Sanger Sequencing-Critical Innovations

1) Lee Hood (1986)

Radiolabelled ddNTPsFluorescently Labelled ddNTPs
eliminate radioactivity, multiplex reactions

2) Molly Craxton (1991)

thermostable polymerases, cycle-sequencing
significantly reduced amount of template required, 96-well format

3) Michael Hunkapiller, Lee Hood, Applied Biosystems (circa

1991)
slab gelscapillary gel electrophoresis
much easier/better automation, lane tracking, high speed runs,
better resolution, 3 x 96 well/24 hours  12 x 96 well/24 hours
Multiplexed (104) Capillary Array for Electrophoresis
State of the Art - ABI 3700 “Prism” DNA Sequencer
 Complete genome sequencing:
Why bother?
( For instance, why not just sequence expressed genes
as cDNAs? Expressed genes constitute <5% of the
entire human genome! )

HOWEVER:
• Control elements not sequenced
• Many genes expressed at low levels
• Some genes difficult to recognize
• The remaining 95% of ‘junk’ DNA may have some as yet
unknown but important function
 1.) Shotgun Sequencing
• A team headed by J. Craig Venter from the Institute for Genomic
Research (TIGR) and Nobel laureate Hamilton Smith of Johns Hopkins
University, sequenced the 1.8 Mb bacterium with new computational
methods developed at TIGR's facility in Gaithersburg, Maryland.

• Previous sequencing projects had been limited by the lack of adequate

computational approaches to assemble the large amount of random
sequences produced by "shotgun" sequencing.
• In conventional sequencing, the genome is broken down laboriously into
ordered, overlapping segments, each containing up to 40 Kb of DNA.
• These segments are "shotgunned" into smaller pieces and then
sequenced to reconstruct the genome.
• Venter's team utilized a more comprehensive approach by
"shotgunning" the entire 1.8 Mb H. Influenzae genome.
 Shotgun Sequencing
• Used to sequence whole
genomes
• Steps:
– DNA is broken up
randomly into smaller
fragments
– Dideoxy method produces
reads
– Look for overlap of reads

Strand Sequence
AGCATGCTGCAGTCATGCT-------
First Shotgun Sequence
-------------------TAGGCTA
AGCATG--------------------
Second Shotgun Sequence
------CTGCAGTCATGCTTAGGCTA
Reconstruction AGCATGCTGCAGTCATGCTTAGGCTA
 Shotgun Sequencing
• Previously, such an approach would have failed because the

software did not exist to assemble such a massive amount of

information accurately.

• Software, developed by TIGR, called the TIGR Assembler was up

to the task, reassembling the approximately 24,000 DNA fragments

into the whole genome.

• After the H. Influenzae genome was "shotgunned" and the clones

purified sufficiently the TIGR Assembler software required

approximately 30 hours of central processing unit time on a

SPARCenter 2000 containing half a gigabyte of RAM .

http://bioinfo.mbb.yale.edu/course/projects/final-4/
 Shotgun approach: H influenza as an example

 Genome 1830000 bp
 Broken up into random overlapping fragments (sonication)
 1-2 kb fragment ligated in to plasmid
 Got19687 clones
 Ends of inserts were sequenced
 28643 sequences obtained = 11631485 bp (~ over 6x genome)
 30 hrs sequence assembly with 512 RAM of computer with TIGR
assembler
 140 contigs
Need to fill in 140 gaps
1.) Found clones whose seq was splitted in other clones= total 99 gaps
were filled
2.) Remaining 42 gaps: Cloning in other vector (lambda)---- each library
was probed with the 84 nt seq identical to the seq at the end of
unlinked contigs
Random probes were also selected to validate the previous results
Gap filling in Shot Gun sequencing

 Probe genomic
library (not
clones used for
sequencing)

 Use probes from

ends of contigs

 Visualizes clones
that will fill in
gaps
 2.) Clone contig approach
 Good for eukaryotic genome

 Genetic and physical map of the

fragment/genome should be known

 Make clones as long as possible to minimize

number needed

 Arrange clones before sequencing

 Several ways
Methods to build clone contigs:
1. Chromosome Walking: a.) By Hybridization

 Use random clone as probe

 Use next clone as probe, etc.

 Problems arising due to repeats can be avoided by

blocking the repeats in genome before hybridization
b.) By PCR :

If the end fragments is sequenced then the walk can be

speeded up by PCR

If Oligos from A1 gives amplification in B4 so they have

overlapping fragments.

Continue the walk by sequencing B4 and design new pair

of Oligos for next step……..

Not good for large genomes (slow)

Can assemble only 15-20 contigs, good for positional

cloning
 Expression libraries--
alternative to hybridization

• Gene product (protein) is made (by E. coli) and

detected by variety of methods
• Eukaryotic genes: cDNA library is essential (no
introns, gene size small)

Screening:
• Immunological
• Functional
Immunological screening
 The plaque lift: kind of
like a Western blot

Detect antibody with secondary antibody conjugated

to reporter enzyme for visualization
 Functional cloning
• Genetic complementation:
– Cloned DNA sequence corrects defect in host
strain
• Gain of function
– Cloned DNA confers new function to host

Both of these require cloned DNA to be

transcribed, translated into functional protein
in host (eukaryotic protein in E. coli could
cause problems)

And you need a good assay for expression!

Functional
complementation: Shaker-2 mice have
defects in the inner
shaker gene ear, poor balance, and
deafness

The shaker 2 gene encodes myosin XV

Mutations in the human homolog can
cause deafness
Screening libraries for specific genes
(finding the needle in the haystack)
I. Isolating individual clones
II. Screening by sequence
A. Hybridization
B. PCR
III. Screening by protein
structure/biological function
IV. Gene identification--diseases
 Positional Gene Cloning
Positional cloning is a term derived from the late 1980s which
basically was to be contrasted to functional cloning, so probably we
should define both. Functional cloning was finding a gene by
understanding something about what its function is.

So the hemophilia gene was identified by knowing there was a

problem with a blood clotting factor and then figuring out what gene
must have coded for that, and isolating or cloning that gene.
But for most diseases, we don't have enough information to guess
what the function was, so positional cloning, which came into being
as a need of trying to identify the cause of things like cystic fibrosis,
was a way of identifying the gene by its position in the genome.

Basically, it's the position in the genome that you're trying to zero in
on by a series of steps that go from a larger view to narrower view to
finally zeroing in on the single base pair that's gone awry. And in
many instances that's what you're looking for.