This article appeared in a journal published by Elsevier.

The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright
 Author's personal copy

Available online at www.sciencedirect.com

Clinical Biochemistry 41 (2008) 447 – 452

Diagnostic utility of hepatitis C virus core antigen in hemodialysis patients

Subhash Medhi a,b,⁎, Sai K. Potukuchi a , Sunil K. Polipalli a , Shyam S. Swargiary a,b , Purabi Deka a ,
Anish Choudhary c , Nargis Begum a,c , Zahid Hussain a,c , R.S. Ahlawat a , Premashis Kar a
a
PCR Hepatitis Laboratory, Department of Medicine, Maulana Azad Medical College and Lok Nayak Hospital, University of Delhi, New Delhi-110002, India
b
Department of Biotechnology, Gauhati University, Guwahati-781014, Assam, India
c
Human Genetics Laboratory, Department of Biosciences, Jamia Millia Islamia, New Delhi, 110025, India
Received 18 April 2007; received in revised form 24 December 2007; accepted 27 December 2007
Available online 11 January 2008

Abstract

Background: Patients undergoing hemodialysis are at high risk for Hepatitis C virus infection. Anti-HCV antibody detection is widely used for
screening this infection but is not sensitive for window period detection. An ELISA to detect the HCV Core Antigen has recently become
available.
Objectives: To investigate the utility of the HCV core Antigen ELISA in the detection of HCV infection in hemodialysis patients and to
compare with 3rd generation ELISA validated by real-time PCR.
Methods: Two hundred fifty hemodialysis patients were included in the study. Anti-HCV antibodies and Total HCVcAg was determined by
third generation ELISA kits. HCV RNA was determined using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) and sensitivity of the
two assays was confirmed by estimating viral load using real-time PCR.
Results: Forty-three out of 250 (17.2%) patients were positive for anti-HCV antibodies and HCVcAg. 13/250 (5.2%) were positive for
HCVcAg but anti-HCV negative, which is statistically significant (P b 0.05). All 13 were confirmed viremic by in-house nested RT-PCR leading to
specificity of 100%. Viral load of 49,258 ± 28,682 copies/mL were detected in HCVcAg positive cases in comparison to 239,383 ± 107,805 copies/
mL in the only anti-HCV positive group (P b 0.001). False negative cases for HCVcAg assay accounted for 2/250 (0.8%) in which the viral load was
306 ± 461 copies/mL which was significantly lower in comparison to HCVcAg positive group (P b 0.001, t-test = 9.982).
Conclusions: Total HCVcAg ELISA is an accurate serological marker for early identification of HCV infection, than is possible by currently
used serological assay. It will be useful for patients undergoing hemodialysis who have a longer window period due to immunosuppressed state. It
is both a cost-effective and a less labor-intensive alternative to PCR, enhancing its clinical utility.
© 2008 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Keywords: HCV: Hepatitis C Virus; Biomembranes; HCVcAg: HCV Core Antigen; RT-PCR: Reverse Transcriptase Polymerase Chain Reaction; Hemodialysis

Introduction Northern Africa. The lowest prevalence (0.01%–0. 1%) has

Hepatitis C Virus (HCV) is a positive stranded RNA virus
distantly related to the Flaviviruses, and has been classified into
the genus Hepacivirus of the family Flaviviridae [1]. More than
200 million people are infected with HCV with at least 70% of
acute infections progressing to chronic active hepatitis, cirrhosis
and hepatocellular carcinoma (HCC) [2]. Region-specific
estimates range from b1.0% in Northern Europe to N 2.9% in
⁎ Corresponding author. Room no. 101, B.L.Taneja Block, Maulana Azad
Medical College, New Delhi-110002, India. Fax: +91 011 23230132.
E-mail address: medhi_79@yahoo.co.uk (S. Medhi).
0009-9120/$ - see front matter © 2008 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
doi:10.1016/j.clinbiochem.2007.12.024
been reported from countries like United Kingdom and
Scandinavia; the highest prevalence (15%–20%) has been
reported from Egypt [3,4]. An estimated 27% of cirrhosis and
25% of HCC worldwide occur in HCV-infected people [5]. In
India approximately 2% of the population is infected with HCV
infection [6]. Parenteral route appears to be the major mode of
HCV transmission [7]. End stage renal disease (ESRD) patients
on maintenance hemodialysis (HD) are at an increased risk of
acquiring HCV infection and have higher prevalence of anti-
HCV antibodies than the general population [8].
Accurate diagnosis of active HCV infection is important not
only because of its associated morbidity and mortality but also
 Author's personal copy
448 S. Medhi et al. / Clinical Biochemistry 41 (2008) 447–452
due to the possibility of spontaneous or pharmacology induced
viremic clearance. Routine diagnosis of HCV is based on the
detection of anti-HCVantibodies but it goes undetected in the first
4 to 6 weeks of infection (Window Period) in immunocompetent
patients, whereas blunted or absent antibody response may occur
in immunosuppressed patients, during which period circulating
viral RNA is present. The window period can be longer in
hemodialysis patients as they are severely immunocompromised
[9] and are in high-risk group of HCV infection who need to be
screened routinely for HCV viremia. In addition, those who
spontaneously clear the infection may remain anti-HCV positive
for decades or even for life [10]. In chronic persistence hepatitis C
virus infection the individual may be symptom free and the
disease remains undiagnosed until the patient presents with liver
disease or its complications [11,12]. There are clear advantages to
target the screening of hepatitis C virus in asymptomatic people at
high risk [13]. The most recent serological tests yield false-
positive or indeterminate results at the rates of 11% or higher
[14,15]. A new immunoassay for the detection of hepatitis C core
antigen (Trak-C; Ortho-Clinical Diagnostics, Raritan, N.J.) was
designed for screening blood donors [16] and also for monitoring
treatment [17,18]. Recently, HCVcAg assay was used for
detection of HCV infection in hemodialysis patients from Tunisia
where it has been found that the test is relatively inexpensive and
specific to diagnose HCV infection during the window period
[19]. Direct detection of HCV has depended on nucleic acid
amplification technology (NAT) during the window period.
Positive result from NAT by Polymerase Chain Reaction (PCR)
for HCV RNA indicates active infection [14]. Several groups
have reported the use of quantitative real-time RT-PCR assays for
estimating the HCV viral load. Real-time RT-PCR assays have
achieved sensitivities of approximately 300 copies/mL or better
[20]. Since nucleic acid techniques remain expensive and largely
unavailable in many laboratories in the developing world, the
present study assesses the clinical usefulness of the HCV core
antigen enzyme immunoassay for the diagnosis of HCV infection
in dialysis patients validated by real-time PCR in the dialysis
population.
Materials and methods
Subjects and samples
Two hundred fifty patients undergoing maintenance hemo-
dialysis at Lok Nayak Hospital were enrolled in the present study
during the period August 2005 to December 2006. The study was
approved by the ethical committee of Maulana Azad Medical
College, as per the Declaration of Helsinki (1995). 10 mL blood
was collected by venipuncture from patients after an informed
consent, at the beginning of the HD session (midweek session).
Aliquots of serum from each patient were immediately separated
and stored at −40 °C for serological and HCV RNA detection.
Serological tests were done to detect HBsAg (Qiagen, Hilden,
Germany), anti-HCV by third generation ELISA kit (Inno-Test
HCV A6 III kit, Innogenetics NV. Ghent, Belgium) and total
HCV core antigen assay (Ortho HCV 3.0) according to the
manufacturer's protocol. Tests were performed in duplicate and
were considered positive if a reaction was observed in both cases.
The serological tests was done at baseline and repeated after 1, 3
and 6 months. Patients who are positive for other serological
markers are excluded from the study.
Liver histology
Liver biopsy was done wherever possible after having
obtained the informed consent of the patients. The severity of
the liver disease was determined histopathologically and
grading of the Histological Activity Index (HAI) from 0–13
and degree of hepatic fibrosis from 0–4 staging. The HAI and
hepatic fibrosis scoring was done as per the modified Knodell
Score. The HAI F6, fibrosis F3 considered as severe and if HAI
F5, fibrosis F2 as mild liver disease.
RNA extraction
Viral RNA was extracted from 140 µL of serum with
QIAamp®Viral RNA Kit (Qiagen, Germany) as per manufac-
turer's instructions. RNA pellet was reconstituted in 60 µL of
elution buffer and stored at −40 °C until use.
In-house one-tube nested RT-PCR amplification
RT-PCR was performed using specific primers for the
conserved 5′UTR region as described earlier [21]. The forward
primer is AS1 (5′ CTGTGAGGAACTACTGTCTT), AS2 (5′
TTCACGCAGAAAGCGTCTAG) and the reverse primer is S1
(5′GTGCTCATGGTGCACGGTCTACGAGACCTC), S2(5′
CACTCGCAAGCACCCTATCAGGC ATGCA) to amplify a
256 bp product. Amplification of the specific product was
carried out by PCR thermal cycler (PTC-100, MJ Research,
Watertown, Massachusetts, USA). 10 µL of RNA was mixed
with 0.2 µL (20 pmol) of antisense primer, incubated for 1 min
at 94 °C and 1 min at 56 °C, and then stored on on ice. 50 µL of
the reaction mixture containing 10× reaction buffer, dNTPS
(10 mmol/L), MgCl2 (2.5 mmol/L), 20 pmol of primers AS1
and S1, 0.5 U of Taq Polymerase (New England Biolabs, Inc,
USA) and 2.5 µL (20 U/µL) of Moloney Murine Leukemia
Virus (MMuLV) Reverse Transcriptase (New England Biolabs,
Inc, USA) was added to the precooled RNA mix for in-house
one step RT-PCR. The conditions were 60 min at 42 °C for RT,
2 min at 95 °C for denaturation of the reverse transcriptase,
followed by 35 cycles of 30 s at 95 °C, annealing for 30 s at
54 °C, and extension for 30 s at 72 °C. After the last cycle, a
final extension was made at 72 °C for 7 min. The second round
of PCR was performed with the same master mix containing
AS2 and S2 primers using 5 µL of the first product as template
under the same reaction conditions. Positive and negative
controls were included in every PCR amplification experiments.
Real-time PCR
Estimation of viral load was carried out by real-time PCR (Rotor
Gene 3000, Corbett Research, Sydney, Australia). Primer and
probe were designed as described earlier [22] which matched the
 Author's personal copy

S. Medhi et al. / Clinical Biochemistry 41 (2008) 447–452 449

Table 1 Sydney, Australia). Reverse-transcription was done for 15 min at

List of factors associated with hemodialysis patients at baseline 50 °C followed by 5 min denaturation at 95 °C. The corre-
Group Initial screening (N = 250) sponding cDNA were amplified by PCR (20 s at 95 °C, 30 s at
I II III P value a 50 °C acquiring FAM/Sybr, and 20 s at 72 °C) over 45 cycles. The
Total cases 43 13 207 NS CT values from the clinical samples were plotted on the standard
Age 44.8 ± 17.3 48.9 ± 14.7 42.4 ± 13.6 NS curve, and the number of copies was calculated automatically.
Transfusions ≥5 26 (60.5%) 7 (53.8%) 46 (22.2) b0.05 b
Hemodialysis ≥10 sessions 31 (72%) 6 (46%) 52 (25%) b0.05 c Statistical analysis
ALT (IU/L) ≤40 34.2 ± 12 38.6 ± 10 22.6 ± 4.9 NS
AST (IU/L) ≤ 40 25 ± 12 30 ± 10.5 19.9 ± 5.5 NS
Total bilirubin (mg/dL) 0.46 ± 0.15 0.51 ± 0.24 0.5 ± 0.08 NS Viral loads estimated by real-time PCR were compared
(0.4 – 1.2) between the subgroups as shown by applying t-test, using the
Total protein (g/dL) (6.5 – 8) 6.8 ± 0.3 6 ± 0.5 6.14 ± 1.2 NS Epi-info 2002 statistical software. Statistical significance was
Albumin (g/dL) (3.5 – 5.0) 4.8 ± 0.3 4.4 ± 0.4 3.43 ± 0.6 NS assessed at the two-sided P b 0.05 levels.
Prothrombin time (sec) 13.68 ± 4.42 14.1 ± 3.7 14.25 ± 2.7 NS
(10–12)
Results
Group I: anti-HCV positive and HCVcAg positive; Group II: anti-HCV negative
and HCVcAg positive.
Group III: anti-HCV negative and HCVcAg negative.
A total of 250 patients (150 males/ 100 females) who
a
Between Group I and II, Group I and III, Group II and III. underwent hemodialysis, were in the age group of 18–70 years,
b
P b 0.05; t-test = 14.6 between Group I and III. with mean age 45.4 ± 16.6. 30 (12%) patients had past history of
c
P b 0.05 ; t-test = 14.6 between Group I and III. jaundice, 55 (22%) patients received renal transplant. The mean
duration of dialysis was 12 ± 9 months (mean). The patients
were divided into three groups.
highly conserved 5″ UTR region of the different HCV genotypes.
The primers used were forward primer HCV1 (−272 5′ AGCG- (i) HCVcAg Positive, Anti-HCV Positive
TCTAGCCATGGCGT-3′), and reverse primer HCV2 (−191 5′ (ii) HCVcAg Positive, Anti-HCV negative
GGTGTACTCACCGGTTCCG) and HCV probe (− 223 5′ (iii) HCVcAg negative, Anti-HCV negative
FAMM-CYCCCCCTYCCGGGAGAGCCAT-TAMRA-3′), to
amplify a 77 bp fragment of the HCV genome. These primers There was no significant difference with respect to age, ALT
match the well conserved HCV sequences among the different and AST activity, Prothrombin time and total bilirubin
genotypes, but do not match human frequent nucleic acid concentration. The difference was significant with respect to
sequences according to the PCR are software [23]. The RNA the duration of hemodialysis treatment (P b 0.05; t-test = 11.84
standard representing the 5′ UTR region was constructed between group I and III) and the number of transfusions
according to Florence Komurian-Pradel et al. [24]. The RT-PCR (P b 0.05; t-test = 14.6 between group I and III) as reported in
was carried out with hepatitis C Virus quantification kit (Roche Table 1. Liver biopsy was obtained from 23 patients positive for
Diagnostics GmbH, Germany) according to the manufacturer's HCVcAg at baseline. The mean Knodell Histological Activity
instructions. 15 µL of master mix with 10 µL of the RNA template Index (HAI) was 5.4 ± 2.8 and it is significantly less (P b 0.05) in
were sealed, centrifuged in 0.2 mL tubes and transferred to the patients who receive less the 10 hemodialysis session (4.9 ± 0.4)
Rotor Gene 3000 real-time PCR machine (Corbett Research, then that observed in patients with more then 10 hemodialysis

Table 2
Comparative analysis of factors associated with hemodialysis patients
Group First follow up 1st month (N = 250) Second follow up 3rd month (N = 250) Third follow up 6th month (N = 250)
I II III I II III I II III
Total cases 46 10 207 48 8 207 50 6 207
ALT (IU/L)⁎ 37.4 ± 11.2 37.8 ± 10 26.6 ± 5 34.2 ± 12 38.6 ± 10 24.8 ± 6.9 34.2 ± 12 38.6 ± 10 27.6 ± 3.7
AST (IU/L)⁎⁎ 27 ± 11.5 29 ± 9 21 ± 4.8 26.5 ± 10 28 ± 9.5 21.5 ± 5 28 ± 10 30 ± 11.5 22 ± 5.5
Total bilirubin (mg/dL)⁎⁎⁎ 0.44 ± 0.2 0.6 ± 0.4 0.5 ± 0.1 0.5 ± 0.12 0.61 ± 0.14 0.48 ± 0.2 0.4 ± 0.2 0.5 ± 0.14 0.4 ± 0.1
Total protein (g/dL)$ 5.7 ± 0.2 5.5 ± 0.4 6.2 ± 1.5 5.5 ± 0.15 5 ± 0.5 6.18 ± 1.5 5.2 ± 0.1 5.3 ± 0.5 6.14 ± 1.2
Albumin(g/dL) $$ 4.6 ± 0.2 4 ± 0.5 3.43 ± 0.35 4.6 ± 0.4 3.8 ± 0.5 3.43 ± 0.4 4.2 ± 0.4 3.5 ± 0.45 4.4 ± 0.6
Prothrombin time (sec) $$$ 13.68 ± 4.42 14.1 ± 3.7 14.25 ± 2.7 13.68 ± 4.42 14.1 ± 3.7 14.25 ± 2.7 13.68 ± 4.42 14.1 ± 3.7 14.25 ± 2.7
Group I: anti-HCV positive and HCVcAg positive; Group II: anti-HCV negative and HCVcAg positive.
Group III: anti-HCV negative and HCVcAg negative.
⁎ P b 0.05; t-test = 7.3, 13.3 between Group I and III, Group II and III, respectively during follow up.
⁎⁎ P b 0.05; t-test = 11, 17, 15 between Group I and II, Group I and III, Group II and III respectively during follow up.
⁎⁎⁎ P b 0.05; t-test = 6.6, 11 between Group I and II, Group I and III, respectively during follow up.
$
P b 0.05; t-test = 5.5, 9.3 between Group I and III, Group II and III, respectively during follow up.
$$
P b 0.05; t-test = 12.2 between Group I and II respectively during follow up.
$$$
P N 0.05 and not significant during follow up.
 Author's personal copy
450 S. Medhi et al. / Clinical Biochemistry 41 (2008) 447–452
session (8.4 ± 0.5). The hemodialysis patients who were kept in
follow up for six months at an interval of 1st, 3rd and 6th
months (Table 2), in which the total cases of lone HCVcAg
positivity decrease subsequently from 13 at base line to 10, 8
and 6 respectively. There is also simultaneous increase in anti-
HCV and HCVcAg positivity from 43 at base line to 46, 48 and
50 at the end of follow up. The ALT, AST activity and total
bilirubin concentration were within the normal range during the
follow up although there was a significant difference in the ALT
activity between group I and III (P b 0.05; t-test = 7.3) and group
II and III (P b 0.05; t-test = 13.3). The AST activity also differed
significantly between group I and II (P b 0.05; t-test = 11), group
I and III (P b 0.05; t-test = 17) and group II and III (P b 0.05;
t-test = 15). The total bilirubin concentration also differed sig-
nificantly between group I and II (P b 0.05; t-test = 6.6) and
group I and III (P b 0.05; t-test = 11). The total protein and
albumin is on the lower side and the difference is significant,
which in case of total protein between group I and III (P b 0.05;
t-test = 5.5) and group II and III (P b 0.05; t-test = 9.3) and
albumin between group I and II (P b 0.05; t-test = 12.2). The
prothrombine time is within the normal range and there is no
significant difference during the follow up.
Serology
Of 250 hemodialysis cases, HCVcAg and anti-HCV positive
were found in 43(17.2%) cases, 13 (5.2%) were found to be
HCVcAg positive but anti-HCV negative, which was statisti-
cally significant (P b 0.05). Of 207 HCVcAg negative cases,
only 2 (0.8%) were positive for HCV RNA. 13 (53%) patients
which were initially only positive for HCVcAg 3 (23%), 5
(38.4%) and 7(53.8%) patients were later seroconverted after 1,
3 and 6 months respectively (Table 2). In renal transplantation 2
patients were HCVcAg positive at baseline and anti-HCV
positive after 3 months.
In house nested one-tube RT-PCR
Fifty-five out of 250 patients (22%) were tested positive for
HCV RNA; representative photograph of positive HCV RNA
with 256 bp amplicon was shown in Fig. 1. Which include 40
HCV RNA positive among 43 cases positive for HCVcAg and
anti-HCV in group I. In group II all the 13 cases, which were
positive only for HCVcAg, are also positive for HCV RNA and
Fig. 1. M = 100 bp marker, S1, S2, S3, S4 are the HCV RNA positive product
amplified from hemodialysis samples.
Table 3
Viral load in HCV positive hemodialysis patients
Group Anti-HCV HCVcAg HCV- Number Viral load (Mean ± standard
RNA of cases deviation) in copies/mL
I + + + 40 239,383 ± 107,805
II − + + 13 49,258 ± 28,682
III − − + 2 306 ± 461
P b 0.001; t-test = 9.9 between Group I and II.
Group I: anti-HCV positive and HCVcAg positive; Group II: anti-HCV negative
and HCVcAg positive.
Group III: anti-HCV negative and HCVcAg negative.
in 207 serologically negative cases only 2 cases were found to
be HCV RNA positive. The sensitivity of HCVcAg assay was
96% (53 out of 55 results were positive).
Viral load in various HCV cases
The mean viral loads of 55 HCV RNA positive cases were
estimated after dividing the cases into subgroups as depicted in
Table 3. The viral load of representative cases was shown in
Fig. 1. All the cases in group I anti-HCV and HCVcAg positive
have significantly elevated viral load (ranging from 131,578
copies/mL to 347,189 copies/mL) as compared to group II and
III. The difference in viral load is significant between group I and
II (P b 0.05; t-test = 9.9). In group II the viral load that was more
than 15,000 copies/mL was positive for HCVcAg alone. Two
subjects who were HCV RNA positive but HCVcAg negative
(false HCVcAg negative) in group III have comparatively low
viral load (ranging from 68 copies/ mL to 4200 copies/ mL).
Discussion
The routine clinical diagnosis of Hepatitis C Virus (HCV)
infection is based on the detection of anti-HCV antibodies that
indicates current or past HCV infection but not viral replication
[10]. In the window period, the viral load is very less and
despite improvements in the assay for anti-HCV, the infection
goes undetected, more so in immunocompromised patients such
as patients suffering from end-stage renal disease (ESRD) on
maintenance hemodialysis (HD) [25]. In our study HCVcAg
alone could detect 13 cases at baseline of which 3/13 (23%), 5/
13 (38.4%) and 7/13 (53.8%) were later seroconverted after 1, 3
and 6 months respectively, thus screening of HCV antibodies
alone does not exclude infection with HCV in hemodialysis
patients and HCVcAg assay is more sensitive and may be useful
in the early phase of infection before seroconversion. As HCV
infection is highly prevalent [26] and aggressive in the dialysis
population [27], the screening and accurate quantification of
viral load is essential to establish patient suitability for treatment
and subsequent length of treatment [28,29]. The bio-chemical
parameters such as ALT and AST activity, total bilirubin con-
centration, total protein and albumin levels differed signif-
icantly among the groups during the follow up (Table 2),
although they were within the normal range in case of ALT,
AST activity and total bilirubin concentration. The total protein
and albumin levels were slightly on the lower side and the
 Author's personal copy
S. Medhi et al. / Clinical Biochemistry 41 (2008) 447–452
difference was significant during the follow up, which suggest
that the patients were immunocompromised. No significant
difference in ALT activity was observed between hemodialysis
patients with advanced fibrosis (N = 12) than those with mild
disease (N = 11). Liver biopsy is necessary to exclude significant
liver pathology in patients with HCV and ESRD and to define
patients on whom antiviral treatment might be helpful which is
in concordance with the study by Perez et al. [30], in which they
found that liver biopsy can be avoided in patients with
persistently normal ALT in renal transplant patients. An earlier
study by Peterson et al. [31] showed that 87% of HCV RNA
positive specimens among blood donors were positive for
HCVcAg. A much higher sensitivity (96.4%) was observed in
our study in which HCVcAg was positive in 53 out of 55 cases
that were positive for HCV RNA. The seroprevalance of HCV
in hemodialysis patients was estimated to be 27% in an earlier
study at our center, while in the present study it is 22%.
Although the infection rates have decreased, it is still very high,
reflecting incomplete adherence to universal precautions.
Nucleic acid techniques such as RT-PCR is a sensitive method
for diagnosis of active HCV infection and can be used to assess
viral load [32,33]. In our study, all HCVcAg positive were
confirmed to be viremic by an in-house nested RT-PCR leading
to a specificity of 100% as reported previously [34,35]. The
sensitivity of HCVcAg assay was 96% (53 out of 55) whereas
the sensitivity and specificity of HCVcAg assay in hemodialysis
cases from India has been reported to be 60% and 83%
respectively [36]. In our study, 0.8% cases went undetected by
HCVcAg assay. This is probably due to the low viral loads in
immunocompromised hemodialysis patients. Thus, the detec-
tion of HCV core antigen in serum is inexpensive (which is
about $4 per test compared to $8 by RT-PCR), reliable and
highly specific assay (P b 0.05; CI = 95%;t-test = 86.8) that can
be useful in most laboratory settings to diagnose HCV infection
in hemodialysis patients and especially in laboratories where
nucleic acid technologies are not yet available. Real-time PCR
is the gold standard to get accurate information on the viral load
[37]. An earlier study had shown that HCVcAg assay could not
assess HCV viral load below 37,768 copies/mL [38]. The sen-
sitivity of the HCVcAg ELISA among hemodialysis patients
was assessed by real-time PCR for the first time in our study and
it showed that viral load above 15,000 copies/mL could be
detected by HCVcAg assay. Viral loads between 105 and 106
copies/mL have been reported during the window period in
blood donors [39]. The viral load that could be detected by anti-
HCV assay was 239,383 ± 107,805 copies/mL and that of cases
that could be detected by HCVcAg alone was 49,258 ± 28,682,
which is highly significant ( p b 0.001). In our study, RT-PCR
could detect 0.8% cases that were undetected by serology; viral
load in this group was found to be 306 ± 461 copies/mL, which
is highly significant ( p b 0.001) in comparison to the group of
patients that could be detected by HCVcAg, which indicates
that HCVcAg assay is significantly related to the HCV load in
hemodialysis patients. In conclusion, although nucleic acid
techniques allow more accurate and sensitive detection of active
viral infection among HCV patients, the high cost and the
requirement of skilled manpower limit its universal application.
451
The HCVcAg is both less labor-intensive and cost-effective and
thus, highly suitable for routine clinical use.
References
[1] Choo QL, Richman KH, Han JH, Berger K, Lee C, Dong C, Gallegos C, et al.
Genetic organization and diversity of the hepatitis C virus. Proc Natl Acad
Sci U S A 1991;88:2451–5.
[2] Leone N, Rizzetto M. Natural history of hepatitis C virus infection: from
chronic hepatitis to cirrhosis, to hepatocellular carcinoma. Minerva
Gastroenterol Dietol 2005;51:31–46.
[3] Shepard CW, Finelli L, Fiore AE, Bell BP. Epidemiology of hepatitis B and
hepatitis C virus infection in United States children. Pediatr Infect Dis J
2005;24:755–60.
[4] Abdel-Wahab MF, Zakaria S, Kamel M, et al. High seroprevalence of
hepatitis C infection among risk groups in Egypt. Am J Trop Med Hyg
1994;51:563–7.
[5] Perz JF, Armstrong GL, Farrington LA, Hutin YJ, Bell BP. The
contributions of hepatitis B virus and hepatitis C virus infections to
cirrhosis and primary liver cancer worldwide. J Hepatol 2006;45:529–38.
[6] Chandra M, Khaja MN, Farees N, Poduri CD, Hussain MM, Aejaz Habeeb
M, Habibullah CM. Prevalence, risk factors and genotype distribution of
HCV and HBV infection in the tribal population: a community based study
in south India. Trop Gastroenterol 2003;24:193–5.
[7] Frank C, Mohamed MK, Strickland GT, Lavanchy D, Arthur RR, Magder
LS, et al. The role of parenteral antischistosomal therapy in the spread of
hepatitis C virus in Egypt. Lancet 2000;355:887–91.
[8] Fabrizi F, Poordad FF, Martin P. Hepatitis C infection and the patient with
endstage renal disease. Hepatology 2002;36:3–10.
[9] Lok AS, Chien D, Choo QL, Chan TM, Chiu EK, Cheng IK, et al.
Antibody responses to core, envelope and non structural hepatitis C virus
antigens: comparison of immunocompetent and immunocompromised
patients. Hepatology 1993;18:497–502.
[10] Lauer GM, Walker BD. Hepatitis C virus infection. N Engl J Med
2001;345:41–52.
[11] Van der Poel CL, Cuypers HT, Reesink HW. Hepatitis C virus six years on.
Lancet 1994;344:1475–9.
[12] Alter HJ. Epidemiology of hepatitis C in the West. Semin Liver Dis
1995;15:5–14.
[13] Seymour CA. Screening asymptomatic people at high risk for hepatitis C.
The case forBMJ 1996;312:1347–8.
[14] Alter MJ, Kuhnert WL, Finelli L. Centers for Disease Control and
Prevention. Guidelines for laboratory testing and result reporting of
antibody to hepatitis C virus. Centers for Disease Control and Prevention.
MMWR Recomm Rep 2003;52:1–13.
[15] Krajden M. Hepatitis C virus diagnosis and testing. Can J Public Health
2000;91:S34–9.
[16] Cano H, Candela MJ, Lozano ML, Vicente V. Application of a new
enzyme-linked immunosorbent assay for detection of total hepatitis C virus
core antigen in blood donors. Transfus Med 2003;13:259–66.
[17] Lunel F, Veillon P, Fouchard-Hubert I, Loustaud-Ratti V, Abergel A, Silvain
C, et al. Fontevraud Study Group. Antiviral effect of ribavirin in early non-
responders to interferon monotherapy assessed by kinetics of hepatitis C
virus RNA and hepatitis C virus core antigen. J Hepatol 2003;39:826–33.
[18] Maynard M, Pradat P, Berthillon P, Picchio G, Voirin N, Martinot M, et al.
Clinical relevance of total HCV core antigen testing for hepatitis C
monitoring and for predicting patients' response to therapy. J Viral Hepat
2003;10:318–23.
[19] Bouzgarrou N, Fodha I, Othman SB, Achour A, Grattard F, Trabelsi A,
et al. Evaluation of a total core antigen assay for the diagnosis of
hepatitis C virus infection in hemodialysis patients. J Med Virol 2005;
77:502–8.
[20] Kleiber J, Walter TG, Haberhausen G, Tsang S, Babiel R, Rosenstraus M.
Performance characteristics of a quantitative, homogeneous TaqMan RT-
PCR test for HCV RNA. J Mol Diagn 2000;2:158–66.
[21] Das U, Kar P, Gopalkrishna V, Sharma JK, Madan K, Das BC.
Comparative evaluation of hepatitis C virus infection in serum and liver
 Author's personal copy
452 S. Medhi et al. / Clinical Biochemistry 41 (2008) 447–452
tissue of patients with chronic liver disease by reverse transcription-
polymerase chain reaction. Clin Microbiol Infect 1999;5:256–61.
[22] Pugnale P, Latorre P, Rossi C, Crovatto K, Pazienza V, Gottardi AD,
et al. Realtime multiplex PCR assay to quantify hepatitis C virus RNA
in peripheral blood mononuclear cells. J Virol Methods 2006;133:
195–204.
[23] Griffais R, Andre' PM, Thibon M. K-tuple frequency in the human
genome and polymerase chain reaction. Nucleic Acids Res 1991;19:
3887–91.
[24] Komurian-Pradel F, Paranhos-Baccala G, Sodoyer M, Chevallier P,
Mandrand B, Lotteau V, et al. Quantitation of HCV RNA using real-
time PCR and fluorimetry. J Virol Methods 2001;95:111–9.
[25] Hanuka N, Sikuler E, Tovbin D, Mostoslavsky M, Hausman M, Orgel M,
et al. Hepatitis C virus infection in renal failure patients in the absence of
anti-hepatitis C virus antibodies. J Viral Hepat 2002;9:141–5.
[26] Fissell RB, Bragg-Gresham JL, Woods JD, Jadoul M, Gillespie B,
Hedderwick SA, et al. Patterns of hepatitis C prevalence and seroconver-
sion in hemodialysis units from three continents: the DOPPS. Kidney Int
2004;65:2335–42.
[27] Perez RM, Ferreira AS, Medina-Pestana JO, Cendoroglo-Neto M, Lanzoni
VP, Silva AE, et al. Is hepatitis C more aggressive in renal transplant
patients than in patients with end-stage renal disease? J Clin Gastroenterol
2006;40:444–8.
[28] EASL International Consensus Conference on Hepatitis C. Paris, 26 to 27
February 1999. Consensus statement. J. Hepatol. 1999; 31:3–8.
[29] Carithers Jr RL, Marquardt A, Gretch DR. Diagnostic testing for hepatitis
C. Semin Liver Dis 2000;20:159–71.
[30] Perez RM, Ferreira AS, Medina-Pestana JO, Lanzoni VP, Silva AE, Ferraz
ML. Is alanine aminotransferase a good marker of histologic hepatic
damage in renal transplant patients with hepatitis C virus infection? Clin
Transplant 2005;19:622–5.
[31] Peterson J, Green G, Iida K, Caldwell B, Kerrison P, Bernich S, et al.
Detection of hepatitis C core antigen in the antibody negative ‘window
phase' of hepatitis C infection. Vox Sang 2000;78:80–5.
[32] Hagiwara H, Hayashi N, Fusamoto H, Kamada T. Quantitative analysis of
hepatitis C virus RNA: relationship between the replicative level and the
various stages of the carrier states or the response to interferon therapy.
Gastroenterol Jpn 1993;5:48–51.
[33] Fukumoto T, Berg T, Ku Y, Bechstein WO, Knoop M, Lemmens HP, et al.
Viral dynamics of hepatitis C early after orthotopic liver transplantation:
evidence for rapid turnover of serum virions. Hepatology 1996;24:1351–4.
[34] Schuttler CG, Thomas C, Discher T, Friese G, Lohmeyer J, Schuster R,
et al. Variable ratio of hepatitis C virus RNA to viral core antigen in
patient sera. J Clin Microbiol 2004;42:1977–81.
[35] Veillon P, Payan C, Picchio G, Maniez-Montreuil M, Guntz P, Lune FL.
Comparative evaluation of the total hepatitis C virus core antigen,
branched-DNA, and Amplicor monitor assays in determining viremia for
patients with chronic hepatitis C during interferon plus ribavirin
combination therapy. J Clin Microbiol 2003;41:3212–322.
[36] Reddy AK, Dakshinamurty KV, Lakshmi V. Utility of HCV core antigen
ELISA in the screening for hepatitis C virus infection in patients on
hemodialysis. Indian J Med Microbiol 2006;24:55–7.
[37] Hazari S, Acharya SK, Panda SK. Development and evaluation of a
quantitative competitive reverse transcription polymerase chain reaction
(RT-PCR) for hepatitis C virus RNA in serum using transcribed thio-RNA
as internal control. J Virol Methods 2004;116:45–54.
[38] Fabrizi F, Lunghi G, Aucella F, Mangano S, Barbisoni F, Bisegna S, et al.
Novel assay using total hepatitis C virus (HCV) core antigen quantification
for diagnosis of HCV infection in dialysis patients. J Clin Microbiol
2005;43:414–20.
[39] Busch MP, Kleinmamm SM 2000. NAT testing of blood donors for
transfusion transmitted infectious diseases. Transfusion 2000;40:143–159.