Hsslive Xii Zoology Prvs Questions Vers 2022 Navas

Join Now: https://join.hsslive.in/group Downloaded from www.Hsslive.
in ®
Navas cheemadan SOHSS-AREEKODE

HUMAN REPRODUCTION (a) Identify the parts labelled as (A), (B), (C) and (D)
and name the part which is cut or tied up during male
AND
sterilisation.
REPRODUCTIVE HEALTH (b) Mention the surgical contraceptive methods in
male and female.
HSE- July 2022 (SAY/IMP.) HSE-March- 2022
1. First menstruation in a female begins at puberty 5. Expand the term ZIFT (1)
and is called _______. (1) 6. Mitotic division of zygote results in the formation
2. Expand the term IUD. (1) of blastomeres is called ________ (1)
3. Identify the figure and label the parts marked as 7. Write the functions of the following structures in
(A), (B) and (C) (2) human reproduction : (2)
(a) Leydig cells (b) Corpus luteum
8. (a) Name the cap-like structure present in sperm
head.
(b) Write its function. (2)
9. “Sex of a child is determined by father.”
Substantiate the statement. (3)
10. ‘Incidents of STDs are very high among the age
group of 15-24 years.’
(a) What is STD ? (b) Name any four STDs. (3)
HSE-August 2021
11. Expand the following terms (1)

a)MMR b)IMR
12. Identify the odd one (1)
(hPL, Androgen, Relaxin, hCG )
13. Disease or infections which are transmitted
through sexual intercourse are called sexually
transmitted disease (STDs)
a)Give any two examples for STDs
b)Write any two preventive measures to avoid
STDs ? (2)
14. Identify the two types of cells lined on the inside of
4. Diagrammatic view of male reproductive system is seminiferous tubule. Distinguish their function (2)
given below : (5)
15. Mention two programmes implemented in India to
attain total reproductive health? (2)
16. How many spermatozoa and ova are produced
from 25 primary spermatocyte and 25 primary
oocytes ? (2)
17. Distinguish between spermiogenesis and
spermiation ? (2)
18. Fill in the blanks with suitable terms given in
bracket
(Progestogen, Multiload-375, Vaults, Periodic
abstinence, Tubectomy, Saheli) (2)
NAVAS CHEEMADAN navas9895@gmail.com

Join Now: https://join.hsslive.in/group Downloaded from www.Hsslive.in ®

Barrier Copper Natural Surgical 29. Match the following (2)
method releasing method method
IUDs
Condom (B) Coitus (D)
interrupts
(A) Cu-T (C) Vasectomy
19. The wall of uterus has 3 layers of tissues (2)

a)Name the three layers of uterine wall 30. Match the following (2)
b)Among these 3 layers, which layer is glandular
and undergo cyclic changes during menstrual cycle
?
20. Identify the pars of oviduct (fallopian tue) from
below description :
a)Finger like projection of oviduct that helps in
collection of the ovum after ovulation 31. ‘LH and FSH play significant role in
b)The part of oviduct with narrow lumen that joins spermatogenesis.’ (3)
the uterus (a) Write the functions of LH and FSH in
c)Funnel shaper part of oviduct that is closer to the spermatogenesis.
ovary (3) (b) Write a single term used to denote LH and FSH
21. Explain different types of Intra uterine devices with together.
their example (3) 32. Sexually Transmitted Diseases (STDs) are seen to
be high among people with age group 15 – 24 yrs.
HSE-March 2021 (a) Write the names of any 4 STDs.
(b) Mention the measures to be taken to prevent
22. Name the oral contraceptive for female developed STDs. (3)
by CDRI. (1)
23. During luteal phase of menstrual cycle, Graafian HSE –July-2020
follicle transforms into ____ (1)
24. Expand the following terms related with Assisted 33. The embryo with 8 to 16 blastomeres is called a
Reproductive Technologies : (2) ________. (1)
(a) ICSI (b) GIFT (a) Gastrula (b) Morula
(c) Blastula (d) Trophoblast
25. Fill in the blanks to complete the schematic
representation (2) 34. Observe the diagrammatic view of male
reproductive system given below and name the
parts labeled ‘a’, ‘b’, ‘c’ and ‘d’. (2)
26. Write any four objectives of Reproductive and

Child Health Care (RCH) programmes (2)
27. Write any four differences between
Spermatogenesis and Oogenesis. (2)
28. In women, some hormones are secreted only
during pregnancy. Name any such hormones (2)


35. Rearrange the following human reproductive (a) Name ‘A’ and ‘B’.
events in the correct order of their occurrence (2) (b) Reconstruct the graph showing the level of
hormones in luteal phase.
(c) Name the hormone secreted by Corpus Luteum
and mention its function.
36. (a) Expand ART. (2) HSE-June-2019

(b) Suggest the ART which may be successful in the
following condition : 42. Find out the correct sequence : (1)
(i) Inability of the male partner to inseminate (a) Fertilisation- zygote - Blastula - Morula -
the female. cleavage - Implantation
(ii) Female cannot produce ovum but can (b) Fertilisation- zygote - cleavage - Morula -
provide suitable environment for Implantation - Blastula
(c) Fertilisation- zygote - Morula - cleavage -
fertilisation and further development. Implantation - Blastula
(d) Fertilisation- zygote - cleavage - Morula -
37. Observe the diagrams A and B given below related
Blastula – Implantation
to contraceptive methods. (3)
43. 'LH Surge' induces the rupture of Graffian follicle
(a) Which gland produces LH and in which day LH
Surge happens?
(b) Write the role of LH in males. (2)
44. There are several method of in vitro fertilisation to
(a) Identify A and B.
assist couples who lack the ability of fertilisation.
(b) Explain this surgical method.
(a) Give the popular name of the programme
(c) Why this method is generally advised as a
(b) Suggest two techniques of in vitro fertilisation
terminal method of contraception ?
and their conditions of transfer to assist these
HSE –March-2020 people (3)
38. Name the technique of transferring embryos up to HSE-March-2019

8 blastomeres into the fallopian tube. (1)
45. The milk produced during the initial few days of
a)GIFT b)ZIFT c)ICSI d) IUI
lactation is called…………………. (1)
39. “All copulations lead to fertilization and 46. "The sex of the baby is determined by the father
pregnancy”. Do you agree with this statement?
and not by the mother. Do you agree with this
Justify your answer. (2)
statement ? Substantiate your answer. (2)
40. Amniocentesis for sex determination is legally 47. Observe the diagram given below showing the
banned now. (2)
reproductive system of the female and name the
(a) What is amniocentesis ?
parts labeled 'A', sectional view 'B', C' &'D' (2)
(b) Why it is banned ?
41. The graph given below shows the level of the
ovarian hormones in a normally menstruating
woman during the follicular phase. (3)


48. A wide range of contraceptive methods are 56. In a class room discussion, a student said that
presently available. If so, (HSE-March-2019)(2) sex of the baby is determined by the father.
(a) Name one contraceptive method having least Analyse the statement and give reason for it ?
side effect. (2)
(b) Which contraceptive method is generally
57. Different contraceptive methods are used to
advised for females as a termination method to
control population explosion. Summarise the
prevent any more pregnancies?
natural method and barrier method of
(c) List out any two possible ill-effects of the usage
of contraceptive methods. contraception ? (2)
49. (a) Expand STDs. 58. Sexually transmitted disease (STD) are mainly
(b) Cite any two examples for STD. transmitted through sexual contact (3)
(c) Suggest any two methods for the prevention of a)Name any two examples of STD?
STDs. (3) b)Explain any two methods adopted to prevent
STD ?
HSE-June-2018
50. Number of spermatids produced from 25

primary spermatocytes are ........... (1) HSE-March-2018-Model Exam
a) 25 b)50 c)100 d)250
59. The middle layer of uterus is called……… (1)
51. Select the relationship between the first two
60. Vasectomy and tubectomy are said to be
words and fill the lank space with a suitable
effective and irreversible contraceptive
word (1)
methods. Differentiate between these two
Sterilization in male : Vasectomy
methods. (2)
Sterilization in female :.............
61. From an infertility clinic a doctor advised a
52. The incidence of STDs are reported more
childless couple to undergo GIFT.
among the age group between 15-24 years.
l. Expand GIFT
(2nci)
2. Mention the steps involved in this
(a) What are STDs?
procedure (2)
(b) Suggest methods to prevent STDs,
53. Match the column B &C with column A (3) HSE-JUNE-2017
62. Human female possess 44+XX chromosome

number. The chromosome number of
secondary oocyte is (1)
a)44+XX b)22+X c)44+XX d)22+XX
63. Observe the diagram and answer the question
(2)
HSE-March-2018
54. Name the cells in testis which synthesize and

secrete androgens? (1)
55. Different contraceptive methods are given
below. Pick out the odd one (1)
a)Cu T b)Saheli
c)Multiload 375 d)Lippes loop


a) Identify A and B Suggest a suitable assisted reproductive
b) Write the function of B technology (ART) for each problem in
64. Prepare a brief notes to be presented in an expanded form.
awareness programme for adolescent about HSE-March-2016
AIDS, their causes and preventive measures? 73. Breast feeding during initial period of infant growth
(3) is necessary to develop immunity of new born
babies. Why ? (1)
HSE-March-2017 74. Categorise the given birth control methods into
three groups with proper heads.
65. Which of the following pairs of STDs is
(Cervical caps, Vasectomy, Cu T, Tubectomy,
completely curable ? (1)
Diaphragms, Condoms, Lippes Loop ) (3)
a)HIV, Hepatitis B 75. match the columns A and B (2)
b)Hepatitis B, Gonorrhoea A B
c)Symphils, Gonorrhoea Corpus Luteum Embryo
d)Chlamydomonas, Genital Herpes Leydig cells Implantation
66. Feeding...................in the first few days is Blastocyst Progesterone
essential for preventing infection in a newly Inner cell mass Androgens
born baby (1) Prolactin
67. LH and FSH are gonadotrophins. Distinguish
HSE-June-2015
their roles in male and female? (2)
68. What is ART ? Categorize the following ART’s 76. Choose the odd one from the following and
based on their application in male sterility and write common features of others. (1)
female sterility: a)Estrogen b)Anrogen c)Relaxin
GIFT, AI d)Progesterone
77. Some techniques commonly used for
HSE-June-2016
infertility treatment are given below. Read
69. The process of fusion of sperm with ovum is them carefully and answer the question
called......................... (1) ZIFT,GIFT,ICSI,IUI,IVF (3)
70. Match the column A and B (2) a)which of the above techniques is used
for the collection of sperm from the
husband or a healthy donor and artificially
introduced into the vagina or uterus of
the female?
b)Distinguish between ZIFT and GIFT
c)Write the common term used to denote
the techniques given below ?
78. Complete the flow chart showing
spermatogenesis by filling A and B and answer
71. Select the odd one and justify your selection? the question (2)
Malaria, Gonorrhoea ,Amoebiasis, filariasis (1)
72. Diagnostic report of two couples having
infertility problem are given below : (2)
1) The Women cannot produce ovum
2) The man has very low sperm count in a)what is the chromosome number of
semen. primary spermatocyte?

b)what is the significance of reduction 84. Schematic representation of Gametogenesis
division in spermatognenesis? is given below . Identify A. Write one
difference between A and B (1)
HSE-March-2015
79. Foetal sex can e determined by a test based

on chromosomal pattern from the amniotic
fluid (2)
a)What is this test?
b)Revealing of sex determination through this
test is banned. Is this ban is necessary ?
c) invitro fertilisation followed by embryo
transfer is known as .......
80. 1)In which part of human reproductive
system the following events occur? (2)
a)Fertilisation b)Implantation
HSE-June-2014
2)Diagram of a Human blastocyst is given
below .Identify A and B 85. ........... and ..........are two surgical
contraceptive methods in male and female
respectively (1)
86. Diagram of mammalian sperm is given below.
Label the parts marked (1)
81. It is evident that, it is the genetic makeup of

the sperm that determine the sex of the child
in human being. Substantiate. (2)
82. Identify the diagram and write how it acts (1)
87. Sex of the bay is determined by the father,

not by the mother. Substantiate? (2)
88. Amniocentesis for sex determination is
banned in our country? Is this Ban necessary?
Comment one use of amniocentesis?
(2)
83. Mothers milk is considered essential for new
born infants (1) HSE-MARCH-2014
a)Name the fluid secreted by mother from 89. Observe the diagram and answer the question
breast during the initial days of lactation (3)
b)What type of immunity it provides a) Identify A and B
b) What is the function of C

c) In which of the marked part reduction c)Why the lactational amenrrhoea is not so
division takes place? What is the significance effective? (1)
of it? HSE-MARCH-2013
94. The following statements compare the
process of Oogenesis and spermatogenesis.
Which one is not true
a)Production of ovum ceases at certain age,
but sperm production continues even in old
men
b)Oogenesis begins in the embryonic stages,
but spermatogenesis starts at the oneset of
puberty.
c)Meiotic arrest occurs both in Oogenesis and
spermatogenesis.
d)Polar bodies are formed in Oogenesis (1)
90. One of our neighbour is suffering from 95. Suggest the ART which may be successful in
itching, fluid discharge, slight pain and the following conditions (3)
swelling in the genital region (2) a)A female cannot produce an ovum, but can
a)What do you think the disease he is provide suitable environment for fertilization
suffering from? and further development
b)What measures are to be taken to prevent b)Male partner is unable to inseminate the
such disease female or has very poor sperm count
91. Expand the following abbreviations which are c)Fusion of gamete and zygote formation
commonly used in reproductive health doesnot occur within the body of female
a)ART b)ZIFT (1) 96. The diagram represents a process of
gametogenesis. Closely observe it and answer
HSE-SAY-2013 the following (2)
92. Though one ovum is produced from a primary a)Is it spermatogenesis or Oogenesis?
oocyte it can result into a male or female b)What does smaller shaded circle represent?
child after fertilisation. But in these case of c)Write down two significance of production
spermatocyte though 4 sperms are produced of same?
only two of the can result to a female child
after fertilisation justify? (1)
93. Sterilization and IUDs are effective birth
control measures, but lactational
amenorrhoea may not be so effective
a)How the sterilization procedure of male
differ from that of female in preventing
pregnancy? (2)
b) Which part of the female reproductive
organ is utilized for the IUD procedure? How
this procedure prevents pregnancy? (2)


HSE-SAY-2012
97. Find out the odd one from the following,

write the reason (1)
a)Cu T, b)Cu 7 c)LNG-20 d)Multiload-375
a)What is A and B?
98. One couple came to know that they have a
b)Name the two types of cells found in the
girl child during fourth month of pregnancy
Blastocyst?
and they decided to do MTP (2)
c)Which layer of blastocyst is attached to the
a)What is MTP?
endometrium? And Name the process?
b)At which stage of pregnancy MTP relatively
safe?
HSE-SAY-2011
c)How will you respond to the decision of
102. Note the relationship between first two
female foeticide by the couple?
terms and suggest a suitable terms for the
99. Observe the diagram provided (do not copy
fourth place (1)
the picture) (3)
a)Progesteron : Corpus luteum
HCG : ........................
b)GIFT : Gamete
ZIFT : ........................
103. Observe the Graph provided
a)Label A and B
b)On which day of menstrual cycle Graffian
follicle rupture?
c)Name the process induces the rupture of
a)What do A and B stands for? (1)
graffian follicle
104. Nalini is four month pregnant at the
d)Write the name and function of the
insistence of her mother in law, she
structure forming inside the ovary after
underwent an illegal diagnostic procedure by
rupture of Graffian follicle?
which the sex of the baby was determined to
be female . Nalini’s mother in law cursed her
HSE-March-2012
for conceiving a girl child.
100. “STDs present a major health concern in
a)What is the diagnostic procedure used
both industrialization and developing
here?
countries” (3)
b) “scientifically, Nalini is not responsible for
a) What you meant by STD?
conceiving a girl child”. How will you
b) Name two STDs?
substantiate this statement? (1)
c) Suggest two preventive measures?
105. Observe the diagram provided and
101. Some stages of embryonic development
identify the process: (2)
are given below. Observe these diagram and
answer the question (3)

109.
The above graph shows the level of ovarian
hormones in a normally menstruating women
during follicular phase (3)
a)Name A and B
b)Mention the role of pituitary hormones in
maintaining this condition
a)Label; A,B,C and D c)Reconstruct the graph for luteal phase?
b)Why the gametes produced are haploid
even though the gamete mother cells are HSE-SAY-2010
diploid? 110. Select the ART that uses an early embryo
106. Raju has lost his mother at birth. He is with upto 8 blastomeres (1)
unhealthy and contract diseases easily. In his a)ZIFT )IUT c)GIFT d)IUI
Doctor’s opinion, Raju’s ill health is due to his 111. The total population in India is alarmingly
not drinking mother’s milk. increased to 1 billion according to 2001
How will you justify the doctor’s opinion in censes. The population growth rate was still
the light of your knowledge of immunity? (2) around 1.7%, a rate at which our population
could be double in 33 years
HSE-MARCH-2011 Cite the probable reasons for such an
107. One among the contraceptive method is increase in population growth rate? (2)
peculiar. Find the odd one and what is the 112. The graph shown below shows the levels
common among others? (1) of LH and FSH at various stages of menstrual
a)Periodic abstinence cycle. (3)
b)coitus interruptus
c)Lactational amenorrhea
d)IUDs
108. The treatment facility advertised on the

brochure of a private clinic is shown below
a)Can you suggest what type of clinic is?
b)Make a brief note on any three of the
treatment procedure? (2) a)Name the source of LH and FSH
IVF ZIFT GIFT IUI b)The level of LH is maximum during the
middle day of cycle. Mention its effect?
c)Note the function of LH in male?
HSE-March-2010
113. Given below is the diagrammatic
representation of Human blastocyst. Observe

the diagram and answer the following
questions. (2)
a)Identify A and B
b)Write the function of A and B
114. When the urine sample of a lady is tested,
presence of Human chorionic gonadotropin
(HCG) was detected (2)
a)What does the presence of HCG indicate?
b)Which is the source of HCG?
115. Diagram shown below is a surgical
method used for female sterilization
(2)
a) What is the method shown in the diagram?
b) Mention any two IUDs to prevent
conception?
c)what is surgical method of male sterilization
called?
Click here to watch video lesson


PRINCIPLES OF INHERITANCE 8. Consider the two statements regarding the
haemophilia disorder (2)
AND VARIATION (i) It is an autosome linked dominant disease.
(ii) The heterozygous female (carrier) for
haemophilia may transmit the disease to son.
HSE- July 2022 (SAY/IMP.) Select the wrong statement and correct it.
1. Various symbols are used in human pedigree
HSE-March 2021
analysis. Identify the following symbols
(2)
9. Name the genetic disorder in which a blood
clotting protein is affected leading to non-stop
bleeding even through a simple wound. (1)
10. Presence of an additional copy of chromosome 21
was observed in a person during diagnosis. (2)
(a) Identify the genetic disorder
(b) Write the characteristic features of this
disorder
11. If a father is with ‘O’ blood group and mother is
2. TH Morgan carried out several dihybrid crosses in with ‘B’ blood group, write the possible blood
Drosophila. Mention two reasons for selecting groups of their children. (2)
Drosophila as an experimental organism? 12. Micrograph of Red blood cells of two persons
(2) (A) and (B) are shown below. Person B is affected
3. Characters of certain genetic disorders are given with a specific genetic disorder.
below. Identify the given disorders (i) Identify the genetic disorder.
(3) (ii) Write reason for this disorder.
a) Sex linked recessive disorder that affect the
clotting of blood
b)The disorder caused by the substitution of
Glutamic acid by Valine at the sixth position of
beta globin chain of Haemoglobin
c)The inborn error metabolism and affected
individual lacks an enzyme that converts Phenyl 13. ‘Incomplete Dominance’ is an example for
alanine to Tyrosine. deviation from Mendelian Inheritance. Illustrate
with example (3)
HSE- March 2022
14. Consider the two statement regarding the
4. (a) Distinguish between Male heterogamety and haemophila disorder
Female heterogamety. (2) a)It is an autosome linked dominant disease
(b) Write one example for each. b)The heterozygous female (carrier) for
5. “Sex of a child is determined by father.” haemophilia may transmit the disease to son
Substantiate the statement (3) Select the wrong statement and correct it
HSE- August 2021
15. A monohybrid cross is given below :
6. Identify the symbol used in pedigree analysis (1)
7. T.H Morgan selected Drosophila melanogaster as

a suitable experimental organism. Mention any Find the F2 phenotype and genotype ratio (2)
two reason for selecting Drosophila as
experimental organism (2) 16. Distinguish male heterogamety and female
heterogamety with example (3)

HSE-July-2020 (a) Haemophilia is a autosome linked recessive
disease.
17. Select a female heterogametic animal from the (b) Turner’s syndrome is due to the presence of an
following : (1) additional copy of X chromosome
(a) Human beings (b) Drosophila HSE-June-2019
(c) Birds (d) Grasshopper
18. Complete the table using appropriate terms : (2) 23. Identify the following symbols in pedigree Analysis
(1)
24. Observe the cross of a pure violet and white
flower (2)
19.
In a cross between a true breeding red flowered
and a true breeding white flowered plants, the F1
generation was pink coloured flowers. From this
cross – (2)
(a) Identify the Inheritance.
(b) Give an example for this type of Inheritance.
(c) Write the F2 phenotypic and genotypic ratio.
HSE-March-2020
20. From the following, find out the symbol used in
the human pedigree analysis representing male. a) By using the F, progeny design a test cross.
(1) b) Mention the significance of test cross
25. Each symptom of two chromosomal disorders are
given below : (2)
 Gynaecomastia
 Rudimentary ovary and lack of secondary
21. Observe the figure given below showing Mendel’s
sexual characters
experiment using pea plants. (2)
(a) Identify the disorders.
(b) Give the reason for these disorders
HSE-March-2019
26. Find the odd one out. Justify your answer.

Down's syndrome, Turner's syndrome,
phenylketonuria, Klinefelter’s syndrome (2)
27. The amino acid composition of the relevant
portion of β chain of two haemoglobin molecule
molecules (A & B) are shown below (3)
(a)Which one of the polypeptide chain is

(a) Identify the cross abnormal?
(b) Which are the laws proposed by Mendel based on (b) Name the disorder caused by it.
this observations ? (2) (c) What is the reason for this abnormality?
22. Correct the following statements, if there is any (d) What is the effect of this abnormality in such
mistake : individuals?


HSE-June-2018
28. Observe the following cross between

heterozygous dominant progeny and homozygous
recessive parent. Answer the following questions
(2)
a) Identify the cross?

b) Mention the significance of this cross?
29. The following diagram shows amino acid
sequences of a part of β chain of haemoglobin of
2 individuals. Observe the amino acid sequence
and answer the following questions : (2)
a) Observe the above cross and name this

phenomenon?
b) Write down the theoretically given
explanation of the phenomenon (2)
33. Haemophilia, Sickle cell anaemia and Phenyl
Ketonurea are Mendelian disorders
(a)What do you mean by mendelian disorder
a) Which among the above indicate sickle cell
(b) which one of the above is an example of in
anemic condition?
b) Justify your answer? born error of metabolism? Mention the cause
c) Describe what is single base substitution? of disorder? (2)
30. The blood group of a child is 'O'. His father is with
'A' blood group and mother with ‘B' blood group. HSE-Model Exam -2018
Write, down the genotype of the child and 34. Construct a monohybrid cross between
genotypes of parents. (2) homozygous violet and white coloured flowers of
a pea plant How can one determine whether the
F1 Progenies are homozygous or heterozygous?
HSE-March-2018 (2)
35. From a clinical laboratory, Ramu's blood group
31. ln a classroom discussion, a student said that the was identified as 'AB' goup. But his father has 'A'
sex of the baby is determined by father. Analyze blood group and mother has is 'B’ blood group.
the statement and give reason for it ? (2) a) Is Ramu's blood group identification correct?
32. b) Substantiate your answer using co dominance
principle. (2)
36. Identify the syndromes ’A' and 'B' (2)


b) Diagrammatically represent a monohybrid
cross between Tall and dwarf pea plant
HSE-MARCH-2017
39. The following table shows the F2 generation
of a Dihybrid cross. Identify the phenotype
with homozygous recessive genotype. Find
out A:B:C:D (2)
HSE-JUNE-2017
37. Observe the diagrammatic representation of

following pedigree analysis and answer the 40. Which of the following do not have similar sex
question. (3) chromosome? (homogametic ) (1)
(1) Human female
(2) Drosophila female
(3) Bird female
(4) Bird male
41. Examine the following fragment of beta globin

chain in human haemoglobin and identify the
hereditary disease with reason (2)
a) Describe the type of inheritance shown in the
diagram
b) Distinguish between Mendelian disorder and HSE-June-2016
chromosomal disorder with example?
42. Observe the figure below and answer the
question following : (2)
38. Observe the following diagram and answer the
question
(Hint: step in making a cross in pea plant ) (2)
a)Identify the figure?

b)what show the shaded symbols used?
a) Name the process marked as A and writes its
significance?


43. a)Complete the flow chart of chromosomal
disorder by filling the blank boxes (A and B)
(3)
a) Identify the syndromes A and B.?

b) What is the chromosome numbers in A and
B?
HSE-SAY-2015
47. Diagrammatic representation of the pedigree
analysis of the inheritance of sickle cell
anaemia is shown below. (3)
b)What is aneuploidy ?
HSE-March-2016
44. Which of the following is not a Mendelian

disorder (1)
Colourblindness, Down's syndrome,
Haemophilia, Thalassemia
45. Study the following cross and answer the
questions. a)Name the type of inheritance shown in the
[Hint: ABO blood group in man is controlled figure ?
by three alleles IA, IB and i.] b) Write the genotype of A and B?
(Hint : Disease is controlled by a pair of allele
HbA and Hbs )
c)Represent pedigree analysis of an X linked
Recessive Inheritance diagrammatically
48. Observe the inheritance shown in A and B
a)Write the genotypes of Father, Mother and

Son.
b)The type of dominance of human blood
group inheritance is………………… (2)
a)Name the type of inheritance shown in A

46. Observe the figure and answer the question and B?
(2) b)What is the difference between the two
types of inheritance? (2)


HSE-March-2015 57. a)Paternity or maternity can be determined by
certain scientific methods. What is it? Define
49. b)Briefly write the methodology involved in the
technique ?
c)comment on its other application (3)
HSE-March-2014
58. Explain the phenomenon shown in the following

figure and the reason for difference in the
production of recombinant in Cross A and cross B
as explained by Morgan. (3)
a)Identify the syndrome from the diagram, and

write the genotype?
b)It occurs in both sexes (Male and female)? Write
the reason (2)
50. Fill in the blanks: (1)
a)...............is a metabolic disorder that occurs due
to the lack of an enzyme that converts phenyl
alanine to tyrosine.
b)...............is a disease caused by the substitution
of glutamic acid by valine at the 6th position
51. It is evident that, it is the genetic make of a sperm

that determine the sex of the child in human
beings. Substantiate (2)
59. Difference in chromosome number of some
HSE-SAY-2014
human being A,B,C, and D is given below:
A)22 pairs of Autosome
52. Correct the amino acid sequence of sickle cell
B)22 pairs of Autosome +XO
hamemoglobin (1)
C)22 pairs of Autosome+ 1 autosome
D)22 pairs of Autosome+ XXY
a) Identify the person with who suffers from
Klinfelter’s syndrome. Write its symptoms
b)Differentiate between aneuploidy and
polyploidy ? (3)
53. Identify they syndrome from the genotype given
60. Gopalan argues that if the father is of ‘A’ blood
below: (1)
group, Mother is of ‘B’ blood group. Their children
a)44 Autosome + XXY
can be only be ‘A’ group, ‘B’ group or ‘AB’ group.
b) 44 Autosome +XO
a) Do you agree with Gopalan’s arguement?
54. Sex of the Baby is determined by the father, not b) Give reason for your argument? (2)
by the mother. Substantiate (2)
55. a)Define mutation (1) HSE-SAY-2013
b)What are the different types of mutation? (1)
56. The family of Queen Victoria shows a number of 61. In the given pedigree the shaded figure denotes
Haemophilic descendants as she was the carrier of individuals expressing a specific trait (2)
the disease. Name the pattern of inheritance of
this Royal disease. (1)

Which of the following is the most probable mode

of inheritance of this trait
A-Simple mendalian recessive inheritance a) From the above give an example for genotype
B-Co dominant Relationship of a single pair of and phenotype?
allele b) Complete the work using the punnet square
C-X linked recessive transmission and find out the phenotypic ratio in the F2
D-X linked dominant transmission generation?
E-Polygenic inheritance
HSE-March-2012
HSE-March-2013
66. Complete the tale using suitable term (2)
62. Identify the trait from pedigree chart. Give one
example each. (2) Turner’s syndrome ..........a........
Sterile female
---------b-------- 44A+XXY ..........c.........
--------d--------- Trisomy-21 Mental
retardation
67. In Pea plant the gene for yellow seed colour is
dominant over green and round seed shape is
dominant over wrinkled. Write the four types of
gametes formed in heterozygous pea plant with
63. A poultry farm manager was cursing his hens for Yellow and round seeds (YyRr) (1)
producing lion share of cocks in its progeny. 68. The first child of a couple is affected with
Hearing this, Kumar-farm manager starts to lame Phenyketonuria. During the second pregnancy
his wife for delivering consecutive girl children. they visited a genetic counsellor and Prepared a
Analyse the situation scientifically and state pedigree chart of their family. (2)
whether you agree with kumar? (3) a)What is pedigree analysis?
HSE-SAY-2012 b)Draw the symbols for
i) Affected female
64. Diagrammatic representation of chromosome ii) Sex unspecified
map of Drosophila is given below (2) iii)Consanguineous mating
HSE-say-2011
Y- Yellow 69. Symbols used in human pedigree analysis and

W- White their meanings are provided in the table. Fill in the
blanks with suitable meaning or symbols (1)
M- Miniature
a)Which genes are more linked?
b)Who mapped chromosome firstly?
c)Tightly linked genes show low
recombination. Why?
65. Work of a student is given below: (3)


70. Certain facts related to human disorder are given: a)What is possible blood groups of the children
1)It is inborn error in metabolism should have?
2)It is inherited as an autosomal recessive trait b)Whether any change in blood group will occur if
3)The affected person is mentally retarded they have two sons instead of daughters?
a)name the disorder
b)What are the physiological processes behind HSE-SAY-2010
this mental retardation (2)
71. A genetic cross is represented below (2) 75. Some genetic abnormalities, their genotype and
features are distributed in Column A,B and C
respectively . Match them correctly (1.5 mark)
Column A Column B Column B
Down’s 44A+XO Rudimentary
syndrome ovary and
sterility
Turner’s 44A+XXY Furrowed
syndrome tongue and
partially opened
mouth
a) Identify the given cross? Klinfelter’s 45A+XX/XY Gynaecomastia
b) Elaborate upon the significance of such cross? syndrome and sterility
HSE-March-2011 76. The flow chart A and B given below represents the
inheritance of normal haemoglobin and sickle cell
72. The frequency of occurring Royal disease or haemoglobin (3.5)
Haemophilia is high in the pedigree of Royal
families of Queen Victoria. Which of the following
cannot be generally inferred from this? (1)
a)Queen Victoria was not homozygous for the
disease
b)Many heterozygous families were there in the
Royal family
c)Non-Royal families were not affected with
haemophilia
d)There is less possibility to become a female
diseased a) Observe the Flow chart A and complete the
e)Generally a diseased female cannot survive flow chart B
after the first menstruation b) Note down the genotype of a sickle cell
f)Pedigree analysis is the study of inheritance anaemia patient and mention the symptom of
patterns of traits in human female. the disease
73. After analyzing the karyotype of a short statured c) Mention the peculiarity of HbAHBs phenotype
Round headed person with mental retardation, a
general physician noticed an addition of HSE-March-2010
autosomal chromosome .
Answer the following question (2) 77. To find out the unknown genotype of a violet
a)Addition or deletion of chromosome generally flowered pea plant a researcher done the
result in............. flowering cross. Observe the diagram and answer
b)What may be the possible syndrome or disorder the following question:
of the above person should suspected to be? (Hint :Violet flower colour in pea plant is
c)Suggest two or more morphological peculiarity dominant over white )
to confirm the chromosome disorder in that
person?
74. A couple has 2 daughters. The blood group of
husband and wife is O (2)

a)What would be the above cross called?

b)can you determine the unknown genotype of
violet flowered parent by drawing Punnet square?
78. Polypeptide chains of two haemoglobin molecules
are shown below. One of the chains shows an
abnormality. Observe the diagram and answer the
following questions
a) Which of the polypeptide chain in the

haemoglobin is abnormal leading to a disease?
b)What is the reason for this abnormality ?
c)What will be the effect of this change in
polypeptide chain ?


MOLECULAR BASIS OF INHERITANCE YAC: Yeast artificial chromosome
BAC :…………………………………….
HSE- July 2022 (SAY/IMP.) 9. Observe the diagram of lac operon (2)
1. Mention the triplet codon acts as initiator codon

during translation. (1)
2. Describe the different stages or steps in the
process of transcription. (3)
3. Flow chart showing the various steps of DNA
finger-printing is provided :
a)Complete the flow chart (5)
a)Write the name of enzymes labeled as A,B and C

b)Which act as the inducer in Lac operon
10. Observe the diagram below
(b) Write any two applications of DNA finger-printing.

a) Identify the type of RNA Molecule
b) Write the base sequence complementary to
HSE-March 2022
the anticodon loop ? (2)
4. Name the enzyme that joins the DNA fragments in
dis-continuous strand during replication. (1)
HSE-March 2021
5. ‘Codon AUG is known as initiator codon. (a) Name 11. Under microscope, chromatin is seen as ‘beads-
the amino acid coded by AUG. (b) Write any two on-string’ like structure. Here, ‘beads’ represent
stop codons (2) the structures called _____. (1)
6. (a) Expand the term DNA. Who proposed double 12. ‘In a cell, euchromatin and Heterochromatin can
helical model of DNA ? (b) List out the nitrogen be observed under microscope.’ Distinguish
bases in DNA. between euchromatin and Heterochromatin. (2)
(3)
13. In eukaryotes, gene expression can be regulated
7. Schematic diagram of a transcription unit is given at several levels. Write different levels at which
below : (5) gene expression can be regulated. (2)
14. Figure of ‘lac operon’ in the absence of lactose
(inducer) is given below. Draw the diagram of ‘lac
operon’ in the presence of lactose and label it. (3)
(a) Identify the parts A and B.
(b) What is transcription ?
(c) Write the complementary DNA strand by observing
the strand given below : 5'-ATGCATGCAT-3'
HSE-August 2021
8. Fill in the Blanks (1) 15. The diagram represent DNA Replication process
(a) Identify ‘P’.

(b) Draw the diagram in the presence of inducer.
(c) Write the enzymes produced by the structural
genes ‘z’, ‘y’ and ‘a’.
HSE-March-2020
a)Re draw the diagram, rectifying if any mistakes
b)Name the two enzymes involved in DNA 19. One of the salient features of genetic code is
Replication process (3) “Universal”. (2)
(a) Write any other two salient features of Genetic
HSE-July-2020 code
b) Which is the initiator codon ? And name the
16. (a) Complete the flow chart given below showing
amino acid it codes.
DNA finger-printing technique. (2)
20. Observe the figure given below : (3)
(b) Who developed the DNA finger-printing (a) Identify the process in the picture.
technique ? (b) Name any two enzymes needed for this
(c) Write the full form of VNTR. process.
17. Schematic structure of a transcription unit is given (c) Write the peculiarities of the newly
below : (2) synthesized daughter strands
21. A DNA sequence is provided below. 5' –
ATGCATGCATGCATGCATGCATGCAT – 3' (3)
(a) Write down the sequence of its
complementary strand.
(b) Name the enzyme involved in transcription of
(a) Identify a, b and c. DNA.
(b) The coding sequences/expressed sequences in (c) What would happen if both the strands of the
eukaryotes are known as ________. DNA act as templates for transcription?
18. Lactose catabolism in the absence of inducer in E.
Coli is given below (3)


HSE-June-2019
22. In a double stranded DNA, the ratios

between Adenine and Thymine,
Guanine and Cytosine are constant and 27. Observe the figure given below :
equal one. Who observed this fact ? (1)

23. Observe the diagram of a double
stranded DNA strand : (2)
a) Identify the figure.

b)How many histone molecules are
present in the Histone core ?
c)Distinguish between Euchromatin
Identify the bonds A, B, C & D. and Heterochromatin. (2)
24. The following diagram shows a process 28. The diagrammatic representation of
in the Ribosome : (2) the DNA fingerprint from a crime scene

and that of a suspected persons are
give below (3)
Identify the Process and explain
25. Transcription of eukaryotes is more

a)What is your conclusion about the
complicated than that of prokaryotes.
suspects based on DNA Fingerprint
Explain any two additional complexities
given ?
found in the transcription of
(b) What is VNTR ?
eukaryotes. (3)
(c) Who developed this technique first?
HSE March 2019
29. The diagrammatic representation of a
26. Diagrammatic representation of the
process in bacteria is given below (3)
central dogma given below is not
correct. make necessary corrections
and redraw it (1)


33. Expand the following (3)
a)SNP b)BAC c)YAC
HSE MARCH 2018
34. Expresses sequence in the gene is

called (1)
a)Introns b)Muton
c)Exons d)Cistron
35. DNA is tightly packed structure and is
found as units called nucleosomes
a) Identify the process. (a) Explain the concept of nucleosomes
b) Name the enzyme involved in this (b)Differentiate between euchromatin
process. and hetero chromatin (2)
c) Explain the three major steps in this 36. Identify the disadvantages of RNA over
process. DNA as a genetic material and explain

it ? (2)
HSE JUNE 2018 37. a) In Lac-operon lactose act as inducer
30. “Human genome project is a mega molecule. Evaluate the statement and
project” give two reason to explain explain it (3)
this? (2) b) Observe the diagram of Lac –Operon
31. Observe the diagram and answer the and Identify Labelled part A,B,C and
following (2)
HSE-Model-2018
38. Complete the flow chart of Southern

blot hybridization (2)
a)Identify the diagram ?

b)Name the enzymes A,B, and C
32. “Genetic code is universal in nature”
a)Substantiate this statement ?
b)mention any two other salient
features of genetic code (2)


c)Mention two uses of DNA a) Name 'A' and ‘B' from the above
fingerprinting. diagram.
b. Describe the following terms
39. Read the following statements and
i) Capping ii)Tailing
answer the following questions
1-A genetic material should be able to
HSE-JUNE-2017
generate its replica
42. Find the odd one and write the
2-A genetic material should not provide
common feature of the other (1)
scope for mutation
Cytidine, adenine, Thymine, guanine
3- A genetic material should be able to
43. Observe the diagram (2)
express itself in the form of mendelian
characters.
a. Choose the correct statements from
the above. b. Rewrite the wrong
statement to correct one (2)
40. Observe the given diagram and answer
the following questions. (2)
a)Redraw the diagram correctly if any

mistake is there ?
b)what does the diagram indicate?
b)What is the function of DNAL ligase in
this process ?
44. Read the codon sequence in the mRNA
unit which is undergone translation
(3)
a)Identify the above process.

b) Name the enzyme required to
a)What will happend if the nitrogen
polymerise the DNAstrand.
base ‘U’ in the 6th position is replaced
c) Name the enzyme required to join the
by ‘A’ by point mutation
discontinuous strands
b)Name and define this type of
d) In eukaryotes replication of DNA occurs
mutation
at ……………phase of cell cycle.
c)draw the base sequence in the coding
41. DNA strand from which the above
mRNA is transcribed ?

HSE-March 2017 a)Find the start codon and stop
45. Which of the following combinations codon?
do not apply to DNA ? ( 1) b)How many amino acids will be
present in the protein translated
from this Mrna ?
c)The additional sequences that are
not translated in the mRNA is
called......
46. Examine the diagram of Mrna given 50. a) The hints of lac Operon is given
below . Mark the 5’ end 3’ end of Mrna below (HSE-June-2016) (3)

by giving reason (2)
47. A small fragment of a skin of different

person was extracted from nails of a
a)which substance is acting as
murdered person. This fragment of skin
inducer in this operon ?
led the crime investigators to the
b)explain the working of operon in
murder. Ased on this incident answer
the presence of inducer ?
the following questions (3)
OR
(1) What technique was used by the
51. b)With the help of the figure given,
investigators
explain the processing of hnRNA mRNA
(2) What is the procedure involved
in eukaryotes (3)
in this technique
Or
48. In an E.coli cultre lactose is used as
food instead of glucose. If So, answer
the following questions (3)
(1) How do the bacteria respond to
the above situation at genetic
level?
(2) If lactose is removed from the
medium what will happen?
HSE-June 2016
49. Observe the figure of mRNA and
answer the following question (3)


HSE-March 2016 a)which one of the suspected
52. Results of a famous experiment is given individual may involve in the crime ?
in the figure .Answer all (2) b)write any other use of DNA figure
a)Identify the experiment ? print ? (2)
b)which property of DNA is proved HSE-June -2015
by experiment ? 55. Observe the following diagram and
answer the question? (3)
a) Diagrammatically represent changes

takes place when lactose is added to
medium?
b) What is the role of z,y, and a gene in
53. Read carefully the sequence of codon
this metabolic pathway ?
in the mRNA unit and answer the
56. Observe the diagram and answer the
question (2)
question? (3)
a)what changes is needed in the

first codon to start the translation
process ?
b)if translation starts by that
change, till which codon it can be
continues ?
54. Schematic representation of DNA a)what is the difference in the
finger prints as shown below replication process ins strand A and
strand B ?
b)what is the role of DNA ligase in
the replication process in B strand ?
c)what is meant by replication fork ?
HSE-March-2015
57. Explain Transcription. A transcription
unit in a DNA is defined by 3 regions.
Write the name of any 2 regions? (2)

58. a) The steps in DNA Finger printing are c)Comment on its other application?
given below. Complete the flow chart (3)
(A and B) 63. a)Define mutation ?
b)Mention the application of DNA b)What are the different types of
finger printing (3) mutation ? (2)
HSE-March-2014
64. “Prediction of the sequence of
aminoacids from the nucleotide
sequence in mRNA is very easy, but the
59. The flow of genetic information is
exact prediction of nucleotide
shown below. Name the process of A
sequence in mRNA from the sequence
and B (1)
of amino acids coded by mRNA is
difficult”
a)Which property of genetic code is the
reason for the above condition ?
HSE-June-2014
Explain
60. Diagrams of components of DNA are b)Which are the stop codons in DNA
given below: (1) transcription ? (3)
Identify and differentiate the two 65. Diagrammatic representation of
diagrams I and II ‘Central Dogma’ is given below :
Observe the diagram carefully and
redraw it making appropriate
corrections (1)
61. a)Identify the diagram and explain

66. Observe the diagram and answer the
question (2)
a)Identify the process shown in the
b)In some cases DNA is produced from figure and define it ?
RNA. Name this process and give b)Identify the structure ‘B’, write any
example ? (2) one function of it in the process shown
62. a)Paternity and maternity can be in the diagram ?
determined by certain scientific
methods. What is it? Define?
b)Briefly write the methodology
involved in the technique ?


HSE-Sept-2013
67. Presence of lactose enhances the

production of beta galactosidase and
other enzymes in bacteria . How will
you explain this phenomenon ? (1) a)Name the process a,b,c and d
68. A DNA sequence for coding a peptide is
71. Given below is the figure showing the
given below
functioning of lac operon in presence
of lactose. Redraw the figure and label
the parts numbered 1 to 6 (3)
a)Write the complementary mRNA coding

sequence for it ?
72. RNA is not an ideal molecule as genetic
b)Find out the amino acids sequence of material because (1)
peptide chain using the codon given in the
hints
c)if a mutation causes a change in the

sixth codon CTC to CAC. It leads to a
mendelian disorder. Identify the disease
and write the specific characteristic of the
HSE-June-2012
disease ? (4)
73. Following are the first two steps in
69. Draw the flow chart showing the steps
Griffiths transformation experiment
of southern blot hybridisation using
radiolabelled VNTR ? (3)
HSE-March 2013 a)If there is any mistake correct it

70. The flow of genetic information is b)write the remaining steps ? (1.5)
shown below (2)


74. DNA is the better genetic material than in the absence of inducer (Lactose) is
RNA, Do you agree with this given below. (3)
statement? Substantiate (1.5)
75. Given below is the diagrammatic
representation of first stage of a
process in a bacteria
a)What is ‘P’?
b)Name the enzyme produced by the
a)Identify the process structural gene ‘Z’,’Y’, and ‘A’ ?
b)Name the enzyme catalyses this process c)Re draw the diagram in the presence of
c)What are the additional complexities in an Inducer
eukaryotes in this process ? (3)
HSE-March-2012
76. A transcription unit is given below.
Observe it and answer the question (3)
a)How can you identify the coding strand ?

b)Write the sequence of RNA formed from
this unit ?
c)what would happened if both strand of
DNA act as template for transcription ?
77. In E.coli Lactose catabolism is
controlled by Lac Operon. Lac operon


EVOLUTION a)Homologus organs : Divergent
evolution
1. Allele frequencies in a population
................................: Convergent
represented as p2 + 2pq + q2 = 1. Name
evolution
the evolutionary principle.
8. The original seed eating finches in
(HSE- July 2022) (1) (SAY/IMP.)
Galapagos island evolved into many
2. Who proposed the ‘rivet popper
other forms with altered beaks.
hypothesis’ ?
Identify the evolutionary phenomenon
and define it (HSE August 2021)(2)
Mention any two theories that explain
9. a) Define Hardy-Weinberg principle
origin of life.
b)Mention any four factors that affect
Hardy-Weinberg equilibrium
3. Write any three factors that affect
(HSE August 2021)(3)
Hardy-Weinberg equilibrium.
10. Select an example for homologous
organs. (HSE March 2021)(1)
4. Homologous organ : Divergent
(a) Eyes of octopus and mammals
evolution :: Analogous organ :
(b) Forelimbs of Whales and Bats
________ (HSE March 2022)(1)
(c) Flippers of Penguins and Dolphins
5. “Allele frequencies in a population are
(d) Wings of Birds and Butterflies
stable and is constant from generation
11. Evolution of Darwin finches is an
to generation.” (HSE March 2022)(3)
example for ‘Adaptive radiation’.
(a) Name the principle.
(a) What is meant by ‘Adaptive
(b) Mention any four factors those
radiation’ ?
affect this principle
(b) Give two other example for
6. Choose the correct terms from the
organisms those exhibit Adaptive
bracket to fill in the blanks and
radiation. (HSE March 2021)(2)
complete the table :
12. (a) Identify the equation related with
(HSE March 2022)(2)
genetic equilibrium given below :
(Bigbang theory, Miller’s experiment,
p2 + 2pq + q2 = 1
Lamarkism, Darwinism)
(b) Write the factors affecting genetic
equilibrium resulting in evolution.
(HSE March 2021)(3)
13. Which among the following is an
example for homology ?(HSE JULY 2020)(1)
7. Identify the relationship and fill the (a) The eye of the Octopus and of
blank (HSE August 2021)(1) Mammals
(b) Sweet potato and potato


(c) Thorns and tendrils of Bougainvillea
and Cucurbita
(d) Wings of butterfly and of birds
14. Define Hardy – Weinberg principle.
(b) List out any two factors affecting
Hardy – Weinberg Equilibrium.
(HSE JULY 2020)(2)
15. Diagrammatic representation of the
operation of natural selection on
different traits is shown below : 18. p2 + 2pq + q2 = 1 denotes an
(HSE JULY 2020)(2) evolutionary principle.
(HSE March 2020)(2)
(a) Name the principle.
(b) Mention any three factors affecting
this.
19. Based on evolution in the geological
period arrange the plants and animals
in the correct order in various million
years ago. Choose the appropriate
organisms from the bracket.
[Reptiles, Plants, Sea-weeds, Jawless
fish, Fish with stout fin]
(i) Identify ‘a’, ‘b’ and ‘c’.

(ii) What is the evolutionary significance of ‘b’
?
16. Which of the following human ancestor

is more ‘ape’ like? (HSE March 2020)(1)
(HSE-June-2019)(2)
(a) Homo habilis
20. Make a flow chart using the following
(b) Dryopithecus
terms : (HSE-June-2019)(2)
(c) Australo pithecines
(Natural selection, Struggle for
(d) Homo erectus
existence, Variation, Origin of species,
17. Fill the blanks in Column A and B using
'Over production, Survival of the
appropriate terms. (HSE March 2020)(2)
fittest]
21. Prepare a flow chart showing the
evolution of modern man in the


hierarchical order of their evolution b)enlist any three factors affecting this
using the details given below : principle (HSE-June 2018)(2)
Homo erectus, Homo habilis, Dryopithecus, 25. Prepare a flow chart of evolution of
Australopithecines, Homo sapiens, Rama pithecus,
man in descending order by choosing
Neander thal nman (HSE-March-2019)(2)
the names given below
22. Some examples of evolutionary
(HSE-June 2018) (3)
structures are given below. Classify
them under suitable headings:
(a) Forelimb of Man, Cheetah, Whale,
Bat.
(b) Wings of Butterfly, Bird.
(c) Thorns and tendrils of Bougainvillea 26. Complete the boxes with the suitable
and cucurbita. words given below, :
(d) Vertebrate hearts or brains. [Analogus, Homologus. Convergent
(e) Eye of the Octopus and Mammals. evolution. Divergent evolution]
(f)Flippers of penguins and Dolphins. (HSE-March 2018)(2)
(HSE-March-2019)(2)
23. Above homologous organs provide
evidence of a particular type of
evolution. (HSE-June 2018) (2)
(a) identify the type of evolution. 27. Explain the factors affecting hardy-
(b) What do you mean by Homologous Weinberg equilibrium
organs ? (HSE-March 2018)(2)
Diagrammatic representation of Miller
experiment is given below. Answer the
following questions (HSE-Model 2018)(2)
24. p2+2pq+q2 =1 is the gene frequency of 1. Name A and B

the population showing an 2.From those given below chose the
evolutionary principle new molecules obtained by the other
a)Name the principle scientists from similar experiment.

(Amino acid, sugar, fat, Alkaloid, a) What do B and C represent
pigment , flavanoid ) b) Explain the process shown in B and C
28. A collection of moths made in England 32. Z value of a frugivorous species are
during 1850, supported evolution by given below . which value is not
natural selection' applicable to continents
Write a note on the process of natural (HSE-March-2017)(1)
selection on moths influenced by (1) 0.6 (2) 0.65 (3) 0.20 (4)0.68
industrialisation . (HSE-Model 2018)(2) 33. A population of 208 people of MN
29. Arrange the following names in blood group was sampled and it was
ascending order of evolution. found that 119 were MM group, 76MN
Homo sapiens, Ramapitrecus, blood group, 13NN group. Answer the
Australopithecines,Homo habilis, following questions
Neanderthal, Homo erectus (HSE-March-2017)(3)
(HSE-Model 2018)(3) a) Determine the gene frequencies of
30. Rearrange the following in the order of M and N alleles in the population
their evolution period b) How does the above frequency
(HSE-JUNE-2017)(1) affect evolution?
-Australopithecines Or
-Neanderthal man Examine the pictures of Darwin’s
-Homo sapiens finches given below and answer the
-Homo erectus following questions
-Dryopithecus a)What phenomenon in evolution is
31. Diagrammatic representation of the represented in the picture ?
operation of Natural selection on b)explain the phenomenon with the
different trait is given. Observe it and help of an additional example ?
answer the questions :
(HSE-JUNE-2017)(3)
34. Which of the following sets of gases

were used in Miller’s experiment?
(HSE-March-2017)(1)


35. Observe the diagram and answer the b)mention any two factors affecting
questions given below equilibrium ?
(HSE-June-2016) (1) c)what is the significance of
disturbance occur in genetic
equilibrium ?
40. Observe the diagrammatic
representation and answer the
question (HSE-June 2015)(4)
a)Identify the type of evolution in the
concept diagram A and B ?
b)write example pair each for
homologous and analogous organs ?
36. Statement below show features of
some human fossils. Read carefully and
identify the fossil (HSE-June 2016)(2)
a)Human like being with brain capacity
650-800cc
b)Lived in east and central asia with
a)Explain the phenomenon shown in
brain capacity 1400 cc
the figure ?
37. Which theory talks about huge
b)How can it consider as an evidence of
explosion that lead to origin of
evolution?
universe ? (HSE-March 2016)(1)
c)Write any other example for this
38. ‘Natural selction can lead to
phenomenon. Explain
stabilisation ,directional change and
41. Four groups of organs are given below:
disruptive change’
Read them carefully and answer the
Explain the term stabilization,
questions (HSE-June 2015)(4)
directional and disruptive change
mentioned above ?
(HSE-March 2016)(3)
39. Read the principle and answer the a)Categorize the four groups of organs
question: (HSE-March 2016)(3) as homologous and analogous organs ?
“Allele frequency in a population are b)Based on each group of organs
stable and constant from generation differentiate convergent evolution and
to generation called genetic divergent evolution ?
equilibrium” c)illustrate homologous and analogous
a)Name the principle mentioned here? organ as evidences of evolution ?
42. Match the following

(HSE-March-2015)(2) 46. Given below is the diagrammatic
representation of operation of natural
selectionon different traits
a)Identify the type of natural selection
A,B, and C with explanation of each.
b)Define Hardy-weinberg principle?
(HSE-March 2014)(4)
43. The above shown pictures are beaks of
a particular type of bird seen in an
island during Darwin’s journey
(HSE-March 2015)(2)
a)identify the bird and name the
island?
b)write the significance of this process
in evolution ?
44. Arrange the following in a hierarchical
manner in ascending order based on
their period of evolution.
(HSE-June 2014)(1) 47. A specific rat population was controlled
for about decade by a poison. After
population decline for about 10 years,
the rat population was increased and
45. a)The diagram given below shows a stabilized.
particular type of evolutionary process
in Australian marsupials. Identify the
evolutionary phenomenon and
comment on
b)Give another example for such type
of evolutionary process and explain ?
(HSE-June 2014)(3)
Resistance to poison is governed by a
dominant autosomal gene ‘R’. In 1975
majority of the resistant animals are
heterozygous at this locus (Rr)
a)What was the major genotype of rat
population before 1961
A)RR B)Rr C)rr


D)R is absent as it produced by a  Eye of octopus and mammal
mutation
b)What explanation you give for the 50. Theory of chemical evolution is a
development of resistance against version of theory of abiogenesis.
poison in these rats ? Analyze the statement.
c) “This illustration can be used to (HSE March -2013)(2)
explain theory of evolution” 51. Diagrammatic representation of the
Substantiate (HSE May-2013)(2) operation of the natural selection in a
48. The diagram shows how the number of population is given (june-2012)(1)
species in different group of
vertebrates has changed between 400
million years ago and 5 million years
ago. The wider a block indicate the
more species there are
(HSE-May 2013)(3)
Redraw the diagram when nature

select large sized and small sized
individuals
52. Complete the flow chart showing the
evolution of man using age, name and
brain capacities of fossils
(June-2012)(3)
a)Which is the species found most at

200 million years ago ?
b)Birds are most close relative to which
group of organism?
c)what is the trend observed in the
evolution of amphibians?
49. Arrange the following examples under
two heads viz-Homologous organ and 53. Note the relationship between the first
analogous organ (HSE-March 2013)(2) pair and complete second pair
 Fore limb of whale and bat (March-2012)(1)
 Wings of butterfly and bat a)Natural selection : Darwin
 Heart of man and cheetah Inheritance of acquired character
:.......................

b)Heart of vertebrate : Homologous
organ
flipper of penguin and Dolphin
:..............
54. A collection of peppered moths made
in England during different period is
given below (March-2012)(1.5)
a)What is your observation ?

b)Name the evolutionary process
behind this process?
c)write the reason for decreased
number of white winged moth in 1920
?
55. An evolutionary process occurred in
the evolution of marsupial mammals in
Australia is given below ?
(March-2012)(1.5)
a)Name this evolutionary process?

b)suggest another example for this
phenomenon ?


MICROBES IN HUMAN WELFARE 10. Enzyme used in detergents for removing
oily stains from laundry is _____.
(a) Lipase (b) Protease
1. Who discovered the first antibiotic (c) Amylase
Penicillin ? (HSE-July 2022)(1) (d) Pectinase (HSE March- 2021)(1)
2. Write the use of following microbial 11. Fill in the blanks to complete the table :
product : (HSE-July 2022)(2)
(a) Pectinase and Protease
(b) Streptokinase
3. The first antibiotic discovered was
_______. (HSE-March 2022)(1)
4. Match the following :(HSE-March 2022)(2)
(HSE March- 2021)(2)
12. A free living nitrogen fixing bacteria in the

soil. (HSE-July-2020)(1)
(a) Rhizobium (b) Azospirillum
5. (a) Expand the term AIDS. Mention the (c) Nostoc (d) Anabaena
name of virus that causes AIDS. 13. Match the following : (HSE-July-2020)(2)
(b) Name the widely used diagnostic test (a) Acetic acid (i)Trichoderma
for AIDS. polysporum
(b) Citric acid (ii) Acetobacter aceti
(c) List out any four practices for the
(c) Cyclosporine A (iii) Lactobacillus
prevention of AIDS. (d) Lactic acid (iv) Aspergillus niger
(HSE-March 2022)(5) (v)Monascus
purpureus
6. Name the free living fungus used as an
effective biocontrol agent of several plant 14.Microbe which help in the production
pathogen (HSE-August 2021)(1)
of Biogas (HSE-March-2020)(1)
7. Biogas is a mixture of gases produced by
(a) Aspergillus niger
the microbial activity and used as a fuel
(b) Trichoderma Polysporum
.Mention the name of bacteria used for
(c) Saccharomyces cerevisiae
production of biogas
(d) Methanobacterium
(HSE-August 2021)(1)
15.Some examples of microbes in human
8. Match the following(HSE-August 2021)(2)
A B welfare are given. Classify them under
1)Trichoderma a)Streptokinase the headings given below.
polysporum
2)Monascus b)Ethanol
[Egs : Rhizobium, Propionibacterium
purpureus sharmanii, Azaspirillum, Lactic acid
3)Streptococcus c)Cyclosporin bacteria, Anabaena, Azotobacter,
4)Sacharomyces d)Statin
cervisiae Aspergillus niger, Saccharomyces
cerevisiae...] (HSE-March-2020)(2)
9. Organic pollutants in sewage water is
measured as _____(HSE March- 2021)(1)
(a) GMO (b) MTP (c) BOD (d) HGP


b)Clostidiumburyliorm
c)Acetobacteraceti
d)Aspergillusruger
(HSE-model 2018)(1)
16.Match the following (HSE-June-2019)(2)
22.a)Name the yeast used for the
commercial production of ethanol.
b)Name the yeast used for the
production of statins
(HSE-model 2018)(2)
23.Complete the table by filling A,B,C and
D using hints from the bracket
17.Bio-fertilisers are organisms that enrich
(HSE-JUNE-2017)(2)
the nutrient quality of the soil. How
(Gobar gas, biological control, anabaena,
these biofertilisers enrich the soil
Sacharomyces cerviciae , Prpionibacterium
nutrients ? Give two examples
sharmanii )
(HSE-June-2019)(2)
18.Microbes are useful to human beings in
Methanogen- ........A.............
diverse ways. If so, name the following
Bread making-.........B.............
: (HSE-March-2019)(2)
Biofertilizer:.............C............
(a) Microbe known as "Baker's Yeast".
Trichoderma:...........D..........
(b) Lactic acid producing bacterium.
24.What are the advantages of
(c)Fungus which helps in the production
biofertilizers over chemical fertilizers?
of bio-active molecule – cyclosporine A.
Give an example for biofertilizer?
(d) Symbiotic nitrogen fixing bacterium.
(HSE-March-2017)(2)
19.In Sewage Treatment plant microbes
25.Chose the correct answer from the
play a significant role. Distinguish
bracket (HSE-June-2016) (1)
between primary and secondary
Cyclosporin A is produced by.......
treatment in sewage plant?
(HSE-June 2018)(2) (a)Aspergillus (b)Clostridium
20.Complete the table with appropriate (c)Trichoderma (d)Acetobacter
terms (HSE-March 2018)(2) 26.Select a bio-control agent from the
given microbe (HSE-June-2016)(1)
a)Baculo virus b)Rhino virus
c)Picorna virus d)Adeno virus
27.“BOD is commonly calculated as an
index of water pollution”
21.Find the odd one out a)Do you agree with this statement? Why?
a)Trichoderma polysporum b)Expand BOD? (HSE-March 2016)(2)

28.In our state waste management is a
problem. Government promote and
give subsidy to biogas plants. Comment
the functioning of biogas plants with
the help of microbe.
(HSE-June 2014)(2)
29.BOD of some water sample is given 33.Match the following (june-2012)(2)
below (HSE-June 2015)(2)
A- Sample-1 200mg/L
B- Sample-2 80mg/L
C- Sample-3 300mg/L
D- Sample-4 25mg/L 34.Rearrange the coloumn B & C with
a)Which of above water sample is most respect to A (March-2012)(2)
polluted ? A B C
b) what is meant by flocs/ what is its Monascus Streptoki Antibiotic
role in sewage treatment ? pupureus nase
30.Microbes can also be used as a source Streptococcus Statin Immunosuppr
essant
of energy. Substantiate with example?
Pencillium Cylospor Clot buster
(HSE-March 2015) (2) notatum in-A
31.Complete the illustration appropriately Trichoderma Pencillin Cholesterol
? (HSE-MAY 2013)(2) polysporum lowering agent
32.Some bioactive molecule, their sources

and their medical importance are given
in the table below. Fill up the missing
part (HSE-March 2013)(2)


7 Which is the causative organism for
malaria disease ? Name the two hosts
HUMAN HEALTH AND DISEASE
required for the malarial parasites to
1 Mention any four measures useful for complete its life cycle
prevention and control of alcohol and (HSE August 2021)(2)
drug abuse (HSE July 2022)(2) 8 Observe the figure
2 Match the column (A) with column (B) (HSE March 2021)(2)
(HSE July 2022)(2)
3 Match the Column (A) with Column (B)

and (C) : (HSE July 2022)(2) (a) Identify the molecular structure
given in the figure.
(b) Name the regions labelled as A, B
and C.
9 Drug/Alcohol abuse results in
immediate and far reaching effects.
Write some effects you have studied.
(HSE March 2021)(2)
10 Vaccines are given to children at
4 Write any four ill-effects of various stages of their development.
Drug/Alcohol abuse. (a) What is meant by ‘vaccine’ ?
(HSE March 2021)(2) (b) Write the principle of vaccination.
5 Innate immunity is characterised by (HSE March 2021)(2)
providing different types of barriers. 11 Observe the list of certain common
Name the four types of barriers of diseases in human given below and
innate immunity (HSE August 2021)(2) answer the following : (HSE-July-2020)(2)
6 World Health Organisation has started
a number of programmes to prevent
(a) Identify the bacterial disease among
the spreading of HIV Infection. Mention
the enlisted.
any four preventive measures against
(b) Name its causative organism.
HIV infection (HSE August 2021)(2)
(c) Mention any two symptoms of it.

12 Prepare a pamphlet as part of an 19 Complete the flow chart given below
awareness programme in your school
regarding the “Prevention and control of
Alcohol and Drug abuse in adolescents”.
[Hint : Prevention and control measures]

(HSE-July-2020)(3)
13 Name any two protozoan diseases, its
causative organism and any two
symptoms. (HSE-March-2020)(2)
14 Complete the illustration chart given
below. (HSE-March-2020)(2)
15 Explain the measures useful for (HSE-March-2019)(2)
prevention and control of alcohol and
drugs abuse among adolescents. 20 List of some diseases commonly
(HSE-March-2020)(3) occurring in man are given below.
16 'Don't die of ignorance.' Arrange them based on causative
(a) About which it is mentioned ? organism in the table. Malaria,
(b) List two measures taken by WHO to Common cold, Typhoid, Ascariasis.
prevent it (HSE-June-2019)(2) Pneumonia, Ring worm, Amoebiasis
17 Observe the figure and answer the (HSE-March-2019)(2)
following questions (HSE-June-2019)(2) Bacteria Fungus Virus Protozoan
a) Identify the given molecule.
b)Mention two types of immune
responses in human body.
21 Identify the bacterial disease from the
following (HSE-June 2018)(1)
a)Typhoid b)Amoebiasis
c)Malaria d)Filariasis
22 Classify the following barriers of innate
immunity under 3 suitable heading
(HSE-June 2018)(3)
18 Write the effect of the following drugs 23 Innate immunity is a non-specific type
in human body (HSE-June-2019)(3) of defense and consists of four types of
(a) Ophiods (b) Cannabinoids barriers. Categorize the barriers and
(c) Coca alkaloids give one example for each.

(HSE-March 2018)(2) 30 Fill the blanks A,B,C and D using correct
24 Complete the table given below terms given in the box
(HSE-March 2018)(2) (HSE-JUNE-2017)(2)
Passive immunity
Sensitivity to some particles
Metastasis
Active immunity
Autoimmune deficiency
Immune deficiency disease
a)....A............ – Cancer
25 Consumption of drug and alcohol affect b) Allergy -..B.........

the person’s mental and physical C).....C.......-AIDS
health very badly. List the warning sign
of alcohol or drug abuse d)Rheumatoid arthritis-.......D......
(HSE-March 2018)(2) 31 Morphine is said to be an abused drug.
26 Study the relationship between the Discriminate the term ‘use’ and ‘abuse’
first two words and fill the blank space of the drugs based on this example ?
with a suitable word (HSE-March-2017)(2)
Pnemonia : Streptococcus 32 Differentiate active immunity from
pneumonae passive immunity. Give an example for
Typhoid:.................. passive immunity ?
(HSE-Model 2018)(1) (HSE-March-2017)(2)
27 Prepare a hand out to educate 33 Complete the table by filling a,b,c and d
students about the symptoms of the (HSE-June 2016)(2)
dreaded disease cancer, its detection
and treatment (HSE-Model 2018)(3)
28 Prepare a brief note to be presented in
an awareness programme for
adolescents about AIDS, their causes
and preventive measures
(HSE-June-2017)(3)
29 Fill the box A,B,C and D
34 Answer the question about the given
(HSE-JUNE-2017)(2)
figure (HSE-June 2016)(2)


38 Match the terms given in three
coloumn of table correctly
(HSE-June 2015)(2)
a)Identify the part X and Y ?

39 “If proper care and attention is not
b)Name any two type of this
given by adults, adolescent may
molecules ?
become addicted to drug or alcohol”.
35 Select odd one out and justify your
What is your opinion about this
selection (HSE-June 2016)(1)
statement ? substantiate your answer ?
Malaria, Gonorrhoea, Amoebiasis,
(HSE-June 2015)(2)
filariasis.
40 Cancer is one of the most dreaded
36 Identify the disease shown in the
diseases of human beings, and is major
following figure and write the
cause of death all over the globe
causative organism of the disease
(HSE-March-2015)(3)
(HSE-March 2016)(1)
a)what are the causes of cancer?
b)what are the methods for
detection of cancer?
c) What are the types of treatment
of cancer?
41 Briefly describe the characteristic of
cancer cells ? (HSE-June 2014)(2)
42 It is said that “Chikunguniea” once
affected will not a person in next half
of his life. Justify this statement
37 “Blood of a man is tested positive for (HSE-June 2014)(2)
cannainoid” 43 Classify the diseases given in the box
a)what are these? as two groups based on their
b)from where there are extracted causative organism. Specify the type
naturally ? of causative organism for each group
c)which part of the body is affected (HSE-March-2014)(2)
by these ? (HSE-March 2016)(3)


a)Erythroxylum coca : Cocaine
Typhoid, Papaversomniferum :...............
Malaria, Pneumonia
b)salmonella typhi : Typhoid fever
Diphtheria
Amoebiasis plasmodium falciparum :............
51 One of your Friend Argued that anti-
44 Prepare a pamphlet for an awareness
retroviral drugs are effective
programme in your school about the
medicine to treat AIDS
measures to prevent and control
(June-2012)(3)
alcohol and drug abuse in adolescents
a)What is your opinion about it?
(March-2014)(2)
b)How HIV affect our immunity ?
45 The meaning of ‘antibiotics’ is
‘against life’, where as with reference
52 Arrange the following diseases in the
to human being is is ‘pro life’
following coloumn in correct order
(March-2014)(2)
(March-2012) (2)
Substantiate this statement with
Typhoid,Ring worm, Amoebiasis,
suitable example ?
AIDS, Malaria, Pneumonia, Common
46 Prepare a pamphlet for adolescent
Cold
children to make them aware of
alcohol and drug abuse?
(HSE-May 2013)(2)
47 “Prevention is better than cure” . This
statement is true in the case of AIDS
as well as immunisation .
53 In a class room discussion a student
Substantiate (HSE-May 2013)(2)
argues that allergic reaction are more
48 Most often HIV Infection occur due to
common in metro cities than in
conscious behaviour patterns. Do you
villages. (March-2012)(2)
agree with this statement ?
a)Do you agree with this statement ?
Substantiate your answer?
b) Which type of immunoglobulin is
(HSE-March 2013)(2) responsible for allergic reactions?
49 Nature has as many verities of plants c) suggest two drugs which reduce
which give drugs for abuse, as there allergic symptoms ?
are medicinal plants which give
medicines. Substantiate with two
examples (HSE March 2013)(2)
50 Note the relationship between first two
terms and suggest a suitable term for
the fourth place (june-2012(1)


8. (a) The term ‘biodiversity’ was
popularised by _________.
BIODIVERSITY AND CONSERVATION
(b) Name the two types of
1. Differentiate between in-situ and ex- biodiversity conservation.
situ approaches of biodiversity (c) Write any three causes of
conservation with two examples biodiversity loss.
each (HSE July 2022)(2) (HSE-July 2020)(3)
2. The term ‘Biodiversity’ was 9. Select the cause of extinction of
popularised by the scientist Cichlid fish in lake Victoria of East
________. (HSE-March 2022)(1) Africa. (HSE-March 2020)(1)
3. (a)Write four major causes of (a) Habitat loss and fragmentation
Biodiversity loss. (b) Over-exploitation
(b) Give one example for in-situ (c) Alien species invasions
conservation and ex-situ (d) Co-extinctions
conservation of Biodiversity. 10. Tropical Amazonian rainforest in
(HSE-March 2022)(3) South America has the greatest
4. Biodiversity can be descried at 3 biodiversity on earth. Do you agree
levels of biological organizations with this? Explain.
a) Mention three levels of biological (HSE-March 2020)(2)
diversity ? 11. In your school the Science Club
b)Who popularized the term decided to conduct a seminar about
“Biodiversity” (HSE-August-2021) (2) "Biodiversity conservation -
5. Mention the two conservative Approaches". You are invited
approaches to protect our to.present a paper on this seminar.
biodiversity. Give one example for List out the main points you
each conservative approach ? included in the presentation.
(HSE-August-2021) (2) (Hint : In Situ, Ex-Situ conservation)
6. Now-a-days, the world is facing a (HSE-June-2019)(3)
problem of increased rate of species 12. Which among the following belongs
extinction due to human activities’. to ex-situ conservation?
Write major causes of biodiversity Wildlife sanctuaries, Bio sphere
losses (HSE March 2021)(2) reserves, Zoological parks, National
7. “Species diversity is greater in parks, Sacred groves
tropical regions than in temperate (HSE-March-2019)(1)
regions.” Give reasons. 13. The causes of biodiversity loss are
(HSE March 2021)(2) designated as "EVIL QUARTET".
Explain the Evil Quartet in
biodiversity loss.

(HSE-March-2019)(2) 20. “When we conserve and protect
14. Human beings can conserve and the whole ecosystem, its
protect ecosystem and biodiversity. biodiversity at all levels is
Prepare a handout to show protected”. Based on this statement
different methods of biodiversity explain the strategies of biodiversity
conservation? (HSE-June 2018)(2) conservation (HSE-June 2016)(3)
15. Observe the graph and answer the 21. “when need turns to greed, it leads
following questions to biodiversity loss”. Substantiate
(HSE-March 2018)(3) this statement by explaining two
causes of biodiversity loss.
(HSE-June 2016)(3)
22. Observe the concept diagram of Evil
Quartet of biodiversity loss
(HSE-March 2016)(2)
a) Name S,A,C and Z in the graph

b) Name the scientist who explained
species-area relationship
16. "The accelerated rates of species
extinction that the world is facing
today is largely due to human
activities". (HSE-Model 2018)(3)
a)Write A and B
Do you agree with this statement.
b)What is co-extinction ?
Justify your answer.
17. Explain the levels of biodiversity?
23. Read the statement and chose the
(HSE-JUNE-2017)(3)
correct option (HSE-March 2014)(1)
18. Explain different types of
biodiversity conservation with
example (HSE-JUNE-2017)(3)
19. Distinguish between in situ
conservation from ex situ
conservation with one example
each ? (HSE-March-2017)(2)


24. Two approaches for the a)Do you agree with this statement?
conservation of biodiversity is Justify your answer
shown as A and B(HSE-June 2015)(3) b)distinguish between two types of
biodiversity conservation ?
(HSE-March 2014)(3)
28. While preparing the species are
relationship graph of 4 areas, the
following Z values are obtained
Area A =0.1
a)Identify the type of conservation Area B= 0.8
shown in A and B? Area C =1.2
b)Write the difference between two Area D= 0.3
types of biodiversity conservation a)Which area show maximum
shown in A and B? species richness ?
c)Which of the above approach is b)what are the expected reasons for
more desirable when there is an the loss of biodiversity in area with
urgent need to save species ? low species richness ?
25. We have moral responsibility to (HSE-May 2013)(3)
take good care of earth’s 29. “Nature does lot of service for
biodiversity and pass it on in good which an economic value or price
order to next generation. tag cane put” substantiates giving
a)Define biodiversity? examples. (HSE-March 2013)(2)
b)write causes for biodiversity loss? 30. “Conservation of biodiversity is a
c)Name two type of biodiversity collective responsibility of all
conservation ?(HSE-March 2015)(3) nations”. Write a slogan stressing
26. a)Variety of species are present the significance of biodiversity
around us, what they constitute and conservation? (HSE-March 2013)(1)
comment? 31. Last twenty years alone have
b)comment on in situ conservation witnessed the disappearance of 27
and ex situ conservation? animal species from earth.
c)In these aspect explain the (June2012)(3)
concept of hot spot with example- a)Name the animal disappeared
give importance to recent issues recently
with regard to western ghat b) What may be the causes of this
(HSE-June 2014)(3) loss ?
27. “Nature provides all for the need of c) How can we conserve
man but not for his greed” biodiversity?


32. The given graph shows the
distribution of insects in different
latitude of earth (March-2012)(3)
a)What is your observation ?

b)List the three reasons for greater
biodiversity in tropical region ?
c)Write 2 causes of biodiversity loss ?

Hsslive Xii Zoology Prvs Questions Vers 2022 Navas

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Hsslive Xii Zoology Prvs Questions Vers 2022 Navas

Uploaded by

Copyright:

Available Formats

Join Now: https://join.hsslive.in/group Downloaded from www.Hsslive.

Navas cheemadan SOHSS-AREEKODE

11. Expand the following terms (1)

NAVAS CHEEMADAN navas9895@gmail.com

Navas cheemadan SOHSS-AREEKODE

19. The wall of uterus has 3 layers of tissues (2)

26. Write any four objectives of Reproductive and

NAVAS CHEEMADAN navas9895@gmail.com

Navas cheemadan SOHSS-AREEKODE

36. (a) Expand ART. (2) HSE-June-2019

38. Name the technique of transferring embryos up to HSE-March-2019

NAVAS CHEEMADAN navas9895@gmail.com

Navas cheemadan SOHSS-AREEKODE

50. Number of spermatids produced from 25

62. Human female possess 44+XX chromosome

54. Name the cells in testis which synthesize and

NAVAS CHEEMADAN navas9895@gmail.com

Navas cheemadan SOHSS-AREEKODE

Navas cheemadan SOHSS-AREEKODE

79. Foetal sex can e determined by a test based

81. It is evident that, it is the genetic makeup of

87. Sex of the bay is determined by the father,

Navas cheemadan SOHSS-AREEKODE

NAVAS CHEEMADAN navas9895@gmail.com

Navas cheemadan SOHSS-AREEKODE

97. Find out the odd one from the following,

NAVAS CHEEMADAN navas9895@gmail.com

Navas cheemadan SOHSS-AREEKODE

108. The treatment facility advertised on the

Navas cheemadan SOHSS-AREEKODE

Click here to watch video lesson

NAVAS CHEEMADAN navas9895@gmail.com

Navas cheemadan SOHSS-AREEKODE

7. T.H Morgan selected Drosophila melanogaster as

Navas cheemadan SOHSS-AREEKODE

26. Find the odd one out. Justify your answer.

(a)Which one of the polypeptide chain is

NAVAS CHEEMADAN navas9895@gmail.com

Navas cheemadan SOHSS-AREEKODE

28. Observe the following cross between

a) Identify the cross?

a) Observe the above cross and name this

NAVAS CHEEMADAN navas9895@gmail.com

Navas cheemadan SOHSS-AREEKODE

37. Observe the diagrammatic representation of

41. Examine the following fragment of beta globin

a)Identify the figure?

NAVAS CHEEMADAN navas9895@gmail.com

Navas cheemadan SOHSS-AREEKODE

a) Identify the syndromes A and B.?

44. Which of the following is not a Mendelian

a)Write the genotypes of Father, Mother and

a)Name the type of inheritance shown in A

NAVAS CHEEMADAN navas9895@gmail.com

Navas cheemadan SOHSS-AREEKODE

58. Explain the phenomenon shown in the following

a)Identify the syndrome from the diagram, and

51. It is evident that, it is the genetic make of a sperm

NAVAS CHEEMADAN navas9895@gmail.com

Navas cheemadan SOHSS-AREEKODE

Which of the following is the most probable mode

Y- Yellow 69. Symbols used in human pedigree analysis and

NAVAS CHEEMADAN navas9895@gmail.com