The use of antibodies and

immunofluorescence analysis to
determine whether dl1015 polyomavirus
MT forms nanoclusters

Student name: Sabina Ioana Manolache

Date of submission: 20th April 2020

A report submitted in partial fulfilment of the requirements for the award of

B.Sc. Biomedical Sciences

1
Index
Page
Abstract
1.Introduction ………………………………………………………………………………………..5
1.1 T Antigens……………………………………………………………………………………..6
1.1.1 Large T antigen…………………………………………………………………………...6
1.1.2 Small T antigen………………………………………………………………..…...……..6
1.1.3 Middle T antigen…………………………………………………………………………..6
1.1 Binding proteins……………………………………………………………………………..7
1.2.1 PP2A………………………………………………………………………………………..7
1.2.2 Src Family………………………………………………………………………………….7
1.2.3 Shc............................................................................................................................8
1.2.4 PI3K………………………………………………………………………………………...8
1.2.5 PLC-γ1......................................................................................................................8
1.3 dl1015.............................................................................................................................8
1.4 Aim..................................................................................................................................9
2.Methods......………………………………………………………………...……………..………10
2.1 Cells and plasmids.........................................................................................................10
2.2 Mutation generation.......................................................................................................10
2.3 Immunofluorescence assays.........................................................................................10
3.Results.......………………………………………………………………..………..…………… 11
4.Discussion..……………………………………………………………………………………… 14
4.1 Future Proposals……………………………………………………………………………...15
5.Conclusion.………………………………………………………………………………………. 16
6.References..……………………………………………………………………………………….17
7.Appendices..………………………………………………………………………………………12
7.1 Learning Log..................................................................................................................22
7.2 NSREC Approval Letter……………………………………………………………………...26
7.3 LabRAT Risk Assessment……………………………………………………………………27

2
Abstract
Polyomaviruses have been priceless models in our efforts to understand eukaryotic
transcription and replication mechanisms. The transformation and tumorigenesis studies
performed on these viruses have produced important information regarding the mechanisms
regulating cell growth and the impact of their deregulation. Middle T-antigen, the major
transforming oncogene encoded in the genome of murine polyomaviruses, is essential for
viral proliferation and persistence. MT has the ability to induce neoplastic transformation in
cells. Mutant dl1015 of MT has been found to be defective in transformation with no
understandable cause.
The aim of this research was to determine whether the ability to form nanoclusters, as well
as the aspect and size of those nanoclusters, could be the cause of the dl1015 MT’s inability
to transform cells in culture. A comparison between the nanoclusters produced by dl1015
and wt MT was made.
Rat2 fibroblast cells were used in this study. They were transfected with a plasmid encoding
the wt MT or mutant dl1015, with an extended HA tag on the C-terminal end. The antibody
12CA5 was added while the cells were live in order to bind to the HA tag . After washing and
fixating with formaldehyde, a polyclonal antibody anti-mouse IgG labelled with AF488 was
added in order to visualise antibody binding using an epifluorescent microscope.
Dl1015 demonstrated an ability to form nanoclusters on the cell surface, which was
indistinguishable from wt. No difference in size or number was observed. Therefore, the
defect accounting for the inability of transformation in mutant dl1015 is not cluster formation.
Further research is needed.

3
1.Introduction
Polyomaviruses belong to the family Polyomaviridae and they consist of DNA tumour viruses
(De Gascun and Carr, 2013) that are able to transform mammals’ cells in vitro. (Baez et al.,
2017) Polyomaviruses are non-enveloped, circular and have a dsDNA genome of 5.100bp
approximately that constitutes 12% of the virion mass (Gjoerup and Chang, 2010). Murine
polyomavirus (MPyV) was discovered by Ludvik Gross in 1953, while working on the cell
free transmission of leukaemia in mice (Gross, 1953).

Originally, polyomaviruses and papillomaviruses were part of the same family,

Papovaviridae (Ahsan and Shah, 2002), but in the year 2000, they were separated and
every subfamily has moved up to be a family, instead (Desselberger, 2002). This indicates
that viruses from different families are separate, both genetically and immunologically, with
distinct biological properties (Gelderblom, 2014).

Since 2008, eight HPyVs have been found. To this

date, 32 species of polyomaviruses (PyV) have
been discovered, as shown in figure 1. Out of all of
these, ten are known to infect humans (HPyVs)
(De Gascun and Carr, 2013). The infection is
usually benign; however, HPyVs only cause
persistent infections in individuals that are healthy,
without any evidence of disease (Payne, 2017).

Polyomaviruses have a virion of 40-50 nm in

diameter with an icosahedral capsid (Ahsan and
Shah, 2002) . The latter is made of three virus-
encoded structural proteins : VP1, VP2 and VP3
(Delbue, Comar and Ferrante, 2017). The virion
consists of 72 pentameric capsomers of VP1 with a
single copy of VP2 and VP3 linked to each
pentamer (Lagatie, Tritsmans and Stuyver, 2013).

The viral genome is divided into three parts: an early region of about 2.4 kb, which codes for
large, middle and small tumour proteins created by alternative splicing patterns (reviewed in
Fluck and Schaffhausen, 2009), a late region (2.3 kb), which codes for the viruses-encoded
structural proteins and agnoprotein, and a noncoding regulatory region of 0.4 kb. (Ahsan and
Shah, 2002). The early transcription region encodes the T antigens which maintain and
promote the replication of the viral genome (Dilworth, 1995). Large, middle and small T are
named tumour antigens because they were discovered using antibodies from tumour-
bearing animals. (reviewed in Fluck and Schaffhausen, 2009)

All polyomaviruses encode a small (ST) and large T antigen (LT) (Pipas, 1992). Murine and
hamster PyV are the only two virus types that also make a middle T antigen (MT). Other
polyomaviruses, such as SV40 and the human viruses BK and JC, do not encode a third T-
antigen. However, all T antigens (small, middle and large) are involved in both virus
replication and cell transformation (reviewed in Fluck and Schaffhausen, 2009).

4
1.1 T antigens

All three T antigens have very different roles. LT is able to immortalise primary cells, but it
can’t transform. As a result, it is not needed for tumorigenesis (Moore et al., 1980 ;
Rassoulzadegan, Binetruy and Cuzin, 1982). The ST plays an important role in cell cycle
progression, but it doesn’t contribute to the transformation process (Mullane et al., 1998). MT
is the only one that has the ability to transform established cell lines into to a tumorigenic
phenotype (Hassell et al., 1980; Novak, Dilworth and Griffin, 1980)

Their expression can lead to radical changes in cell morphology, such as decreased cell-
substratum adhesion, stress fibre remodelling with increased cell motility, lack of contact
inhibition and anchorage independent growth (Treisman et al., 1981).T antigens are thought
of being responsible for the induction of the S phase in infected cells, but the process that
causes cells to begin DNA synthesis is not fully understood (Ogris, Mudrak and
Wintersberger, 1992 ).

1.1.1 Large T antigen

Large T antigen (LT) is a multi-functional nuclear protein needed for viral DNA replication. It
also participates in controlling viral gene expression. It can immortalize some specific cell
types and it has been reported to reduce the serum requirement of immortalized cells,
suggesting an important role in growth induction (Ogris, Mudrak and Wintersberger, 1992).

LT has different influences over cellular gene expression. It can alter the messenger RNA
(mRNA) levels of cellular transcription factors. It interacts with and regulates the DNA-
binding and transcriptional activity of specific transcription factors, as well as directly binding
to DNA. Large T antigen plays a role in the substitution of eukaryotic transcription factors.
Additionally, it regulates all components of signalling transduction pathways (Moens et al.,
1997).

1.1.2 Small T antigen

ST seems to intensify the infectivity of the virus, by permitting more-extensive replication of

viral DNA (Ogris, Mudrak and Wintersberger, 1992). ST has shown to be able to inhibit
protein phosphatase 2A (PP2A), a cellular protein, and as a result, it could modulate the
components of the signalling transduction pathways and prevent the dephosphorylation of
many transcription factors. Additionally, ST controls cellular gene expression. It does this by
regulating the mRNA levels of transcription factors or by interacting with other transcription
factors (Moens et al., 1997).

1.1.3 Middle T antigen

The major transforming protein of polyoma virus is MT, a 55 kDa polypeptide comprised of
421amino acids that can cause multiple tumours in mice, even in the absence of large T or
small T (Ichaso and Dilworth, 2001). This oncoprotein is found in cell membranes, whereas
ST and LT are found in the cytoplasm (Ito, Brocklehurst and Dulbecco, 1977; Zhou et al.,
2011).However, the majority of MT is located in perinuclear compartments that don’t
colocalize with marker proteins for neither the E.R. nor other subcellular partitions of the
secretory pathway (Gottlieb and Villarreal, 2001).

5
MT is synthesized early in the viral lytic cycle and it is produced by alternative splicing from
synthesized RNA. The N-terminal amino acid sequence present in MT is the same as the LT
and ST. Middle T has a common region with ST, but a unique C terminus. The latter has
phosphorylation sites and a membrane anchor sequence that is thought to form
a transmembrane region (Zhou et al., 2011; Cheng et al., 2009). The membrane anchor
accounts for the transformation ability of MT, as mutations that cause its elimination disrupt
this function completely(Cheng et al., 2009). Mutations in the phosphorylated tyrosines and
proline-rich sequence region of MT are also known to reduce its transformation ability, even
though these exact mechanisms are still unknown (Cheng et al., 2009).

Therefore, MT plays a pivotal role in cell transformation: it binds and activates cytoplasmic
proteins that take part in growth factor-induced mitogenic signal transduction to the nucleus
(Oliveira et al., 1998). MT shows its effect on cells by changing cellular proteins’ regulation; it
acts similarly to an activated Growth Factor Receptor (GFR) (Dilworth, 1995 ; Dilworth,
2002). Even though it doesn’t have any intrinsic enzymatic activity, the interactions
mediated by MT form an MT cellular protein complex (Schaffhausen and Roberts, 2009). By
itself, the complex, is not sufficient to cause transformation (Ling et al., 1992). Mutant dl1015
MT, which is also known to associate with all wt MT-binding proteins, does not transform
(Ling et al., 1992).

MT is unable to overcome the senescent characteristics of primary cells (Fluck and

Schaffhausen, 2009). The inability of MT to immortalise primary cells could be because of
p53, a tumour suppressor (Lomax and Fried, 2001; Moule et al., 2004). It has been
demonstrated that when MT activates ARF, itself an activator of p53, it also induces p53-
mediated blockage to cell division (Lomax and Fried, 2001). This inability of MT to transform
primary cells could be surmounted by the co-expression of mutant p53 and ST and LT
antigens (Rassoulzadegan et al., 1982 ; Reihsaus et al., 1992; Lomax and Fried, 2001).

1.2 Binding proteins

1.2.1 PP2A
PP2A , , is made of a subunit A and a catalytic subunit C. Its binding site is found in the N-
terminus of MT (Pallas et al., 1990). PP2A is involved in the regulation of many cellular
functions, such as transcription and transcription. Additionally, it is also known to act as a
tumour suppressor (JANSSENS and GORIS, 2001; Cheng et al., 2009). The N-terminal
portion needed for PP2A to bind is also associated with transformation and with the tyrosine
kinase Src family (Friedmann, Doolittle and Walter, 1978; Markland et al., 1986).
1.2.2 Src family
The tyrosine Kinase Src family is associated to the transforming property of MT. The binding
region for Src overlaps largely with PP2A. For Src binding, residues 185 to 210 are also
required. However, the mechanism behind this is still not fully understood (Brewster, Glover
and Dilworth, 1997; Glover, Brewster and Dilworth, 1999).

When MT first binds to the PP2A core dimer, it forms a binding site for the Src tyrosine
kinase family (Glenn and Eckhart, 1993; Van Kanegan and Strack, 2009). It then binds and
activates pp60c-src, pp62c-yes and pp59c-fyn, which are necessary in order to transform
established cells to both a tumorigenic phenotype (Ichaso and Dilworth, 2001) and in tissue

6
culture (Wallace and Galloway, 2016). Upon binding and activation of the Src family tyrosine
kinase, MT itself is phosphorylated at three major tyrosine residues: Y250, Y315 and Y322,
which act as binding sites for the SH2 or PTB domains of PI3K, ShcA and phospholipase
C-γ1(Dilworth, 2002). This interaction activates PI3K- and PLC-γ1-dependent signalling
pathways (Dilworth, et al, 1994).

1.2.3 Shc

The Shc family is very important for MT transformation. There are four Shc genes: ShcA,
ShcB, ShcC andShcD. They all contain a PTB domain, an SH2 domain and a CH1 domain.
(Ahmed and Prigent, 2017). ShcA is recruited to the PP2A/Src/MT complex; it gets
phosphorylated on three tyrosine residues and it forms binding sites for Grb2, an adaptor
protein (reviewed in Schaffhausen and Roberts, 2009). The latter is then phosphorylated and
it associates with Sos1 as well as Gab1 and 2. Gab1 provides binding sites for PI3K and
SHP2 (Nicholson, 2001). Sos1 activates the Raf-MEK-ERK MAPK signalling cascade and in
turn, it activates various transcription factors (reviewed in Schaffhausen and Roberts, 2009).

1.2.4 PI3K
PI3K is comprised of an adaptor p85 regulatory subunit and a catalytic p110 subunit
(Carpenter et al., 1993). The subunit p85 is encoded by two genes, which can bind MT
without causing disruptions in its functions (Cohen et al., 1990; Cohen et al., 1990b). The
catalytic subunit has three isoforms: α, β and δ. Only the p110α isoform has been found to
be needed in MT transformation (Utermark et al., 2007). Studies have shown that the when
pp110α is taken out of the equation and therefore it doesn’t get involved in this process,
tumour growth induced by MT is not observed (Utermark et al., 2007). This discovery was
positively welcomed from the drug industry, helping in the development of specific inhibitors
for isoform (Zhou, 2013).

When p85 binds to MT, it also recruits the catalytic subunit to the MT complex. This causes
PI3K to convert phosphoinositide to PIP3, which activates PDPK1. PI3K activation is not a
clear process, however it seems that its activity is stimulated by the interactions between the
p85 SH2 domains and phosphotyrosine (Carpenter et al., 1993). PDPK1 is an AKT
serine/threonine kinase activator, which also becomes activated in this process. The
activation of AKT boosts DNA synthesis and it can also inhibit apoptosis (Avan et al., 2016).
Subsequently, Rac is activate, which then activates c-fos and it starts promoting migratory
signals.

1.2.5 PLC-γ1

PLC-γ1 uses its SH2 domains to bind to MT p-Y322, which is site of the conversion of PIP2
to DAG and IP3 (Su et al., 1995). As a consequence, the Ca2+ level in the cell increases,
activating the PKC family that regulates proteins engaging in cell signalling (Fluck and
Schaffhausen, 2009).

1.3 dl1015
The majority of the proteins associated with MT have been characterized by mutations that
disrupt binding. However, mutant dl1015, which is non transforming, doesn’t have an
identified binding defect (Magnusson et al., 1981). It is unable to transform rat fibroblasts in
semisolid medium, but this defect is not complemented by the ts-a mutant. (Magnusson et
al., 1981). It has deficiencies both in the stimulation of the host cell and the replication of

7
viral DNA, even after serum stimulation of cellular DNA synthesis (Magnusson et al., 1981).
It is able, however, to form a complete complex comprising all identified MT-related proteins,
including the 85-kDa subunit of PI3K (Ling et al., 1992).
It is thought that for the transformation of fibroblasts, the formation of large MT complexes
(nanoclusters) on the cell surface is required (Zhou, 2013). Studies have been conducted
using mutants defective in transformation that showed no MT clusters on the cell surface,
strongly indicating that it may be an essential factor in transformation. Nanoclustering
appears to be a prevalent inquiry (Garcia-Parajo et al., 2014).
Dl1015 has a deletion of 10 residues (338 to 347) in the C-terminal region of MT, which is a
region rich in proline residues (Denis, Rouleau and Schaffhausen, 2017). These deletions
code for middle and large T-antigens producing shortened MT and LT (Magnusson et al.,
1981) and as a consequence, they could account for the poor transformation and
tumorigenesis of MT (Denis, Rouleau and Schaffhausen, 2017). Due to this deletion, MT
binding to PLCg could also be partially affected (Oliveira, Brochado and Sogayar, 1999).
It has been contemplated that the deleted region might be accountable for binding a host
target protein that accommodates a Src homology domain 3 (SH3) domain. SH3 domains
are known to interact with proline-rich regions. Interactions necessitate the core binding idea
of PxxP, where “x” is any amino acid. However, it is unlikely that the effect of the dl1015
mutations is related to a defect in SH3 binding (Denis, Rouleau and Schaffhausen, 2017;
Dilworth et al. personal communication).

Mutant dl1015 has been associated with less binding to pp60c-src, PI3K, or ShcA than wt
(Ichaso and Dilworth, 2001). However, when in vitro,it was found to be able to phosphorylate
pp60c-src and enhance its protein kinase activity, which indicates that the properties of MT,
as well as modifying the structure and function of pp60c-src, could be important for
transformation.
When MT expression levels were matched, no difference in protein binding capacity was
seen (Ling et al., 1992). The level of PI3K activity in dl1015 is easily comparable to that of
the wt (Morgan et al., 1988). It can recruit PI3K activity like the wt, but it is unable to elevate
the cellular level of PIP3, the protein utilised to signal downstream of PI3K. Consequently,
the activation of AKT or RAC1 doesn’t occur (Denis, Rouleau and Schaffhausen, 2017). This
inability of maintaining an increase in PI3K products might indicate that an unknown protein
interacts with the deleted region of dl1015 or that the interactions between known proteins
are defective or PI3K signalling is blocked between recruiting the enzyme to membranes and
signalling to the downstream targets (Fluck and Schaffhausen, 2009 ;Ichaso and Dilworth,
2001). However, high levels of PI3K activity with MT would not enough to induce cellular
transformation (Ling et al., 1992).

Establishing what causes a lack of transformation by dl1015 MT will provide further

information about the requirements for human cancer formation and potentially provide new
therapy targets. Devising ways of inhibiting GFR in cancer could be achieved if more
information about the interactions between MT and various proteins are discovered.
1.4 Aim
To determine whether mutant dl1015 of MT forms nanoclusters on the cell surface and if so,
whether there are any differences in their size and number when compared to wild type.

8
2.Materials and Methods
2.1 Cells and plasmids. Rat2 fibroblast cells were grown in Dulbeccos Modified Eagles
Medium (DMEM, Gibco) supplemented penicillin and streptomycin, glutamine and 10%
foetal calf serum, and incubated at 37°C and 10% CO2 .
The MT plasmid used was comprised of a BamHI-EcoRI fragment of polyomavirus DNA
missing the MT intron cloned into pUC19.
The Escherichia coli (E.coli) bacteria containing the desired plasmid were grown in LB broth
containing ampicillin. A Qiagen Hi Speed Midi Plasmid purification kit was then used to purify
the plasmid DNA.

2.2 Mutation generation. PCR was used to isolate Middle T tagged with the HA epitope
from the wt or dl1015 MT plasmid. A forward primer
(CCGCACATACTGCTGGAAGAAGACG) matching exactly the polyomavirus sequence was
used together with a reverse mutation primer containing an EcoRI site, which is the
sequence encoding the HA tag.

PCR was performed using Phusion polymerase (New England BioLabs) under the
manufacturer’s conditions. The conditions of PCR were 94°C for 180 sec, then 25 cycles of
94°C for 45 sec, 57°C for 60 sec, and finally 72°C for 120 sec. After this, the sample was
incubated at 72°C for 600 sec.
Restrictions enzymes BlpI and EcoRI (NEB) were then used to digest the DNA product,
which was then cloned into BlpI=EcoRI cleaved pUCMT.
The mutant was verified as correct by DNA sequencing before use.

2.3 Immunofluorescence assays. The plasmid DNA transfection procedure for a 24-well
plate was performed using Lipofectamine® 3000 and P3000™ reagents. The cell confluency
in the 24 well plate was between 70 and 90% at transfection.
Two dilutions in tube 1 and 2 were prepared containing 25 µL of Opti-MEM each and 0.75
and 1.5 μL of Lipofectamine 3000® Reagent, respectively.
In a different tube, the diluted DNA was prepared: 50 μL of Opti-MEM® Medium was added
together with 1 μg of plasmid DNA and 2 μL of the P3000™ reagent. 25 μL of diluted DNA
was added to both tubes 1 and 2. The complex was incubated at room temperature for 5
minutes. After the 5 min incubation, 50μL of the DNA-lipid complex in tubes 1 and 2 was
added into well 1 and 2, and the plate was incubated for 48h at 37°C. When analysed,
dilution in well 2 showed the highest transfection efficiency.
For fixed-cell staining, the medium was then removed and the cells were washed three times
with phosphate-buffered saline (PBS) and then fixed with 4% formaldehyde solution in PBS
and incubated for 15 min at room temperature.
The cells were then washed three times with PBS and permeabilized by incubation with 1%
NP-40 in PBS for 5 min at room temperature. Cells were washed three times 5 min in DPBS,
and then treated with Image-iT FX Signal Enhancer solution for 30 min at room temperature.
After a further three washes, the cells were incubated with a 1:2000 dilution of PAb762
antibody at room temperature for 60mins. The cells were then washed three times with PBS
and the primary antibody was detected by incubation with a 1:1000 dilution of an Alexa
Fluor488 labelled anti-mouse IgG antibody (Invitrogen). The cells were washed a further
three times in PBS and then mounted onto glass slides with Prolong Gold anti fade mountant
(Invitrogen).
Live-cell labelling was achieved by washing the cells three times with PBS at 37°C, followed
by incubation for 20 min at 37°C with a 1:1000 dilution of anti HA antibody 12CA5. The cells
were then washed three times with PBS and fixed with formaldehyde as above.
Immunofluorescent images were captured using a Hamamatsu Orca Flash 4 sCCD camera
on a Nikon Eclipse Ti2 epifluorescence microscope controlled by Nikon Elements software.

9
3. Results

This research was initiated in order to investigate a possible defect in mutant dl1015 that
could account for its inability of transforming cells in culture.
It was observed that wt MT, as well as being able to transform cells in culture, could form
nanoclusters at a molecular level. The formation of nanoclusters is thought to be a significant
step in the transformation process, even though the mechanism is still not fully understood.
For this reason, mutant dl1015 was studied.
If mutant dl1015 of MT could not form nanoclusters, it could be indicative of its non-
transforming defect. On the other hand, if mutant dl1015 of MT could form nanoclusters, but
very similar in size and number to wt, it could suggest that the defect for its non-transforming
property lies somewhere else. However, if those nanoclusters would be different in both size
and number, the mechanism behind the formation of clusters could be investigated more in
depth to understand the proteins involved and more importantly, why there is that difference
between mutant dl1015 of MT and wt MT.
In order to look at the nanoclusters, an extended HA tag on the C-terminal end was added to
both wt MT and dl1015 of MT. The plasmid expressing these proteins were then transfected
into Rat2 cells using Lipofectamine 3000, and incubated for 24 hours. The cells were then
incubated with the 12CA5 anti-HA monoclonal antibody, washed and fixed with
formaldehyde. The antibody was then detected with 12CA5 an AF488 labelled anti-mouse
IgG antibody bound to the primary antibody.
The fluorescence was viewed on a Nikon Eclipse Ti2 inverted microscope using a 100x lens
and epifluorescent optics. Images were captured using an Hamamatsu Orca Flash 4
scientific CCD camera and Nikon Elements software (Figure 2).
The results how that both wild type and dl1015 were observed in nanoclusters, and there
were no apparent differences in the number, or size of the clusters between wt and dl1015
MT. Therefore, it seems likely that dl1015 MT does not have defects in its ability to form
nanoclusters.
In regard to size, in fig 3. it can be seen that the nanoclusters formed by wt MT and mutant
dl1015 of MT are very similar. A scale bar of 1 µm was used to compare the different
nanoclusters. It appears that all nanoclusters of both wt MT and mutant dl1015 are almost 1
µm in size. Whereas regarding the quantity of nanoclusters, it can be deduced that, when
comparing wt MT to mutant dl1015, the frequency at which they are found throughout the
complexes is very similar to one another.

10
Figure 2. Images showing the nanoclusters formed by wt MT on the left and mutant dl1015 on the right. It can be
seen that there are no obvious differences between the two types of MT: sizes look similar, as well as number of
clusters. A close up is needed to further analyse this statement.

11
Figure 3. Images showing the sizes of nanoclusters in wt and dl1015 Mt, by comparing them to the scale bar of 1qm shown in
each image. It can be observed that all nanoclusters are of similar size, if not identical. Also, the amount of nanoclusters on each
cell seems similar to one another.

12
4.Discussion
Murine PyV MT is a transmembrane protein that binds signalling molecules in subcellular
membrane sites. MT is a tail-anchored integral transmembrane protein with a C-terminus
translocated to the surface of the cell and a cytosolic N-terminal domain that binds signalling
molecules (Zhou et al., 2011).

MT is an oncogene that has the ability to transform cells even without the presence of ST or
LT. MT transforms cells by being a functional homologue of an activated tyrosine kinase-
associated growth-factor receptor (Dilworth et al., 1994). For this reason, middle T is
considered an active analogue of such a receptor, that can give useful information about the
functions of oncogenic receptors (Zhou et al., 2011).
Dl1015 MT is a mutant of wt MT that has proven to be non-transforming. It has been shown
that dl1015 doesn't activate PKB, which is dependent on the presence of PI3K (Grand,
2001). However, when matched to wt, its PI3K activity seems to be very similar (Ling et al.,
1992).
The deletion dl1015 has eliminates proline residues that constitute an SH3 domain binding
region. However, this doesn't produce the full defective phenotype of dl1015, therefore, other
altered residues could be possibly involved (Grand, 2001).
These matters have raised many questions within the scientific community, as the defect
causing this property has not yet been identified.

In this study, the ability of dl1015 MT to form nanoclusters was investigated. In previous
studies, it has been suggested that the formation of MT nanoclusters has a pivotal role in
transformation of fibroblasts. In the case of L405E MT, also non-transforming, it has been
discovered that ,although its interaction with MT binding proteins is very similar to wt, L405E
cannot form complexes on the cell surface. As a consequence, the lack of nanocluster
formation was thought to account for its inability to transform (Zhou, 2013). A similar theory
was proposed here to explain why mutant dl1015: interacts with MT binding proteins very
similarly to wt, but cannot transform fibroblasts (Urich et al., 1995). However, it has been
suggested that the disruption of the cluster formation could potentially inhibit receptor
oncogenic signalling independently of kinase activity, which could provide a separate goal
for drug development. (Zhou, 2013)
The exact mechanism behind the cluster formation in MT and how it is organised into large
clusters in the plasma membrane are not clear. It could be that there are many factors
available at the cell surface membrane that are involved in the cluster formation process.
However, it has been indicated that clustering might be a way to provide efficient and rapid
spatial confinement for the avoidance of the long-distance diffusion in a cell’s environment.
Lipid rafts in external cell membranes could possibly contribute to the clustering of MT
molecules seen in the plasma membrane. (Cebecauer et al., 2010)
From the data presented in this study, dl1015 demonstrated an ability to form ~1µm clusters
on the cell surface. Thorough examination of surface MT with an anti-HA antibody at a high
magnification showed that the MT clusters weren’t uniformly distributed. It was observed that
the clusters were present throughout the whole external membrane: from the top of the
nucleus to the bottom surface of the cell. Also, the MT clusters of mutant dl1015 were
indistinguishable from wild type because no difference in size or number was observed.

Clusters of 0.5µm in diameter were found to contain thousands of receptors (Githaka et al.,
2016), which makes it likely that the clusters observed in this study could also be comprised
of several MT molecules. The nanoclusters could be investigated with a scanning near-field
optical microscope because of its higher resolution. Scanning near-field optical microscopy

13
(SNOM) is a technique that investigates optically the surface of a cell to form either a high-
resolution 2D image or to make a local spectroscopy. SNOM implicates a positioning probe
with nanometric resolution, a feedback mechanism and optical devices used to generate,
guide, scatter and detect light (Bouhelier, 2016). Its resolution reaches well into the sub-100
nm regime (Vobornik and Vobornik, 2008), which makes it ideal.
The existence of different MT mutants has always been beneficial to the identification of MT-
binding proteins and to the discovery of their importance in cell transformation (Oliveira,
Brochado and Sogayar, 1999).
Mutant 200∆10 was found to be able to form clusters; however it cannot transform, possibly
due to the absence of the Src binding site (Zhou, Y. ,2013) , suggesting that the formation of
the clusters is not related to the proteins that bind onto that site. Mutant L405E has a
mutation in the hydrophobic sequence: Leucine 405 to Glutamate. L405E binds to all MT-
related proteins, but it still cannot transform cells (Zhou, Y. ,2013) . Mutant 180∆10 lacks
both PP2A and Src binding sites and it’s non-transforming (Zhou, Y. ,2013). Dl1015
associates with all known MT-binding proteins, has the ability to form nanoclusters, but it is
non-transforming. This information suggests that there are still some unmeasured
biochemical properties that are defective in mutant dl1015. Further investigations are
required to determine the specific biochemical defect.

In conclusion, it can be confirmed that the formation of nanoclusters is required for MT

transformation. dl1015, although non-transforming, has the ability to form nanoclusters on
the outer cell surface. The defect accounting for its inability to transform is not cluster
formation. This suggests that there is yet another factor involved that disrupts dl1015’s ability
to transform cells. Establishing what causes a lack of transformation by dl1015 MT will
provide further information about the requirements for human cancer formation and
potentially provide new therapy targets. Devising ways of inhibiting GFR in cancer could be
achieved if more information about the interactions between MT and various proteins are
discovered.

4.1 Future proposals

1. Nanoclusters are still to be researched. Details of their molecular composition,

biogenesis, size, stability, functions and regulation are yet to be identified. This could
be achieved by firstly looking at the nanoclusters using a scanning near-field optical
microscopy (SNOM), which uses a nanoscale light source, detector and/or scatterer
scanned in close proximity to the cell surface. It would give more intel about their
shape, size, chemical composition, molecular structure and dynamic properties.

2. Thorough investigation of the signalling molecules involved in the formation of the MT

complex in different MT mutants in order to investigate in which subcellular
compartment the signals are generated as well as to understand how their location
alters cell signalling by using phospho-specific antibodies and high-quality antibody
arrays, which could be focused on a specific cellular function. Understanding and
identifying the changes in cell signalling could make it easier to develop a
combinatorial therapeutic intervention.

3. Proteomic approaches are needed in order to discover any additional MT binding

proteins, such as conducting matrix-assisted laser desorption/ionization (MALDI)
and/or electrospray ionization (ESI).

14
5.Conclusion
In this research, the ability of mutant dl1015 to form nanoclusters was evaluated using Rat2
fibroblast cells transfected with a bacterial plasmid containing the sequence needed to
express wt MT and mutant dl1015. Antibodies were used to detect the presence of the
middle T- antigen and the nanocluster formation.
The results showed that mutant dl1015 of middle T in murine polyomavirus was able to form
nanoclusters at a molecular level. However, after analysing the number and sizes of
individual clusters in both wt and mutant MT, it can be concluded that they look identical to
wild type MT.
The initial objective of the research has been met, even though different results were
desired.
Considering the new knowledge given from this experiment, it can be confirmed that the
ability to form nanoclusters is not the defect that is stopping dl1015 MT from being non-
transforming.
In conclusion, the research has been successful as another property of mutant dl1015 has
been found. In order to understand more about its non-transforming defect, further research
should be conducted.

15
Bibliography
Ahmed, S.B.M. and Prigent, S.A. (2017). Insights into the Shc Family of Adaptor
Proteins. Journal of Molecular Signaling, 12(2).

Ahsan, N. and Shah, K.V. (2002). Polyomaviruses: An Overview. Graft, [online] 5, pp.S9–
S18.

Avan, A., Narayan, R., Giovannetti, E. and Peters, G.J. (2016). Role of Akt signaling in
resistance to DNA-targeted therapy. World Journal of Clinical Oncology, 7(5), p.352.

Baez, C.F., Brandão Varella, R., Villani, S. and Delbue, S. (2017). Human Polyomaviruses:
The Battle of Large and Small Tumor Antigens. Virology: Research and Treatment, 8,
p.1178122X1774478.

Bouhelier, A. (2016). Nanoscale Optical Imaging and Spectroscopy. Reference Module in

Materials Science and Materials Engineering.

Brewster, C.E., Glover, H.R. and Dilworth, S.M. (1997). pp60c-src binding to polyomavirus
middle T-antigen (MT) requires residues 185 to 210 of the MT sequence. Journal of Virology,
71(7), pp.5512–5520.

Carpenter, C.L., Auger, K.R., Chanudhuri, M., Yoakim, M., Schaffhausen, B., Shoelson, S.
and Cantley, L.C. (1993). Phosphoinositide 3-kinase is activated by phosphopeptides that
bind to the SH2 domains of the 85-kDa subunit. The Journal of Biological Chemistry,
268(13), pp.9478–9483.

Cebecauer, M., Spitaler, M., Serge, A. and Magee, A.I. (2010). Signalling complexes and
clusters: functional advantages and methodological hurdles. Journal of Cell Science, 123(3),
pp.309–320.

Cheng, J., DeCaprio, J.A., Fluck, M.M. and Schaffhausen, B.S. (2009). Cellular
Transformation by Simian Virus 40 and Murine Polyoma Virus T antigens. Seminars in
cancer biology, 19(4), pp.218–228.

Cohen, B., Liu, Y.X., Druker, B., Roberts, T.M. and Schaffhausen, B.S. (1990a).
Characterization of pp85, a target of oncogenes and growth factor receptors. Molecular and
Cellular Biology, 10(6), pp.2909–2915.

Cohen, B., Yoakim, M., Piwnica-Worms, H., Roberts, T.M. and Schaffhausen, B.S. (1990b).
Tyrosine phosphorylation is a signal for the trafficking of pp85, an 85-kDa phosphorylated
polypeptide associated with phosphatidylinositol kinase activity. Proceedings of the National
Academy of Sciences of the United States of America, 87(12), pp.4458–4462.

De Gascun, C.F. and Carr, M.J. (2013). Human Polyomavirus Reactivation: Disease
Pathogenesis and Treatment Approaches. [online] Clinical and Developmental Immunology.

16
Delbue, S., Comar, M. and Ferrante, P. (2017). Review on the role of the human
Polyomavirus JC in the development of tumors. Infectious Agents and Cancer, [online] 12(1).

Denis, D., Rouleau, C. and Schaffhausen, B.S. (2017). A Transformation-Defective

Polyomavirus Middle T Antigen with a Novel Defect in PI3 Kinase Signaling. Journal of
Virology, [online] 91(2).

Desselberger, U. (2002). Virus Taxonomy: Classification and Nomenclature of Viruses.

Seventh Report of the International Committee on Taxonomy of Viruses, edited by M.H.V.
van Regenmortel, C.M. Fauquet, D.H.L. Bishop, E.B. Carstens, M.K. Estes, S.M. Lemon, J.
Maniloff, M.A. Mayo, D.J. McGeoch, C.R. Pringle and R.B. Wickner, Virology Division,
International Union of Microbiological Societies, Academic Press, San Diego, 1162 pp.
ISBN: 0-12-370200-3; Virus Research, 83(1–2), pp.221–222.

Dilworth, S.M. (1995). Polyoma virus middle T antigen: meddler or mimic? Trends in
Microbiology, 3(1), pp.31–35.

Dilworth, S.M. (2002). Polyoma virus middle T antigen and its role in identifying cancer-
related molecules. Nature Reviews Cancer, 2(12), pp.951–956.

Dilworth, S.M., Brewster, C.E.P., Jones, M.D., Lanfrancone, L., Pelicci, G. and Pelicci, P.G.
(1994). Transformation by polyoma virus middle T-antigen involves the binding and tyrosine
phosphorylation of Shc. Nature, [online] 367(6458), pp.87–90.

Fluck, M.M. and Schaffhausen, B.S. (2009). Lessons in Signaling and Tumorigenesis from
Polyomavirus Middle T Antigen. Microbiology and Molecular Biology Reviews : MMBR,
[online] 73(3), pp.542–563.

Friedmann, T., Doolittle, R.F. and Walter, G. (1978). Amino acid sequence homology
between polyoma and SV40 tumour antigens deduced from nucleotide sequences. Nature,
274(5668), pp.291–293.

Garcia-Parajo, M.F., Cambi, A., Torreno-Pina, J.A., Thompson, N. and Jacobson, K. (2014).
Nanoclustering as a dominant feature of plasma membrane organization. Journal of Cell
Science, 127(23), pp.4995–5005.

Gelderblom, H.R. (2014). Structure and Classification of Viruses. [online] Nih.gov..

Githaka, J.M., Vega, A.R., Baird, M.A., Davidson, M.W., Jaqaman, K. and Touret, N. (2016).
Ligand-induced growth and compaction of CD36 nanoclusters enriched in Fyn induces Fyn
signaling. Journal of Cell Science, 129(22), pp.4175–4189.

Gjoerup, O. and Chang, Y. (2010). Update on Human Polyomaviruses and Cancer.

Advances in Cancer Research, pp.1–51.

Glenn, G.M. and Eckhart, W. (1993). Mutation of a cysteine residue in polyomavirus middle
T antigen abolishes interactions with protein phosphatase 2A, pp60c-src, and
phosphatidylinositol-3 kinase, activation of c-fos expression, and cellular transformation.
Journal of virology, 67(4), pp.1945–52.

Glover, H.R., Brewster, C.E. and Dilworth, S.M. (1999). Association between src-kinases
and the polyoma virus oncogene middle T-antigen requires PP2A and a specific sequence
motif. Oncogene, 18(30), pp.4364–4370.

17
Grand, R.J.A. (2001). Viruses, cell transformation, and cancer. Amsterdam: Elsevier.

Gross, L. (1953). A Filterable Agent, Recovered from Ak Leukemic Extracts, Causing

Salivary Gland Carcinomas in C3H Mice. Experimental Biology and Medicine, 83(2),
pp.414–421.

Hassell, J.A., Topp, W.C., Rifkin, D.B. and Moreau, P.E. (1980). Transformation of rat
embryo fibroblasts by cloned polyoma virus DNA fragments containing only part of the early
region. Proceedings of the National Academy of Sciences of the United States of America,
77(7), pp.3978–82.

IARC Working Group on the Evaluation of Carcinogenic Risk to Humans (2013). Malaria and
Some Polyomaviruses (SV40, BK, JC, and Merkel Cell Viruses). [online]
www.ncbi.nlm.nih.gov. Lyon (FR): International Agency for Research on Cancer

Ichaso, N. and Dilworth, S.M. (2001). Cell transformation by the middle T-antigen of polyoma
virus. Oncogene, [online] 20(54), pp.7908–7916.

Ito, Y., Brocklehurst, J.R. and Dulbecco, R. (1977). Virus-specific proteins in the plasma
membrane of cells lytically infected or transformed by pol-oma virus. Proceedings of the
National Academy of Sciences of the United States of America, 74(10), pp.4666–70.

JANSSENS, V. and GORIS, J. (2001). Protein phosphatase 2A: a highly regulated family of
serine/threonine phosphatases implicated in cell growth and signalling. Biochemical Journal,
353(3), p.417.

Katze, M.G., Korth, M.J., Law, G.L. and Nathanson, N. (2015). Viral Pathogenesis: From
Basics to Systems Biology. [online] Google Books. Academic Press.

Lagatie, O., Tritsmans, L. and Stuyver, L.J. (2013). The miRNA world of polyomaviruses.
Virology Journal, 10(1).

Ling, L.E., Druker, B.J., Cantley, L.C. and Roberts, T.M. (1992). Transformation-defective
mutants of polyomavirus middle T antigen associate with phosphatidylinositol 3-kinase (PI 3-
kinase) but are unable to maintain wild-type levels of PI 3-kinase products in intact cells.
Journal of Virology, [online] 66(3), pp.1702–1708.

Lomax, M. and Fried, M. (2001). Polyoma virus disrupts ARF signaling to p53. Oncogene,
20(36), pp.4951–60.

Magnusson, G., Nilsson, M.G., Dilworth, S.M. and Smolar, N. (1981). Characterization of
polyoma mutants with altered middle and large T-antigens. Journal of Virology, [online]
39(3), pp.673–683.

Markland, W., Cheng, S.H., Oostra, B.A. and Smith, A.E. (1986). In vitro mutagenesis of the
putative membrane-binding domain of polyomavirus middle-T antigen. Journal of Virology,
59(1), pp.82–89.

Moens, U., Seternes, O.M., Johansen, B., Rekvig, O.P. and Rekvig, O.P. (1997).
Mechanisms of Transcriptional Regulation of Cellular Genes by SV40 Large T- and Small T-
Antigens. Virus Genes, 15(2), pp.135–154.

18
Moore, J.L., Chowdhury, K., Martin, M.A. and Israel, M.A. (1980). Polyoma large tumor
antigen is not required for tumorigenesis mediated by viral DNA. Proceedings of the National
Academy of Sciences of the United States of America, 77(3), pp.1336–40.

Morgan, W.C., Kaplan, D.R., Pallas, D.C. and Roberts, T.M. (1988). Recombinant
retroviruses that transduce middle T antigen cDNAs derived from polyomavirus mutants:
separation of focus formation and soft-agar growth in transformation assays and correlations
with kinase activities in vitro. Journal of Virology, 62(9), pp.3407–3414.

Moule, M.G., Collins, C.H., McCormick, F. and Fried, M. (2004). Role for PP2A in ARF
signaling to p53. Proceedings of the National Academy of Sciences of the United States of
America, 101(39), pp.14063–6.

Mullane, K.P., Ratnofsky, M., Culleré, X. and Schaffhausen, B. (1998). Signaling from
Polyomavirus Middle T and Small T Defines Different Roles for Protein Phosphatase 2A.
Molecular and Cellular Biology, 18(12), pp.7556–7564.

Nicholson, P.R. (2001). ShcA tyrosine phosphorylation sites can replace ShcA binding in
signalling by middle T-antigen. The EMBO Journal, 20(22), pp.6337–6346.

Novak, U., Dilworth, S.M. and Griffin, B.E. (1980). Coding capacity of a 35 percent fragment
of the polyoma virus genome is sufficient to initiate and maintain cellular transformation.
Proceedings of the National Academy of Sciences, 77(6), pp.3278–3282.

Ogris, E., Mudrak, I. and Wintersberger, E. (1992). Polyomavirus large and small T antigens
cooperate in induction of the S phase in serum-starved 3T3 mouse fibroblasts. Journal of
Virology, 66(1), pp.53–61.

Oliveira, M.L., Roberts, T.M., Druker, B.J. and Armelin, M.C. (1998). Mapping of
polyomavirus middle T domain that is responsible for AP-1 activation. Oncogene, 16(23),
pp.2975–2982.

Oliveira, M.L.S., Brochado, S.M. and Sogayar, M.C. (1999). Mechanisms of cell
transformation induced by polyomavirus. Brazilian Journal of Medical and Biological
Research, [online] 32(7), pp.861–865.

Pallas, D.C., Shahrik, L.K., Martin, B.L., Jaspers, S., Miller, T.B., Brautigan, D.L. and
Roberts, T.M. (1990). Polyoma small and middle T antigens and SV40 small t antigen form
stable complexes with protein phosphatase 2A. Cell, 60(1), pp.167–176.

Payne, S. (2017). Human Polyomavirus - an overview | ScienceDirect Topics. [online]

Sciencedirect.com.

Pipas, J.M. (1992). Common and unique features of T antigens encoded by the
polyomavirus group. Journal of virology, 66(7), pp.3979–85.

Rassoulzadegan, M., Binetruy, B. and Cuzin, F. (1982). High frequency of gene transfer
after fusion between bacteria and eukaryotic cells. Nature, 295(5846), pp.257–259.

Rassoulzadegan, M., Cowie, A., Carr, A., Glaichenhaus, N., Kamen, R. and Cuzin, F.
(1982). The roles of individual polyoma virus early proteins in oncogenic transformation.
Nature, 300(5894), pp.713–718.

19
Reihsaus, E., Kraiss, S., Barnekow, A. and Montenarh, M. (1992). Cooperation of p53 and
polyoma virus middle T antigen in the transformation of primary rat embryo fibroblasts.
Experimental Cell Research, 199(1), pp.10–18.

Schaffhausen, B.S. and Roberts, T.M. (2009). Lessons from Polyoma Middle T Antigen on
Signaling and Transformation: A DNA Tumor Virus Contribution to the War on Cancer.
Virology, 384(2), pp.304–316.

Su, W., Liu, W., Schaffhausen, B.S. and Roberts, T.M. (1995). Association of Polyomavirus
middle tumor antigen with phospholipase C-gamma 1. The Journal of biological chemistry,
270(21), pp.12331–4.

Treisman, R., Novak, U., Favaloro, J. and Kamen, R. (1981). Transformation of rat cells by
an altered polyoma virus genome expressing only the middle-T protein. Nature, 292(5824),
pp.595–600.

Urich, M., Shemerly, M.Y.M.E., Besser, D., Nagamine, Y. and Ballmer-Hofer, K. (1995).
Activation and Nuclear Translocation of Mitogen-activated Protein Kinases by Polyomavirus
Middle-T or Serum Depend on Phosphatidylinositol 3-Kinase. Journal of Biological
Chemistry, 270(49), pp.29286–29292.

Utermark, T., Schaffhausen, B.S., Roberts, T.M. and Zhao, J.J. (2007). The p110alpha
isoform of phosphatidylinositol 3-kinase is essential for polyomavirus middle T antigen-
mediated transformation. Journal of Virology, 81(13), pp.7069–7076.

Van Kanegan, M.J. and Strack, S. (2009). The Protein Phosphatase 2A Regulatory Subunits
B′β and B′δ Mediate Sustained TrkA Neurotrophin Receptor Autophosphorylation and
Neuronal Differentiation. Molecular and Cellular Biology, [online] 29(3), pp.662–674.

Wallace, N.A. and Galloway, D.A. (2016). Chapter 8 - Viral Oncogenesis: Infections that Can
Lead to Cancer. [online] ScienceDirect.

Zhou, A.Y., Ichaso, N., Adamarek, A., Zila, V., Forstova, J., Dibb, N.J. and Dilworth, S.M.
(2011). Polyomavirus Middle T-Antigen Is a Transmembrane Protein That Binds Signaling
Proteins in Discrete Subcellular Membrane Sites. Journal of Virology, [online] 85(7),
pp.3046–3054.

Zhou, Y. (2013). The Role of Subcellular Distribution upon Signalling by Polyomavirus

Middle Tumour-antigen. [online] Imperial College London.

20
7.Appendix
7.1 Learning Logs

Topic and Focus of Study

Options for different lab projects discussed during meeting.

Brief Outline of Intent

The student had to do extended research in order to be more prepared on the topic
chosen.

Agreed Objectives
The topic of the dissertation was decided.
Ethics application needed to be completed and sent.

Date and Time for Next Meeting: 20/01/2020

Meeting 1 Date: 4/11/2019

Signed:

Student

Supervisor

Meeting 2 Date: 20/01/2020

Comments
Ethics application needed some minor adjustments in order to be approved.
Agreed Objectives
The student was to start the introduction.

21
 Date and Time for Next Meeting: 10/02/2020

Signed:

Student

Supervisor

22
Meeting 3 Date: 10/02/2020

Comments
Ethics application was approved.
Brief discussion about lab practicals.
Questions were addressed.
Agreed Objectives
Student was to start the methods section.
Date and Time for Next Meeting (Optional): 19/02/2020

Signed:

Student

Supervisor

Optional Meeting 4 Date: 19/02/2020

Comments

Student visualised and captured images of the nanoclusters using the epifluorescent
microscope.
Agreed Objectives

Student was to start the Results section.

Signed:

Student

Supervisor

23
7.2 Natural Science Rec Approval Letter

24
 7.3 LabRAT

Risk "The use of antibodies/immunofluorescence analysis Assessment

Assessment to determine whether other dl1015 Polyomavirus MT Date: 2/11/2019
For (Project forms nanoclusters"
title): Review Date:

Carrie Name: Sabina Manolache Authorised by: Name: Prof. Stephen

d out Dilworth
Research
by:
Staff Student Supervisor Signature: Stephen M.
Dilworth
PhD MSc BSc

Hazard Persons affected Risk Controls Risk Rating Future

Requirements
(outline the controls in place)
(with timescales)

Accept
Risk?
Likelihood
Severity

Risk

Y/N

Chemical hazards

Chemicals Employees & N/A

students

Antibodies • Suitable PPE to be worn 1 1 1 Y

at all times
May contain small
levels of sodium • Proper protocols of use
azide and disposal prepared before
experimental work commence

25
Milk powder

May cause • Use PPE at all times 1 1 1 Y

allergies

16% aqueous S,E  All work to be performed 2 1 2 Y N/A

solution of with academic present.
Formaldehyde  All work to be performed
in fume hood. These are
Toxic, corrosive, included on preventative
probable maintenance schedule
carcinogen as well as being subject
to in-house testing
regime using
anemometer.
 Suitable PPE such as
lab coats, appropriate
gloves and eye
protection are worn
always
 Protocol of each assay
will include the precise
use of chemicals and
regulation associated
such as waste disposal
will be made available.

Ethanol (70%) Student, employees  An appropriate induction 1 1 1 Y N/A

Ethanol which covers general
Absolute, and information on
Methanol laboratory safety
practice, personal
Harmful if protective equipment
swallowed or (PPE) and fire training
inhaled. May will be delivered.
affect nervous  Suitable PPE such as
system, kidneys, lab coats, appropriate
liver and blood. gloves and eye
protection are worn
always.
 Appropriate external
storage for inactive
chemicals and solvents,
separated from
hazardous chemicals
(that are flammables,
acids, oxidizing agents,
bases etc.)
 Protocol of each assay
will include the precise
use of chemicals and
regulation associated
such as waste disposal
will be made available.

26
Phosphate Student, employees  Suitable PPE such as 1 1 1 Y N/A
buffered saline lab coats, appropriate
gloves and eye
May irritates the protection are worn
eyes, skin, mouth, always.
and throat. The  Protocol of each assay
aerosols may will include the precise
irritate respiratory use of chemicals and
tract. regulation associated
such as waste disposal
will be made available.
Foetal calf Student, employees  Suitable PPE will be 1 1 1 Y N/A
serum worn always

Gastro-intestinal
upset if swallowed
in large doses.

DME Medium Student, employees  An appropriate induction 1 1 1 Y N/A

which covers general
Medium: May information on
irritate skin, eyes laboratory safety
and upper practice, personal
respiratory tract if protective equipment
get contact. (PPE) has been
delivered to all relevant
staff and students.

CO2 Students and  Appropriate external 3 1 3 Y N/A

employees storage of gas cylinders
If inhaled for short securely restrained.
term exposure,  Gas and alarm system
may cause ringing monitoring readily in
in the ears, place where significant
nausea, irregular hazard may be present.
heartbeat,  Required training such
dizziness, as Manual Handling for
convulsions relevant staff in use of
regulators, connecting
cylinders, replacing the
cylinder etc.

Disinfectants S, E, P  Suitable PPE to be worn 1 1 1 Y N/A

at all times
Trigene  Use according to
(Halogenated manual handling
Tertiary Amine), instructions and
Virkon (Potassium instructions on labels
peroxymonosulph  Spill kit available in
ate) laboratory

Mild eye irritant

27
May be toxic
when ingested or
inhaled

Antibiotics S, E  Protocol of use and 1 1 1 Y N/A

(Penicillin, disposal prepared
Streptomycin) before starting
experimental work
May cause  Suitable PPE to be worn
allergies all the time
 No workers with known
allergy to be exposed.


Biological
Hazards

Student employees  An appropriate induction 1 1 1 Y N/A

which covers general
Rat cell lines information on
transfected with laboratory safety
MT containing practice, personal
plasmid. protective equipment
(PPE) and fire training
No known will be delivered.
hazards  Suitable PPE such as
lab coats, appropriate
gloves and eye
protection are worn
always.
 Protocol of each assay
will include the precise
use of chemicals and
regulation associated
such as waste disposal
will be made available.

Radiation
Hazards

NA - - - - - - N/A

Equipment Hazards – Including SAFETY CRITICAL Equipment (i.e. equipment whose failure to operate correctly would
result in unsafe conditions)

Incubators, Students,  Visual inspection is 1 1 1 y N/A

water bath employees, necessary for each use
contractors  A display of equipment
Extremely hot on annual Preventative
Maintenance Schedule
and results in place.
 Alarm system
monitoring readily in
place where significant
hazard may present.

28
Safety Cabinets Students, employees  Use restricted to those 1 1 1 y N/
Class 2 who have been suitably A
trained
 A display of equipment
on annual Preventative
Maintenance Schedule
and results in place.
 Visual inspection is
necessary for each use
Other Hazards

Housekeeping of Students,  Monthly or weekly 1 1 1 y N/A

the working employees, maintenance schedule if
laboratory contractors the laboratory is in place
involving all relevant
Poor staff and students who
housekeeping of are associated with
the lab may work in the laboratory
expose to slippery
floor that cause
electricity trip or
falls

Lone Working Employees and  None Allowed 1 1 1 Y N/A

Students
• No lone working allowed

29
 Risk Calculation and Interpretation

Severity Likelihood

High – Death or major injury (as defined by High – where it is certain or near certain
RIDDOR) or illness causing long term that harm will occur
disability

Medium – Injuries or illness causing short Medium – where harm will often occur
term disability

Low – All other injuries or illness Low – where harm will seldom occur

Risk Rating

Persons affected

Low likelihood Medium High likelihood

likelihood
1
3
2

Low severity
e – employees
1 Trivial Risk Tolerable Risk Moderate Risk s – students
1 2 3 v – visitors
c – contractors
Medium
severity 2 Tolerable Risk Moderate Risk Substantial Risk p – public

6
2 4

High severity
3 Moderate Risk Substantial Risk Intolerable Risk

3 6 9

30
A guide to a risk control plan

Action and Timescale (Timescales where required shall be determined by the

appropriate school/service or management unit)
Risk Level

No action required and no documentation necessary

Trivial

Tolerable No additional controls are required. Monitoring is required to ensure that the controls
are maintained.

Moderate Efforts should be made to reduce the risk further where reasonable and practicable.
Risk reduction measures (where identified) should be implemented within a defined
period.

Substantial Work should not be started until the risk has been reduced. If work is already in
progress then urgent action should be taken.

Intolerable Work should NOT be started or continued until the risk has been reduced. If it is not
possible to reduce the risk, then work must remain prohibited

31