ARTICLE

https://doi.org/10.1038/s41467-022-29191-x OPEN

Aged bone matrix-derived extracellular vesicles as

a messenger for calcification paradox
Zhen-Xing Wang 1,2, Zhong-Wei Luo1,2, Fu-Xing-Zi Li3, Jia Cao 1,2, Shan-Shan Rao2,4, Yi-Wei Liu1,2,
Yi-Yi Wang1,2, Guo-Qiang Zhu1,2, Jiang-Shan Gong1,2, Jing-Tao Zou1,2, Qiang Wang5, Yi-Juan Tan1,2, Yan Zhang2,
Yin Hu2, You-You Li1,2, Hao Yin1,2, Xiao-Kai Wang6, Ze-Hui He1,2, Lu Ren3, Zheng-Zhao Liu 2,7,8,9,10,
Xiong-Ke Hu2, Ling-Qing Yuan 3, Ran Xu3, Chun-Yuan Chen 1,2 ✉ & Hui Xie 1,2,7,8,9,10 ✉
1234567890():,;

Adipocyte differentiation of bone marrow mesenchymal stem/stromal cells (BMSCs) instead

of osteoblast formation contributes to age- and menopause-related marrow adiposity and
osteoporosis. Vascular calcification often occurs with osteoporosis, a contradictory asso-
ciation called “calcification paradox”. Here we show that extracellular vesicles derived from
aged bone matrix (AB-EVs) during bone resorption favor BMSC adipogenesis rather than
osteogenesis and augment calcification of vascular smooth muscle cells. Intravenous or
intramedullary injection of AB-EVs promotes bone-fat imbalance and exacerbates Vitamin D3
(VD3)-induced vascular calcification in young or old mice. Alendronate (ALE), a bone
resorption inhibitor, down-regulates AB-EVs release and attenuates aging- and ovariectomy-
induced bone-fat imbalance. In the VD3-treated aged mice, ALE suppresses the ovariectomy-
induced aggravation of vascular calcification. MiR-483-5p and miR-2861 are enriched in AB-
EVs and essential for the AB-EVs-induced bone-fat imbalance and exacerbation of vascular
calcification. Our study uncovers the role of AB-EVs as a messenger for calcification paradox
by transferring miR-483-5p and miR-2861.

1 Department of Orthopedics, Xiangya Hospital, Central South University, Changsha, Hunan, China. 2 Movement System Injury and Repair Research Center,

Xiangya Hospital, Central South University, Changsha, Hunan, China. 3 The Second Xiangya Hospital, Central South University, Changsha, Hunan, China.
4 Xiangya Nursing School, Central South University, Changsha, Hunan, China. 5 Department of Laboratory Medicine, Affiliated Zhejiang Hospital, Zhejiang

University School of Medicine, Hangzhou, Zhejiang, China. 6 Department of Emergency Medicine, Xiangya Hospital, Central South University, Changsha,
Hunan, China. 7 Department of Sports Medicine, Xiangya Hospital, Central South University, Changsha, Hunan, China. 8 National Clinical Research Center for
Geriatric Disorders, Xiangya Hospital, Central South University, Changsha, Hunan, China. 9 Hunan Key Laboratory of Organ Injury, Aging and Regenerative
Medicine, Changsha, Hunan, China. 10 Hunan Key Laboratory of Bone Joint Degeneration and Injury, Changsha, Hunan, China. ✉email: chency19@csu.edu.cn;
huixie@csu.edu.cn

NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications 1

ARTICLE
O
steoporosis is a bone disease characterized by low bone
mass and poor bone quality due to an imbalanced bone
metabolism and often occurs in aged people, especially in
postmenopausal women1–3. Unbalanced differentiation of bone
marrow mesenchymal stem/stromal cells (BMSCs) into adipo-
cytes at the expense of osteoblasts contributes importantly to age-
and menopause-associated marrow adiposity and osteoporosis4.
Vascular calcification, a pathological process sharing many
common features with bone formation, is often accompanied by
decreased bone mass or disturbed bone remodeling5–7. This
contradictory association is called “calcification paradox”5–7.
However, the mechanism underlying the calcification paradox is
not fully understood.
Exosomes are 40–150 nm extracellular vesicles (EVs) derived
from multivesicular bodies and play critical roles in intercellular
communication by transferring bioactive components, such as
proteins, messenger RNAs (mRNAs), microRNAs (miRNAs), and
genomic DNA to recipient cells8–11. Bone matrix vesicles are
nanosized EVs located within the matrix of bone and provide the
initial site for bone mineralization12. Similarities in size, mor-
phology, and components (proteins and lipids) between bone
matrix vesicles and exosomes suggest that bone matrix vesicles
are anchored exosomes secreted by bone cells12. Since the term
“exosomes” in the vast majority of the literatures generally refers
to EVs sharing certain biochemical or biophysical features of
exosomes without demonstrating their intracellular origin, here
we chose to use the generic term “EVs” instead of “exosomes”.
Currently, the cell types mainly responsible for the production of
bone matrix EVs (B-EVs) remain unclear. Evidence is also lacking
on whether B-EVs are involved in age- and menopause-associated
BMSC fate switching and bone-fat imbalance.
Like bone cells, vascular smooth muscle cells (VSMCs) can also
produce matrix EVs-like structures13. Matrix EVs from the
mineralized VSMCs contain fewer matrix Gla protein (a miner-
alization inhibitor) and have a higher ability to promote mineral
nucleation than matrix vesicles secreted under physiological
condition13, suggesting the involvement of matrix EVs in vascular
calcification. Studies have indicated that multiple growth factors
deposited in the bone matrix can be released into bone marrow
during osteoclastic bone resorption and then participate in the
regulation of bone homeostasis14,15. These reports, together with
the evidence of the relatively or absolutely increased bone
resorption in senile or postmenopausal osteoporosis1,16, suggest
that B-EVs may be released into bone marrow and then into
circulation to induce calcification paradox during skeletal aging
and menopause.
In this study, we uncover the role of EVs from the aged bone
matrix (AB-EVs) as a messenger for the calcification paradox by
transferring specific miRNAs to BMSCs and VSMCs. First, we
isolated B-EVs from the aged and young humans or rats and
evaluated the exosome identity of theses vesicles. We then
investigated the cell origin of B-EVs and compared the in vitro
effects of AB-EVs and EVs from young bone (YB-EVs) on
osteogenic and adipogenic differentiation of BMSCs as well as on
calcification of VSMCs. In vivo, we tested whether AB-EVs could
promote bone-fat imbalance and exacerbate Vitamin D3 (VD3)-
induced vascular calcification in young or aged mice. Moreover,
we evaluated whether alendronate (ALE), a bone resorption
inhibitor widely used for osteoporosis treatment17, could decrease
AB-EVs release and attenuate bone-fat imbalance and VD3-
induced vascular calcification in aged ovariectomized (OVX)
mice. Meanwhile, the candidate miRNAs that may mediate AB-
EVs-induced marrow fat accumulation and calcification paradox
were screened based on miRNA expression profiling, and their
mediator roles were confirmed in vitro and in vivo.
2 NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x
Results
Identification and characterization of B-EVs. YB-EVs and AB-
EVs were respectively isolated from young and aged human bone
specimens. As viewed under the transmission electron micro-
scope (TEM), YB-EVs and AB-EVs exhibited cup-like morphol-
ogies (Fig. 1a). Nanoparticle Tracking Analysis (NTA) revealed
that YB-EVs and AB-EVs had mean diameters of 109.1 ± 38.5 nm
and 101.9 ± 34.6 nm, respectively (Fig. 1b), similar to that pre-
viously reported exosomes9,18,19. Flow cytometric analysis
showed that a vast majority (>97%) of the isolated YB-EVs and
AB-EVs expressed the exosomal markers including CD63, CD81,
and TSG101 (Fig. 1c), which further indicates the exosome
identity of these vesicles. Exosomes are specifically enriched with
many molecules from their parent cells and also express marker
proteins specific for their parent cells20,21. Flow cytometric ana-
lysis was conducted to assess the protein expression of SOST (a
glycoprotein protein mainly produced by osteocytes22,23), type I
collagen (COL I, a osteoblast marker protein24), and type X
collagen (COL X, a phenotypic marker of hypertrophic
chondrocytes25) in YB-EVs, AB-EVs, osteocytes-derived EVs
(OCY-EVs), osteoblasts-derived EVs (OB-EVs), and hypertrophic
chondrocytes-derived EVs (HYPC-EVs). The results showed that
SOST protein was expressed in YB-EVs, AB-EVs, OCY-EVs, and
HYPC-EVs, but not in OB-EVs (Fig. 1d). COL I and COL X were
expressed in the vast majority of OB-EVs and HYPC-EVs,
respectively, whereas OCY-EVs were negative for this protein
(Fig. 1d). A very small proportion (<10%) of YB-EVs and AB-
EVs were positive for COL I and COL X (Fig. 1d). These results
indicate that the majority of B-EVs are released from osteocytes,
but not from osteoblasts or hypertrophic chondrocytes.
The tetraspanin CD63 is preferentially enriched in the
membrane of intracellular endosomal intraluminal vesicles (ILVs,
the precursors of exosomes) and extracellular exosomes, but not in
other types of EVs26. To label the osteocyte-specific ILVs/exo-
somes in bone and vasculature, we generated Cd63em(loxp-mCherry-
loxp-eGFP)3 mice harboring conditional Cd63 alleles in which the
stop codon in exon 8 at the 3′ UTR of Cd63 gene was replaced
with a knock-in mCherry reporter gene flanked by two LoxP
sites, and followed by an eGFP reporter gene, which would be
activated if the loxp-mCherry-loxp sequence was excised (Fig. 1e).
Then, we crossed the reporter mice with the transgenic mice
expressing improved Cre recombinase under the control of the
dentin matrix protein 1 (Dmp1) promoter to generate Dmp1iCre;
Cd63em(loxp-mCherry-loxp-eGFP)3 mice, whose eGFP could be
transcribed in osteocytes due to the deletion of the floxed
mCherry by iCre recombinase (Fig. 1e, f). The fluorescent
signals of mCherry and eGFP proteins in the bone and vessel
sections of Dmp1iCre; Cd63em(loxp-mCherry-loxp-eGFP)3 mice,
Cd63em(loxp-mCherry-loxp-eGFP)3 mice, and Dmp1iCre mice were
assessed. Meanwhile, immunostaining was performed to determine
whether the eGFP-labeled exosomes could be stained by SOST
protein. As evidenced by Fig. 1g, abundant mCherry red
fluorescence was observed in cells (osteocytes) within the bone
matrix of cortical bone of Cd63em(loxp-mCherry-loxp-eGFP)3 mice, and
in cells of vascular tissues from Cd63em(loxp-mCherry-loxp-eGFP)3 mice
and Dmp1iCre; Cd63em(loxp-mCherry-loxp-eGFP)3 mice. However, there
were only a few signals of mCherry protein in osteocytes of
Dmp1iCre; Cd63em(loxp-mCherry-loxp-eGFP)3 mice (Fig. 1g). Abundant
dot-like eGFP green signals were at the perinuclear region of
osteocytes, within the bone matrix, or detected in the vascular
tissues of these mice, and most of these green dots were positive
for SOST protein (Fig. 1g), suggesting that most of them are the
released OCY-EVs and can enter into the bone matrix
and vascular tissues under physiologic condition. Neither
mCherry or eGFP signals were observed in the bone and
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x ARTICLE

a b c YB-EVs d
YB-EVs YB-EVs Negative
100 Negative

Distribution (%)
99.9% YB-EVs
80 CD63 100.0%

SOST
1.23%
CD81 97.4% AB-EVs
60 100%
TSG101 98.9% OCY-EVs

%
40 99.8%
99.5% OB-EVs
20 0.57% HYPC-EVs
0
0 100 200 300 400 500 –103 0 103 104 105
Size (nm) FITC 1.20%

COL I
AB-EVs AB-EVs AB-EVs 100%
100

Distribution (%)
Negative 1.00%
80 CD63 100.0% 4.89%
60 CD81 98.4% 6.32%
TSG101 99.5%

%
0.40%
40
20
0 100 200 300 400 500 0 100%

COL X
–1030 103 104 105 0.02%
Size (nm) FITC 0.03%
e 3.51%
4.22%
0.83%

–103 0 103 104

f 1 2 3 4 5 6
1 Marker
600 bp 2 Wild Type
500 bp
400 bp 341 bp 3 Dmp1iCre
300 bp 240 bp
200 bp 4 Cd63fl/ -
100 bp 5 Dmp1iCre; Cd63fl/ -
6 Water
689 bp
600 bp
500 bp
400 bp
300 bp
200 bp
100 bp

g DAPI eGFP mCherry SOST Merge

Dmp1iCre
Cortical Bone

Cd63fl/ -
fl/ -
; Cd63
iCre
Dmp1
iCre
Dmp1
fl/ -
Vessel

Cd63
fl/ -
; Cd63
iCre
Dmp1

vascular tissues of Dmp1iCre mice (Fig. 1g), indicating that these
signals in Cd63em(loxp-mCherry-loxp-eGFP)3 mice and Dmp1iCre;
Cd63em(loxp-mCherry-loxp-eGFP)3 mice are not nonspecific-fluorescence.
There were dot-like SOST-positive signals in the vascular tissues of
Dmp1iCre mice and Cd63em(loxp-mCherry-loxp-eGFP)3 mice (Fig. 1g),
which also suggest that OCY-EVs can be transported from bone to
blood vessels under normal circumstance.
Together, these findings indicate that the majority of B-EVs are
derived from osteocytes and can enter from bone matrix to blood
vessels.

NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications 3

ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x

Fig. 1 Identification and characterization of B-EVs. a–d, Morphology (a), diameter distribution (b), exosomal marker analysis (c), and expression of SOST, COL
I, and COL X (d) in the indicated EVs. Scale bar: 50 nm. e Schematic diagram of the gene targeting strategy for the generation of Cd63em(loxp-mCherry-loxp-eGFP)3 mice
by inserting a mCherry reporter gene flanked by two loxP sites and an eGFP reporter gene in the stop codon in exon 8 at the 3’ UTR of Cd63 gene. f PCR genotyping
of wild-type mice, Dmp1iCre mice, Cd63em(loxp-mCherry-loxp-eGFP)3 mice, and Dmp1iCre; Cd63em(loxp-mCherry-loxp-eGFP)3 mice using primers for determining the insertion of
iCre (up) and eGFP (down). n = 3 biologically independent animals. g Localization of eGFP (green) and mCherry (red), and immunofluorescence staining for SOST
(purple) in bone and vessel from Dmp1iCre mice, Cd63em(loxp-mCherry-loxp-eGFP)3 mice, and Dmp1iCre; Cd63em(loxp-mCherry-loxp-eGFP)3 mice. Scale bar: 20 μm (for bone) or
50 μm (for vessel). n = 3 biologically independent animals. Experiments in a–d were repeated independently three times with similar results. Experiments in f–g
were repeated independently two times with similar results. The illustrated results represented one of the three or two independent experiments. Source data are
provided as a Source Data file.

AB-EVs favor adipogenesis rather than osteogenesis of BMSCs
and augment osteogenic transdifferentiation of VSMCs. To
assess the impacts of AB-EVs and YB-EVs on osteogenic and
adipogenic differentiation of BMSCs, we firstly detected whether
the red lipophilic dye DiI-labeled AB-EVs and YB-EVs could be
internalized by mouse BMSCs. As shown in Supplementary
Fig. 1a, large numbers of red fluorescent signals were presented at
the perinuclear region of BMSCs treated with AB-EVs or YB-EVs
for 3 h, indicating the successful uptake of these EVs by BMSCs.
Quantitative real-time PCR (qRT-PCR) analysis (Supplementary
Fig. 1b) and Alizarin Red S (ARS) staining (Fig. 2a, b), respec-
tively, showed that YB-EVs, but not AB-EVs, markedly promoted
the expression of osteogenesis-related genes (Runx2, Bglap, and
Alpl) and calcium nodule formation of BMSCs under osteogenic
induction. In contrast, AB-EVs, but not YB-EVs, profoundly
augmented the expression of adipogenesis-related genes (Pparγ,
Cebpα, and Fabp4) and lipid droplet formation of BMSCs under
adipogenic differentiation, as shown by qRT-PCR analysis (Sup-
plementary Fig. 1c) and Oil Red O (ORO) staining (Fig. 2a, b).
Fluorescence microscope showed that both the DiI-labeled AB-
EVs and YB-EVs could be taken up by VSMCs (Supplementary
Fig. 2a). Interestingly, ARS staining, qRT-PCR analysis, and
alkaline phosphatase (ALP) activity assay, respectively, showed
that AB-EVs significantly increased calcium deposition (Fig. 2c,
d), reduced the expression of SMC markers (including smooth
muscle 22α (SM22α) and smooth muscle α-actin (SMαA/
αSMA)27,28) (Fig. 2e), enhanced the expression of RUNX2 (a
transcription factor essential for osteogenesis and VSMC
calcification27,29) and COL1A1 (a gene that encodes the major
component of extracellular matrix30) (Fig. 2f), and augmented
ALP activity (a critical marker of osteoblast-like change of
VSMCs30) (Fig. 2g) in human VSMCs undergoing osteogenic
induction, indicating that AB-EVs promote the switching of
VSMC phenotype to osteogenic phenotype. However, YB-EVs
did not induce significant changes of these parameters in the
differentiated VSMCs (Fig. 2c–g), all of which were inconsistent
with their remarkable stimulatory effects on the osteogenic dif-
ferentiation of BMSCs. Cell counting kit-8 (CCK-8) assay indi-
cated that AB-EVs did not reduce the survival or growth of
VSMCs (Supplementary Fig. 2b), suggesting that the calcium
deposition in the AB-EVs-treated VSMCs is not due to the
induction of cell death and intracellular calcium ion release.
Together, these findings indicate that with the aging of bone
donor, B-EVs lose the capacity to stimulate BMSC osteogenesis
and their actions become pro-adipogenic on BMSCs and pro-
osteogenic on VSMCs.
Consistent with the effects of B-EVs, ARS and ORO staining
revealed that OCY-EVs from young donor-derived bone (YB-
OCY-EVs) markedly augmented osteogenesis of BMSCs, but
OCY-EVs from aged donor-derived bone (AB-OCY-EVs) sig-
nificantly enhanced BMSC adipogenesis and VSMC mineralization
(Fig. 2h, i), which further support the osteocyte origin of B-EVs.
To mimic B-EVs release from bone matrix, the osteoclast
progenitor RAW264.7 cells were subjected to osteoclastic
induction and cultured with or without bone slices from the
aged or young humans. The conditioned media (CM) from
osteoclasts receiving different treatments were then harvested to
assess their impacts on osteogenic and adipogenic differentiation
of BMSCs and calcification of VSMCs. Consistent with the effects
of YB-EVs on BMSC differentiation, ARS and ORO staining
revealed that the bone-resorption CM from osteoclasts with
young bone slices (OCYB-CM) remarkably enhanced the ability of
BMSCs to form calcium nodules under osteogenic induction, but
did not induce obvious effect on adipogenesis of BMSCs
compared with CM from osteoclasts without bone slices (OC-
CM) (Fig. 2j, k). On the contrary, the bone-resorption CM from
osteoclasts with aged bone slices (OCAB-CM) had no notable
influence on BMSC osteogenesis, but induced a significant
increase in adipogenic differentiation of BMSCs (Fig. 2j, k).
EVs were isolated from OCYB-CM (EVs in OCYB-CM) and
OCAB-CM (EVs in OCAB-CM) and their effects on BMSC
differentiation were evaluated. Similar to CM from which they
were derived, EVs in OCYB-CM and OCAB-CM, respectively,
were able to profoundly augment osteogenic and adipogenic
differentiation of BMSCs, whereas the EVs-depleted OCAB-CM
exhibited a significantly impaired ability to stimulate adipogenesis
of BMSCs (Fig. 2j, k), indicating an essential role of EVs in the
OCAB-CM-induced promotion of adipogenesis of BMSCs.
Figure 2l, m show the extents of VSMC calcification in different
groups as visualized by ARS staining. Neither OCYB-CM nor EVs
in OCYB-CM induced notable effects on VSMC calcification,
whereas OCAB-CM and EVs in OCAB-CM, but not the exosomes-
depleted OCAB-CM, remarkably enhanced the calcification of
VSMCs. These results suggest that B-EVs can be released from
the bone matrix during bone resorption to regulate BMSC
differentiation fate and VSMC calcification. The positive effects of
OCAB-CM and EVs in OCAB-CM on BMSC adipogenesis and
VSMC calcification, together with the similar action of AB-EVs
directly isolated from the aged bone matrix, prompt us to
investigate whether AB-EVs are involved in the induction of bone
marrow adiposity and calcification paradox in vivo.
AB-EVs promote bone-fat imbalance in young and aged mice.
We next asked whether the intramedullary injection of AB-EVs
one time per two weeks for one month could induce bone loss
and marrow fat accumulation in young (3-month-old) mice and
aggravate bone-fat imbalance in aged (15-month-old) mice
(Fig. 3a). The effects of YB-EVs on bone were also assessed.
Considering animal samples are easily attainable than human
specimens and a larger quantity of B-EVs can be obtained from
rat bone than that from an equal number of mouse bone, AB-EVs
and YB-EVs were respectively isolated from bone specimens from
18-month-old and 2-month-old SD rats. The aged donor rats
exhibited much higher serum levels of blood urea nitrogen (BUN)
and creatinine (CREA) compared with the young donor rats
(Supplementary Fig. 3a, b), indicating that aging induced the
reduction of kidney function in the rats. Similar to that from
human bones, the rats-derived AB-EVs also significantly

4 NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications

NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x ARTICLE

a Solvent YB-EVs AB-EVs b

<0.0001
100

ARS+ Area (%)

<0.0001
80 Solvent
ARS

60 YB-EVs
40 AB-EVs
20
0

<0.0001
80

ORO+ Area (%)

<0.0001
60
ORO

40
20
0

c d <0.0001 e 2.5 0.0121

2.0 0.0148
100

Relative SM22α
ARS+ Area (%)

Relative αSMA
mRNA level
0.0188

mRNA level
<0.0001
80 2.0 1.5
0.0141

60 1.5
ARS

1.0
40 1.0
20 0.5 0.5
0 0.0 0.0

f 0.0006 g h i
<0.0001 <0.0001 <0.0001
<0.0001 <0.0001 Solvent
4 80 80 80
Relative COL1A1

4 1500

ORO+ Area (%)

Relative RUNX2

ARS+ Area (%)

ARS+ Area (%)

0.0015
ALP activity per

<0.0001 <0.0001 <0.0001

gram protein
mRNA level

mRNA level

<0.0001 <0.0001 YB-OCY-EVs

3 3 60 60 60
1000 AB-OCY-EVs
2 2 40 40 40
1 500 20 20 20
1
0 0 0 0 0 0

j OC-CM OCYB-CM EVs in OCYB-CM OCAB-CM EVs in OCAB-CM EVs-depleted OCAB-CM k <0.0001
100

ARS+ Area (%)

<0.0001
80
60
ARS

40
20
1 2 3 4 5 6 0
1 2 3 4 5 6
0.0037
80

ORO+ Area (%)

<0.0001

60 <0.0001 0.0001
ORO

40
20
1 2 3 4 5 6 0
1 2 3 4 5 6

l m 60 <0.0001

ARS+ Area (%)

<0.0001 <0.0001

40
ARS

20

1 2 3 4 5 6 0
1 2 3 4 5 6

Fig. 2 AB-EVs favor adipogenesis rather than osteogenesis of BMSCs and augment osteogenic transdifferentiation of VSMCs. a,b, ARS or ORO
staining of BMSCs treated with solvent, YB-EVs, or AB-EVs under osteogenic or adipogenic induction (a) and quantification of the percentages of ARS+
(red) and ORO+ (red) areas (b). Scale bar: 50 μm. n = 6 biologically independent cells per group. c–g, ARS staining (c), quantification of the percentage of
ARS+ areas (red; d), qRT-PCR analysis of SM22α and αSMA (e), RUNX2 and COL1A1 (f) expression, and ALP activity (g) in VSMCs treated with solvent,
YB-EVs, or AB-EVs under osteogenic induction. Scale bar: 50 μm. n = 6 biologically independent cells per group. h Quantification of the percentages of
ARS+ and ORO+ areas in BMSCs treated with solvent, YB-OCY-EVs, or AB-OCY-EVs under osteogenic or adipogenic induction. n = 3 biologically
independent cells per group. i Quantification of the percentages of ARS+ areas in VSMCs treated with solvent, YB-OCY-EVs, or AB-OCY-EVs under
osteogenic induction. n = 3 biologically independent cells per group. j–k, ARS and ORO staining (j) and quantification of the percentages of ARS+ (red) and
ORO+ (red) areas (k) in BMSCs with different treatments under osteogenic or adipogenic induction. OC: osteoclasts; CM: conditioned media. Scale bar:
50 μm. n = 6 biologically independent cells per group. l–m, ARS staining (l) and quantification of the percentage of ARS+ areas (red; m) in VSMCs with
different treatments under osteogenic induction. Scale bar: 50 μm. n = 6 biologically independent per group. Experiments in a–d and h–m were repeated
independently three times with similar results. The illustrated results represented one of the three independent experiments. Experiments in e–g were
performed with six biological replicates per group without independent repetition. Data were presented as mean ± SD. Statistical significance was
determined by one-way ANOVA with Bonferroni post hoc test. Source data are provided as a Source Data file.

stimulated adipogenesis rather than osteogenesis of BMSCs and bone mass phenotypes compared with the other two age-matched
increased VSMC mineralization, while YB-EVs from rats mark- groups, as revealed by the microcomputed tomography (μCT)-
edly enhanced calcium nodule formation of BMSCs and had no reconstructed images of femurs, the much lower trabecular bone
distinct effect on BMSC adipogenesis and VSMC calcification, as volume fraction (Tb. BV/TV), trabecular number (Tb. N), or/and
indicated by ARS and ORO staining of the differentiated BMSCs trabecular thickness (Tb. Th), as well as the higher trabecular
(Supplementary Fig. 3c, d) and ARS staining of the differentiated separation (Tb. Sp). In contrast, YB-EVs remarkably enhanced
VSMCs (Supplementary Fig. 3e, f). As shown in Fig. 3b, c, the Tb. BV/TV and Tb. Th in young mice, and markedly increased
AB-EVs-treated young and aged mice had the lowest trabecular Tb. Th and decreased Tb. Sp in aged mice (Fig. 3b, c). Both YB-

NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications 5

ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x

a EVs EVs Sacrificed

200 μg per time
Intramedullary injection
Week 1 Week 2 Week 3 Week 4 End

b Solvent YB-EVs AB-EVs c

0.0406
Young mice 0.0123 0.0066 0.0385
<0.0001
40 3 100 400 Solvent

Tb. BV/TV (%)

<0.0001 <0.0001 0.0004

Tb. N (mm-1)

Tb. Sp (μm)
Tb. Th (μm)
30 80 0.0381
300
0.0271 2 YB-EVs
60
20 200 AB-EVs
1 40
10 20 100
0 0 0 0
Aged mice

20 3 80 400 0.0250 0.0002

Tb. BV/TV (%)

0.0433 0.0388 0.0245 0.0018

Tb. N (mm-1)

Tb. Th (μm)

Tb. Sp (μm)
15 0.0001 60 300
0.0001 2
10 40 200
1 20
5 100
0 0 0 0

0.0003
d 0.0411 e Solvent YB-EVs AB-EVs f
30 6 0.0059
2.0
Ultimate load (N)

0.0004

(μm3/μm2 year)

MAR (μm/day)
0.0137 0.0002
Young mice

1.5

BFR/BS
20 4
Calcein

1.0
10 2
0.5
0 0 0.0
0.0037
0.0003
30 4
Ultimate load (N)

2.0 <0.0001

(μm3/μm2 year)

MAR (μm/day)
0.0328 0.0093
Aged mice

3 1.5
Calcein

BFR/BS
20 0.0292
2 1.0
10
1 0.5
0 0 0.0

g Solvent YB-EVs AB-EVs h i 0.0003

<0.0001 <0.0001
200 6

Relative Pparγ
Young mice

mRNA Level
<0.0001
N. AdCs/Ar
(per mm2)

150 0.0441
4
PLIN

100
50 2

0 0
0.0012
<0.0001
<0.0001
300 <0.0001 3
Relative Pparγ
Aged mice

mRNA Level
N. AdCs/Ar

0.0128
(per mm2)

200 2
PLIN

100 1

0 0

j Solvent YB-EVs AB-EVs k 0.0259 l <0.0001

50 <0.0001 150 0.0024

OCN (ng mL–1)
in Young mice
N. OBs/BS

40
Young mice

0.0072
(mm–1)

30 100
OCN

20 50
10
0 0
0.0416
0.0011
20 <0.0001 40
OCN (ng mL–1)
in Aged mice
Aged mice

0.0036
N. OBs/BS

15 30
(mm–1)
OCN

10 20
5 10
0 0

EVs and AB-EVs did not cause statistically significant differences of this parameter in young and aged mice, respectively (Fig. 3d),
of cortical bone area fraction (Ct. Ar/Tt. Ar) and cortical thick- indicating the potential positive effect of YB-EVs and definite
ness (Ct. Th) in young and aged mice (Supplementary Fig. 4a, b). negative effect of AB-EVs on bone strength.
Three-point bending test revealed that YB-EVs induced a trend of Calcein double-labeling showed that YB-EVs treatment
increase of femur ultimate load value in both young and aged induced much higher levels of bone formation rate per bone
mice, whereas AB-EVs caused a significant and tend of decrease surface (BFR/BS) and mineral apposition rate (MAR) values in

6 NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications

NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x ARTICLE

Fig. 3 AB-EVs promote bone-fat imbalance in young and aged mice. a Schematic diagram of the experimental design for assessing the effects of YB-EVs
and AB-EVs on bone phenotypes in young and aged mice. b μCT-reconstructed images of femurs. Scale bars: 1 mm. c Quantification of Tb. BV/TV, Tb. N,
Tb. Th, and Tb. Sp. n = 10 biologically independent animals per group. d Ultimate load values of femurs. n = 10 biologically independent animals for young
mice. n = 6 biologically independent animals for aged mice. e–f, Calcein (green) double labeling of trabecular bones (e) and quantification of BFR/BS and
MAR (f). Scale bar: 25 μm. n = 5 biologically independent animals per group. g–h, PLIN immunofluorescence staining images of femur sections (g) and
quantification of the number of PLIN+ (red) adipocytes in bone marrow (h). Scale bar: 100 μm. n = 6 biologically independent animals per group. i qRT-
PCR for Pparγ expression in femurs. n = 9 biologically independent animals per group. j–k, OCN immunohistochemical staining images (j) and the number
of OCN-stained (brown) osteoblasts (N. OBs) on the trabecular bone surface (BS) (k). Scale bar: 50 μm. n = 6 biologically independent animals per group.
l ELISA for serum OCN. n = 10 biologically independent animals per group. All experiments were performed with at least five biological replicates per group
without independent repetition. Data were presented as mean ± SD. Statistical significance was determined by one-way ANOVA with Bonferroni post hoc
test. Source data are provided as a Source Data file.

both young and aged mice, whereas the AB-EVs-treated young
and aged mice exhibited trend of or significant lower levels of
these indicators compared with the age-matched mice treated
with solvent or YB-EVs (Fig. 3e, f). Immunofluorescence staining
for perilipin (PLIN) demonstrated that only a small number of
adipocytes were observed in the bone marrow of the solvent-
treated young mice, while marrow adipocytes accumulated in the
aged solvent-treated mice (Fig. 3g, h). Treatment with AB-EVs,
but not YB-EVs, significantly increased the number of adipocytes
in the bone marrow of young and aged mice (Fig. 3g, h),
consistent with the pro-adipogenic effect of AB-EVs on BMSCs.
In aged mice, YB-EVs induced a trend of decrease in marrow
adipocyte number (Fig. 3g, h), which may be due to that YB-EVs
favor osteogenesis rather than adipogenesis of BMSCs. qRT-PCR
analysis for the gene expression of adipogenic transcription factor
Pparγ demonstrated the remarkable stimulatory effect of AB-EVs
and the significant inhibitory effect of YB-EVs on adipogenesis
(Fig. 3i).
Immunohistochemical staining for osteocalcin (OCN) revealed
that YB-EVs significantly enhanced osteoblast number on
trabecular bones of both young and aged mice (Fig. 3j, k). In
contrast, AB-EVs caused a marked decrease in osteoblast number
compared with the solvent-treated group (Fig. 3j, k), even if AB-
EVs did not show any negative effect on osteogenic differentia-
tion of BMSCs in vitro. This may be attributable to the
augmentation of BMSC adipogenesis at the expense of osteogen-
esis after AB-EVs treatment. Enzyme-linked immunosorbent
assay (ELISA) for serum OCN further confirmed the remarkable
positive effect of YB-EVs on osteogenic activity, whereas the AB-
EVs-treated young and mice showed a trend of decrease in serum
OCN compared with the solvent-treated control mice (Fig. 3l).
These findings indicate that B-EVs contribute to the bone
formation during the growth period, but facilitate bone
marrow fat accumulation rather than bone formation during
skeletal aging.
Tartrate-resistant acid phosphatase (TRAP) staining (Supple-
mentary Fig. 4c, d) and ELISA for the bone resorption marker
C-terminal telopeptides of type I collagen (CTX-I) in serum
(Supplementary Fig. 4e) indicated that neither AB-EVs nor YB-
EVs notably affected osteoclast formation and activity in both
young and aged mice. Consistently, the result in vitro also
demonstrated that both AB-EVs and YB-EVs did not trigger
marked effects on osteoclast formation of RAW264.7 cells
(Supplementary Fig. 4f, g).
The spleen samples from the above-described young mice
receiving solvent, YB-EVs, or AB-EVs treatment were obtained
and photographed. As shown in Supplementary Fig. 5a, b, the
YB-EVs- or AB-EVs-treated mice showed comparable spleen
sizes and weights compared to the solvent-treated control mice.
Hematoxylin and eosin (H&E) staining revealed that treatment
with YB-EVs or AB-EVs did not induce obvious histopathological
changes such as inflammatory cell infiltration and lymph node
hyperplasia in the mouse spleen tissues (Supplementary Fig. 5c).
There were also no significant differences in the percentages of
lymphocytes and neutrophils in white blood cells among the
solvent-, YB-EVs-, or AB-EVs-treated mice (Supplementary
Fig. 5d). Together, these findings indicate that the rats-derived
YB-EVs and AB-EVs do not induce notable immune and
inflammatory responses in mice after intravenous injection.
AB-EVs exacerbate VD3-induced vascular calcification. We
then established experimental models with acute vascular calci-
fication in 3-month-old mice by intraperitoneal injection with
VD3 for continuous four days31,32 and compared the effects of
AB-EVs and YB-EVs on vascular calcification after two times
intravenous injections on days 1 and 3 during the period of VD3
treatment (Fig. 4a). qRT-PCR analysis revealed that treatment
with AB-EVs, but not YB-EVs, induced prominent reductions of
mRNA levels of SMC markers including Sm22α and αSma in
abdominal aortas of these mice (Fig. 4b), indicating the loss of
vascular smooth muscle phenotype after AB-EVs administration.
Von Kossa and ARS staining showed the presence of small Von
Kossa- or ARS-stained areas in abdominal aortas of the mice
treated with solvent or YB-EVs, whereas the aortas from the AB-
EVs-treated mice had large calcium deposition lesion areas
stained with high intensity of Von Kossa or ARS dye (Fig. 4c–e).
The significant increase of calcium deposition in abdominal
aortas of the AB-EVs-treated mice was further confirmed by
vascular calcium content analysis (Fig. 4f). Immunofluorescence
staining for the osteogenic factor RUNX2 and qRT-PCR analysis
for the osteogenic marker Alpl revealed that the mice treated with
AB-EVs, but not YB-EVs, displayed markedly increased levels of
RUNX2 protein and Alpl mRNA in abdominal aortas than that
treated with solvent (Fig. 4g–i), indicating that AB-EVs induce
the transition of the cells within the vessels into an osteogenic
phenotype.
We also established chronic vascular calcification experiment
models in 3-month-old female mice by freely feeding the mice
with diet containing 0.25% adenine for 4 weeks33,34 and explored
the effects of AB-EVs and YB-EVs on vascular calcification after
intravenous injection at the first day of weeks 1 and 3 during the
feeding period (Fig. 4j). Consistent with that observed in the
mouse models of VD3-induced acute vascular calcification,
treatment with AB-EVs, but not YB-EVs, resulted in significantly
decreased mRNA levels of Sm22α and αSma (Fig. 4k), as well as
profoundly increased calcium deposition lesion areas (Fig. 4l–n),
vascular calcium content (Fig. 4o), RUNX2 protein expression
(Fig. 4p, q), and Alpl gene expression (Fig. 4r) in abdominal
aortas of the mice with adenine-induced chronic vascular
calcification, which further demonstrate the positive role of AB-
EVs on vascular calcification.
We then assessed the circulating levels of calcium ions and
inorganic phosphate in the VD3-induced acute vascular calcifica-
tion and adenine-induced chronic vascular calcification mouse

NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications 7

ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x

a EVs EVs Sacrificed b

200 μg per time 2.5 2.0 <0.0001

Relative Sm22α
<0.0001

Relative αSma
Intravenous injection

mRNA level
mRNA level
2.0 0.0003 1.5 <0.0001 Solvent
1.5 YB-EVs
1.0
D1 D2 D3 D 4 Intraperitoneal injection D 11 1.0 AB-EVs
VD3 VD3 VD3 VD3 500 U per gram 0.5 0.5
0.0 0.0
c Solvent YB-EVs AB-EVs
Von Kossa

d e <0.0001 f
<0.0001

Von Kossa+ area (%)

<0.0001
40 40 <0.0001 4

(mmol/g protein)
<0.0001

ARS+ area (%)

<0.0001
30 30 3

Calcium
20 20 2
10 10 1
ARS

0 0 0

g Solvent YB-EVs AB-EVs h i 0.0071

RUNX2+ area (%)

<0.0001
30 6 0.0007
RUNX2 DAPI

Relative Alpl
mRNA level
<0.0001
20 4

10 2

0 0

j 200 μg per time intravenous injection k <0.0001

2.5 2.0
Relative Sm22α
<0.0001

Relative αSma
EVs EVs Sacrificed <0.0001

mRNA level
mRNA level
2.0 1.5 <0.0001
1.5
1.0
1.0
Week 1 Week 2 Week 3 Week 4 End 0.5 0.5
Adenine containing diet 0.0 0.0

l Solvent YB-EVs AB-EVs m n o

Von Kossa+ area (%)

20 20 0.0003 1.0 <0.0001

(mmol/g protein)
<0.0001 ARS+ area (%)
0.0001 0.8 <0.0001
15
Von Kossa

15 <0.0001

Calcium
0.6
10 10
0.4
5 5 0.2
0 0 0.0

p Solvent YB-EVs AB-EVs q r 0.0001

RUNX2+ area (%)

<0.0001
15 5 0.0054
RUNX2 DAPI

Relative Alpl

<0.0001
mRNA level

4
10 3
5 2
1
0 0

s t u v
Solvent 8 h AB-EVs 8 h AB-EVs 24 h
Von Kossa+ area (%)

0.0002 0.0085
Solvent 15 1.0
(mmol/g protein)

CB BM CB BM CB BM
0.8
Calcium

10
Bone

0.6
5 0.4
Von Kossa

0.2
0 0.0
s
s

AB-EVs
AB t
AB t

-EV
-EV

n
n

lve
lve

So
So
Vessel

models receiving different treatments. The results showed that
YB-EVs induced a significant increase of serum calcium ion in
the mice with VD3-induced acute vascular calcification and a
trend of increase of serum inorganic phosphate in both the acute
and chronic mouse models of vascular calcification (Supplemen-
tary Fig. 6a, b). However, treatment with AB-EVs resulted in
marked increases of both serum calcium ions and inorganic
phosphate in these two models of vascular calcification, and the
effects were much higher than that of YB-EVs (Supplementary
Fig. 6a, b). The levels of calcium and phosphorus in AB-EVs and
B-Exo were also tested. The results revealed that both calcium and
phosphorus could be detected in AB-EVs and YB-EVs, but the

8 NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications

NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x ARTICLE

Fig. 4 AB-EVs exacerbate vascular calcification. a Experimental design of the VD3-induced acute vascular calcification mouse models treated with
solvent, YB-EVs, or AB-EVs by intravenous injection. b qRT-PCR analysis of Sm22α and αSma expression in abdominal aortas of mice in (a). n = 9
biologically independent animals per group. c–e, Von Kossa and ARS staining images (c) and quantification of the percentages of Von Kossa+ (brownish
black; d) and ARS+ (red; e) areas. Scale bar: 200 μm. n = 10 biologically independent animals per group. f Vascular calcium content measurement. n = 10
biologically independent animals per group. g–h, RUNX2 immunofluorescence staining images (g) and quantification of the percentage of RUNX2+ (red)
areas (h). Scale bar: 200 μm. n = 10 biologically independent animals per group. i qRT-PCR analysis of Alpl expression. n = 9 per group. j Experimental
design of the adenine-induced chronic vascular calcification mouse models treated with solvent, YB-EVs, or AB-EVs by intravenous injection. k qRT-PCR
analysis of Sm22α and αSma expression in abdominal aortas of mice in (j). n = 9 biologically independent animals per group. l–n Von Kossa staining images
(l) and quantification of the percentages of Von Kossa+ (brownish black; m) and ARS+ (red; n) areas. Scale bar: 200 μm. n = 10 biologically independent
animals per group. o Vascular calcium content measurement. n = 10 biologically independent animals per group. p-q, RUNX2 immunofluorescence staining
images (p) and quantification of the percentage of RUNX2+ (red) areas (q). Scale bar: 200 μm. n = 10 biologically independent animals per group. r qRT-
PCR for Alpl expression. n = 9 biologically independent animals per group. s Fluorescence microscopy analysis of femur and abdominal aorta sections from
mice treated with solvent or DiO (green)-labeled AB-EVs by intramedullary injection. CB: cortical bone; BM: bone marrow. Scale bar: 200 μm (for bone) or
50 μm (for vessel). n = 3 biologically independent animals per group. t–v, Von Kossa staining images (t), quantification of the percentage of Von Kossa+
areas (brownish black; u), and vascular calcium content measurement (v) in abdominal aortas from the VD3-induced acute vascular calcification mouse
models receiving solvent or AB-EVs treatment by intramedullary injection. Scale bar: 200 μm. n = 5 biologically independent animals per group.
Experiment in s was repeated independently three times with similar results. The illustrated results represented one of the three independent experiments.
The other experiments were performed with at least five biological replicates per group without independent repetition. Data were presented as mean ±
SD. Statistical significance was determined by one-way ANOVA with Bonferroni post hoc test (a–t) or unpaired, two-tailed Student’s t-test (u–v). Source
data are provided as a Source Data file.

level of calcium in AB-EVs was much higher than that in YB-EVs
(Supplementary Fig. 6c). Thus, the delivery of abundant calcium
to blood and the increase of blood phosphorus may also
contribute to the positive effect of AB-EVs on vascular
calcification.
To simulate the transport of AB-EVs from bone to blood
vessels in vivo, AB-EVs were labeled with a green fluorescent dye
DiO and administered into mice by intramedullary injection. As
shown in Fig. 4s, a lot of green dot-like signals were detected in
bone marrow at 8 h after AB-EVs injection and the signals were
decreased after injection of AB-EVs for 24 h. In the vessel wall of
the abdominal aorta, only a small amount of green fluorescence
was observed at 8 h after AB-EVs treatment and the signals were
increased at 24 h after AB-EVs injection (Fig. 4s), suggesting that
AB-EVs located in the bone can be transported to the blood vessel
wall. Subsequently, we assessed whether a single intramedullary
injection of AB-EVs could exacerbate VD3-induced vascular
calcification in 3-month-old mice (Supplementary Fig. 7a). As
evidenced by Von Kossa and ARS staining, vascular calcium
content analysis, and immunohistochemical staining for RUNX2,
respectively, the ratios of calcium deposition lesion areas (Figs. 4t,
u and S7b), vascular calcium content (Fig. 4v), and RUNX2
expression (Supplementary Fig. 7c, d) in the vessel wall of the
abdominal aortas were significantly higher in the AB-EVs-treated
mice than that in the solvent group. Together, these findings
indicate that AB-EVs have the ability to accumulate into the
vessel wall to promote vascular calcification.
ALE downregulates AB-EVs release and attenuates bone-fat
imbalance and VD3-induced vascular calcification in aged
OVX mice. To investigate whether the bone resorption inhibitor
ALE could inhibit the release of AB-EVs from aged bone, ALE or
solvent was added to the cultures of osteoclasts with or without
bone slices from an aged volunteer (AB). The CM from osteo-
clasts treated with solvent (OC-CM), ALE (OCALE-CM), AB
(OCAB-CM), or AB + ALE (OCAB+ALE-CM) were collected to
assess the changes of contents of EVs and the effects of these CM
on osteogenesis and adipogenesis of BMSCs and calcification of
VSMCs. As the concentration of EV proteins is widely used as an
indicator of the quantity of EVs35–37, the contents of EV proteins
in these CM were compared. As shown in Fig. 5a, ALE did not
significantly affect the production of EVs in osteoclasts cultured
without aged bone slices, but notably reduced the concentration
of EVs in the culture supernatant of osteoclasts in the presence of
aged bone slices, as indicated by the comparable levels of EV
proteins between OC-CM and OCALE-CM groups, and the much
lower levels of EV proteins in OCAB+ALE-CM group compared
with OCAB-CM group. This suggests that ALE can successfully
inhibit AB-EVs release from the bone matrix during osteoclastic
bone resorption. The quantitative data for ARS and ORO staining
of the differentiated BMSCs (Fig. 5b, c) and ARS staining of the
differentiated VSMCs (Fig. 5d) revealed that OCALE-CM did not
induce significant changes in osteogenic and adipogenic differ-
entiation of BMSCs and calcification of VSMCs relative to OC-
CM. However, OCAB+ALE-CM lost the ability to augment BMSC
adipogenesis and VSMC calcification when compared with
OCAB-CM (Fig. 5b–d), suggesting that ALE blocks the release of
AB-EVs from the bone matrix during bone resorption and
thereby leads to the decreased ability of OCAB-CM to stimulate
adipogenesis of BMSCs and calcification of VSMCs.
The animals subjected to ovariectomy have been widely used as
experimental models of postmenopausal osteoporosis and studies
have shown the markedly increased bone resorption activity in OVX
model1,38. Thus, we established OVX models in 16-month-old
female mice and tested whether the intragastric administration of
ALE once a week for three times could attenuate bone-fat imbalance
in these aged OVX mice (Supplementary Fig. 8a). The much lower
uterus weights in all OVX mice relative to all sham-operated mice
confirmed the success of the operation (Supplementary Fig. 8b). ALE
did not markedly affect uterus weights in OVX mice (Supplementary
Fig. 8b), which excluded the regulatory effect of ALE on estrogen
production. μCT-reconstructed images of femur samples and
quantitative trabecular bone microstructural parameters revealed
that ALE caused a trend of increase in trabecular bone mass in Sham
mice and profoundly reversed the OVX-induced reduction of
trabecular bone mass in OVX mice (Fig. 5e, f). Treatment with
ALE did not induce any notable effects on cortical bone parameters
including Ct. Ar/Tt. Ar and Ct. Th in both Sham and OVX mice
(Supplementary Fig. 8c). The profound inhibitory effects of ALE on
osteoclast formation and activity were confirmed by TRAP staining
of femur sections (Supplementary Fig. 8d, e) and ELISA for serum
CTX-I (Supplementary Fig. 8f), respectively. Immunofluorescence
staining for PLIN and qRT-PCR analysis for Pparγ indicated that
ALE induced trend of decreases of bone marrow adipocyte number
and Pparγ expression in Sham mice (Fig. 5g, i). In OVX mice, ALE
did not cause a statistically significant reduction of Pparγ expression,

NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications 9

ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x

a 1.0 b 20 c 40 d 30

ORO+ Area (%)

ARS+ Area (%)

ARS+ Area (%)
<0.0001 <0.0001 <0.0001 0.0008 <0.0001 <0.0001
OC-CM
EVs proteins 0.8 15 30
(μg μL–1) 0.6 20 OCALE-CM
10 20
0.4 10 OCAB-CM
0.2 5 10
OCAB+ALE-CM
0.0 0 0 0

e SHAM OVX
Solvent ALE Solvent ALE f
<0.0001
<0.0001 <0.0001
5 <0.0001 0.0002 0.10 0.0015 0.0484 80 0.0142 0.0058 500 SHAM+Solvent

Tb. BV/TV (%)

micro-CT

Tb. N (mm–1)

Tb. Th (μm)

Tb. Sp (μm)
4 0．08 60 400
0.06 SHAM+ALE
3 300
40
2 0.04 200 OVX+Solvent
1 0.02 20 100 OVX+ALE
0 0.00 0 0

g SHAM OVX h i
Solvent ALE Solvent ALE <0.0001 0.0001
250 2.5

Relative Pparγ
mRNA Level
2.0

N. AdCs/Ar
200

(per mm2)
150 1.5
PLIN

100 1.0
50 0.5
0 0.0

j SHAM OVX k l
Solvent ALE Solvent ALE

N. OBs/BS (mm )
20

–1
10

OCN (ng mL–1)

8 15
6
OCN

10
4
2 5
0 0

m SHAM OVX n o
Solvent ALE Solvent ALE <0.0001 <0.0001
15 0.0019 0.0104
3

(mmol/g protein)
ARS+ area (%)

Calcium
10 2
ARS

5 1

0 0

p SHAM OVX q r
RUNX2+ area (%)

Solvent ALE Solvent ALE 40 <0.0001 <0.0001

Relative Alpl 4 0.0029 0.0011
mRNA level
30 3
RUNX2 DAPI

20 2
10 1
0 0

Fig. 5 ALE down-regulates AB-EVs release and attenuates bone-fat imbalance and VD3-induced vascular calcification in aged OVX mice. a Total
protein contents of EVs isolated from the conditioned media of osteoclasts treated with solvent (OC-CM), ALE (OCALE-CM), AB (OCAB-CM), or AB + ALE
(OCAB+ALE-CM). n = 5 biologically independent samples per group. b–d, Quantification of the percentages of ARS+ (b) and ORO+ (c) areas in BMSCs with
different treatments under osteogenic or adipogenic induction, or ARS+ areas (d) in VSMCs with different treatments under osteogenic induction. n = 5
biologically independent cells per group. e–f μCT-reconstructed images of femurs from 16-month-old Sham or OVX mice in different groups (e) and
quantification of Tb. BV/TV, Tb. N, Tb. Th, and Tb. Sp (f). Scale bars: 1 mm. n = 5 biologically independent animals per group. g–h PLIN immunofluorescence
staining images of femur sections (g) and quantification of the number of PLIN+ (red) adipocytes in bone marrow (h). Scale bar: 100 μm. n = 5 biologically
independent animals per group. i qRT-PCR for Pparγ expression in femurs. n = 5 biologically independent animals per group. j–l OCN immunostaining images
(j), quantification of the number of OCN-stained (brown) osteoblasts on BS (k), and ELISA for OCN (l). Scale bar: 50 μm. n = 5 biologically independent
animals per group. m–n ARS staining images (m) and quantification of the percentage of ARS+ areas (red; n). Scale bar: 200 μm. n = 5 biologically
independent animals per group. o Vascular calcium content measurement. n = 5 biologically independent animals per group. p–q, RUNX2 immunostaining
images (p) and quantification of the percentage of RUNX2+ (red) areas (q). Scale bar: 200 μm. n = 5 biologically independent animals per group. r qRT-PCR
for Alpl expression. n = 5 biologically independent animals per group. Experiments in b–d were repeated independently three times with similar results. The
illustrated results represented one of the three independent experiments. The other experiments were performed with at least five biological replicates per
group without independent repetition. Data were presented as mean ± SD. Statistical significance was determined by two-way ANOVA with Bonferroni post
hoc test. Source data are provided as a Source Data file.

10 NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications

NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x
but significantly blocked the OVX-induced increase of marrow
adipocytes (Fig. 5g, i). Although ALE showed a direct inhibitory effect
on adipocyte differentiation of BMSCs (Supplementary Fig. 9a, b),
the higher sensitivity of OVX mice than Sham mice to the
antiadipogenic effect of ALE suggests that the inhibition of bone
resorption may also contribute to the ALE-induced decrease of
marrow adiposity. ALE did not notably affect osteogenic differentia-
tion of BMSCs in vitro (Supplementary Fig. 9c, d). Consistently, the
ALE-treated Sham and OVX mice showed no significant changes in
osteoblast number and activity compared with the solvent-treated
Sham and OVX mice, respectively, as shown by OCN immunostain-
ing of femur sections (Fig. 5j, k) and ELISA for serum OCN (Fig. 5l).
We then evaluated the impact of ALE on VD3-induced vascular
calcification in aged (16-month-old) Sham and OVX mice
(Supplementary Fig. 10a). All OVX mice had significant reduced
uterus weights compared with the solvent- or ALE-treated Sham
mice (Supplementary Fig. 10b). ARS staining of abdominal aorta
sections, vascular calcium content analysis, RUNX2 immunofluor-
escence staining, and qRT-PCR analysis for Alpl, respectively,
demonstrated that the solvent-treated aged OVX mice displayed
much higher ratios of calcium deposition areas (Fig. 5m, n), vascular
calcium content (Fig. 5o), and ectopic osteogenic activities (Fig. 5p–r)
in the vessel wall of the abdominal aortas than that in the solvent-
treated aged Sham mice after intraperitoneal injection of VD3.
However, OVX surgery did not exacerbate VD3-induced vascular
calcification in 3-month-old young mice, as indicated by vascular
calcium content analysis (Supplementary Fig. 11a) and ARS staining
(Supplementary Fig. 11b, c), which were consistent with the evidence
that YB-EVs released from young bone could not accelerate vascular
calcification. ALE not only dramatically abolished the increases of
calcium deposition areas, vascular calcium content, RUNX2 protein
expression, and Alpl mRNA levels in abdominal aortas of the VD3-
treated aged OVX mice, but also resulted in trends of decreases in
most of these parameters in the VD3-treated aged Sham mice
(Fig. 5m–r). Nevertheless, ALE at indicated gradient dosages did not
directly inhibit calcification of VSMCs in vitro (Supplementary
Fig. 12a, b), suggesting that the negative effect of ALE on vascular
calcification is mediated by an indirect mechanism.
OVX also induced remarkable increases in the levels of serum
calcium ions and inorganic phosphate in the mice subjected to
VD3 administration (Supplementary Fig. 13a, b). ALE did not
notably affect the levels of serum calcium ions and inorganic
phosphate in the VD3-treated aged Sham mice (Supplementary
Fig. 13a, b). In the VD3-treated aged OVX mice, ALE reduced the
circulating levels of these two parameters, but the differences did
not reach statistically significance (Supplementary Fig. 13a, b).
These results suggest that the reductions of serum calcium ions
and inorganic phosphate are not the primary mechanism that
contributes to the ALE-induced inhibition of vascular calcifica-
tion in the VD3-treated aged OVX mice.
Together, the above findings demonstrate the protective effects
of ALE against bone-fat imbalance and VD3-induced vascular
calcification in aged OVX mice, which may be associated with the
ALE-induced inhibition of osteoclastic bone resorption and
subsequent the reduction of AB-EVs release.
MiR-483-5p and miR-2861 are enriched in AB-EVs and
responsible for the AB-EVs-induced promotion of adipogen-
esis of BMSCs and calcification of VSMCs. To explore the
involvement of miRNAs in the AB-EVs-induced promotion of
adipocyte formation and vascular calcification, the Agilent
miRNA array was conducted to compare the miRNA expression
profiles in AB-EVs and YB-EVs from mouse bone specimens.
Totally, 1881 miRNAs were identified and 46 miRNAs were
differentially expressed (absolute fold change ≥1.5; P < 0.05) in
NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications
ARTICLE
AB-EVs and YB-EVs, among which 37 miRNAs were much
higher and 9 miRNAs were much lower in AB-EVs compared
with YB-EVs (Fig. 6a and Supplementary Data 1). Figure 6b
shows the top ten most abundant miRNAs in AB-EVs relative to
YB-EVs. miR-483-5p and miR-2861, which have been reported to
positively modulate adipogenesis39,40 and osteogenic transdiffer-
entiation of VSMCs, respectively41, were the most and second
most abundant miRNAs in AB-EVs compared with YB-EVs
(Fig. 6b), suggesting that these two miRNAs may be involved in
the AB-EVs-induced promotion of BMSC adipogenesis and
VSMC calcification.
The expression changes of miR-483-5p and miR-2861 were
assessed in B-EVs from bone specimens of the mice at different
ages (2-, 12-, and 18-month-old) by qRT-PCR. As shown in
Fig. 6c, both miR-483-5p and miR-2861 showed an age-
dependent increase of expression in B-EVs. Among different
tissues, the bones (femurs and tibias) from 18-month-old aged
mice showed the highest extent of up-regulation of these two
miRNAs compared with that from 2-month-old young mice
(Fig. 6d). The significantly increased expression of these two
miRNAs was also observed in vessels (abdominal aortas) and liver
tissues from 18-month-old aged mice than that from 2-month-
old young mice, but other tissues, including spleen, lungs,
kidneys, brain, heart, and muscles did not show significant
increases in the levels of miR-483-5p and miR-2861 with aging
(Fig. 6d). The enrichment of these two miRNAs was further
demonstrated in serum EVs (Ser-EVs) from old people (67- to
73-year-old) compared with those from 27- to 31-year-old young
people (Fig. 6e). The liver tissues-derived EVs (Liver-EVs) and
Ser-EVs from 18-month-old aged mice (A-Liver-EVs and A-Ser-
EVs) also had higher levels of these two miRNAs than those from
2-month-old young mice (Y-Liver-EVs and Y-Ser-EVs), but the
extents of up-regulation were higher in A-Ser-EVs than that in A-
Liver-EVs (Supplementary Fig. 14a). qRT-PCR analysis revealed
that EVs isolated from OCAB-CM also exhibited much higher
levels of miR-483-5p and miR-2861 compared to EVs from OC-
CM (Fig. 6f). These data suggest that aging induces the
accumulation of miR-483-5p and miR-2861 in B-EVs and
Liver-EVs, which are respectively released from bone matrix
and liver tissues into circulation and then deposited in blood
vessels. ARS and ORO staining showed that both Y-Liver-EVs
and A-Liver-EVs did not induce remarkable effects on BMSC
differentiation and VSMC mineralization, whereas Y-Ser-EVs
induced a statistically significant increase of calcium nodule
formation of BMSCs and A-Ser-EVs markedly increased BMSC
adipogenesis and VSMC mineralization (Supplementary
Fig. 14b–e), indicating that Liver-EVs are not the main
contributor to the Ser-EVs-induced regulation of differentiation
of BMSCs and VSMCs.
We then used specific agomiRs or antagomiRs to overexpress or
silence miR-483-5p or miR-2861 in AB-EVs. Flow cytometry analysis
revealed that incubation with the agomiR-NC-Cy3 indicator for
30 min resulted in more than 90% of AB-EVs positive for Cy3
fluorescent signals, as compared with the solvent-treated AB-EVs
(Fig. 6g), suggesting that agomiRs or antagomiRs are able to enter
into AB-EVs. ORO staining and qRT-PCR analysis for Pparγ
revealed that the overexpression of miR-483-5p by agomiR-483-5p
further augmented the ability of AB-EVs to stimulate lipid droplet
formation and Pparγ expression of mouse BMSCs under adipogen-
esis, whereas the inhibition of this miRNA by antagomiR-483-5p
significantly suppressed the pro-adipogenic effects of AB-EVs
(Fig. 6h–j). ARS staining and qRT-PCR analysis for RUNX2 showed
that the agomiR-2861-pretreated AB-EVs induced a much higher
extent of mineralized nodule formation and a higher level of RUNX2
expression in human VSMCs compared with the agomiR-NC-
pretreated AB-EVs, but the antagomiR-2861-pre-treated AB-EVs
11
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x

a YB-EVs AB-EVs b 25 c <0.0001

expression level
<0.0001

miR-483-5p level
1 2 3 1 2 3 20 20 <0.0001 15

miR-2861 level
0.0003

Relative
15 15 0.0001

Relative

Relative
0.0220
10
10 10
5 5
5
0
0 0

m iR-2 p
m 711 1
m 189 p
01 p
iR p
iR 0
iR a
iR 68

8
-5 f
m 473
m 3-5

- 86

5
- 7 -5
m 1-5
m 396
m 451

12
iR 8-

m 63
iR 7

2M
M
M

2M
M
M
-3
8

-
-
-

12
18

12
18
-4

iR
iR

-
iR
m
d <0.0001
0.0004
10 15 Young mice

miR-483-5p level
0.0005 0.0154

miR-2861 level
10 Aged mice
8 0.0015
0.0135

Relative
Relative
6 5
4 1.5
1.0
2 0.5
0 0.0

Ve e

n
Kid g
y
ain

Mu rt
le
Sp e r
Ve e

n
Kid g
y
ain

Mu rt
le
Sp e r

el
el

ne
ne

lee
n
n

lee
n

a
a

sc
sc

ss
Liv
ss
Liv

Bo

Lu
Bo

Lu

He
He

Br
Br
–2 0 2
Relative miR-483-5p
Relative miR-483-5p

0.0013

Relative miR-2861
Relative miR-2861

0.0016 5 <0.0001 <0.0001

e 8 f 10 10 g 100
level in Ser-EVs
level in Ser-EVs

4 Negative
6 8 8 80 AgomiR 90.5%
3
level

level
6 60
4

%
2 4 4 40
2 1 2 2 20
0 0 0 0 0 3
–10 0 103 104 105
ng

ng

O -CM

O -CM
ed

ed

M
-C

Cy3

-C
u

u
Ag

Ag
Yo

Yo

B
C

C
CA

CA
O

O
h Control AB-EVs + AB-EVs + AB-EVs + AB-EVs + i
<0.0001
j
AgomiR-NC AgomiR-483-5p AntagomiR-NC AntagomiR-483-5p 0.0004
100 4

ORO+ Area (%)

<0.0001 0.0012 0.0020

Relative Pparγ
mRNA Level
80 <0.0001 <0.0001 3
60
ORO

2
40
20 1

1 2 3 4 5 0 0
1 2 3 4 5 1 2 3 4 5

k Control AB-EVs + AB-EVs + AB-EVs + AB-EVs + l m

AgomiR-NC AgomiR-2861 AntagomiR-NC AntagomiR-2861 <0.0001
0.0028
100 <0.0001 15

Relative RUNX2
ARS+ Area (%)
<0.0001

mRNA Level
80 <0.0001 <0.0001
10 0.0116
60
ARS

40 5
20
1 2 3 4 5 0 0
1 2 3 4 5 1 2 3 4 5

Fig. 6 miR-483-5p and miR-2861 are enriched in AB-EVs and responsible for the AB-EVs-induced promotion of adipogenesis of BMSCs and
calcification of VSMCs. a Heatmap showing the differentially expressed miRNAs (absolute fold change ≥ 1.5; P < 0.05) between AB-EVs and YB-EVs. n = 3
biologically independent samples per group. b Top ten most abundant miRNAs in AB-EVs relative to YB-EVs. n = 3 biologically independent samples per
group. c-f, qRT-PCR analysis of miR-483-5p and miR-2861 expression in B-EVs from bone specimens of the mice at different ages (c; n = 6 biologically
independent animals per group), in different tissues from 3-month-old or 18-month-old mice (d; n = 3 biologically independent animals per group), in Ser-EVs
from young (27- to 31-year-old) or old (67- to 73-year-old) human donors (e; n = 3 biologically independent donors per group), and in OC-CM and OCAB-CM
(f; n = 6 biologically independent samples per group). g, Flow cytometry histograms showing the presence of agomiR-NC-Cy3 indicator in AB-EVs. n = 3
biologically independent samples per group. h–j ORO staining images (h), quantification of the percentage of ORO+ areas (red; i), and qRT-PCR for Pparγ
expression (j) in BMSCs with different treatments under adipogenic induction. Scale bar: 50 μm. n = 6 biologically independent cells per group. k–m, ARS
staining images (k), quantification of the percentage of ARS+ areas (red; l), and qRT-PCR for RUNX2 expression (m) in VSMCs with different treatments
under osteogenic induction. Scale bar: 50 μm. n = 6 biologically independent cells per group. Experiments in a–g were performed with at least three biological
replicates per group without independent repetition. The other experiments were repeated independently three times with similar results. The illustrated
results represented one of the three independent experiments. Data were presented as mean ± SD. Statistical significance was determined by one-way
ANOVA with Bonferroni post hoc test (c, i–j, and i–m) or unpaired, two-tailed Student’s t-test (d–f). Source data are provided as a Source Data file.

failed to promote mineralization and RUNX2 expression of VSMCs one time every two weeks for one month. As expected, μCT
(Fig. 6k–m). These findings indicate that miR-483-5p and miR-2861, analysis revealed that the inhibition of miR-483-5p markedly
respectively, act as the mediator of the AB-EVs-induced promotion impaired the ability of AB-EVs to induce trabecular bone loss, as
of adipogenic differentiation of BMSCs and calcification of VSMCs. indicated by the much higher levels of Tb. BV/TV, Tb. N, and Tb.
Th, as well as the much lower level of Tb. Sp in antagomiR-483-
5p-pretreated AB-EVs group compared to antagomiR-NC-
MiR-483-5p and miR-2861 contribute to AB-EVs-induced pretreated AB-EVs group (Fig. 7a, b). No significant changes of
marrow adiposity and calcification paradox. We finally deter- Ct. Ar/Tt. Ar and Ct. Th were observed among the mice treated
mined whether miR-483-5p and miR-2861 were responsible for with solvent, antagomiR-NC-pretreated AB-EVs, or antagomiR-
AB-EVs-induced bone-fat imbalance and vascular calcification, 483-5p-pretreated AB-EVs (Supplementary Fig. 15a, b). Immu-
respectively. The 3-month-old young mice were administered nofluorescence staining for PLIN and qRT-PCR analysis for
with the antagomiR-483-5p- or antagomiR-NC-pre-treated AB- Pparγ showed profound increases of marrow adipocyte number
EVs or an equal volume of solvent by intramedullary injection and Pparγ expression in the bone tissues from mice treated

12 NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications

NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x ARTICLE

AB-EVs +
a AntagomiR-NC b
Solvent AB-EVs +
AntagomiR-483-5p
0.0124 0.0406 400
30 3 80 0.0057 0.0485
Solvent

Tb. BV/TV (%)

Tb. N (mm-1)

Tb. Sp (μm)
Tb. Th (μm)
0.0003 0.0140
60 300
micro-CT

20 0.0029 0.0491
2 AB-EVs+
40 200 AntagomiR-NC
10 1 20 100 AB-EVs+
0 0 0 0 AntagomiR-483-5p

Solvent AB-EVs + AB-EVs + d e <0.0001

c AntagomiR-NC AntagomiR-483-5p <0.0001
0.0001 3
150

Relative Pparγ
mRNA Level
<0.0001

N. AdCs/Ar
(per mm2)
100 2
PLIN

50 1

0 0

f Solvent AB-EVs + AB-EVs + g

AntagomiR-NC AntagomiR-483-5p

N. OBs/BS (mm–1)
40
30 0.0010 0.0072

20
OCN

10
0

h Solvent AB-EVs + AB-EVs + i Von Kossa+ area (%) j k

AntagomiR-NC AntagomiR-2861
40 40 0.0002 4 0.0013

(mmol/g protein)
<0.0001

ARS+ area (%)

<0.0001 <0.0001
30 <0.0001 30 3

Calcium
Von Kossa

20 20 2
10 10 1
0 0 0

l Solvent AB-EVs + AB-EVs + m <0.0001 n

AntagomiR-NC AntagomiR-2861
RUNX2+ area (%)

20 <0.0001 6 <0.0001 Solvent

Relative Alpl
mRNA level
RUNX2 DAPI

<0.0001
15 AB-EVs+
4
10 AntagomiR-NC
2
5 AB-EVs+
0 0 AntagomiR-2861

Fig. 7 miR-483-5p and miR-2861 contribute to AB-EVs-induced marrow adiposity and calcification paradox. a μCT-reconstructed images of femurs
from 3-month-old young mice treated with solvent or AB-EVs pre-treated with antagomiR-NC or antagomiR-483-5p. Scale bars: 1 mm. b Quantification of
Tb. BV/TV, Tb. N, Tb. Th, and Tb. Sp. n = 10 biologically independent animals per group. c–d PLIN immunofluorescence staining images (c) and
quantification of the number of PLIN+ (red) adipocytes in bone marrow (d). Scale bar: 100 μm. n = 8 biologically independent animals per group. e qRT-
PCR analysis of Pparγ expression. n = 9 biologically independent animals per group. f–g, OCN immunostaining images (f) and quantification of the number
of OCN+ (brown) osteoblasts on BS (g). Scale bar: 50 μm. n = 8 biologically independent animals per group. h–j Von Kossa staining images (h),
quantification of the percentage of Von Kossa+ (brownish black; i) and ARS+ (red; j) areas in abdominal aortas from the VD3-induced acute vascular
calcification mouse models receiving solvent or AB-EVs pretreated with antagomiR-NC or antagomiR-2861. Scale bar: 200 μm. n = 10 biologically
independent animals per group. k Vascular calcium content analysis. n = 10 biologically independent animals per group. l–m, RUNX2 immunostaining
images (l) and quantification of the percentage of RUNX2+ areas (red; m). Scale bar: 200 μm. n = 10 biologically independent animals per group. n, qRT-
PCR for Alpl expression. n = 9 biologically independent animals per group. All experiments were performed with at least eight biological replicates per
group without independent repetition. Data were presented as mean ± SD. Statistical significance was determined by one-way ANOVA with Bonferroni
post hoc test. Source data are provided as a Source Data file.

with the antagomiR-NC-pre-treated AB-EVs, but the antagomiR- miR-483-5p in AB-EVs-induced bone-fat imbalance. The role of
483-5p-pre-treated AB-EVs failed to stimulate the accumulation miR-2861 in the AB-EVs-induced promotion of vascular calcifi-
of marrow adipocytes and Pparγ expression (Fig. 7c, d). Immu- cation was assessed in 3-month-old mice subjected to VD3
nohistochemical staining for OCN indicated that the mice treated treatment. Von Kossa and ARS staining indicated that the inhi-
with the antagomiR-NC-pre-treated AB-EVs exhibited a sig- bition of miR-2861 in AB-EVs by antagomiR-2861 prominently
nificant reduction in osteoblast number, but the alteration did not reduced, but did not entirely block, the AB-EVs-induced
occur in the mice treated with the antagomiR-483-5p-pretreated increases of calcium deposition areas in the mouse abdominal
AB-EVs (Fig. 7f, g). These findings determine the essential role of aortas (Fig. 7h, j). Vascular calcium content analysis further

NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications 13

ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x

determined the markedly decreased ability of AB-EVs to increase
vascular calcium content after pre-treatment with antagomiR-
2861 (Fig. 7k). RUNX2 immunostaining and RT-PCR analysis for
Alpl revealed that the antagomiR-2861-pre-treated AB-EVs had a
profoundly reduced capacity to augment ectopic osteogenic
activities in the vessel wall of the abdominal aorta compared to
the antagomiR-NC-pretreated AB-EVs (Fig. 7l–n). Inhibition of
miR-2861 also significantly decreased, but did not entirely abol-
ish, the ability of AB-EVs to increase serum calcium ions and
inorganic phosphate in the mice with VD3-induced vascular
calcification, indicating that miR-2861 partially contributes to the
AB-EVs-induced increase of serum calcium ions and inorganic
phosphate (Supplementary Fig. 16a, b). These results indicate that
miR-2861 is a critical mediator of the AB-EVs-induced stimula-
tory effect on vascular calcification.
Collectively, the findings in our study suggest a new
mechanism underlying the age- and menopause-associated
calcification paradox (Fig. 8). With skeletal aging and menopause,
osteoclastic bone resorption activity is relatively or absolutely
increased. During bone resorption, AB-EVs secreted by osteo-
cytes are released from the bone matrix into bone marrow, where
AB-EVs deliver miR-483-5p to promote the expression of PPARγ
and the differentiation of BMSCs into adipocytes rather than
osteoblasts, thus leading to bone-fat imbalance and osteoporosis.
A portion of AB-EVs are transported into circulation and
deposited in blood vessels to stimulate RUNX2 expression and
osteogenic transdifferentiation of VSMCs via transferring miR-
2861, thereby causing vascular calcification.
Discussion
Aging and menopause are associated with high risks of both
osteoporosis and vascular calcification5–7. The calcification
paradox suggests a link between bone and vasculature and the
existence of possible mechanisms leading to the coincidence of
bone loss and vascular calcification during skeletal aging and
menopause. There have been substantial evidences that a bone-
vascular axis exists42–45. The relative or absolute increase of bone
resorption in the elderly or postmenopausal women facilitates the
mobilization of bone phosphorus and calcium into the blood,
thus leading to abnormal mineral deposition in blood vessels13.
Inflammation, oxidative stress and multiple biological factors
such as fibroblast growth factor 23 (FGF-23), osteoprotegerin
(OPG), osteopontin (OPN), fetuin-A, matrix Gla protein, and
circulating calcifying cells, also implicate causal connections
between bone metabolism and vascular calcification43,46. In this
study, we found that B-EVs, which were usually embedded in the
bone matrix, could be released during osteoclastic bone resorp-
tion and exert temporal-dependent regulatory effects on both
bone homeostasis and vascular calcification. B-EVs from young
bone (YB-EVs) were able to stimulate osteogenesis of BMSCs and
enhance bone formation. The aged bone-derived B-EVs (AB-
EVs), however, lost the ability to exert pro-osteogenic effect on
bone, but could favor adipogenesis of BMSCs and mineralization
of VSMCs in vitro and increase bone-fat imbalance as well as
VD3- or adenine-induced vascular calcification in vivo. Adequate
calcium and phosphorus supply is a prerequisite for both the
occurrence of bone mineralization and the development vascular
calcification7,13. Besides the direct stimulatory effect on VSMC
mineralization, we found that AB-EVs contained a higher level of
calcium compared with YB-EVs and could increase serum cal-
cium ions and inorganic phosphate in both the acute and chronic
mouse models of vascular calcification, suggesting that the direct
transport of large amounts of calcium to circulation and the
increase of phosphate in the blood may be another important
mechanism by which AB-EVs promote vascular calcification. Our
findings present an AB-EVs-mediated new mechanism of the
calcification paradox and further enrich the knowledge of the
bone-vascular axis.
Since their first discovery in growth plate cartilage, researchers
have found that the biological role of matrix vesicles is not
confined to acting as the sites for induction of mineral deposition,
but also involves the modulation of the biological activity of cells
within bone13. Nahar et al. have shown that matrix EVs isolated
from the 4-week-old rats-derived tibial and femoral growth plate
cartilages contain vascular endothelial growth factor (VEGF),
bone morphogenetic proteins (BMPs), OPN, OCN, osteonectin
(ON), and bone sialoprotein (BSP)47. Incubation with these
matrix EVs increases ALP activity in chondrocytes, suggesting a
positive role of cartilages-derived matrix EVs in chondro-osseous
differentiation47. A recent study by Minamizaki et al. has
reported that matrix EVs harvested from the extracellular matrix
deposited by the cultured mouse osteoblastic MC3T3-E1 cells can
inhibit osteoclast formation through the delivery of miR-125b48.
In this study, the periosteum- and bone marrow-depleted whole
bones, but not the growth plate cartilages only, the cultured
chondrocytes, or mineralizing osteoblasts, were used to isolate
matrix EVs by the collagenase II digestion method combined with
the use of OptiprepTM density gradient ultracentrifugation. The
morphology, diameter distribution, and surface marker expres-
sion profiles indicated the exosome identity of the isolated

Fig. 8 Schematic diagram showing the role of AB-EVs as a messenger for calcification paradox by favoring BMSC adipogenesis and VSMC calcification
via transferring miR-483-5p and miR-2861. During bone resorption, AB-EVs secreted by osteocytes are released from bone matrix into bone marrow,
where AB-EVs promote PPARγ expression and adipogenic differentiation of BMSCs rather than osteogenesis by delivering miR-483-5p, thus leading to
bone-fat imbalance and osteoporosis. AB-EVs are also transported into circulation and deposited in blood vessels to stimulate RUNX2 expression and
osteogenic transition of VSMCs via transferring miR-2861, thereby causing vascular calcification.

14 NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications

NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x
bone-derived matrix EVs. Since we did not further determine
their intracellular origin, we just called them “B-EVs”, but not “B-
Exo”. Similar to the previously reported B-EVs, we found that
YB-EVs could exert anabolic effects on bone. More importantly,
our study further determined that AB-EVs failed to induce bone
benefits, but rather induced marrow fat accumulation and aorta
calcification, indicating that the regulatory action of B-EVs on
bone is age-dependent and B-EVs can be transported to circu-
lation to affect vascular health.
B-EVs have always been considered to be released from hyper-
trophic chondrocytes and mineralizing osteoblasts12,13,47–49. Inter-
estingly, here we found that the majority of B-EVs expressed SOST
protein, an osteocyte-derived negative regulator of bone
formation22,23. Only a very small proportion of B-EVs expressed the
osteoblast marker COL I and the hypertrophic chondrocyte marker
COL X. EVs secreted from osteocytes (OCY-EVs) also exhibited
abundant expression of SOST and could trigger a B-EVs-like age-
dependent regulation of BMSC differentiation and VSMC calcifi-
cation. Using Dmp1iCre; Cd63em(loxp-mCherry-loxp-eGFP)3 mice and
SOST immunostaining, we found the presence of eGFP- and SOST-
double-positive OCY-EVs-like dot signals were at the perinuclear
region of osteocytes, within the bone matrix, or in the vascular
tissues of mice. These results suggest that osteocytes, the most
abundant bone cells (>90%) located inside the mineralized bone
matrix50, are the major parent cells that release B-EVs and can be
transported from bone to blood vessels under normal circumstance.
Nevertheless, even though Dmp1-Cre mice are widely used for gene
deletion in osteocytes51–54, Dmp1-Cre has been reported to be able
to inevitably target osteoblasts and some cells in other places55.
DMP1 expression is also found in hypertrophic chondrocytes56.
Thus, Dmp1-Cre mice is not an ideal model to label and trace OCY-
EVs. SOST protein is mainly produced by osteocytes22,23. However,
there are evidences that other cell types such as hypertrophic
chondrocytes are also able to produce SOST protein57,58. In our
study, we did not find out and utilize an ideal Cre mouse model that
targets only osteocytes. Although we found that the majority of
B-EVs were negative for the characteristic markers that were
expressed on EVs from osteoblasts or hypertrophic chondrocytes,
our current results could not rule out that a minority of osteoblasts
and hypertrophic chondrocytes may also contribute to the genera-
tion of B-EVs and play roles in the calcification paradox.
The calcification paradox is not only observed in osteoporosis
patients, but also frequently occurs in patients with other age-
related disorders, such as chronic kidney disease (CKD)7. The
decrease of renal phosphorus excretion leads to increased serum
phosphorus (hyperphosphatemia), which can combine with
blood calcium to generate calcium phosphates and induce the
osteogenic transition of VSMCs, resulting in CKD-mineral bone
disorder (CKD-MBD) and vascular calcification7,33. The adenine-
induced CKD model is widely utilized for studying chronic vas-
cular calcification33,34,59,60. In our study, we found that AB-EVs
could not only exacerbate VD3-induced acute vascular calcifica-
tion, but were also able to aggravate vascular calcification in
mouse models of adenine-induced CKD-related chronic vascular
calcification, suggesting that the strategy targeting AB-EVs may
be promising in treating vascular calcification in patients with
CKD. We found that the donor rats of AB-EVs had much higher
serum levels of BUN and CREA compared with the donor rats of
YB-EVs, consistent with previous evidence that these two para-
meters increase with age in humans61. Aging contributes to the
development of CKD, which in turn increases the risks of both
osteoporosis and vascular calcification62. CKD can lead to
increased bone resorption due to a state of inflammation62.
Considering that AB-EVs could be released during bone resorp-
tion and exert positive effects on bone-fat imbalance and vascular
calcification, the impaired renal function during aging may be a
NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications
ARTICLE
factor leading to the increase of AB-EVs release to the bone
marrow and blood, which finally induces bone-fat imbalance and
vascular calcification. In our study, we did not further assess the
effects of AB-EVs on bone phenotypes in animal models of CKD
and test whether the reduction of AB-EVs release or the
administration of YB-EVs could induce bone protective effects in
the animals with CKD. Given their effects in aged mice and the
association between aging and CKD, we hypothesized that the
inhibition of release or function of AB-EVs or the supple-
mentation of YB-EVs may provide bone benefits in individuals
with CKD, which requires future investigation.
Bisphosphonates are one of the classic anti-osteoporosis drugs
due to their inhibitory effects on osteoclastic bone resorption, but
they can also hinder osteoclast formation and induce osteoclast
apoptosis63,64. In recent years, evidences have shown that
bisphosphonates have the ability to promote osteogenesis and
inhibit adipogenesis of BMSCs65,66, attenuate marrow adiposity
in OVX mice67, and prevent VSMC mineralization and vascular
calcification68,69. There are also studies reporting that treatment
with bisphosphonates decreases osteoblast activity and bone
formation69,70. ALE is a second-generation bisphosphonate and
commonly used as first-line therapy for osteoporosis by inhibiting
bone resorption and increasing bone mass71,72. In our study, we
found that this bone resorption inhibitor did not obviously affect
osteogenic differentiation of BMSCs and mineralization of
VSMCs at the current dose, but it could inhibit adipocyte dif-
ferentiation of BMSCs, mitigate aging- and OVX-induced bone-
fat imbalance, and suppress the OVX-induced aggravation of
vascular calcification. Previous studies have suggested two pos-
sible mechanisms of the bisphosphonates-induced suppression of
vascular calcification. One is the inhibition of bone resorption
and subsequent the reduction of calcium release73, and the other
is the local effect on vascular wall69. Our findings showed that
ALE could reduce the release of AB-EVs from bone matrix and
almost entirely abolished the positive effects of the culture
supernatant from bone-resorbing osteoclasts on adipogenesis of
BMSCs and calcification of VSMCs, suggesting that the blockade
of AB-EVs release because of the inhibition of bone resorption is
another important mechanism by which bisphosphonates
protect against bone-fat imbalance and vascular calcification.
ALE possesses not only anti-resorptive activity, but also anti-
osteoclastogenic and pro-apoptosis effects63,64. Thus, besides the
direct inhibitory action on bone resorption, the suppression of
osteoclast formation and induction of osteoclast apoptotic death
by ALE could also cause the decline of AB-EVs release from the
bone matrix due to the reduction of osteoclasts to resorb bones,
thereby attenuating bone-fat imbalance and vascular calcification.
In our study, we did not explore whether other available newer
bisphosphonates (such as ibandronate and zoledronate74) can
induce similar effects as ALE on AB-EVs release, bone-fat
imbalance, and vascular calcification. Furthermore, the associa-
tion between the inhibition of AB-EVs release by ALE and the
protective effects of ALE against bone-fat imbalance and vascular
calcification remains speculative based on our current evidences.
We did not utilize an animal model to trace AB-EVs in vivo after
ALE administration. There are multiple ways that bispho-
sphonates affect bone phenotypes. Future studies are required to
find out a strategy that specifically inhibits AB-EVs release
without affecting other processes and thereby deeply decipher the
role of AB-EVs in the calcification paradox.
MiRNAs are small non-coding RNAs that regulate cell func-
tion by down-regulating the expression of target genes75,76. MiR-
483-5p has been reported to facilitate adipogenesis of mouse pre-
adipocyte 3T3-L1 cells by positively regulating the expression of
Pparγ39. It can also promote adipogenic differentiation of human
adipose-derived MSCs by directly inhibiting ERK1 gene and
15
ARTICLE
subsequently increasing PPARγ expression40. MiR-2861 is a
miRNA that can target histone deacetylase 5 (HDAC5) to pro-
mote the expression of Runx2, thus stimulating osteoblast dif-
ferentiation and osteogenic transdifferentiation of VSMCs41,77. In
this study, we identified that miR-483-5p and miR-2861 were
enriched in AB-EVs compared with YB-EVs and required for the
AB-EVs-induced positive effects on adipogenesis of BMSCs and
osteogenic transdifferentiation VSMCs, respectively. The results
in vivo revealed that the knockdown of miR-483-5p and miR-
2861 impaired the ability of AB-EVs to induce marrow adiposity
and calcification paradox. These findings, along with the evidence
of the much higher expression of these two miRNAs in bones,
abdominal aortas, and Ser-EVs from aged mice than those from
young mice, suggest that AB-EVs act as the carrier to transfer
miR-483-5p and miR-2861 from bone matrix to bone marrow
and then to the vasculature, where these miRNAs increase BMSC
adipogenesis and VSMC mineralization, thereby promoting
bone-fat imbalance and vascular calcification. Some other miR-
NAs may also partially contribute to the regulatory roles of AB-
EVs in these processes, because either the antagomiR-483-5p- or
antagomiR-2861-pretreated AB-EVs could still induce trend of
positive effects on BMSC adipogenic differentiation and VSMC
mineralization in vitro, as well as on adipogenesis and vascular
calcification in vivo. It should be also noted that the miR-2861-
abundant AB-EVs was not sufficient to augment osteogenic dif-
ferentiation of BMSCs and bone formation like YB-EVs, which
may be associated with the accumulation of bone-detrimental
molecules, such as the pro-adipogenic miR-483-5p, in AB-EVs.
Besides the aged bones, aged vessels, AB-EVs, and A-Ser-EVs, we
also found that the aged liver and A-Liver-EVs also showed
increased levels of miR-483-5p and miR-2861. However, A-Liver-
EVs did not induce similar significant effects as AB-EVs on
BMSC adipogenesis and VSMC mineralization, which may be
associated with the insufficient levels of these two miRNAs or/and
the enrichment of other miRNAs that have different regulatory
effects on these processes in A-Liver-EVs. Nevertheless, we could
not rule out the contribution of A-Liver-EVs to the increase of
miR-483-5p and miR-2861 in A-Ser-EVs. EVs from other non-
bone tissues such as Liver-EVs may be also involved in the
development of aging-associated bone-fat imbalance and vascular
calcification, which still requires future investigation.
There are many other limitations in this study. For assessment
of marrow adipocytes, a limitation of our study is that we just
performed immunofluorescence staining for the adipocyte mar-
ker PLIN, but did not use osmium tetroxide staining combined
with μCT, to evaluate the changes of marrow adipocytes. During
the assays for comparing the effects of OC-CM, OCYB-CM,
OCAB-CM, and EVs from OCYB-CM or OCAB-CM on differ-
entiation of BMSCs and VSMCs, the components in EVs from
simple-cultured osteoclasts (OC-EVs) may be different with EVs
from osteoclasts cultured with YB (OCYB-EVs) or AB (OCAB-
EVs). There may exist some factors in OCYB-EVs that can pro-
mote BMSC osteogenesis, and some molecules in OCAB-EVs that
can promote adipogenic differentiation of BMSCs and calcifica-
tion of VSMCs, which may contribute to the pro-osteogenic effect
of EVs in OCYB-CM and the positive effects of EVs in OCAB-CM
on BMSC adipogenesis and VSMC mineralization. In other
words, the bone-resorbing osteoclasts may also secrete functional
EVs to affect bone and vessel phenotypes, which still warrants
future investigation. Another limitation in our study is that we
did not perform “dose-response” experiments to more carefully
evaluate the effects of AB-EVs and YB-EVs on bone and vessel
phenotypes in the normal physiology and the pathology of
osteoporosis and vascular calcification. Currently, there is no
evidence showing the physiological concentrations of AB-EVs
and YB-EVs in the bone and vessel tissues. Future studies are
16 NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x
required to determine the physiological concentrations of AB-
EVs and YB-EVs using accurate assays and investigate whether
there exist dose-dependent responses in the AB-EVs- or YB-EVs-
treated mice, which will be beneficial for more deeply deciphering
the functional roles of bone-derived EVs in skeletal and vascular
aging and for developing strategies to inhibit AB-EVs or utilize
YB-EVs for therapeutic uses.
Methods
Ethics statement. Animal experiments were approved by the Animal Ethics
Committee and followed the Guidelines for the Care and Use of Laboratory
Animals at Xiangya Hospital of Central South University. The collection and use of
human bone and blood samples were approved by the Committee of Clinical Ethics
at Xiangya Hospital of Central South University and the protocols followed were
compliant with the ethical principles of the Helsinki Declaration. Written informed
consents were obtained from all human donors. No study participant received
compensation.
Human samples. The bone tissues were collected during surgical resection in
patients (three 27−31 years old young women and three 67−73 years old women
with osteoporosis) who underwent open reduction and internal fixation of tibial
plateau fracture, or joint replacement due to osteoarthritis, in order to obtain YB-
EVs and AB-EVs. Serum samples from these donors were collected to isolate
exosomes. The young donors had no other diseases. Besides osteoarthritis, the aged
donors suffered from other diseases such as osteoporosis, thyroid nodule, pul-
monary nodule, pneumonia, hyperlipidemia, hyperuricemia, or/and thyroid poly-
pectomy. The clinical information on these patients has been detailed in
Supplementary Table 1.
Cell isolation and culture. BMSCs were isolated from the bone marrow of the
femurs and tibias of C57BL/6 mice as described previously78. Briefly, the femurs
and tibias were dissected under sterile condition and placed in α-MEM
(SH30265.01; Hyclone, Logan, USA) with 1% Penicillin-Streptomycin (PS; P1400;
Solarbio, Beijing, China). The epiphyses were removed and bone marrow was
flushed out with α-MEM + 1% PS. The cells were washed with α-MEM + 1% PS
and then cultured in α-MEM with 10% fetal bovine serum (FBS; 10099141; Gibco,
Grand Island, USA) and 1% PS. After 24 h of culture, the culture medium was
replaced with fresh complete α-MEM medium to remove the nonadherent cells.
The adherent cells were cultured for another 3–5 days and passaged until reaching
90% confluence. Osteocytes and osteoblasts were isolated from the marrow-
depleted mouse femurs and tibias with the protocol provided by Stern AR et al.79.
Briefly, the bones (femurs and tibias) dissected under sterile condition were placed
in α-MEM + 1% PS. After removing the periosteum, epiphyses, and bone marrow,
the bones were cut into small pieces with lengths approximately 1 mm in Hank’s
balanced salt solution (HBSS; SH30031.02; Hyclone), followed by digestion with
warmed collagenase type IA (300 U/mL; C9891; Sigma‐Aldrich, St. Louis, MO,
USA) for 25 min in α-MEM and subsequent 3 times washing with HBSS. The
collagenase type IA-HBSS treatment was repeated again for 2 times. The solution
obtained during the processes was aspirated and subjected to cell plating. Cells in
the solution were plated in the collagen-coated culture plates and incubated in α-
MEM with 5% fetal calf serum (FCS; 26010074; Gibco), 5% FBS, and 1% PS. These
cells would be primarily osteoblasts. The bone pieces were then incubated with
EDTA solution for 25 min and washed with HBSS, followed by digestion with
collagenase type IA for 25 min and subsequent washing 3 times with HBSS. The
solution aspirated during the processes was also subjected to cell plating and the
obtained cells would be also mainly osteoblasts. After EDTA–HBSS–collagenase
type IA–HBSS treatment for another 2 times, the fractions containing abundant
osteocytes could be obtained. After mincing the remaining bone pieces, the
resulting bone particles and the osteocyte-enriched fractions were seeded into the
collagen-coated plates and incubated in α-MEM + 5% FCS + 5% FBS + 1% PS.
Human aorta VSMCs (FH1244; FuHeng Biology, Shanghai, China) were incubated
in F12K medium (SH30526.01; HyClone) + 10% FBS + 1% PS. RAW264.7 cells
(CL-0190; Procell, Wuhan, China) were cultured in high glucose DMEM
(11965092; Gibco) + 10% FBS + 1% PS. ATDC5 cells (HTX2427; Otwo Biotech,
Shenzhen, China) were cultured in DMEM-F12 medium (C11330500B; Gibco) +
10% FBS + 1% PS. Cells grew at 37 °C and 5% CO2. To obtain hypertrophic
chondrocytes, ATDC5 cells were induced in the commercial chondrogenic medium
(MUBMX-90042; Cyagen Biosciences, Guangzhou, China) for 21 days. The
medium was changed every two days during the induction period.
Isolation and characterization of EVs. Bone specimens were obtained from young
or old human donors, or from 2- or 18-month-old SD rats. After removing the peri-
osteum and bone marrow, the remaining bones were physically crashed to small pieces
using a tissue homogenizer and then subjected to digestion by collagenase II (; Gibco)
for 3 h at 37 °C. The digested tissues were filtered through 70-µm nylon mesh mem-
branes (352350; BD Falcon, San Jose, USA) and then centrifuged at 4500 × g for 30 min
and 10,000 × g for 30 min at 4 °C. The supernatant was collected for Optiprep™ density
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x
gradient ultracentrifugation to harvest B-EVs. For the collection of OCY-EVs, osteo-
cytes were cultured in the complete α-MEM medium for 7 days. For the harvest of OB-
EVs and HYPC-EVs, the osteoblasts and hypertrophic chondrocytes were incubated in
their complete culture media for 48 h. The culture supernatants of these cells were
harvested and subjected to sequential centrifugation (300 × g for 10 min, 2000 × g for
30 min, and 10,000 × g for 30 min) at 4 °C9, in order to remove dead cells and debris.
For the isolation of Ser-EVs, the serum was also subjected sequential centrifugation as
described above to obtain the supernatant. For the collection of Liver-EVs, the liver
tissues were digested using collagenase II for 3 min at 37 °C and filtered with 70-µm
nylon mesh membranes. After centrifugation at 4500 × g for 30 min and 10,000 × g for
30 min at 4 °C, the supernatant was then harvested.
The supernatant obtained during the above processes was then subjected to EVs
purification by Optiprep™ density gradient ultracentrifugation. Briefly, the
supernatant was firstly filtered using a filter (SLGPR33RB; 0.22 μm pore size;
Millipore, Billerica, USA) and centrifuged at 100,000 × g for 3 h to pellet the crude
EVs. Subsequently, the EV pellet was resuspended in 15 mL PBS and concentrated
to about 1.5 mL in a 100 kDa Amicon Ultra-15 Centrifugal Filter Unit (UFC9100;
Millipore) by centrifugation at 4000 × g and 4 °C. 1.33 mL of the ultrafiltration
liquid was mixed with 6.67 mL Optiprep™ solution (60% w/v iodixanol; D1556;
Sigma-Aldrich) to produce a 50% w/v iodixanol layer in a 38.5-mL polyallomer
Beckman Coulter tube, followed by sequentially adding a discontinuous iodixanol
gradient (8 mL of 40% w/v, 8 mL of 20% w/v, and 7 mL of 10% w/v iodixanol) and
2 mL PBS on the top of the 50% w/v iodixanol layer. The gradient was centrifuged
for 18 h at 100,000 × g and 4 °C using a SW 32 Ti rotor (Beckman Coulter; k-factor
204). 2 mL each of the density gradient fractions were harvested and subjected to
NTA with the ZetaView® nanoparticle tracking analyzer (Particle Metrix,
Meerbusch, Germany) for determining the EVs-rich fractions. After being diluted
by PBS to 30 mL, the EVs-rich fractions were centrifuged for 3 h at 100,000 × g and
4 °C. The pellets of EVs were collected and resuspended with PBS.
The exosomal protein contents were quantified by BCA protein assay kit (70-
PQ0011; Multi Sciences LTD., Hangzhou, China). The morphology and size
distribution of EVs were tested by a H-7650 TEM (Hitachi, Tokyo, Japan) and
NTA, respectively. The protein expression of exosomal markers, SOST, COL I, and
COL X was assessed by flow cytometry. Anti-CD81 (sc-7637; 1:100), anti-CD63
(sc-5275, 1:100), and anti-TSG101 (sc-7964, 1:100) were obtained from Santa Cruz
Biotechnology (Santa Cruz, USA). Anti-SOST (AF1589, 1:100), anti-COL I (14695-
1-AP, 1:100), and anti-COL X (bs-0554R, 1:100) were purchased from R&D
Systems (Minneapolis, USA), ProteinTech (Chicago, USA), and Bioss (Beijing,
China), respectively. EVs incubated with secondary antibody (Jackson
ImmunoResearch, West Grove, USA) alone served as negative controls.
For assays in vitro, EVs in different groups were used at the concentration of
20 μg/mL. For experiments in vivo, EVs were used at 200 μg (dissolved in 100 μL
PBS for intravenous injection; dissolved in 10 μL PBS for intramedullary injection)
or 500 μg (dissolved in 10 μL PBS for intramedullary injection) per time for
each mouse.
Preparation of bone-resorption CM. For the preparation of the CM from young
or aged bone-resorbing osteoclasts (OCYB-CM or OCAB-CM), the periosteum- and
bone marrow-depleted young or aged bones were cut into small slices and equally
distributed into several culture plates. The osteoclast progenitor RAW264.7 cells (1
× 105 per well) were seeded onto the bone slices and cultured in the osteoclastic
induction medium (high glucose DMEM + 10% FBS + 100 ng/mL RANKL). The
cells cultured in the RANKL-containing osteoclastic induction medium without
bone slices served as the control group. The medium was changed every other day.
After 5 to 6 days of induction, many osteoclasts were formed and located on the
surface of the bone slices. Osteoclasts began to resorb bone during this period. At
days 6, the medium was replaced with a fresh osteoclastic induction medium (high
glucose DMEM + EVs-depleted 10% FBS + 100 ng/mL RANKL) and the cells
were incubated for another 2 days. Then, the OCYB-CM, OCAB-CM, or CM from
the simple-cultured osteoclasts (OC-CM) were collected. If the newly formed
osteoclasts were less after 5 to 6 days of induction, the cells were subjected to
induction for a total of 8 days, followed by incubation in fresh osteoclastic
induction medium (high glucose DMEM + EVs-depleted 10% FBS + 100 ng/mL
RANKL) for additional 2 days to collect the CM. The obtained OCYB-CM, OCAB-
CM, and OC-CM were stored at −80 °C before use or subjected to EVs purification
by Optiprep™ density gradient ultracentrifugation. The isolated EVs and EVs-
depleted CM were stored at −80 °C before use. For downstream experiments, the
concentrations of CM from different groups, EVs in CM, and EVs-depleted CM
were used at the concentrations of 20 μg/mL. RANKL was purchased from
Peprotech (315-11C; Rocky Hill, USA).
Exosome uptake assay. B-Exo were labeled with DiI fluorescent dye (40726ES10;
YEASEN Biotech, Shanghai, China) following the manufacturer’s protocol. After
removing the redundant dye, B-EVs were added to the cultures of BMSCs or
VSMCs and incubated at 37 °C for 3 h. After discarding the culture supernatant
and washing the cells with PBS, the cells were fixed in 4% Paraformaldehyde (PFA)
for 15 min and incubated with DAPI (D1306; Invitrogen, Carlsbad, USA) to stain
nuclei. The uptake of the red DiI-labeled B-EVs by these cells was determined by a
Zeiss ApoTome fluorescence microscope (Jena, Germany).
NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications
ARTICLE
Osteogenic or adipogenic induction of BMSCs. BMSCs (osteogenic induction: 1
× 105 cells per well; adipogenic induction: 2 × 105 cells per well) were seeded in 48-
well plates and cultured for 24 h in complete medium, which was then replaced by
osteogenic or adipogenic medium (MUBMD-90021 or MUBMD-90031; Cyagen
Biosciences) supplemented with solvent, YB-EVs, AB-EVs, YB-OCY-EVs, AB-
OCY-EVs, OC-CM, OCYB-CM, OCAB-CM, EVs from OCYB-CM or OCAB-CM,
EVs-depleted OCAB-CM, ALE (10 µM; 129318-43-0; Aladdin, Shanghai, China),
OCALE-CM, OCAB+ALE-CM, Y-Liver-EVs, A-Liver-EVs, Y-Ser-EVs, A-Ser-EVs, or
AB-EVs pretreated with agomiR-483-5p, antagomiR-483-5p, agomiR-NC, or
antagomiR-NC. The differentiation medium was changed every two days. For
analyzing the expression of osteogenic or adipogenic genes, the cells were collected
at 2 days after induction and processed for qRT-PCR. For detecting the formation
of mineralized nodules or lipid droplets, the cells were stained with ARS solution
(G1452; Solarbio) at 7 days after osteogenic induction or ORO solution (G1262;
Solarbio) at 15 days after adipogenic induction. The percentages of ARS-positive
(ARS+) and ORO+ areas were measured using Image-Pro Plus 6 software.
Osteogenic induction of VSMCs. VSMCs (5 × 104 cells per well) were plated into
24-well plates and grew to 70% confluence in complete F12K medium, which was
then changed to osteogenic medium (MUBMD-90021; Cyagen Biosciences) sup-
plemented with solvent, YB-EVs, AB-EVs, YB-OCY-EVs, AB-OCY-EVs, OC-CM,
OCYB-CM, OCAB-CM, EVs from OCYB-CM or OCAB-CM, EVs-depleted OCAB-
CM, ALE (0.1−10 µM), OCALE-CM, OCAB+ALE-CM, Y-Liver-EVs, A-Liver-EVs,
Y-Ser-EVs, A-Ser-EVs, or AB-EVs pre-treated with agomiR-483-5p, antagomiR-
483-5p, agomiR-NC, or antagomiR-NC. The expression levels of SM22α, αSMA,
RUNX2, and COL1A1 expression was assessed at 2 days after induction. ALP
activity and mineralized nodule formation, respectively, were detected at 3 and
15 days after induction.
Osteoclastic induction of RAW264.7 cells. RAW264.7 cells (1 × 104 cells per
well) were seeded in 48-well plates and cultured in complete DMEM for 24 h,
followed by replacing the medium with complete DMEM added with RANKL
(100 ng/mL) + solvent, RANKL + YB-EVs, or RANKL + AB-EVs. After induction
for 8 days, the cells were subjected to TRAP staining with a commercial kit (387A;
Sigma-Aldrich) for the detection of osteoclasts (>three nuclei).
CCK-8 assay. VSMCs (5 × 103 cells per well) were plated into 96-well plates and
incubated in complete medium added with solvent or AB-EVs. 1, 2, 3 and 4 days
later, the cells were cultured for additional 3 h in fresh complete medium with
CCK-8 reagent (C008-3; 7Sea Biotech, Shanghai, China). Four wells without cells
were also added with CCK-8 solution and served as the blank group. The absor-
bance at 450 nm was measured with a microplate reader (Varioskan LUX Multi-
mode, Thermo Fisher Scientific, Waltham, USA).
MiRNA array. RNA from AB-EVs and YB-EVs was extracted using ExoQuick®
Exosome Isolation and RNA Purification Kit (EQ806TC-1; System Biosciences,
Mountain View, USA) and then subjected to RNA integration assessment by an
Agilent Bioanalyzer 2100 (Agilent technologies, Palo Alto, USA). After RNA
labeling and array hybridization, Agilent Microarray Scanner was used to scan the
slides with default settings. Raw data were processed with AgiMicroRna R package.
Differential expression analysis between AB-EVs and YB-EVs was performed and
the genes with absolute fold change ≥1.5 and P < 0.05 were considered as differ-
entially expressed.
AgomiR or antagomiR transfection. AgomiRs and antagomiRs were purchased
from Ribobio Biotechnology (Guangzhou, China). AB-EVs were transfected with
agomiR-483-5p (miR40004782-4-5), agomiR-2861 (miR40013803-4-5), agomiR-
NC (miR4N0000001-4-5), agomiR-NC-Cy3 (miR04102-4-5), antagomiR-483-5p
(miR30004782-4-5), antagomiR-2861 (miR30013803-4-5), or antagomiR-NC
(miR3N0000001-4-5) at the concentration of 200 nM for 30 min at 37 °C. The
redundant agomiRs and antagomiRs were removed by centrifugation at 4,000 × g
for 5 min in a 100 kDa Amicon Ultra-4 Centrifugal Filter Unit (Millipore). The
internalization of agomiR-NC-Cy3 by AB-EVs was assessed by flow cytometry.
AB-EVs treated with other agomiRs and antagomiRs were used for subsequent
experiments.
qRT-PCR. Total RNA was extracted with RNAiso Plus kit (9109; TaKaRa, Dalian,
China) and subjected to cDNA synthesis with the GoScript™ Reverse Transcription
System (PRA5000; Promega, Madison, USA) or miRNA First Strand cDNA Synthesis
kit (B532451; Sangon Biotech, Shanghai, China). Then, qRT-PCR was performed with
GoTaq® qPCR Master Mix (A6002; Promega) on FTC-3000 V1.0.3.44 real-time PCR
system. GAPDH or U6 small nuclear RNA served as the reference genes for normal-
ization. The primers were as follows: mouse-Runx2: forward, 5′-GACTGTGGTTACC
GTCATGGC-3′, and reverse, 5′-ACTTGGTTTTTCATAAC AGCGGA-3′; mouse-
Bglap: forward, 5′-CTGACCTCACAGATCCCAAGC-3′, and reverse, 5′-TGGTCTGA
TAGCTCGTCACAAG-3′; mouse-Alpl: forward, 5′-CCAACTCTTTTGTGCC AGAG
A-3′, and reverse, 5′-GGCTACATTGGTGTTGAGCTTTT-3′; mouse-Pparγ: forward,
5′-TCGCTGATGCACTGCCTATG-3′, and reverse, 5′-GAGAGGTCCACAGAGCTG
17
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x
ATT-3′; mouse-Cebpα: forward, 5′-CAAGAACAGCAACGAGTACCG-3′, and reverse,
5′-GTCACTG GTCAACTCCAGCAC-3′; mouse-Fabp4: forward, 5′-AAGGTGAAGA
GCATCATAACCCT-3′, and reverse, 5′-TCACGCCTTTCATAACACATTCC-3′;
mouse-Sm22α: forward, 5′-ACTG CCTAGGCGGCCTTTA-3′, and reverse, 5′-ATGCC
GTAGGATGGACCCTT-3′; mouse-αSma: forward, 5′-GTACCACCATGTACCCAG
GC-3′, and reverse, 5′-GCTGGAAGGTAGACAGC GAA-3′; mouse-Gapdh: 5′-AGGT
CGGTGTGAACGGATTTG-3′, and reverse, 5′-TGTAGAC CATGTAGTTGAGGT
CA-3′; human-SM22α: forward, 5′-GAGGAATTGATGGAAACCAC CG-3′, and
reverse, 5′-CTCATGCCATAGGAAGGACCC-3′; human-αSMA: forward, 5′-CTTC
AGCTTTCAGCTTCCCTGA-3′, and reverse, 5′-CAGAGCCCAGAGCCA TTGT-3′;
human-RUNX2: forward, 5′-TGGTTACTGTCATGGCGGGTA-3′, and reverse, 5′-TC
TCAGATCGTT GAACCTTGCTA-3′; human-COL1A1: forward, 5′-CTCCCCAGC
CACAAAGAGTC-3′, and reverse, 5′-CCGTTCTGTACGCAGGTGAT-3′; human-
GAPDH: forward, 5′-TCGACAGTCA GCCGCATCT-3′, and reverse, 5′-AGTTAAAA
GCAGCCCTGGTGA-3′; miR-483-5p: 5′-CTC CCTTCTCTTCTCCCGTCTT-3′; miR-
2861: 5′-CCGCCCGCCGCCAGGCCCC-3′; U6: 5′-GCGCGTCGTGAAGCGTTC-3′.
Animals and treatments. 3-, 15- and 16-month-old male or female C57BL/6J
mice and male SD rats of 2- or 18-month-old were used and housed in barrier
facilities on a 12 h light/dark cycle at temperature 18–22 °C and humidity 50-60%.
2- and 18-month-old male SD rats were used for the isolation of YB-EVs and AB-
EVs, respectively. The serum samples of the donor rats were collected for assessing
BUN and CREA on automated instruments in the Department of Clinical
Laboratory in Xiangya Hospital of Central South University. Calcium ions and
inorganic phosphate in YB-EVs and AB-EVs were examined with the commercial
kits purchased from Nanjing Jiancheng Bioengineering Institute (C004-2-1 and
C006-1-1; Nanjing, China). To assess the effects of AB-EVs and YB-EVs on bone-
fat balance and the role of miR-483-5p in the AB-EVs-induced promotion of
marrow adiposity, 3- or 15-month-old aged male mice were treated with 200 μg of
YB-EVs, AB-EVs, antagomiR-483-5p- or antagomiR-NC-pre-treated AB-EVs, or
an equal volume of solvent (PBS; 100 μL) by intramedullary injection one time
every two weeks for one month. Then, the mice were killed after collecting the
blood specimens. Spleen tissues were obtained, weighed, and processed for H&E
staining using reagents from Solarbio. Whole blood samples were collected for
evaluating the changes of lymphocytes and neutrophils in white blood cells. Serum
samples were collected for assessing the concentrations of OCN and CTX-I using
the commercial ELISA kits from Elabscience (E-EL-M0864c and E-EL-M3023;
Wuhan, China). The femora were obtained for μCT analysis, biomechanical test,
PLIN immunofluorescence staining, OCN immunohistochemical staining, and
TRAP staining.
To evaluate the impacts of YB-EVs and AB-EVs on acute vascular calcification
and the role of miR-2861 in the AB-EVs-induced aggravation of vascular
calcification, 3-month-old male mice were intraperitoneally injected with VD3 (500
U/g/d) for continuous 4 days, followed by treatment with 200 μg of AB-EVs, YB-
EVs, antagomiR-2861- or antagomiR-NC-pre-treated AB-EVs, or an equal volume
of PBS by intravenous injection (100 μL per mice) at days 1 and 3, or treatment
with 500 μg of AB-EVs or YB-EVs, or an equal volume of PBS (10 μL per mice) by
intramedullary injection at day 1 only. To evaluate the impacts of YB-EVs and AB-
EVs on chronic vascular calcification, 3-month-old female mice were fed a diet
containing 0.25% adenine (Sigma‐Aldrich) for 4 weeks to induce CKD and vascular
calcification. During the feeding period, the mice were treated with 200 μg of YB-
EVs or AB-EVs, or an equal volume of solvent (100 μL per mice) by intravenous
injection at the first day of weeks 1 and 3. 11 days later, the abdominal aortas of the
mice with acute or chronic vascular calcification were collected for qRT-PCR
analysis for Sm22α and αSma expression, Von Kossa staining, ARS staining,
vascular calcium content analysis, immunostaining for RUNX2, or/and qRT-PCR
analysis for Alpl expression. Serum samples were collected for testing calcium ions
and inorganic phosphate using the kits from Nanjing Jiancheng Bioengineering
Institute (C004-2-1 and C006-1-1).
To investigate the effects of ALE on bone-fat balance, 16-month-old female
mice were intragastrically administered with ALE (600 μg/kg/d) or solvent before
and after bilateral OVX or sham operation once a week for three weeks (at 7 days
before surgery; at 1 and 7 days after surgery). To detect the influences of ALE on
vascular calcification, the 3- or 16-month-old mice subjected to OVX or sham
operation were given ALE or solvent as described above and additionally treated
with VD3 or solvent for continuous four days by intraperitoneal injection during
the second week after OVX surgery. 18 days after OVX or sham operation, the
mice were killed and their uteri were obtained and weighted. The serum, femora,
and abdominal aortas were also collected and subjected to downstream analyses as
described above.
Cd63em(loxp-mCherry-loxp-eGFP)3 mice were generated using the CRISPR/Cas9-
mediated knock-in system by Cyagen Biosciences Inc. (Guangzhou, China). Briefly, the
loxp-cc-mCherry-polyA-loxp-cc-eGFP cassette was inserted into Cd63 gene at the site of
stop codon in exon 8 to generate the homologous recombination donor vector, which
was microinjected into the fertilized eggs of C57BL/6J mice combined with Cas9
mRNA and guide RNA (gRNA). The fertilized eggs were then transplanted into female
C57BL/6J mice to produce chimeric mice. The positive F0 generation mice were
identified by long fragment PCR and then cross-breeding with wild-type C57BL/6J
mice to generate F1 mice, which were subjected to genotyping using PCR and DNA
sequencing. The primers for determining the insertion of loxP-flanked mCherry gene
18 NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications
were as follow: P1: 5′-TGAGCAAGGGCGAGGAGGATAACA-3′; P2: 5′-CATGCCG
CCGGTGGAGTGG-3′. The primers P1 and P2 will amplify a 689-bp product if the
loxP-flanked mCherry was inserted, and no products can be amplified in the case of no
insertion. Cd63em(loxp-mCherry-loxp-eGFP)3 mice were crossed with Dmp1iCre mice
(Jackson Laboratory) to obtain Dmp1iCre; Cd63em(loxp-mCherry-loxp-eGFP)3 mice. The
femora and abdominal aortas of these three types of mice were harvested and
processed for the detection of mCherry and eGFP signals as well as SOST expression
with a fluorescence microscope. Anti-eGFP and anti-SOST were obtained from Abcam
(ab290; 1:10, 000; Cambridge, USA) and R&D Systems (AF1589; 1:100; Minneapolis,
USA), respectively. The primers for the iCre transgene were as below: Dmp1-iCre-
FRT-F: CACGTCCTCTCACTTCTCACG; Dmp1-iCre-FRT-R: CTTTGA CAGTGT
CTTATCCAATAGCC. A 341-bp PCR product will be generated in mice hemizygous
for the Dmp1iCre allele and a 240-bp PCR product will be yielded in the wild-type mice.
μCT analysis. The 4% PFA-fixed femora were subjected to μCT scanning by
vivaCT80 scanner (SCANCO Medical AG, Bruettisellen, Switzerland) with a vol-
tage of 50 kV, a current of 400 μA and a resolution of 18 μm per pixel. microCT
V6.1 was used to collect the raw data. CT Analyser 1.11.0.0, µCTVol 2.2.0.0, and
Dataviewer 1.4.3 were used for trabecular bone reconstruction and visualization in
the distal femurs, respectively. The region for trabecular bone analysis was 5% of
femoral length from 0.1 mm above the distal femoral growth plate, in order to
analyze Tb. BV/TV, Tb. N, Tb. Th, and Tb. Sp. For cortical bone, the region for
analysis was 5% of femoral length in the femoral mid-diaphysis for measuring Ct.
Ar/Tt. Ar and Ct. Th.
Biomechanical test. Bone strength was evaluated by three-point bending test using
a mechanical testing machine (Instron 3343; Instron, Canton, USA) as describe
previously80. Briefly, the femur samples were placed on the lower supporting bars
with two fulcrums spaced 8 mm. A vertical compression load with a constant rate
of 5 mm/min was applied until fracture happened. The load-deformation curves
were generated and used for calculating the ultimate load value (N).
Histological analyses and immunostaining. The femora and abdominal aortas
were fixed for 48 h with 4% PFA, decalcified for one week in 18% EDTA (for bone
only) and embedded in paraffin after dehydration. 5 μm-thick femoral sections
were made and processed for PLIN immunostaining using the antibody from
Sigma-Aldrich (P1873; 1:300), immunohistochemical staining for OCN using the
antibody from Servicebio (ab93876; 1:200; Wuhan, China), and TRAP staining
with a kit from Sigma-Aldrich (387A). 5 μm-thick aortic sections were obtained
and stained with Von Kossa reagent (G3282; Solarbio), ARS reagent (G1452;
Solarbio), or RUNX2 antibody (12556; 1:800; Cell Signaling Technology, Danvers,
USA). Secondary antibodies were purchased from Cell Signaling Technology (7074;
1:200) or Jackson Immuno Research (711-545-152 or 711-585-152; 1:400). Images
were obtained under an optical microscope (Olympus CX31, Tokyo, Japan) or a
Zeiss ApoTome fluorescence microscope. The number of adipocytes per square
millimeter of marrow tissue (N. AdCs/Ar/mm2), the numbers of osteoblasts and
osteoclasts per millimeter of bone surface (N. OBs/BS/mm and N. OCs/BS/mm),
and the percentages of Von Kossa+, ARS+, and RUNX2+ areas for each aortic
section were quantified.
Histomorphometric analysis. For double calcein labeling, 0.1% calcein (10 mg/kg;
Sigma‐Aldrich) was administered into the mice in different groups by intraper-
itoneal injection at 10 days and 3 days before sacrifice. The femora were obtained,
fixed with 4% PFA for 48 h, dehydrated in ethanol, and then embedded in methyl
methacrylate. 50-μm-thick bone sections were obtained and the signals were
detected under a Zeiss ApoTome fluorescence microscope. The images were ana-
lyzed using the Image-Pro Plus 6 software to measure BFR/BS and MAR values.
Vascular calcium content analysis. The abdominal aortas were decalcified with
0.6 N HCl at 4 °C for 48 h. After testing the protein concentration, the calcium
content in the supernatant was assessed using a commercial kit from Nanjing
Jiancheng Bioengineering Institute (C004-2-1). The vascular calcium content was
normalized to the concentration of protein.
EV tracing. To explore whether AB-EVs could be transported from bone to blood
vessel wall after intramedullary injection, 500 μg AB-EVs were labeled with DiO
dye following the manufacturer’s instruction. Then, the DiO-labeled AB-EVs
(dissolved in 10 μL PBS) or PBS only were administered into the bone marrow
cavity of mice. 8 or 24 h later, the femora and abdominal aortas were collected and
fixed in 4% PFA for 24 h. After dehydration and quick freezing, the tissues were
embedded in OCT compound (4853; Tissue-Tek, Sakura Finetek, Torrance, USA)
and cut into 10 µm-thick sections. After being stained with DAPI, the sections were
washed and then detected with a fluorescence microscope (Zeiss Apotome).
Statistical analysis. Data were represented as mean ± SD and analyzed using
GraphPad Prism 9. Unpaired, two-tailed Student’s t-test was conducted for com-
parisons between two groups. One- or two-way ANOVA with Bonferroni post hoc
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x
test was used for comparisons among multiple groups. P < 0.05 was considered to
be significant.
Reporting summary. Further information on research design is available in the Nature
Research Reporting Summary linked to this article.
Data availability
MiRNA array data are deposited at ArrayExpress under accession number E-MTAB-
11417. All the other data are available within the article, Supplementary Information file,
Source data file, or from the corresponding authors upon reasonable request. Source data
are provided with this paper. A reporting summary for this article is available as a
supplementary information file. ZEN 2.3 pro, microCT V6.1, FTC-3000 V1.0.3.44, Skanlt
RE 6.0.2, and WPS Office 3.8.1 software are used to collect data. The R scripts are used to
reproduce the analyses and plots for miRNA array. The raw data in this article are
available from the corresponding authors upon reasonable request. Source data are
provided with this paper.
Received: 9 December 2020; Accepted: 25 February 2022;
References
1. Chen, C. Y. et al. Extracellular vesicles from human urine-derived stem cells
prevent osteoporosis by transferring CTHRC1 and OPG. Bone Res. 7, 18 (2019).
2. Tang, Q. et al. Microporous polysaccharide multilayer coated BCP composite
scaffolds with immobilised calcitriol promote osteoporotic bone regeneration
both in vitro and in vivo. Theranostics 9, 1125–1143 (2019).
3. Silva, A. M. et al. Long noncoding RNAs: a missing link in osteoporosis. Bone
Res. 7, 10 (2019).
4. Li, C. J. et al. Long noncoding RNA Bmncr regulates mesenchymal stem cell
fate during skeletal aging. J. Clin. Invest 128, 5251–5266 (2018).
5. Gu, W. et al. Role of NFATc1 in the Bone-Vascular Axis Calcification Paradox. J.
Cardiovasc Pharm. 75, 200–207 (2020).
6. Zhang, Y. & Feng, B. Systematic review and meta-analysis for the association of
bone mineral density and osteoporosis/osteopenia with vascular calcification in
women. Int J. Rheum. Dis. 20, 154–160 (2017).
7. Persy, V. & D’Haese, P. Vascular calcification and bone disease: the calcification
paradox. Trends Mol. Med. 15, 405–416 (2009).
8. van de Vlekkert, D. et al. Excessive exosome release is the pathogenic pathway
linking a lysosomal deficiency to generalized fibrosis. Sci. Adv. 5,
eaav3270–eaav3270 (2019).
9. Chen, C. Y. et al. Exosomal DMBT1 from human urine-derived stem cells
facilitates diabetic wound repair by promoting angiogenesis. Theranostics 8,
1607–1623 (2018).
10. Luo, Z. W. et al. Aptamer-functionalized exosomes from bone marrow stromal
cells target bone to promote bone regeneration. Nanoscale 11, 20884–20892
(2019).
11. Yokoi, A. et al. Mechanisms of nuclear content loading to exosomes. Sci. Adv.
5, eaax8849 (2019).
12. Shapiro, I. M., Landis, W. J. & Risbud, M. V. Matrix vesicles: Are they
anchored exosomes? Bone 79, 29–36 (2015).
13. Jing, L. et al. Role of Matrix Vesicles in Bone-Vascular Cross-Talk. J.
Cardiovasc Pharm. 74, 372–378 (2019).
14. Crane, J. L. & Cao, X. Function of matrix IGF-1 in coupling bone resorption
and formation. J. Mol. Med. 92, 107–115 (2014).
15. Crane, J. L. & Cao, X. Bone marrow mesenchymal stem cells and TGF-beta
signaling in bone remodeling. J. Clin. Invest 124, 466–472 (2014).
16. Hu, Y. et al. Extracellular vesicles from human umbilical cord blood
ameliorate bone loss in senile osteoporotic mice. Metabolism 95, 93–101
(2019).
17. Black, D. M. & Rosen, C. J. Clinical Practice. Postmenopausal Osteoporosis. N.
Engl. J. Med. 374, 254–262 (2016).
18. Song, Y. et al. M2 microglia-derived exosomes protect the mouse brain from
ischemia-reperfusion injury via exosomal miR-124. Theranostics 9, 2910–2923
(2019).
19. Gao, X. et al. Chronic myelogenous leukemia cells remodel the bone marrow
niche via exosome-mediated transfer of miR-320. Theranostics 9, 5642–5656
(2019).
20. Coakley, G., Maizels, R. M. & Buck, A. H. Exosomes and Other Extracellular
Vesicles: The New Communicators in Parasite Infections. Trends Parasitol. 31,
477–489 (2015).
21. Guo, S. C., Tao, S. C. & Dawn, H. Microfluidics-based on-a-chip systems for
isolating and analysing extracellular vesicles. J. Extracell. Vesicles 7, 1508271
(2018).
NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications
ARTICLE
22. Appelman-Dijkstra, N. M. & Papapoulos, S. E. Clinical advantages and
disadvantages of anabolic bone therapies targeting the WNT pathway. Nat.
Rev. Endocrinol. 14, 605–623 (2018).
23. van Bezooijen, R. L., ten Dijke, P., Papapoulos, S. E. & Löwik, C. W. SOST/
sclerostin, an osteocyte-derived negative regulator of bone formation.
Cytokine Growth Factor Rev. 16, 319–327 (2005).
24. Bolarin, D. M., Swerdlow, P., Wallace, A. M. & Littsey, L. Type I collagen as a
marker of bone metabolism in sickle cell hemoglobinopathies. J. Natl Med.
Assoc. 90, 41–45 (1998).
25. Wilson, R., Freddi, S., Chan, D., Cheah, K. S. & Bateman, J. F. Misfolding of
collagen X chains harboring Schmid metaphyseal chondrodysplasia mutations
results in aberrant disulfide bond formation, intracellular retention, and activation
of the unfolded protein response. J. Biol. Chem. 280, 15544–15552 (2005).
26. Men, Y. et al. Exosome reporter mice reveal the involvement of exosomes in
mediating neuron to astroglia communication in the CNS. Nat. Commun. 10,
4136 (2019).
27. Durham, A. L., Speer, M. Y., Scatena, M., Giachelli, C. M. & Shanahan, C. M.
Role of smooth muscle cells in vascular calcification: implications in
atherosclerosis and arterial stiffness. Cardiovasc Res. 114, 590–600 (2018).
28. Henze, L. A. et al. Impact of C-reactive protein on osteo-/chondrogenic
transdifferentiation and calcification of vascular smooth muscle cells. Aging
11, 5445–5462 (2019).
29. Sun, Y. et al. Smooth muscle cell-specific runx2 deficiency inhibits vascular
calcification. Circ. Res. 111, 543–552 (2012).
30. Nakano-Kurimoto, R. et al. Replicative senescence of vascular smooth muscle
cells enhances the calcification through initiating the osteoblastic transition.
Am. J. Physiol. Heart Circ. Physiol. 297, H1673–H1684 (2009).
31. Kwon, D. H. et al. MDM2 E3 ligase-mediated ubiquitination and degradation
of HDAC1 in vascular calcification. Nat. Commun. 7, 10492 (2016).
32. Goettsch, C., Hutcheson, J. D. & Aikawa, E. MicroRNA in cardiovascular
calcification: focus on targets and extracellular vesicle delivery mechanisms.
Circ. Res. 112, 1073–1084 (2013).
33. Yoshida, T., Yamashita, M., Horimai, C. & Hayashi, M. Smooth Muscle-
Selective Nuclear Factor-κB Inhibition Reduces Phosphate-Induced Arterial
Medial Calcification in Mice With Chronic Kidney Disease. J. Am. Heart
Assoc. 6, e007248 (2017).
34. Clinkenbeard, E. L. et al. Increased FGF23 protects against detrimental cardio-
renal consequences during elevated blood phosphate in CKD. JCI Insight 4,
e123817 (2019).
35. Zhang, Y. et al. Hypothalamic stem cells control ageing speed partly through
exosomal miRNAs. Nature 548, 52–57 (2017).
36. Chew, J. R. J. et al. Mesenchymal stem cell exosomes enhance periodontal
ligament cell functions and promote periodontal regeneration. Acta Biomater.
89, 252–264 (2019).
37. Kim, H. et al. Exosome-Guided Phenotypic Switch of M1 to M2 Macrophages
for Cutaneous Wound Healing. Adv. Sci. 6, 1900513 (2019).
38. Chen, K. et al. Pseurotin A Inhibits Osteoclastogenesis and Prevents
Ovariectomized-Induced Bone Loss by Suppressing Reactive Oxygen Species.
Theranostics 9, 1634–1650 (2019).
39. Zhang, J. et al. Grape seed procyanidin B2 inhibits adipogenesis of 3T3-L1
cells by targeting peroxisome proliferator-activated receptor γ with miR-483-
5p involved mechanism. Biomed. Pharmacother. 86, 292–296 (2017).
40. Chen, K. et al. miR-125a-3p and miR-483-5p promote adipogenesis via
suppressing the RhoA/ROCK1/ERK1/2 pathway in multiple symmetric
lipomatosis. Sci. Rep. 5, 11909 (2015).
41. Xia, Z. Y. et al. Runx2/miR-3960/miR-2861 Positive Feedback Loop Is
Responsible for Osteogenic Transdifferentiation of Vascular Smooth Muscle
Cells. Biomed. Res Int. 2015, 624037 (2015).
42. De Maré, A. et al. Sclerostin as Regulatory Molecule in Vascular Media
Calcification and the Bone-Vascular Axis. Toxins (Basel) 11, 428 (2019).
43. Fadini, G. P., Rattazzi, M., Matsumoto, T., Asahara, T. & Khosla, S. Emerging
role of circulating calcifying cells in the bone-vascular axis. Circulation 125,
2772–2781 (2012).
44. Zoppellaro, G., Faggin, E., Puato, M., Pauletto, P. & Rattazzi, M. Fibroblast
growth factor 23 and the bone-vascular axis: lessons learned from animal
studies. Am. J. Kidney Dis. 59, 135–144 (2012).
45. Thompson, B. & Towler, D. A. Arterial calcification and bone physiology: role
of the bone-vascular axis. Nat. Rev. Endocrinol. 8, 529–543 (2012).
46. Vassalle, C. & Mazzone, A. Bone loss and vascular calcification: A bi-
directional interplay? Vasc. Pharm. 86, 77–86 (2016).
47. Nahar, N. N., Missana, L. R., Garimella, R., Tague, S. E. & Anderson, H. C.
Matrix vesicles are carriers of bone morphogenetic proteins (BMPs), vascular
endothelial growth factor (VEGF), and noncollagenous matrix proteins. J.
Bone Min. Metab. 26, 514–519 (2008).
48. Minamizaki, T. et al. The matrix vesicle cargo miR-125b accumulates in the
bone matrix, inhibiting bone resorption in mice. Commun. Biol. 3, 30 (2020).
49. Hasegawa, T. Ultrastructure and biological function of matrix vesicles in bone
mineralization. Histochem Cell Biol. 149, 289–304 (2018).
19
ARTICLE
50. Tatsumi, S. et al. Targeted ablation of osteocytes induces osteoporosis with
defective mechanotransduction. Cell Metab. 5, 464–475 (2007).
51. Lu, Y. et al. DMP1-targeted Cre expression in odontoblasts and osteocytes. J.
Dent. Res. 86, 320–325 (2007).
52. Xiong, J. et al. Matrix-embedded cells control osteoclast formation. Nat. Med.
17, 1235–1241 (2011).
53. Joeng, K. S. et al. Osteocyte-specific WNT1 regulates osteoblast function
during bone homeostasis. J. Clin. Invest 127, 2678–2688 (2017).
54. Asada, N. et al. Matrix-embedded osteocytes regulate mobilization of
hematopoietic stem/progenitor cells. Cell Stem Cell 12, 737–747 (2013).
55. Lim, J., Burclaff, J., He, G., Mills, J. C. & Long, F. Unintended targeting of
Dmp1-Cre reveals a critical role for Bmpr1a signaling in the gastrointestinal
mesenchyme of adult mice. Bone Res. 5, 16049 (2017).
56. Zhang, Q. et al. Dmp1 Null Mice Develop a Unique Osteoarthritis-like
Phenotype. Int J. Biol. Sci. 12, 1203–1212 (2016).
57. Weivoda, M. M., Youssef, S. J. & Oursler, M. J. Sclerostin expression and
functions beyond the osteocyte. Bone 96, 45–50 (2017).
58. van Bezooijen, R. L. et al. Sclerostin in mineralized matrices and van Buchem
disease. J. Dent. Res. 88, 569–574 (2009).
59. Kukida, M. et al. AT2 receptor stimulation inhibits phosphate-induced
vascular calcification. Kidney Int. 95, 138–148 (2019).
60. Schantl, A. E. et al. Inhibition of vascular calcification by inositol phosphates
derivatized with ethylene glycol oligomers. Nat. Commun. 11, 721 (2020).
61. He, Y. H. et al. Improved lipids, diastolic pressure and kidney function are
potential contributors to familial longevity: a study on 60 Chinese centenarian
families. Sci. Rep. 6, 21962 (2016).
62. Evenepoel, P., Opdebeeck, B., David, K. & D’Haese, P. C. Bone-Vascular Axis
in Chronic Kidney Disease. Adv. Chronic Kidney Dis. 26, 472–483 (2019).
63. Fisher, J. E. et al. Alendronate mechanism of action: geranylgeraniol, an
intermediate in the mevalonate pathway, prevents inhibition of osteoclast
formation, bone resorption, and kinase activation in vitro. Proc. Natl Acad.
Sci. USA 96, 133–138 (1999).
64. Reszka, A. A., Halasy-Nagy, J. M., Masarachia, P. J. & Rodan, G. A.
Bisphosphonates act directly on the osteoclast to induce caspase cleavage of
mst1 kinase during apoptosis. A link between inhibition of the mevalonate
pathway and regulation of an apoptosis-promoting kinase. J. Biol. Chem. 274,
34967–34973 (1999).
65. Fu, L. et al. Stimulation of osteogenic differentiation and inhibition of
adipogenic differentiation in bone marrow stromal cells by alendronate via
ERK and JNK activation. Bone 43, 40–47 (2008).
66. Kim, H. K., Kim, J. H., Abbas, A. A. & Yoon, T. R. Alendronate enhances
osteogenic differentiation of bone marrow stromal cells: a preliminary study.
Clin. Orthop. Relat. Res. 467, 3121–3128 (2009).
67. Li, G. W. et al. Influence of early zoledronic acid administration on bone
marrow fat in ovariectomized rats. Endocrinology 155, 4731–4738 (2014).
68. Zhou, S., Fang, X., Xin, H. & Guan, S. Effects of alendronate on the
Notch1‑RBP‑Jκ signaling pathway in the osteogenic differentiation and
mineralization of vascular smooth muscle cells. Mol. Med. Rep. 8, 89–94
(2013).
69. Lomashvili, K. A., Monier-Faugere, M. C., Wang, X., Malluche, H. H. &
O’Neill, W. C. Effect of bisphosphonates on vascular calcification and bone
metabolism in experimental renal failure. Kidney Int. 75, 617–625 (2009).
70. Iwata, K., Li, J., Follet, H., Phipps, R. J. & Burr, D. B. Bisphosphonates
suppress periosteal osteoblast activity independently of resorption in rat femur
and tibia. Bone 39, 1053–1058 (2006).
71. Rennert, G. et al. Oral Bisphosphonates and Improved Survival of Breast
Cancer. Clin. Cancer Res. 23, 1684–1689 (2017).
72. Saag, K. G. et al. Romosozumab or Alendronate for Fracture Prevention in
Women with Osteoporosis. N. Engl. J. Med. 377, 1417–1427 (2017).
73. Price, P. A., Faus, S. A. & Williamson, M. K. Bisphosphonates alendronate and
ibandronate inhibit artery calcification at doses comparable to those that
inhibit bone resorption. Arterioscler Thromb. Vasc. Biol. 21, 817–824 (2001).
74. Lambrinoudaki, I. & Christodoulakos, G. Botsis D. Bisphosphonates. Ann. N.
Y Acad. Sci. 1092, 397–402 (2006).
75. Wu, C. J. et al. MiR-23~27~24-mediated control of humoral immunity reveals
a TOX-driven regulatory circuit in follicular helper T cell differentiation. Sci.
Adv. 5, eaaw1715 (2019).
76. Chandrasekaran, A. R. et al. Cellular microRNA detection with miRacles:
microRNA- activated conditional looping of engineered switches. Sci. Adv. 5,
eaau9443 (2019).
77. Hu, R. et al. A Runx2/miR-3960/miR-2861 regulatory feedback loop during
mouse osteoblast differentiation. J. Biol. Chem. 286, 12328–12339 (2011).
20 NATURE COMMUNICATIONS | (2022)13:1453 | https://doi.org/10.1038/s41467-022-29191-x | www.nature.com/naturecommunications
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-29191-x
78. Zhu, H. et al. A protocol for isolation and culture of mesenchymal stem cells
from mouse compact bone. Nat. Protoc. 5, 550–560 (2010).
79. Stern, A. R. & Bonewald, L. F. Isolation of osteocytes from mature and aged
murine bone. Methods Mol. Biol. 1226, 3–10 (2015).
80. Liu, J. H. et al. Extracellular Vesicles from Child Gut Microbiota Enter into
Bone to Preserve Bone Mass and Strength. Adv. Sci. 8, 2004831 (2021).
Acknowledgements
We thank the volunteers for their contributions to this study. This work was sup-
ported by the National Natural Science Foundation of China (Grant Nos. 81801395
(Z.-X.W.), 82072504 (H.X.), 81871822 (H.X.), 81522012 (H.X.), 81670807 (H.X.),
81702237 (C.-Y.C.), 81600699 (J.C.), 81701383 (Z.-Z.L.), 81974127 (Z.-Z.L.)), the
Innovation Driven Project of Central South University (Grant Nos. 2019CX014
(H.X.), 2018CX029 (Z.-Z.L.)), the Non-profit Central Research Institute Fund of
Chinese Academy of Medical Sciences (Grant No. 2019-RC-HL-024 (H.X.)), the
Science and Technology Plan Project of Hunan Province (Grant Nos. 2017XK2039
(H.X.), 2018RS3029 (H.X.)), the Science and Technology Innovation Program of
Hunan Province (Grant No. 2020RC4008 (H.X.)), the Hunan Province Natural
Science Foundation of China (Grant Nos. 2020JJ4914 (Z.-X.W.), 2017JJ3501 (Z.-
X.W.), 2020JJ5883 (C.-Y.C.), 2020JJ5900 (X.-K.H.)), the China Postdoctoral Science
Foundation (Grant Nos. 2019T120717 (Z.-X.W.), 2017M612596 (Z.-X.W),
2018M632998 (X.-K.H.), 2020T130142ZX (X.-K.H.)), the Key Laboratory of Lumi-
nescence and Real-Time Analytical Chemistry (Southwest University) Ministry of
Education Open Funding (Grant No. 201813 (Z.-X.W.)), the Hunan Provincial
Innovation Foundation for Postgraduate (Grant Nos. CX2018B045 (Y.Z.),
CX20190148 (Z.-W.L.)), and the Free Exploration Program of Central South Uni-
versity (Grant No. 502221901 (S.-S.R.)).
Author contributions
H.X., Z.-X.W. and C.-Y.C. conceived and designed the experiments. Z.-W.L., F.-X.-Z.L.,
Z.-X.W., S.-S.R., Y.-W.L., Y.-Y.W., G,-Q.Z., J.-S.G, J.-T.Z., Y.-J.T., H.Y., Y.-Y.L., and Z.-
H.H. performed the experiments. Z.-W.L., F.-X.-Z.L., Z.-X.W., J.C., Q.W., C.-Y.C., Y.Z.,
Y.H., X.-K.W., L.R., Z.-Z.L., X.-K.H., L.-Q.Y., R.X. and H.X. analyzed and interpreted the
data. H.X., C.-Y.C., and Z.-X.W. wrote the manuscript.
Competing interests
The authors declare no competing interests.
Additional information
Supplementary information The online version contains supplementary material
available at https://doi.org/10.1038/s41467-022-29191-x.
Correspondence and requests for materials should be addressed to Chun-Yuan Chen or
Hui Xie.
Peer review information Nature Communications thanks Patrick D’Haese, Marc Wein
and the other, anonymous, reviewer(s) for their contribution to the peer review of this
work. Peer reviewer reports are available.
Reprints and permission information is available at http://www.nature.com/reprints
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Open Access This article is licensed under a Creative Commons
Attribution 4.0 International License, which permits use, sharing,
adaptation, distribution and reproduction in any medium or format, as long as you give
appropriate credit to the original author(s) and the source, provide a link to the Creative
Commons license, and indicate if changes were made. The images or other third party
material in this article are included in the article’s Creative Commons license, unless
indicated otherwise in a credit line to the material. If material is not included in the
article’s Creative Commons license and your intended use is not permitted by statutory
regulation or exceeds the permitted use, you will need to obtain permission directly from
the copyright holder. To view a copy of this license, visit http://creativecommons.org/
licenses/by/4.0/.
© The Author(s) 2022