Bioinformatics 1 PDF

INSTITUTE OF ENGINEERING & MANAGEMENT, KOLKATA
1
General INTRODUCtion to
bioinformatics
2
“Bioinformatics”
• general definition: computational techniques for solving biological
problems
– data problems: representation (graphics), storage and retrieval

(databases), analysis (statistics, artificial intelligence, optimization,
etc.)
–biology problems: sequence analysis, structure or function

prediction, data mining, etc.
• also called computational biology
3
CENTRAL DOGMA
4
DNA
• can be thought of as the “recipe” for an organism
• composed of small molecules called nucleotides

– four different nucleotides distinguished by the four
bases: adenine (A), cytosine (C), guanine (G) and
thymine (T)
• is a polymer: large molecule consisting of similar units

(nucleotides in this case)
• a single strand of DNA can be thought of as a string

composed of the four letters: A, C, G, T
ctgctggaccgggtgctaggaccctgactgcccggg
gccgggggtgcggggcccgctgag…
5
The Double Helix

• DNA molecules usually consist arranged in the famous
double helix
6
Watson-Crick Base Pairs
• in double-stranded DNA
A always bonds to T
C always bonds to G
7
The Double Helix
• each strand of DNA has a “direction”

– at one end, the terminal carbon atom in the backbone is
the 5’ carbon atom of the terminal sugar
– at the other end, the terminal carbon atom is the 3’
carbon atom of the terminal sugar
• therefore we can talk about the 5’ and the 3’ ends of a

DNA strand
• in a double helix, the strands are antiparallel (arrows

drawn from the 5’ end to the 3’ end go in opposite
directions)
8
9
Chromosomes
• DNA is packaged into individual chromosomes
• prokaryotes (single-celled organisms lacking nuclei)

typically have a single circular chromosome
– examples: bacteria, archea
• eukaryotes (organisms with nuclei) have a species-specific

number of linear chromosomes
– examples: animals, plants, fungi
10
Genomes
• the term genome refers to the complete complement of

DNA for a given species
."
• the human genome consists of 23 pairs of chromosomes
– mosquitos have 3 pairs
– camels have 35 pairs
• every cell (except sex cells and mature red blood cells)
contains the complete genome of an organism
11
Genes
• genes are the basic units of heredity
• a gene is a sequence of bases that carries the information

required for constructing a particular protein (more
accurately, polypeptide)
• such a gene is said to encode a protein
• the human genome comprises ~ 25,000 protein-coding

genes
12
Gene Density
• not all of the DNA in a genome encodes protein:
bacteria ~90% coding gene/kb
human ~1.5% coding gene/35kb
13
Central Dogma
14
RNA
• RNA is like DNA except:

– backbone is a little different
– often single stranded
– the base uracil (U) is used in place of thymine (T)
• a strand of RNA can be thought of as a string composed of

the four letters: A, C, G, U
15
16
Transcription
• RNA polymerase is the enzyme that builds an RNA strand

from a gene
• RNA that is transcribed from a gene is called messenger

RNA (mRNA)
17
Central Dogma
18
Proteins
• proteins are molecules composed of one or more

Polypeptides
• a polypeptide is a polymer composed of amino acids
• cells build their proteins from 20 different amino acids
• a polypeptide can be thought of as a string composed from

a 20-character alphabet
19
Protein Functions
• structural support
• storage of amino acids
• transport of other substances
• coordination of an organism’s activities
• response of cell to chemical stimuli
• movement
• protection against disease
• selective acceleration of chemical reactions 20

Essential and non-essential
Nutritionists divide amino acids into two groups - essential amino

acids (must be in the diet because cells can’t synthesize them) and
non-essential amino acids (can be made by cells).
This classification of amino acids has little to do with the

structure of amino acids.
Some amino acids that are normally nonessential, may need to be

obtained from the diet in certain cases. Individuals who do not
synthesize sufficient amounts of arginine, cysteine, glutamine,
proline, selenocysteine, serine, and tyrosine, due to illness, for
example, may need dietary supplements containing these amino
acids. 21
22
23
Amino Acids
Alanine Ala A
Arginine Arg R
Aspartic Acid Asp D
Asparagine Asn N
Cysteine Cys C
Glutamic Acid Glu E
Glutamine Gln Q
Glycine Gly G
Histidine His H
Isoleucine Ile I
Leucine Leu L
Lysine Lys K
Methionine Met M
Phenylalanine Phe F
Proline Pro P
Serine Ser S
Threonine Thr T
Tryptophan Trp W
Tyrosine Tyr Y
Valine Val V
24
Amino Acid Sequence: Hexokinase
1AASXDXSLVEVHXXVFIVPPXILQAVVSIA
31 T T R X D D X D S A A A S I P M V P G W V L K Q V X G S Q A
61 G S F L A I V M G G G D L E V I L I X L A G Y Q E S S I X A
91 S R S L A A S M X T T A I P S D L W G N X A X S N A A F S S
121 X E F S S X A G S V P L G F T F X E A G A K E X V I K G Q I
151 T X Q A X A F S L A X L X K L I S A M X N A X F P A G D X X
181 X X V A D I X D S H G I L X X V N Y T D A X I K M G I I F G
211 S G V N A A Y W C D S T X I A D A A D A G X X G G A G X M X
241 V C C X Q D S F R K A F P S L P Q I X Y X X T L N X X S P X
271 A X K T F E K N S X A K N X G Q S L R D V L M X Y K X X G Q
301 X H X X X A X D F X A A N V E N S S Y P A K I Q K L P H F D
331 L R X X X D L F X G D Q G I A X K T X M K X V V R R X L F L
361 I A A Y A F R L V V C X I X A I C Q K K G Y S S G H I A A X
391 G S X R D Y S G F S X N S A T X N X N I Y G W P Q S A X X S
421 K P I X I T P A I D G E G A A X X V I X S I A S S Q X X X A
451 X X S A X X A
• enzyme involved in glycolysis

• in every organism known from bacteria to humans
25
Space-Filling Model of Hexokinase
26
Hemoglobin
▪ protein built from 4 polypeptides

▪• responsible for carrying oxygen in red blood cells
27
AMINO ACID
28
Building Polypeptides
Although amino acids serve other functions in cells, their most

important role is as constituents of proteins.
Proteins, as we noted earlier, are polymers of amino acids.
Amino acids are linked to each other by peptide bonds, in which the
carboxyl group of one amino acid is joined to the amino group of
the next, with the loss of a molecule of water
29
Additional amino acids are added in the same way, by formation of

peptide bonds between the free carboxyl on the end of the growing
chain and the amino group of the next amino acid in the sequence.
A chain made up of just a few amino acids linked together is called

an oligopeptide (oligo=few) while a typical protein, which is made
up of many amino acids is called a polypeptide (poly=many).
The end of the peptide that has a free amino group is called the
N-terminus (for NH2), while the end with the free carboxyl is
termed the C-terminus (for carboxyl).
30
31
The peptide bond
32
THE ACID-BASE BEHAVIOUR OF AMINO ACIDS
Amino acids as zwitterions
Zwitterions in simple amino acid solutions

An amino acid has both a basic amine group and an acidic carboxylic
acid group.
33
There is an internal transfer of a hydrogen ion from the -COOH group to

the -NH2 group to leave an ion with both a negative charge and a positive
charge.
This is called a zwitterion.
A zwitterion is a compound with no overall

electrical charge, but which contains separate
parts which are positively and negatively
charged.
34
Adding an alkali to an amino acid solution

If you increase the pH of a solution of an amino acid by adding
hydroxide ions, the hydrogen ion is removed from the
-NH3+ group.
35
Adding an acid to an amino acid solution

If you decrease the pH by adding an acid to a solution of an amino
acid, the -COO- part of the zwitterion picks up a hydrogen ion.
36
That ion contains two acidic hydrogens - the one in the -COOH
group and the one in the -NH3+ group.
The more acidic of these is the one in the -COOH group, and so that
is removed first - and you get back to the zwitterion.
The pH at which this lack of movement during

electrophoresis happens is known as the isoelectric
point of the amino acid. This pH varies from amino acid to
amino acid.
37
That ion contains two basic groups - the -NH2 group and the
-COO- group. The -NH2 group is the stronger base, and so picks up
hydrogen ions first. That leads you back to the zwitterion again.
38
Why isn't the isoelectric point of an amino acid at pH 7?
When an amino acid dissolves in water, the situation is a little bit more
complicated than we tend to pretend at this level. The zwitterion
interacts with water molecules - acting as both an acid and a base.
As an acid:
39
The -NH3+ group is a weak acid and donates a hydrogen ion to a

water molecule. Because it is only a weak acid, the position of
equilibrium will lie to the left.
The -COO- group is a weak base and takes a hydrogen ion from a
water molecule. Again, the equilibrium lies to the left.
When you dissolve an amino acid in water, both of these reactions

are happening.
But . . .
The positions of the two equilibria aren't identical - they vary
depending on the influence of the "R" group.
40
Translation
• ribosomes are the machines that synthesize proteins from

mRNA
• the grouping of codons is called the reading frame
• translation begins with the start codon
• translation ends with the stop codon
41
Codons and Reading Frames
42
The Genetic Code
43
44
45
Third-Base Degeneracy (and the Wobble Hypothesis)

•Codon-anticodon pairing is the crucial feature of the
"reading of the code"
Crick's Wobble Hypothesis argues for the second possibility

-the first base of the anticodon (which matches the 3rd base
of the codon) is referred to as the "wobble position"
46
47
48
49
50
51
52
53
Components of Translation• mRNA:–
Eukaryotes: made in the nucleus,transported to the

cytoplasm.–Prokaryotes:transcription and translation occur
concurrently.
•tRNA:Adaptor molecules that mediate the transfer of information from

nucleic acids to protein
•Ribosomes: manufacturing units of a cell; located in the cytoplasm.

Contain ribosomal RNA and proteins.
•Enzymes: required for the attachment of amino acids to the correct

tRNA molecule, and for peptide bond formation between amino acids.
•Proteins: soluble factors necessary for proper initiation, elongation

and termination of translation
54
Ribosomes: Where the translation happens

Translation takes place inside structures called ribosomes, which are
made of RNA and protein. Ribosomes organize translation and catalyze
the reaction that joins amino acids to make a protein chain.
55
Structure of the ribosome
A ribosome is made up of two basic pieces: a large and a small

subunit.
During translation, the two subunits come together around a

mRNA molecule, forming a complete ribosome.
The ribosome moves forward on the mRNA, codon by codon, as it

is read and translated into a polypeptide (protein chain).
Then, once translation is finished, the two pieces come apart

again and can be reused.
56
Below, you can see a 3D model of the ribosome. Proteins are

colored in blue, while strands of rRNA are colored in tan and orange.
The green spot marks the active site, which catalyzes the reaction
that links amino acids to make a protein.
57
tRNA
The amino acid attaches to the 3’ end of the

tRNA
tRNA can base pair with the codon in mRNA

at the anticodon on the tRNA
58
59
Charging tRNA with an Amino Acid
An individual tRNA is specific for a single amino acid. (There are at

least 20 different tRNAs)
Charging is the process of covalently attaching an amino acid to the

tRNA
Charging is accomplished by aminoacyl tRNA synthetases, each of

which is specific for an amino acid.
60
61
62
63
64
65
66
67
68
69
70
Thank
You
71

Bioinformatics 1 PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Bioinformatics 1 PDF

Uploaded by

Copyright:

Available Formats

INSTITUTE OF ENGINEERING & MANAGEMENT, KOLKATA

– data problems: representation (graphics), storage and retrieval

–biology problems: sequence analysis, structure or function

• also called computational biology

• composed of small molecules called nucleotides

• is a polymer: large molecule consisting of similar units

• a single strand of DNA can be thought of as a string

The Double Helix

Watson-Crick Base Pairs

The Double Helix

• each strand of DNA has a “direction”

• therefore we can talk about the 5’ and the 3’ ends of a

• in a double helix, the strands are antiparallel (arrows

• DNA is packaged into individual chromosomes

• prokaryotes (single-celled organisms lacking nuclei)

• eukaryotes (organisms with nuclei) have a species-specific

• the term genome refers to the complete complement of

• genes are the basic units of heredity

• a gene is a sequence of bases that carries the information

• such a gene is said to encode a protein

• the human genome comprises ~ 25,000 protein-coding

• not all of the DNA in a genome encodes protein:

bacteria ~90% coding gene/kb

human ~1.5% coding gene/35kb

• RNA is like DNA except:

• a strand of RNA can be thought of as a string composed of

• RNA polymerase is the enzyme that builds an RNA strand

• RNA that is transcribed from a gene is called messenger

• proteins are molecules composed of one or more

• a polypeptide is a polymer composed of amino acids

• cells build their proteins from 20 different amino acids

• a polypeptide can be thought of as a string composed from

• storage of amino acids

• transport of other substances

• coordination of an organism’s activities

• response of cell to chemical stimuli

• protection against disease

• selective acceleration of chemical reactions 20

Essential and non-essential

Nutritionists divide amino acids into two groups - essential amino

This classification of amino acids has little to do with the

Some amino acids that are normally nonessential, may need to be

Amino Acid Sequence: Hexokinase

• enzyme involved in glycolysis

Space-Filling Model of Hexokinase

▪ protein built from 4 polypeptides

Although amino acids serve other functions in cells, their most

Proteins, as we noted earlier, are polymers of amino acids.

Additional amino acids are added in the same way, by formation of

A chain made up of just a few amino acids linked together is called

The peptide bond

THE ACID-BASE BEHAVIOUR OF AMINO ACIDS

Amino acids as zwitterions

Zwitterions in simple amino acid solutions

There is an internal transfer of a hydrogen ion from the -COOH group to

A zwitterion is a compound with no overall

Adding an alkali to an amino acid solution

Adding an acid to an amino acid solution

The pH at which this lack of movement during

Why isn't the isoelectric point of an amino acid at pH 7?

The -NH3+ group is a weak acid and donates a hydrogen ion to a

When you dissolve an amino acid in water, both of these reactions

• ribosomes are the machines that synthesize proteins from