7.

1 DNA structure and replication– HL

DNA Structure

Rosalind Franklin’s X-ray diffraction provided crucial evidence that DNA is a double helix.

 Performed X-ray to identify the 3D structure of DNA

 Discovered that DNA is a double helix

Analysis of results of the Hershey and Chase experiment providing evidence that DNA is the genetic
material.

Phages were used as follows:

 Phages’ protein coat was labelled using a radioactive isotope (sulfur) – 35S marks
proteins/makes proteins radioactive (this is because Phosphorus is found in nucleic acids/not
found in proteins) - all new phages’ proteins had no radioactivity/ Radioactive sulfur was found
in the liquid.
 Phages’ DNA was labelled using another radioactive isotope (phosphorus) – 32P marks Nucleic
acids/makes nucleic acids radioactive(this is because Sulphur is found in proteins/not found in
nucleic acids - all new phages’ DNA had radioactivity/ Radioactive phosphorus was found in the
pellet.

Conclusion: DNA is the genetic material

1
Nucleosomes help to supercoil the DNA.

 A nucleosome consists of DNA wrapped around 8 histone proteins.

 The DNA wraps twice around the histone protein core.
 Another histone protein is attached to the outside of the DNA strand. It
helps maintain the colloidal structure of the nucleosome.

DNA Replication

 Occurs in the nucleus

 occurs in a 5'→3' direction
 Requires energy

 Details of DNA replication differ between prokaryotes and eukaryotes. Only the prokaryotic
system is expected.

Remember:

The 5' (prime) end of the free nucleotide is added to the 3' (prime) end of the nucleotide chain that is
already formed.

DNA replication is carried out by a complex system of enzymes:

1. Helicase: unwinds the DNA double helix by breaking the hydrogen bonds between the bases.
2. Single strand binding proteins (SSBs): attach to the DNA strands preventing them from re-annealing.
3. DNA gyrase: (also called topoisomerase) relieves strain on the strand outside the replication fork as it is
being unwound by the helicase
4. DNA primase: synthesizes a short RNA primer on DNA.
5. DNA polymerase III: adds nucleotides to the 3’ end of a primer (in 5’ to 3’ direction)
6. DNA polymerase I: removes the RNA primer and replaces it with DNA
7. DNA ligase: joins the Okazaki fragments on the lagging strand.

*Free nucleotides in the nucleus = deoxynucleoside triphosphates 2

1. Helicase enzyme unwinds and separates the DNA strands by breaking the hydrogen bonds between
the bases.
2. Two replication forks are created and two single DNA strands are exposed. (Remember that Helicase
is fed through the replication fork)
3. DNA gyrase (also called topoisomerase) relieves strain on the strand outside the replication fork as
it is being unwound by the helicase
4. Single-strand binding proteins (SSBs) coat the DNA strands preventing them from re-annealing.
5. DNA primase uses the original DNA strand as a template to synthesize a short RNA strand called
RNA primer. (Remember that DNA polymerase III can only extend the nucleotide chain and doesn’t
start one, and therefore the RNA primers are needed to initiate the replication process).
6. The RNA primer allows DNA polymerase III to bind and start replication.
7. DNA Polymerase III begins to synthesize a new DNA strand by adding nucleotides to each template
strand in a 5'→3' direction.
8. These nucleotides are initially deoxynucleoside triphosphates but they lose two phosphate groups
during the replication process to release energy.
9. One strand is replicated in a continuous manner in the same direction as the replication fork
(leading strand)
10. The other strand is replicated discontinuously and in fragments (Okazaki fragments) in the opposite
direction (lagging strand)
11. DNA Polymerase I removes the RNA primer and replaces it with DNA.
12. DNA ligase then joins the Okazaki fragments together to form a continuous strand.

3
Some regions of DNA do not code for proteins but have other important functions

The regions of DNA that do not code for proteins include:

1. regulators of gene expression, such as:

 Enhancers are short DNA sequences that regulatory proteins bind to, to activate transcription.

 Silencers are DNA sequences that bind regulatory proteins called repressors that prevent RNA
polymerase from binding to the promoter site, thereby preventing transcription.

2. introns
 found in eukaryotes’ DNA only
 non-coding regions of mRNA

4
  are removed from mRNA during transcription

3. telomeres
 mainly in eukaryotes
 repetitive sequences
 Occurs on the ends of eukaryotic chromosomes.
 make up 5-60% of the genome
 protect the DNA during replication: since enzymes can’t replicate all the way to the end of the
chromosome, the parts that aren’t copied are part of the telomeres. This prevents the loss of
genes near the end of the chromosomes.
 Highly repetitive sequences were once classified as “junk DNA” showing a degree of confidence
that it had no role.

4. genes for tRNAs

5. Tandem repeats
 Short tandem repeats (STRs), also known as variable tandem repeats (VNTRs)
 are regions of noncoding DNA that contain repeats of the same nucleotide sequence.
 show variations between individuals in terms of the number of times the sequences is
repeated.
 For example, CATACATACATACATACATACATA is a STR where the nucleotide sequence CATA is
repeated six times for one individual. However, in another individual, this tandem repeat could
occur only 4 times CATACATACATACATA.
 Tandem repeats are used in DNA profiling (in crime scene investigations and paternity tests):
 Fragments are replicated
 Gel electrophoresis is used to separate fragments
 Separation depends upon length of fragment
 Creating bands on a profile (for identification)

Use of nucleotides containing dideoxyribonucleic acid

 Dideoxyribonucleotides are used for base sequencing (Sanger Dideoxy Strategy)

 Dideoxyribonucleotides inhibit DNA polymerase during replication, thereby stopping
replication from continuing.
 Dideoxyribonucleotides with fluorescent markers, are used and incorporated into sequences of
DNA, to stop replication at the point at which they are added. This creates different sized
fragments with fluorescent markers that can be separated by gel electrophoresis and analyzed
by comparing the colour of the fluorescence with the fragment length.

5
6