Hum Genet (1991) 87:654-656

9 Springer-Verlag 1991

3'creatine kinase (M-type) polymorphisms

linked to myotonic dystrophy in Italian and Spanish populations
Massimo Gennarelli ~, Giuseppe Novelli 2, Ana Cobo 3, Montserrat Baiget 3, and Bruno Dallapiccola t *
l Department of Public Health and Cell Biology, IInd University of Rome, Rome, Italy
2Department of Genetics, University of Urbino, Urbino, Italy
3Unitat de Genetica Molecular, Hospital de la Santa Creu i Sant Pau, Barcelona, Spain

Received January 8, 1991

Summary. Linkage analysis and haplotype characteriza- Materials and methods

tion for the allelic system detected at the 3'creatine kinase
muscle type ( C K M M ) locus were carried out in 59 myo- A total of 59 DM families comprising 347 individuals have been
tonic dystrophy ( D M ) families from Italy and Spain. A studied. Clinical diagnosis of DM was performed according to the
criteria of Harper (1989) and the definition of the working group
maximum lod score (Zmax) of 21.26 at a recombination fre- on the molecular defect in DM (Griggs et al. 1989).
q u e n c y (0) of 0.00 was found. N o statistically significant Genomic DNA was extracted by enzymatic lysis according to
linkage disequilibrium was observed b e t w e e n D M and standard procedures and analyzed by Southern blotting and/or the
the R F L P s examined. H o w e v e r , a substantial linkage polymerase chain reaction (PCR). Southern blot analysis was per-
disequilibrium was f o u n d between C K M M - T a q I and formed as described by Brunner et al. (1989) using a 3.2 kb human
C K M M - N c o I sites in these two populations. genomic DNA fragment (BamHI-Sau3A) (courtesy of B. Wieringa)
as a probe to identify CKMM alleles. Two oligonucleotide prim-
ers of 21- and 23-mer (5'GTGCGGTGGACACAGCTGCCG3':
5'CAGCTTGGTCAAAGACATTGAGG3') (courtesy of R. Kor-
neluk) which flank the polymorphic sites (Taql and Ncol) were
Introduction synthesized in a DNA synthesizer (318A Applied Biosystem, War-
rington, UK) and used at a 0.5 gM concentration in the PCR mix-
The m y o t o n i c d y s t r o p h y ( D M ) locus has b e e n m a p p e d ture. Aliquots ranging from 100 ng-I Ixg of genomic DNA were
used for each 1001,tl reaction mix, consisting of 10mM Tris-HCl,
to the 19q13.2-q13.3 region by extensive linkage stud- 50mM KCI, 1.2mM MgC12, 0.01% gelatin, 250gM each dNTP,
ies, using several D N A markers ( H u m p h r i e s et al. 1983; and 2.5 units of Taq polymerase (Perkin/Elmer-Cetus, Norwalk,
Shaw et al. 1985; Pericak-Vance et al. 1986; Bartlett et Conn., USA). Initial denaturation was at 95~ for 7 min, followed
al. 1987; K o r n e l u k et al. 1989a, b). A c o m b i n e d physical by 30 cycles of 95~ denaturation (1 min), 55~ annealing (1 min),
and genetic m a p s h o w e d that the markers most closely 72~ extension (1.5 rain), with a final 72~ extension for 7 min in
linked to D M reside in c h r o m o s o m a l region of about an automated thermocycler (Perkin/Elmer-Cetus, Norwalk, Conn..
USA). A 10-btl volume of PCR products was digested in separate
5 Mb ( L e B e a u et al. 1989; Smeets et al. 1990). The mus- tubes with 20 units of TaqI and NcoI (Biorad, Milan, Italy). The
cle-specific creatine kinase ( C K M M ) gene ( P e r r y m a n et
al. 1986; Stallings et al. 1988) is the most thightly linked
m a r k e r currently used for p r e s y m p t o m a t i c and prenatal
diagnosis of this disease ( B r u n n e r et al. 1989; Y a m a o k a
et al. 1990; Gennarelli et al. 1990). Linkage studies
and informativity of C K M M in D M families f r o m N o r t h
A m e r i c a , C a n a d a , The Netherlands and Finland have
been reported. T h e y provide suitable information for
D M diagnostic p r o g r a m s ( B r u n n e r et al. 1989; N o k e -
lainen et al. 1990; Y a m a o k a et al. 1990).
In this paper we report data on the gene and haplo-
type frequencies of two allelic systems detected at the
C K M M locus in 59 D M families f r o m Italy and Spain.
O u r results prove the usefulness and applicability of
C K M M analysis for p r e s y m p t o m a t i c testing and early
fetal diagnosis in our populations.

* Present address and address for offprint requests: Dipartimento di Fig. 1. Ethidium bromide-stained agarose gel electrophoresis of the
Sanitfi Pubblica e Biologia Cellulare, c/o C.R.I. Laboratorio Cen- PCR products undigested (lane 1) and digested with TaqI (lanes 2,
trale, Servizio di Genetica, Via Ramazzini, 15, 1-00151 Rome, Italy 4, 6, 8, IO, 12) and with NcoI (lanes 3, 5, 7, 9, 11, 13)
 655

digested fragments were separated on a 2% agarose gel in TBE and n o n - D M c h r o m o s o m e s of fully informative D M pa-
1 x buffer at 90 V for 90 rain and visualized directly by ethidium tients, are in accordance with published data.
bromide staining and UV inspection (Fig. 1). Haplotypes were as- Table 2 reports the frequencies of the C K M M locus
signed by hand according to segregation analysis. Allelic associa-
tions and linkage disequilibrium quantification were evaluated es- p h e n o t y p e s , which are in a g r e e m e n t with the expecta-
sentially according to Nokelainen et al. (1990). Two-point linkage tions of the H a r d y - W e i n b e r g equilibrium ( H W E ) for the
analysis was performed using the MLINK program [Version 5.03, TaqI R F L P . A significant deviation from H W E has b e e n
updated by Ott (1985)] assuming a gene frequency of 1/10000 for observed for the NcoI R F L P (P < 0.05). This suggests a
the mutant DM allele. Individuals at risk for DM were assigned to p r o b a b l e m o r e recent origin of this p o l y m o r p h i s m , in
liability classes as described in Haam et al. (1988). spite of the fact that the TaqI site is an "ancient" one,
and/or that a n o n - r a n d o m intermingling of individuals
occurred in our subpopulations (Spiess 1989). This ac-
R e s u l t s and discussion cords with the i n t r a - C K M M R F L P s linkage disequilib-
rium f o u n d in this study ( A = - 0 . 3 2 ; Amax = 0.242) with
Allelic frequencies detected at the C K M M locus for TaqI a chi-squared value of 22.02 (P < 0.001), with I df (Table
and NcoI R F L P s are r e p o r t e d in Table 1. T h e allelic fre- 3). This disequilibrium does not affect the informativity
quencies and p o t y m o r p h i s m information content (PIC) of the C K M M R F L P system; in fact, the P I C of 0.65,
in our sample, which includes healthy family m e m b e r s calculated f r o m the haplotype frequencies at this locus,
is similar to the value obtained u n d e r the hypothesis of
no linkage disequilibrium. F o r each p o l y m o r p h i s m or
Table 1. Allelic frequencies of RFLPs at the CKMM locus haplotype, no statistically significant difference was ob-
Probe-enzyme Alleles detected by Fre- PIC served for particular associations with normal or D M
c h r o m o s o m e s ( P > 0.05) (Table 3). This is in a g r e e m e n t
Southern PCR quen-
cies with the results previously published for D u t c h and Fin-
blot
nish populations. Table 4 reports the linkage analysis be-
3'CKMM-Taql 1 (4.3kb) (ll70bp) 0.27 tween D M and C K M M . N o unequivocal crossovers were
2 (4.2kb) (1020bp+150bp) 0.73 0.32 observed in the 174 informative meioses analyzed. The
3'CKMM-NcoI 1 (3.5kb) (1170bp) 0.33 m a x i m u m lod score (Zm~x) for D M - C K M M was 21.26 at
2 (2.5kb) (985bp + 185bp) 0.67 0.34 a r e c o m b i n a t i o n fraction (0m~) of 0.00. The values are
given assuming 0 males = 0 females.
O u r analysis confirms tight linkage of C K M M to D M
Table 2. Distribution of the CKMM locus phenotypes in Italian as previously shown in other populations ( B r u n n e r et al.
and Spanish populations, ns, Not significant 1989: N o k e l a i n e n et al. 1990; Y a m a o k a et al. 1990). Pre-
sent data also support evidence of D M genetic h o m o -
Enzyme Pheno- No. of phenotypes X2 (for HWE) geneity in different ethnic groups ( T a k e m o t o et al. 1990)
type Observed Expected and are relevant for counselling and prenatal diagnsosis
of this disease in south E u r o p e a n populations. The avail-
1-1 7 8.9
ability of D N A markers distal to the D M locus ( J o h n s o n
Taql 1-2 53 48.1 1.04 (ns)
et al. 1990) and the P C R - b a s e d protocols r e p o r t e d in this
2-2 62 65.0
study, which allow the analysis of the C K M M / R F L P s ,
1-1 7 13.28 should greatly improve the accuracy of g e n o t y p e assess-
NcoI 1-2 66 53.90 6.27 (P < 0.05) m e n t in D M families.
2-2 49 54.76
Acknowledgements. Many thanks to the DM families for their con-
tinuing cooperation in the present study. This work was supported
by P. F. Ingegneria Genetica (no 91.00037.PF99) and Biotecnologie
Table 3. Haplotype frequencies at the CKMM locus in 59 DM pa- e Biostrumentazione, CNR (Italy). The financial support of Tele-
tients and 220 normal chromosomes thon, Italy for the project "Molecular study of the DM gene" is
Haplotypes DM patients Controls gratefully acknowledged. A.C. is a recipient of a FISS (Fondo de
Investigaciones de la Seguridad Social) fellowship. We wish to thank
TaqI-NcoI Observed Expected Observed Expected Robert Korneluk (Ottawa) for his encouragement and support.
1-1 0 5.1 3 19.0
1-2 17 10.8 50 40.4
References
2-1 14 13.8 67 51.4
2-2 28 29.3 100 109.0 Bartlett R J, Periak-Vance MA, Yamoka L, Gilbert J, Herbstreith
M, Hung WY, Lee JE, Mohands T, Bruns G, Laberge C,
Thibault MC, Ross D, Roses AD (1987) A new probe for the
Table 4. Lod scores for linkage between DM and CKMM diagnosis of myotonic muscular dystrophy. Science 235 : 1648-
1650
Recombination fraction (0) Brunner HG, Korneluk RG, Coerwinkel-Driessen M, MacKenzie
A, Smeetts H, Lambermon HMM, van Oost BA, Wieringa B,
0.00 0.0t 0.10 0.20 0.30 0.50 Ropers HH (1989) Myotonic dystrophy is closely linked to the
CKMM/DM 21.26 20.38 16.86 11.39 7.51 0.00 gene for muscle-type creatine kinase (CKMM) Hum Genet 81 :
308-310
656
Gennarelli M, Novelli G, Giovannucci Uzielli ML, Pietropolli A,
Dallapiccola B (1990) Rapid prenatal diagnosis of myotonic
dystrophy in the second trimester using polymerase chain reac-
tion. J Med Genet 27 : 662-663
Griggs RC, Wood DS, the Working Group on the Molecular De-
fect in Myotonic Dystrophy (1989) Criteria for establishing the
validity of genetic recombination in myotonic dystrophy. Neu-
rology 39 : 420-421
Haam EA, Mulley JC, Gedeon AK, Heffield LJ, Sutherland GR
(1988) Presymptomatic testing for myotonic dystrophy by means
of the linked DNA marker APOC2. Med J Aust 149 : 326-329
Harper PS (1989) Myotonic dystrophy, 2rid edn. Saunders, Phila-
delphia
Humphries SE, Jowet NI, Williams L, Rees A, Vella M, Kessling
A, Myklebost O, Lydon A, Seed M, Galton D J, Williamson R
(1983) A DNA polymorphism adjacent to the human apolipo-
protein CII gene. Mol Biol Med 1 : 463-471
Korneluk RG, MacKenzie AE, Nakamura Y, Dube I, Jacob P,
Hunter AGW (1989a) A reordering of human chromosome 19
long arm DNA markers and identification of markers flanking
the myotonic distrophy locus. Genomics 5 : 596-604
Korneluk RG, MacLeod HL, McKeithan TW, Brooks JD, Mac-
Kenzie AE (1989b) A chromosome 19 clone from a transloca-
tion breakpoint shows close linkage and linkage disequilibrium
with myotonic dystrophy. Genomics 4:146-151
Johnson K, Shelbourne P, Davies J, Buxoton J, Nimmo E, Siciliano
MJ, Bachinski LL, Anvret M, Harley H, Rundle S, Miki T,
Brunner H, Williamson R (1990) A new polymorphic probe
which defines the region of chromosome 19 containing the
myotonic dystrophy locus. Am J Hum Genet 46:1073-1081
Le Beau MM, Ryan D Jr, Pericak-Vance MA (1989) Report of the
committee on the genetic consitution of chromosome 18 and
19. Cytogenet Cell Genet 51 : 338-358
Nokelainen P, Alanen-Kurki L, Winqvist R, Falck B, Somer H,
Leisti J, Johnson K, Savontaus ML, Peltonen L (1990) Linkage
disequilibrium detected between dystrophia myotonica and the
APOC2 locus in a Finnish population. Hum Genet 85 : 541-545
Ott J (1985) Analysis of human genetic linkage. Johns Hopkins
University Press, Balitmore London
Pericak-Vance MA, Yamaoka LH, Assinder RIF, Hung WY,
Bartlett RJ, Staich JM, Gaskell PC, Ross DA, Shrrman S, Fey
GH, Humphries S, Williamson R, Roses DA (1986) Tight link-
age of apolipoprotein C2 to myotonic dystrophy on chromo-
some 19. Neurology 36 : 1418-1423
Perryman MB, Kerner SA, Bohlmeyer TJ, Roberts R (1986) Iso-
lation and sequence analysis of a full length cDNA for human
M creatine kinase. Biochem Biophys Res Commun 140:981-
989
Shaw D J, Meredith AL, Sarfarazi M, Huson SM, Brook JD, Myk-
lebost O, Harper PS (1985) The apolipoprotein CII gene: sub-
chromosomal localization and linkage to the myotonic dystrophy
locus. Hum Genet 70 : 271-273
Smeets H, Bachinsky L, Coerwinkel M, Schepens J, Hoeijmarkers
J, van Duin M, Grzeshik KH, Weber CA, de Jong P, Siciliano
MJ, Wieringa B (1990) A long-range restriction map of the
human chromosome 19q13 region: close physical linkage be-
tween CKMM and the ERCCI and ERCC2 gene. Am J Hum
Genet 46 : 492-501
Spiess EB (1989) Genes in populations, 2nd edn. Wiley, New
York
Stallings RL, Olson E, Strauss AW, Thompson LH, Bachinski LL,
Siciliano MJ (1988) Human creatine kinase genes on chromo-
somes 15 and 19, and proximity of the gene for the muscle form
to the genes for apolipoprotein C2 and excision repair. Am J
Hum Genet 43:144-151
Takemoto Y, Miki T,Nishikawa K, Nakura J, Kamino K, Takai
SI, Honjo T, Ogihara T (1990) The locus for Japanese myoto-
nic dystrophy is also linked to D19S19 on the long arm of chro-
mosome 19. Genomics 6 : 195-196
Yamaoka LH, Pericak-Vance MA, Speer MC, Gaskell PC, Stajich
J, Haynes C, Hung WY, Lamberge C, Thibault MC, Mathieu
J, Walker AP, Bartlett RJ, Roses AD (1990) Tight linkage of
creatine kinase (CKMM) to myotonic dystrophy on chromo-
some 19. Neurology 40 : 222-226