Senior High School

NOT

General Biology 2
Quarter 3 - Module 1
GENETICS

GENERAL BIOLOGY 2

Department of Education ● Republic of the Philippines

1
General Biology 2- Grade 12
Alternative Delivery Mode
Quarter 3 - Module 1: Genetics
First Edition, 2020

Republic Act 8293, section 176 states that: No copyright shall subsist in any work of
the Government of the Philippines. However, prior approval of the government agency or office
wherein the work is created shall be necessary for exploitation of such work for profit. Such
agency or office may, among other things, impose as a condition the payment of royalty.

Borrowed materials (i.e., songs, stories, poems, pictures, photos, brand names,
trademarks, etc.) included in this book are owned by their respective copyright holders. Every
effort has been exerted to locate and seek permission to use these materials from their
respective copyright owners. The publisher and authors do not represent nor claim ownership
over them.

Published by the Department of Education – Division of Cagayan de Oro Schools

Division Superintendent: Dr. Cherry Mae L. Limbaco, CESO V

Development Team of the Module

Author:

Reviewers: Jean S. Macasero, Shirley Merida, Duque Caguindangan, Eleanor Rollan,

Rosemarie Dullente, Marife Ramos, January Gay Valenzona, Mary Sieras, Arnold Langam,
Amelito Bucod, Adam Ray H. Manlunas

Illustrators and Layout Artists: Jessica Bunani Cuňado, Kyla Mae L. Duliano

Management Team
Chairperson: Cherry Mae L. Limbaco, Ph.D., CESO V
Schools Division Superintendent

Co-Chairperson: Rowena H. Paraon, Ph.D., CESE

Assistant Schools Division Superintendent

Members Lorebina C. Carrasco, OIC-CID Chief

Jean S. Macasero, EPS- Science
Joel D. Potane, LRMDS Manager
Gemma P. Pajayon – PDO II
Lanie M. Signo – Librarian II
Evelyn Q. Sumanda, School Head
Cely B. Labadan, School Head
Printed in the Philippines by
Department of Education – Division of Cagayan de Oro City
Office Address: Fr. William F. Masterson Ave Upper Balulang Cagayan de Oro
Telefax: (08822)855-0048
E-mail Address: cagayandeoro.city@deped.gov.ph

2
 Senior
Senior High
High School
School

General Biology
2
Quarter 3 - Module 1:
Genetics

This instructional material was collaboratively developed and reviewed

by educators from public and private schools, colleges, and or/universities. We
encourage teachers and other education stakeholders to email their feedback,
comments, and recommendations to the Department of Education at action@
deped.gov.ph.

We value your feedback and recommendations.

Department of Education ● Republic of the Philippines

3
This page is intentionally blank

4
 Table of Contents

What This Module is About ................................................................................................................... i

What I Need to Know .............................................................................................................................. ii
How to Learn from this Module ...........................................................................................................ii
Icons of this Module ...............................................................................................................................iii

What I Know ........................................................................................................................................... iii

First Quarter
Lesson 1: Genetic Engineering
What I Need to Know..................................................................................................10
What’s I Know: Definition of Terms.........................................................................10
What New .......................................................................................................................10
What is It: Leaning Concepts………………………………………………………….11

What’s More: Poster Making………………………………………………………….12

What’s I’ve learned: Determining Genetic Technology…. ................................13
What I Can Do: Pros and Cons ...............................................................................13

Lesson 2: Applications of Recombinant DNA

What I Need to Know..................................................................................................14

What’s I Know: Definition of Terms.........................................................................14

What’s New: Designer Genes ..................................................................................14

What’s Is It: Learning Concepts ……………………………………………………..15

What’s More: ...............................................................................................................18

What I’ve Learned…………………………………..........................................18

5
This page is intentionally blank

6
 Module 1
Genetics
What This Module is About

This module demonstrates your understanding of the characteristics of Earth

that are necessary to support life, particularly on the essential components of this
planet that drives all living things or biotic factors (plants, animals, microorganisms) to
exist. It also emphasizes on the different subsystems (geosphere, hydrosphere,
atmosphere, and biosphere) that make up the Earth and how these systems interact
to produce the kind of Earth we live in today.

This module will help you explore the key concepts on topics that will help you
answer the questions pertaining to our very own, planet earth.

This module has two (2) lessons:

• Lesson 1: Genetic Engineering
• Lesson 2: Applications of Recombinant DNA

What I Need to Know

After going through this module, you are expected to:
1. Outline the processes involved in genetic engineering. (STEM_BIO11/12-IIIa-b-6)

2. Discuss the applications of recombinant DNA. (STEM_BIO11/12-IIIa-b-7)

3. Describe general features of the history of life on Earth, including generally accepted
dates and sequence of the geologic time scale and characteristics of major groups of
organisms present during these time periods. (STEM_BIO11/12-IIIc-g-8)

7
How to Learn from this Module

To achieve the learning competencies cited above, you are to do the following:
• take your time reading the lessons carefully.
• follow the directions and/or instructions in the activities and exercises diligently.
• answer all the given tests and exercises.

Icons of this Module

What I Need to This part contains learning objectives that

Know are set for you to learn as you go along the
module.

What I know This is an assessment as to your level of

knowledge to the subject matter at hand,
meant specifically to gauge prior related
knowledge
What’s In This part connects previous lesson with that
of the current one.

What’s New An introduction of the new lesson through

various activities, before it will be presented
to you

What is It These are discussions of the activities as a

way to deepen your discovery and under-
standing of the concept.

What’s More These are follow-up activities that are in-

tended for you to practice further in order to
master the competencies.

What I Have Activities designed to process what you

Learned have learned from the lesson

What I can do These are tasks that are designed to show-

case your skills and knowledge gained, and
applied into real-life concerns and situations.

II

8
This page is intentionally blank

9
 Lesson
Genetic Engineering
1
What I need to know

Learning Competency
The learners should be able to outline the steps involved in genetic engineering
(STEM_BIO11/12-III a-b-6)

At the end of the lesson, the learners will be able to:

• compare classical breeding with modern genetic engineering techniques;
• enumerate the steps in molecular cloning;
• describe some methods to introduce DNA into cells; and
• explain the selection and screening of transformants / genetically modified
organisms (GMOs)

What I know

Definition of Terms:

1. Genetic Engineering 6. Genome

2. DNA 7. Gene Mapping
3. Recombinant DNA 8. Biotechnology
4. Plasmids 9. Polymerase Chain Reaction
5. Cloning 10. Gene Therapy

What’s New

PRE-ACTIVITY:

1. How organisms may be modified?

2. Enumerate plants and animals that have desirable or enhanced traits and how each of the traits
was introduced or developed. Modifying Technique ex. Classical Breeding, Recombinant DNA
Technology.

10
 ENHANCED TRAIT MODIFYING TECHNIQUE
Example: Flavr-Savr (Delayed Ripening Recombinant DNA Technology
Tomatoes
1. 1.
2. 2.
3. 3.
4. 4.
5. 5.

What’s is it

INTRODUCTION:

❖ Genetic engineering, the artificial manipulation, modification, and recombination of DNA or

other nucleic acid molecules in order to modify an organism or population of organisms.
❖ The term genetic engineering initially referred to various techniques used for the modification
or manipulation of organisms through the processes of heredity and reproduction. As such,
the term embraced both artificial selection and all the interventions of biomedical techniques,
among them artificial insemination, in vitro fertilization (e.g., “test-tube” babies), cloning, and
gene manipulation.
https://www.britannica.com/science/genetic-engineering

❖ Classical plant breeding uses deliberate interbreeding (crossing) of closely or distantly related
individuals to produce new crop varieties or lines with desirable properties. Plants are
crossbred to introduce traits/genes from one variety or line into a new genetic background.
https://www.sciencedaily.com/terms/plant_breeding.htm#:~:text=Classical%20plant%20breeding%20uses%20deliberate,i
nto%20a%20new%20genetic%20background.

❖ Genetic engineering is the process of using recombinant DNA (rDNA) technology to alter the
genetic makeup of an organism. Traditionally, humans have manipulated genomes indirectly
by controlling breeding and selecting offspring with desired traits. Genetic engineering
involves the direct manipulation of one or more genes. Most often, a gene from another
species is added to an organism's genome to give it a desired phenotype.
https://www.genome.gov/genetics-glossary/Genetic
Engineering#:~:text=Genetic%20engineering%20is%20the%20process,selecting%20offspring%20with%20desired%20traits.

Genetic engineering involves the use of molecular techniques to modify the traits of a target
organism. The modification of traits may involve:
1. introduction of new traits into an organism;
2. enhancement of a present trait by increasing the expression of the desired gene; and
3. enhancement of a present trait by disrupting the inhibition of the desired genes’ expression.
A general outline of recombinant DNA may be given as follows:
1. cutting or cleavage of DNA by restriction enzymes (REs)
2. selection of an appropriate vector or vehicle which would propagate the recombinant DNA (
eg. circular plasmid in bacteria with a foreign gene of interest)

11
 3. ligation (join together) of the gene of interest (eg. from animal) with the vector (cut bacterial
plasmid)
4. transfer of the recombinant plasmid into a host cell (that would carry out replication to make
huge copies of the recombined plasmid)
5. selection process to screen which cells actually contain the gene of interest
6. sequencing of the gene to find out the primary structure of the protein

Ways in which these plasmids may be introduced into host organisms:

❖ Biolistics. In this technique, a “gene gun” is used to fire DNA-coated pellets on plant tissues.
Cells that survive the bombardment, and are able to take up the expression plasmid coated
pellets and acquire the ability to express the designed protein.
❖ Plasmid insertion by Heat Shock Treatment. Heat Shock Treatment is a process used to
transfer plasmid DNA into bacteria. The target cells are pre-treated before the procedure to
increase the pore sizes of their plasma membranes. This pretreatment (usually with CaCl2) is
said to make the cells “competent” for accepting the plasmid DNA. After the cells are made
competent, they are incubated with the desired plasmid at about 4°C for about 30min. The
plasmids concentrate near the cells during this time. Afterwards, a “Heat Shock” is done on
the plasmid-cell solution by incubating it at 42°C for 1 minute then back to 4°C for 2 minutes.
The rapid rise and drop of temperature is believed to increase and decrease the pore sizes in
the membrane. The plasmid DNA near the membrane surface are taken into the cells by this
process. The cells that took up the plasmids acquire new traits and are said to be
“transformed”.
❖ Electroporation. This technique follows a similar methodology as Heat Shock Treatment, but,
the expansion of the membrane pores is done through an electric “shock”. This method is
commonly used for insertion of genes into mammalian cells.

Some methods are:

• Selection of plasmid DNA containing cells
• Selection of transformed cells with the desired gene
• PCR detection of plasmid DNA
• Genetically Modified Organisms (GMOs)

What’s More

Poster Making:

Create a poster on the steps and other methods involved in recombinant DNA.

12
 What’s I’ve Learned

POST QUIZ:

1. Determine which technologies are most appropriate for which cell types.

TECHNOLOGY CELL TYPE

1 Plants cells
2. Electroporation
3.Biolistics
4. Bacterial cells
5. Mammalian cells

What’s I can do
PERFORMANCE TASK:

1. Research on the pros and cons of genetic engineering.

PROS CONS
1.
2.
3.
4.
5.
2. What is your opinion on Genetic Engineering? Note: Support your opinion with facts and include
the issue of biosafety.

RECOMMENDED READINGS:

1. https://www.ck12.org/book/human-biology-genetics/section/10.1/
2.https://www.ck12.org/c/biology/biotechnology/lesson/Biotechnology-
BIO/?referrer=concept_details
3.https://www.khanacademy.org/science/biology/biotech-dna-technology/intro-to-biotech-
tutorial/a/intro-to-biotechnology

13
 Lesson Discuss the Applications of
2 Recombinant DNA

What I need to know

Learning Competency:
The learners should be able to discuss the applications of Recombinant DNA
Technology (STEM_BIO11/12-III a-b-7)

Specific Learning Outcomes:

At the end of the lesson, the learners will be able to:
• give examples of products from recombinant DNA technology;
• illustrate the use of databases to search genes for desired traits;
• describe steps in PCR to amplify and detect a gene of interest;
• identify the parts of an expression vector;
• explain how genes may be cloned and expressed

What I know

PRIOR KNOWLEDGE: Definition of Terms

1. Clone 6. Modified Trait

2. Plasmids 7. Human Genome
3. Biotechnology 8. Genetic Modified Organism
4. PCR Amplification
5. Detection

What’s New

PRE-ACTIVITY: Designer Genes Work

1. How does DNA Replicate?
2. What is Genetically Modified Organism (GMO)?
3. Illustrate your own Designer genes based on the following:
1. Identify a special trait.
2. Identify a source organism.
3. Identify a target organism.
4. Identify the modified/ added trait.
Example: Hot Tomato > Chili > Tomato > Spicy Tomato

14
Tomatoes

It was reported this week that Brazilian scientists are hoping to create spicy tomatoes using Crispr
gene-editing techniques. Although tomatoes contain the genes for capsaicinoids (the chemicals that
give chillies their heat) they are dormant – Crispr could be used to make them active. This is desirable
because, compared to tomatoes, chillies are difficult to farm – and capsaicinoids have other useful
applications besides their flavour – in pepper spray for example.
https://www.theguardian.com/science/2019/jan/13/the-five-genetically-modified-fruit-edited-bananas-tomatoes

What’s is It

INTRODUCTION:

PRESENTATION OF RECOMBINANT DNA

There are many different traits that can be introduced to organisms to change their properties. The
following table shows examples of modified traits using cloned genes and their applications:

MODIFIED TRAIT GENE MODIFICATION RECIPIENT APPLICATION (FIELD)

ORGANISM
Insulin Production Insertion of Human Bacteria (Medicine)
Insulin Gene Production of Human Insulin in
Bacteria
Pest Resistance Insertion of Bt-toxin Corn / Maize (Agriculture)
gene Production of corn plants with
increased resistance to corn
boxer
Delayed Ripening Disruption of a gene Tomato plant Agriculture)
for a ripening enzyme Production of plants with fruits
(e.g. that have delayed ripening
polygalacturonase) fruits. These fruits will survive
longer transport time, allowing
their delivery to further
locations (i.e. export deliveries)
Chymosin Production Insertion of a gene for Bacteria (Industry)
chymosin Enhance large scale production
of chymosin. This enzyme serves
as a substitute for rennet in the
coagulation of milk. Rennet has
to be harvested from calves. The
large scale production of this
enzyme in bacteria provides an
abundant supply of this
important component for the
cheese production industry.

15
 ❖ PCR Amplification
Once a desired trait is chosen, information must be acquired for either its detection or expression in
a given organism.

1. Detection
❖ Some researchers may be interested in determining if a given gene/trait is available in a
particular organism. If no previous research provides this information, researchers may test
the DNA of different organisms for the presence of these specific genes. A technique that
allows the detection of specific genes in target organisms is called PCR.
❖ PCR amplification is an in-vitro method that simulates DNA replication in vivo. It utilizes a
thermostable (heat-resistant) DNA polymerase that builds single stranded DNA strands unto
unwound DNA templates.
❖ PCR uses repeated cycles of incubation at different temperatures to promote the unwinding
of the DNA template (~95°C); the annealing of a primer (a ~20bp oligonucleotide sequence
(recall RNA primers in DNA replication) onto the ssDNA template strand (~54 - 60°C); and the
extension of the generated ssDNA strand through the binding of complementary bases to the
template strand (~72° C). The thermostability of the polymerase allows it to survive the
repeated cycles of denaturation, annealing and extension with little loss of enzyme function.
Each cycle of PCR doubles the amount of the target sequence. A typical PCR experiment uses
about 35 cycles of amplification. This increases the original amount of the target sequence by
235 (i.e. ~34 billion) times.
❖ Gene detection by PCR involves the design of primers that would only bind to sequences that
are specific to a target. For example, researchers would want to find out if gene X (e.g. the
gene for insulin) is available in a target organism (e.g. a mouse, Mus musculus). Primers may
be designed by looking at the available sequences for gene X in the databases (e.g. all the
genes for insulin in different organisms; humans, pigs, cows, etc.). The different gene X
sequences must be aligned/ compared to match areas of sequence similarity (conserved
sequences) and areas of sequence dissimilarity (non-conserved sequences). Primers designed
to have the same sequence as the conserved areas will be specific for binding gene X
sequences in all the target organisms. Primers designed to have the same sequence as the
non-conserved areas will only be specific for the organisms which match its sequence.

Steps in PCR Amplification

❖ Step 0: Undenatured Template ; Temp ~ 54 °"C;

Template: double stranded (ds) DNA strand. Complementary sequences are held together by H-bonds
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)

❖ Step 1: Template denaturation ; Temp ~ 95 °"C;

Template: single stranded (ss) DNA strands; DNA strands are separated; H-bonds between
complementary sequences are broken
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)

16
 ❖ Step 2: Primer Annealing ; Temp ~ 54 °"C (dependent on primer melting temperature);
Template: ssDNA strands. H-bonds are formed between complementary sequences on the primers
and the target sequences.
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
Direction of elongation  CCATAGATC (Reverse Primer)
5’ GCGATGAGG 3’ → Direction of elongation (Forward Primer)

3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)

❖ Step 3: New DNA strand elongation ; Temp ~ 72 °"C;
The two new dsDNA strands are formed by the elongation of the generated ssDNA and the H-bonds
between the complementary sequences on these new strands and their templates. Each of the new
dsDNA strands is made up of one old strand from the original template, and one new strand that was
generated as a reverse complement of the template. This is called semiconservative replication of the
sequence.

New Strand 1:
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand) (old)
3’ CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC-5’ (Reverse Primer) (new)

New Strand 2:
5’ GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG-3’ (Forward Primer) (new)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand) (old)

❖ Step 4: Repeat step 1 to 3 for N number of cycles (N is usually 35)

PCR Results
The expected product of PCR amplification will depend on the sequences / position at which the
primer sequences bind. If the forward primer starts binding at nucleotide 3 (coming from the 5’ end)
of a 43bp long gene, and the reverse primer binds at a position complementary to nucleotide 39 of
the coding strand, then a 37bp product is expected per cycle of PCR.

PCR Applications

❖ PCR may be used to detect the presence of a desired gene in an organism. Depending on the
primer design, the expected product may represent only a specific region of the gene or the
entire gene itself. The first case is useful for detection of the gene, or the detection of
organisms with that specific gene within a sample. The second case is useful for the
amplification of the entire gene for eventual expression in other organisms. The direct
amplification/copying of a full gene is part of the process for “cloning” that gene.
2. Cloning and Expression
❖ Some genes provide economically, and industrially important products (e.g. insulin-coding
genes; genes for collagen degradation). In some cases, scientists would want to put these
genes into organisms for the expression of their products. One example would be the insertion
of an insulin- coding gene from the human genome into bacteria. This allows the
“transformed” bacteria to now produce human insulin as a product.
❖ Certain types of bacteria are capable of this process since they are able to take genes within
their cell membranes for eventual expression. The genes are normally in the form of small,
circular DNA structures called plasmids.

17
 What’s More

ACTIVITY:

1. Illustrate the steps in restriction digestion and PCR.

What’s I’ve learned

POST QUIZ:

1. Discuss how PCR may be used for the detection of disease-causing pathogens in a population during
the COVID Pandemic.
For example: it may be used to check if a patient has a COVID virus infection.
2. Discuss how the cloning and expression of certain genes allows for massive production of the
desired product.
For Example: the cloning and expression of insulin in bacteria allows for the mass
production of this necessary protein for use by diabetic patients.

RECOMMENDED READINGS:

1.https://flexbooks.ck12.org/cbook/ck-12-middle-school-life-science
2.0/section/3.18/primary/lesson/recombinant-dna-ms-ls
2. https://www.ck12.org/book/cbse_biology_book_class_xii/section/14.1/
3. https://www.ck12.org/section/dna-technology/

18