing.
Acknowledgements
We thank all individuals who participated in this study. Special appreciation to Mrs. Fadimu
and Mrs. Adeyefa (both of Blood bank, University College Hospital, Ibadan, Nigeria) for
linking us up with volunteer blood donors. This study was supported by University of Ibadan
MEPI Junior Faculty Research Training Program (UI-MEPI-J) mentored research award
through National Institute of Health (NIH) USA grant funded by Fogarty International
Centre, the office of AIDS Research and National Human Genome Research Institute of NIH,
the Health Resources and Services Administration (HRSA) and the Office of the U.S. Global
AIDS Coordinator under award number D43TW010140 to BO. The funders had no role in
study design, data collection and analysis, decision to publish, or preparation of the
manuscript. The authors have no conflict of interest to declare.
Sequence Notes
All consensus nucleotide sequences obtained in this study were submitted to GenBank.
Database and assigned accession numbers KY786266-272 and MN943617-635.

References
1. UNAIDS. Global HIV & AIDS statistics — 2019 fact sheet | UNAIDS.
https://www.unaids.org/en/resources/fact-sheet. Published 2019. Accessed March 1,
2020.
2. Peeters M, Toure-kane C, Nkengasong JN. Genetic diversity of HIV in Africa:
impact on diagnosis , treatment , vaccine development and trials. AIDS.
2003;17(May):2547-2560.
3. UNAIDS. New Fast Track Strategy to end AIDS by 2030. 2020.
4. Peeters M. The genetic variability of HIV-1 and its implications. Transfus Clin Biol.
2001;8:222-225.
5. Peeters M, Jung M, Ayouba A. The origin and molecular epidemiology of HIV. Expert
Rev. 2013;11(9):885-896.
6. Nazziwa J, Faria NR, Chaplin B, et al. Characterisation of HIV-1 Molecular
Epidemiology in Nigeria: Origin, Diversity, Demography and Geographic Spread. Sci
Rep. 2020;10(1):3468. doi:10.1038/s41598-020-59944-x
7. Fayemiwo SA, Odaibo GN, Oni AA, Ajayi AA, Bakare RA, Olaleye DO. Genital
ulcer diseases among HIV-infected female commercial sex workers in Ibadan, Nigeria.
Afr J Med Med Sci. 2011;40(1):39-46.
http://www.ncbi.nlm.nih.gov/pubmed/21834260. Accessed March 1, 2020.
8. Oyefara JL. Food insecurity, HIV/AIDS pandemic and sexual behaviour of female
commercial sex workers in Lagos metropolis, Nigeria. Sahara J. 2007;4(2):626-635.
doi:10.1080/17290376.2007.9724884
9. Osaro E, Mohammed N, Zama I, et al. Prevalence of p24 antigen among a cohort of

HIV antibody negative blood donors in Sokoto, north western Nigeria - The question
of safety of blood transfusion in Nigeria. Pan Afr Med J. 2014;18:174.
doi:10.11604/pamj.2014.18.174.3449
10. Odaibo GN, Adewole IF, Olaleye DO. High Rate of Non-detectable HIV-1 RNA
among Antiretroviral Drug Naive HIV Positive Individuals in Nigeria. Virol Res Treat.
2013;4:VRT.S12677. doi:10.4137/VRT.S12677
11. Atilola GO, Akpa OM, Komolafe IOO. HIV/AIDS and the long-distance truck drivers
in south-west Nigeria: A cross-sectional survey on the knowledge, attitude, risk
behaviour and beliefs of truckers. J Infect Public Health. 2010;3(4):166-178.
doi:10.1016/j.jiph.2010.08.002
12. Azuonwu O, Erhabor O, Frank-Peterside N. HIV infection in long-distance truck
drivers in a low income setting in the Niger Delta of Nigeria. J Community Health.
2011;36(4):583-587. doi:10.1007/s10900-010-9344-4
13. Ijeoma A, Ejikeme A, Theodora O, Chika O. Knowledge, attitude, willingness of HIV
counseling and testing and factors associated with it, among long distant drivers in
Enugu, Nigeria: an opportunity in reduction of HIV prevalence. Afr Health Sci.
2018;18(4):1088-1097. doi:10.4314/ahs.v18i4.30
14. Njoku OS, Manak MM, O’Connell RJ, et al. An evaluation of selected populations for
HIV-1 vaccine cohort development in Nigeria. PLoS One. 2016;11(12):1-14.
doi:10.1371/journal.pone.0166711
15. Olusola BA, Olaleye DO, Odaibo GN. Early HIV infection among persons referred for
malaria parasite testing in Nigeria. Arch Virol. 2017;163(2):439-445.
doi:10.1007/s00705-017-3599-3
16. Sanders EJ, Mugo P, Prins HAB, et al. Acute HIV-1 infection is as common as malaria
in young febrile adults seeking care in coastal Kenya. 2014.
doi:10.1097/QAD.0000000000000245
17. Sanders EJ, Wahome E, Powers KA, et al. Targeted screening of at-risk adults for
acute HIV-1 infection in sub-Saharan Africa. AIDS J. 2016;29(0 3):1-24.
doi:10.1097/QAD.0000000000000924.Targeted
18. Olowe OA, Mabayoje VO, Akanbi O, et al. HIV P24 antigen among HIV antibody
seronegative blood donors in Osogbo Osun State, South Western Nigeria. Pathog Glob
Health. 2016;110(4-5):205-208. doi:10.1080/20477724.2016.1205311
19. Japhet M, Adewumi O, Adesina O, Donbraye E. High prevalence of HIV p24 antigen
among HIV antibody negative prospective blood donors in Ile-Ife, Nigeria. J
Immunoass Immunochem. 2016;1819(April). doi:10.1080/15321819.2016.1174133
20. Sankalé J, Langevin S, Odaibo G, et al. The Complexity of Circulating HIV Type 1
Strains in Oyo State, Nigeria. 2007;23(8):1020-1025. doi:10.1089/aid.2006.0304
21. Gall A, Ferns B, Morris C, et al. Universal Amplification, Next-Generation
Sequencing, and Assembly of HIV-1 Genomes. 2012. doi:10.1128/JCM.01516-12
22. Vidal N, Peeters M, Mulanga-Kabeya C, et al. Unprecedented Degree of Human
Immunodeficiency Virus Type 1 (HIV-1) Group M Genetic Diversity in the
Democratic Republic of Congo Suggests that the HIV-1 Pandemic Originated in
Central Africa. J Virol. 2000;74(22):10498-10507. doi:10.1128/jvi.74.22.10498-
10507.2000
23. Gourraud P, Karaouni A, Woo J, et al. APOBEC3H haplotypes and HIV-1 Pro-Viral
vif DNA Sequence Diversity in Early Untreated HIV-1 Infection. Hum Immunol.
2011;72(3):207-212. doi:10.1038/jid.2014.371
24. UNAIDS. Nigeria | UNAIDS. 2018.
https://www.unaids.org/en/regionscountries/countries/nigeria. Accessed March 1,
2020.
25. Kiwanuka N, Ssetaala A, Mpendo J, et al. High HIV-1 prevalence, risk behaviours,
and willingness to participate in HIV vaccine trials in fishing communities on Lake
Victoria, Uganda. J Int AIDS Soc. 2013;16:1-8. doi:10.7448/IAS.16.1.18621
26. Eisinger R, Dieffenbach C, Fauci A. HIV Viral Load and Transmissibility of HIV
Infection Undetectable Equals Untransmittable. JAMA. 2019;321(5).
doi:10.1001/jama.2018.21167
27. Olaleye D. Isolation and characterization of a new subtype A variant of human
immunodeficiency virus type I from Nigeria. 1996;1996(I):97-106.
28. Charurat M, Nasidi A, Delaney K, et al. Characterization of Acute HIV-1 Infection in
High-Risk Nigerian Populations. J Infect Dis. 2012;205:1239-1247.
doi:10.1093/infdis/jis103
29. Okoroiwu HU, Okafor IM, Asemota EA, Okpokam DC. Seroprevalence of
transfusion-transmissible infections (HBV, HCV, syphilis and HIV) among
prospective blood donors in a tertiary health care facility in Calabar, Nigeria; An
eleven years evaluation. BMC Public Health. 2018;18(1):1-8. doi:10.1186/s12889-
018-5555-x
30. Buseri FI, Muhibi MA, Jeremiah ZA. Sero-epidemiology of transfusion-transmissible
infectious diseases among blood donors in Osogbo, south-west Nigeria. Blood
Transfus. 2009;7(4):293-299. doi:10.2450/2009.0071-08

31. Umolu PI, Okoror LE, Orhue P. Human immunodeficiency virus (HIV) seropositivity
and hepatitis B surface antigenemia (HBSAG) among blood donors in Benin city, Edo
state, Nigeria. Afr Health Sci. 2005;5(1):55-58.
http://www.ncbi.nlm.nih.gov/pubmed/15843132. Accessed February 29, 2020.
32. Iyalla C, Ejele AO, Okoh DA, Igbigbi E. Seroprevalence study of HTLV-1 and 2 in
prospective blood donors and pregnant women in Port Harcourt, Nigeria. African J
Infect Dis. 2015;9(2):57-60. doi:10.4314/ajid.v9i2.8
33. Dirisu J, Alli T, Adegoke A, Osazuwa F. A Survey of prevalence of serum antibodies
to human immunodeficiency deficiency virus (HIV), hepatitis B virus (HBV) and
hepatitis C virus (HCV) among blood donors. N Am J Med Sci. 2011;3(1):35.
doi:10.4297/najms.2011.335
34. Hassan A, Muktar HM, Mamman AI, Ahmed AJ, Isa AH, Babadoko AA. The
incidence of HIV among blood donors in Kaduna, Nigeria. Afr Health Sci.
2007;7(4):253. http://www.ncbi.nlm.nih.gov/pubmed/21499493. Accessed February
29, 2020.
35. Olajubu FA, Osinupebi OA, Deji-Agboola M, Jagun EO. Seroprevalence of HIV
among blood donors, antenatal women and other patients in a tertiary hospital in
Nigeria. Braz J Infect Dis. 2009;13(4):280-283. doi:10.1590/s1413-
86702009000400008
36. Motayo BO, Faneye AO, Udo UA, Olusola BA, Ezeani I, Ogiogwa JI. Seroprevalence
of transfusion transmissible infections (TTI), in first time blood donors in Abeokuta,
Nigeria. Afr Health Sci. 2015;15(1). doi:10.4314/ahs.v15i1.3
37. Egah DZ, Banwat EB, Audu ES, et al. Hepatitis B surface antigen, hepatitis C and HIV
antibodies in a low-risk blood donor group, Nigeria. East Mediterr Heal J.

2007;13(4):961-966.
38. Chikwem JO, Mohammed I, Okara GC, Ukwandu NCD, Ola TO. Prevalence of
transmissible blood infections among blood donors at the University of Maiducuri
Teaching Hospital, Maiduguri, Nigeria. East Afr Med J. 1997;74(4):213-216.
39. Odaibo GN, Taiwo A, Aken’Ova YA, Olaleye DO. Detection of HIV antigen and
cDNA among antibody-negative blood samples in Nigeria. Trans R Soc Trop Med
Hyg. 2008;102(3):284-287. doi:10.1016/j.trstmh.2007.12.001
40. Eko Mba JM, Bisseye C, Mombo LE, et al. Assessment of rapid diagnostic tests and
fourth-generation Enzyme-Linked Immunosorbent Assays in the screening of Human
Immunodeficiency and Hepatitis B virus infections among first-time blood donors in
Libreville (Gabon). J Clin Lab Anal. 2019;33(3). doi:10.1002/jcla.22824
41. Shittu AO, Olawumi HO, Adewuyi JO. Pre-donation screening of blood for
transfusion transmissible infections: the gains and the pains - experience at a resource
limited blood bank. Ghana Med J. 2014;48(3):158-162. doi:10.4314/gmj.v48i3.7
42. Mboudjeka I, Zekeng L, Takehisa J, et al. HIV type 1 genetic variability in the
northern part of Cameroon. AIDS Res Hum Retroviruses. 1999;15(11):951-956.
doi:10.1089/088922299310458
43. Ragupathy V, Zhao J, Wood O, et al. Identification of new, emerging HIV-1 unique
recombinant forms and drug resistant viruses circulating in Cameroon. Virol J.
2011;8:185. doi:10.1186/1743-422X-8-185
44. Olusola BA, Kabelitz D, Olaleye DO, Odaibo GN. Early HIV infection is associated
with reduced proportions of gamma delta T subsets as well as high creatinine and urea
levels. Scand J Immunol. 2020;(June 2019):1-13. doi:10.1111/sji.12868

Reprints requests
Reprints requested should be directed to Prof Gerogina N. Odaibo, Department of Virology,
College of Medicine, University College Hospital, Ibadan, Nigeria.
foreodabo@hotmail,com
Table 1: Prevalence of early and chronic HIV-1 infection among Persons referred from malaria parasite testing and Voluntary Blood
Donors
Voluntary Blood
Persons referred for malaria parasite testing
Donors
Location Ibadan Saki Ibadan Total P-Value/Test
Number of Participants 450 440 138 1028 P<0.00001/Z
Number (%) HIV+ 29(6.44) 17(3.86) 9(6.52) 55(5.35) P>0.05/χ2

Number (%) Chronic HIV + 19(4.22) 11(2.5) 2(1.44) 32(3.11) P>0.05/ χ2

Number (%) Early HIV+ 10(2.22) 6(1.36) 7(5.07) 23(2.23) P<0.03674/ χ2
Male/Female 168/282 130/310 136/2 434/594 P<0.0001/Z
Number (%) HIV+ 29(6.44) 17(3.86) 9(6.52) 55(5.35)
Male (%) HIV+ 14(48.27) 5(29.4) 9(100) 28(50.90) P>0.05/ χ2

Female (%) HIV+ 15(51.72) 12(70.5) 0(0) 27(49.09) P>0.05/ χ2
Number (%) Chronic HIV + 19(4.22) 11(2.5) 2(1.44) 32(3.11)
Male (%) HIV+ 10(52.63) 4(36.3) 2(100) 16(50.00)

P>0.05/ χ2
Female (%) HIV+ 9(47.37) 7(63.6) 0(0) 16(50.00)
Number (%) Early HIV+ 10(2.22) 6(1.4) 7(5.07) 23(2.23)
Male (%) HIV+ 4(40.00) 1(16.6) 7(100) 12(52.17)

P>0.05/ χ2
Female (%) HIV+ 6(60.00) 5(83.3) 0(0) 11(47.82)
Legend
Values shown are in number and percentages. Statistical tests used: Z and chi-square (χ2) tests. Significant differences are in bold fonts while
differences that are not significant are written as P>0.05.

Table 2: Proportions of HIV reactive samples based on Enzyme Immunoassay
HIV Rapid Ab POC HIV Ab ELISA HIV Ag/Ab ELISA

Location Number Tested
Reactive (%) False Negative (%) Reactive (%) False Negative (%) Reactive (%)
Ibadan 231 8(3.46)* 6(1.95) 11(4.76) 3(1.29) 14(6.06)*
# #
Saki 440 8(1.81) 9(2.95) 11(2.50) 6(1.36) 17(3.86)
a
Total 671 16(2.38) 15(2.45) 22(3.27) 9(1.34) 31(4.61)

*P<0.0001
#
P<0.0001
a
P<0.001
HIV Rapid Antibody

Sensitivity (95% CI) 52.38% (29.78-74.29) a/a+b
Specificity (95%CI) 99.50%(98.20-99.94) d/c+d
PPV (95%CI) 84.62%(54.55-98.08) a/a+c
NPV (95%CI) 97.54%(95.53-98.82) d/b+d
a= True Positive; b= False Negative; c= False Positive; d=True Negative. *Difference in numbers of reactive HIV samples between HIV Rapid
Ab POC and HIV Ag/Ab ELISA for samples collected in Ibadan was significant (P<0.0001). # Difference in numbers of reactive HIV samples
between HIV Rapid Ab POC and HIV Ag/Ab ELISA for samples collected in Saki was significant (P<0.0001). aDifference in numbers of
reactive samples (using HIV Ag/Ab ELISA) between Ibadan and Saki was significant (P<0.001). χ2 was used to test for significance.
Legend
Values shown are in number and percentages. *Difference in numbers of reactive HIV samples between Alere™ Determine™ HIV-1/2 Rapid
Antibody Test kit (HIV Rapid Ab POC) and 4th generation ELISA kit (HIV Ag/Ab ELISA) for samples collected in Ibadan was significant
(P<0.0001). #Difference in numbers of reactive HIV samples between HIV Rapid Ab POC and HIV Ag/Ab ELISA for samples collected in Saki
was significant (P<0.0001). aDifference in numbers of reactive samples (using HIV Ag/Ab ELISA) between Ibadan and Saki was significant
(P<0.001). χ2 was used to test for significance. a= True Positive; b= False Negative; c= False Positive; d=True Negative.
Table 3: Subtype classification of HIV-1 GAG gene isolated from individuals at the early stage of infection
Sequence Assigned
Location ID Sub-typing tool Accession number subtype
REGA COMET
Saki EHIV001 Recombinant CPZ KY786266 Unassigned
Recombinant of
Ibadan EHIV002
FK CPZ KY786267 K
Saki EHIV003 CRF02-AG CRF02-AG KY786268 CRF 02-AG

A1/Check for 02-
Saki EHIV004
CRF02-AG AG KY786269 CRF 02-AG
Saki EHIV005 CRF02-AG CRF02-AG KY786270 CRF 02-AG
Recombinant of Recombinant
Saki EHIV006
GD CPZ KY786271 GD
Ibadan EHIV007 CRF02-AG CRF02-AG KY786272 CRF 02-AG
Saki EHIV008 Not Sequenced
Ibadan EHIV009 Not Sequenced
Ibadan EHIV010 A1 A1 MN943617 A
Ibadan EHIV012 G G MN943624 G
Ibadan EHIV014 CRF02-AG CRF02-AG MN943628 CRF 02-AG
Ibadan EHIV016 G G MN943627 G
Ibadan EHIV017 CRF02-AG CRF02-AG MN943629 CRF 02-AG
Ibadan EHIV018 CRF02-AGvif CRF02-AGvif MN943633a CRF 02-AG
Ibadan EHIV019 Not Sequenced
Letter a in superscript corresponds to samples that the GAG gene were not sequenced, rather VIF gene was sequenced and used for subtyping.
G
A
MN943625
MN943619
Gag gene was not sequenced for these samples
A1
G
A1
G
EHIV022
EHIV023
a
Legend
Ibadan
Ibadan
Figure 1: Diagram showing number of HIV positive samples on serological assays
Legend
Values are shown in numbers only. Total number of samples positive for an assay type
corresponds to the addition of all numbers in the circle representing the assay. Samples
positive on Alere™ Determine™ HIV-1/2 Rapid Antibody (HIV Rapid Kit), 3rd generation
ELISA kit (HIV Ab ELISA) and 4th generation ELISA kit (HIV Ag/Ab) are represented in
red, green and yellow colours respectively. Those positive on two assays are in grey while
samples positive on the three assays are in light grey. No sample was reactive on 3rd
generation HIV ELISA (HIV Ab ELISA) alone. Also no sample was reactive on both
Alere™ Determine™ HIV-1/2 Rapid Antibody (HIV Rapid Kit) and HIV Ab ELISA.
Figure 2C: Summary of subtypes isolated from individuals at the early stages of HIV-1 infection
C. Pie chart showing the distribution of subtypes isolated from Voluntary blood donors in Ibadan, Nigeria. Total number of individuals in this
group is 7. One sample was not sequenced. Two samples each were subtyped as A, G and CRF02-AG.
Legend
Figure Legend
Table 1: Prevalence of early and chronic HIV-1 infection among Persons referred from malaria
parasite testing and Voluntary Blood Donors
Values shown are in number and percentages. Statistical tests used: Z and chi-square (χ2) tests. Significant
differences are in bold fonts while differences that are not significant are written as P>0.05.
Table 2: Proportions of HIV reactive samples based on Enzyme Immunoassay
Values shown are in number and percentages. *Difference in numbers of reactive HIV samples between
Alere™ Determine™ HIV-1/2 Rapid Antibody Test kit (HIV Rapid Ab POC) and 4th generation ELISA kit
(HIV Ag/Ab ELISA) for samples collected in Ibadan was significant (P<0.0001). #Difference in numbers of
reactive HIV samples between HIV Rapid Ab POC and HIV Ag/Ab ELISA for samples collected in Saki
was significant (P<0.0001). aDifference in numbers of reactive samples (using HIV Ag/Ab ELISA) between
Ibadan and Saki was significant (P<0.001). χ2 was used to test for significance. a= True Positive; b= False
Negative; c= False Positive; d=True Negative.
Table 3: Subtype classification of HIV-1 GAG gene isolated from individuals at the early stage of
infection
Letter a in superscript corresponds to samples that the GAG gene were not sequenced, rather VIF gene was
sequenced and used for subtyping.
Figure 1: Diagram showing number of HIV positive samples on serological assays
Values are shown in numbers only. Total number of samples positive for an assay type corresponds to the
addition of all numbers in the circle representing the assay. Samples positive on Alere™ Determine™ HIV-
1/2 Rapid Antibody (HIV Rapid Kit), 3rd generation ELISA kit (HIV Ab ELISA) and 4th generation ELISA
kit (HIV Ag/Ab) are represented in red, green and yellow colours respectively. Those positive on two assays
are in grey while samples positive on the three assays are in light grey. No sample was reactive on 3rd
generation HIV ELISA (HIV Ab ELISA) alone. Also no sample was reactive on both Alere™ Determine™
HIV-1/2 Rapid Antibody (HIV Rapid Kit) and HIV Ab ELISA.

Figure 2: Summary of subtypes isolated from individuals at the early stages of infection
Values are shown in percentages only. A. Pie chart showing the distribution of subtypes isolated from
persons referred for malaria parasite antigen testing in Saki, Nigeria. Total number of individuals at this
location is 6. One sample was not sequenced. Three, 1 and 1 samples were subtyped as CRF-02AG,
Recombinant GD and Unassigned respectively. B. Pie chart showing the distribution of subtypes isolated
from persons referred for malaria parasite antigen testing in Ibadan, Nigeria. Total number of individuals at
this location is 10. One sample was not sequenced. Four and 3 samples were subtyped as CRF-02AG and A
respectively while one sample were subtyped as G and K each. C. Pie chart showing the distribution of
subtypes isolated from Voluntary blood donors in Ibadan, Nigeria. Total number of individuals in this group
is 7. One sample was not sequenced. Two samples each were subtyped as A, G and CRF02-AG.
Ibadan
G
11%
CRF02-AG
45%
A
33%
K
11%
A B CRF02-AG K A G
Figure 2: Summary of subtypes isolated from individuals at the early stages of HIV-1 infection
Legend
Values are shown in percentages only. A. Pie chart showing the distribution of subtypes isolated from persons referred for malaria parasite antigen
testing in Saki, Nigeria. Total number of individuals at this location is 6. One sample was not sequenced. Three, 1 and 1 samples were subtyped
as CRF-02AG, Recombinant GD and Unassigned respectively. B. Pie chart showing the distribution of subtypes isolated from persons referred
for malaria parasite antigen testing in Ibadan, Nigeria. Total number of individuals at this location is 10. One sample was not sequenced. Four and
3 samples were subtyped as CRF-02AG and A respectively while one sample were subtyped as G and K each.

2020 04 09 20058966 Full

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

2020 04 09 20058966 Full

Uploaded by

Copyright:

Available Formats

medRxiv preprint doi: https://doi.org/10.1101/2020.04.09.20058966; this version posted April 14, 2020.

The copyright holder for this preprint

DETECTION OF EARLY HIV-1 INFECTION AMONG

FEBRILE PERSONS AND BLOOD DONORS IN OYO STATE,

Babatunde A. Olusola1, David O. Olaleye1, Georgina N. Odaibo1*

Prof Georgina N. Odaibo

diversity is likely impacting on diagnosis.

diagnosis, transmission, pathogenesis and vaccine designs2,4,5.

(CRF02_AG, G, A, B, C, D, CRF06_cpx, URFs etc.) have been characterized in the country

HIV infected blood in Nigeria and other developing countries18,19.

detection was also determined.

Materials and Methods

Study sites and patient population

Recruitment of participants, sample collection and processing

antigen/antibody and HIV-1 Gag DNA.

Identification of early and chronic HIV-1 infections

conditions and according to the manufacturer’s recommendation. Furthermore, HIV-1

approved for routine HIV diagnosis in the country.

PCR amplification and sequencing

sequenced. As described previously23, Vif-1 (ATTCAAAATTTTCGGGTTTATTACAG)

and TATED3-1 (AATTCTGCAACAACTGCTGTTTAT) primers were used for first round

while Vif-2 (AGGTGAAGGGGCAGTAGTAATACA) and TATED-

1(GCAGGAGTGGAAGCCATAATAAG) primers used for second round. The PCR

TATED-1 for VIF).

Detection of HIV-1 subtypes and recombination

version 3.0 (http://dbpartners.stanford.edu/RegaSubtyping/), Comet, version 2.2

(http://comet.retrovirology.lu), National Center for Biotechnology Information, Bethesda,

MD (http://www.ncbi.nlm.nih.gov /Blast.cgi) and jpHMMM: Improving the reliability of

recombination prediction in HIV-1 (http: //jphmm.gobics.de/submission_hiv). The first three

assigned accession numbers KY786266-272 and MN943617-635.

delinked from patient identifiers and anonymized.

Eligibility/ Exclusion criteria

Data management and statistical analysis

compared using ANOVA. Test of significance was set at P<0.05.

Prevalence of early and chronic HIV infection

chronic HIV infection (Table 1).

Proportions of HIV reactive samples based on serological assays

A, G as well as CRF02-AG. Subtype K, recombinants and unassigned subtypes were found

among persons referred for malaria antigen test.

previously hypothesized25. To effectively control the prevalence and incidence of HIV-1

further transmission of the virus to susceptible individuals. It is unadvisable to use HIV-1

We have previously reported the detection of CRF02_AG, subytpe K, recombinant strain GD

and A as the predominant circulating HIV-1 strains in Ibadan, Nigeria6.

of replicative capacities, diagnosis, transmission and pathogenesis. In another study, we have

reduced proportions of T cells in infected individuals during early stages of HIV-1

done using Antigen/Antibody based ELISA techniques for elimination of seroconversion.

early stages of infection are ongoing.

manuscript. The authors have no conflict of interest to declare.

Database and assigned accession numbers KY786266-272 and MN943617-635.

https://www.unaids.org/en/resources/fact-sheet. Published 2019. Accessed March 1,

2. Peeters M, Toure-kane C, Nkengasong JN. Genetic diversity of HIV in Africa:

impact on diagnosis , treatment , vaccine development and trials. AIDS.

3. UNAIDS. New Fast Track Strategy to end AIDS by 2030. 2020.

6. Nazziwa J, Faria NR, Chaplin B, et al. Characterisation of HIV-1 Molecular

Epidemiology in Nigeria: Origin, Diversity, Demography and Geographic Spread. Sci

Rep. 2020;10(1):3468. doi:10.1038/s41598-020-59944-x

Afr J Med Med Sci. 2011;40(1):39-46.

http://www.ncbi.nlm.nih.gov/pubmed/21834260. Accessed March 1, 2020.

commercial sex workers in Lagos metropolis, Nigeria. Sahara J. 2007;4(2):626-635.

9. Osaro E, Mohammed N, Zama I, et al. Prevalence of p24 antigen among a cohort of

of safety of blood transfusion in Nigeria. Pan Afr Med J. 2014;18:174.

in south-west Nigeria: A cross-sectional survey on the knowledge, attitude, risk

behaviour and beliefs of truckers. J Infect Public Health. 2010;3(4):166-178.