international journal of hydrogen energy 35 (2010) 3433–3439

Available at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/he

[FeFe]-hydrogenase gene quantification and melting curve

analysis from hydrogen-fermenting bioreactor samples

Katariina E.S. Tolvanen*, Ville P. Santala, Matti T. Karp

Department of Chemistry and Bioengineering, Tampere University of Technology, P.O. Box 541, FI-33101 Tampere, Finland

article info abstract

Article history: In this study, quantitative PCR (qPCR) was used to quantify [FeFe]-hydrogenases and
Received 29 November 2009 subsequently melting curves were analyzed from hydrogen-fermenting, mixed-culture
Received in revised form bioreactor samples. Denaturing gradient gel electrophoresis (DGGE) analysis was also
26 January 2010 performed to the reactor samples revealing a clostridial dominance in the reactor. Primers
Accepted 28 January 2010 targeting [FeFe]-hydrogenases were designed based on known clostridial [FeFe]-
Available online 24 February 2010 hydrogenase gene sequences and tested with several clostridial strains. The results show
that amplification efficiencies of four different clostridia are highly similar and melting
Keywords: curves of the clostridial strains were within 1  C of each other. We compared the melting
Quantitative PCR curves to the hydrogen percentage and observed a correlation between the results. The
Biohydrogen closer the melting curves were to those of clostridia, the better the hydrogen production.
Clostridia Based on these results, the primers and melting curve analysis of [FeFe]-hydrogenase
Mixed-culture analysis amplicons can be used for analysing hydrogenase genes from bioreactor samples.
Community characterization ª 2010 Professor T. Nejat Veziroglu. Published by Elsevier Ltd. All rights reserved.

1. Introduction bioreactors [3–9], which makes the [FeFe]-hydrogenase

A growing amount of research on biological hydrogen
production has also created interest around the enzymes
responsible for the hydrogen production, namely the
hydrogenases. Hydrogenases can be divided into three
groups based on their metal content in the H2-activating
sites: [Fe]-hydrogenases, [FeFe]-hydrogenases, and [NiFe]-
hydrogenases [1]. The [Fe]-hydrogenases have been found
in some methanogens and catalyze an intermediary step in
methane production, the [FeFe]-hydrogenases are respon-
sible for the actual hydrogen production according to
2Hþ þ 2e 4 H2, whereas the bidirectional [NiFe]-
hydrogenases are most often involved in the oxidation of
hydrogen [2]. The [FeFe]-hydrogenases are mainly present in
gram-positive bacteria such as Clostridium spp. These
bacteria are often considered to be the main group of
H2-producers in mesophilic, hydrogen-fermenting
a valuable target for analysis.
In order to efficiently operate biohydrogen-producing
dark fermentation processes or adjust parameters upon
malfunctions it is important to understand how the system,
meaning the microorganisms, work. Quantification of the
main producers, monitoring their hydrogenase expression
and monitoring the changes in the community structure
during operation is important for understanding what kind
of community changes are linked to changes in the biore-
actor operation. Monitoring of several strains indepen-
dently would give information on the interactions between
different strains, but not necessarily about their functions
in the community. Targeting for example the [FeFe]- and
[NiFe]-hydrogenase genes separately could allow the
detection and division of the microbes to functional groups,
such as the [FeFe]-hydrogenase group containing only
hydrogen producers and the [NiFe]-hydrogenase group

* Corresponding author. Fax: þ358 3 3115 2896.

E-mail address: katariina.tolvanen@tut.fi (K.E.S. Tolvanen).
0360-3199/$ – see front matter ª 2010 Professor T. Nejat Veziroglu. Published by Elsevier Ltd. All rights reserved.
doi:10.1016/j.ijhydene.2010.01.132
3434 international journal of hydrogen energy 35 (2010) 3433–3439
containing hydrogen producers and consumers [10]. In
a hydrogen-fermenting bioreactor, where the community
structure can change substantially over time, functional
detection would provide a rapid tool for bioprocess moni-
toring. Operational parameters could be adjusted during
operation to favour the hydrogen production resulting in
more stable production.
Melting curve analysis after PCR is most often used to
verify that the signal increase in qPCR is specific to the
target amplicon and not the result from primer dimers.
When double-stranded DNA is gradually heated, the mole-
cules melt in a series of steps depending on their GC-content
[11,12]. This property has been utilized in denaturing
gradient gel electrophoresis (DGGE) for separation of DNA
fragments of different base composition [13,14], but simi-
larly, it can be utilized in melting curve analysis to compare
amplicon base compositions. It has been reported that
melting curve analysis can be used for mutation and SNP
detection in human genome analyses e.g. [15,16]. It has also
been used to identify group isolates of Streptococcus angino-
sus [17], differentiation of beer-spoiling bacteria of the class
Clostridia [18] and quantification and diversity analysis of
ruminal methanogens [19]. In a recent study, the melting
curve analysis was used to monitor microbial changes
during operation of a continuous-flow enriched nitrification
system [11].
In our previous studies, we have used probe based quan-
titative real-time PCR (qrt-PCR) systems to specifically monitor
Clostridium butyricum 16S rRNA gene and hydA gene and gene
expression in mixed-culture bioreactor samples [7,10]. These
methods provide information from the reactor at a single
species level. In this study we present [FeFe]-hydrogenase
targeting primers and apply them to bioreactor sample
quantification and melting curve analysis. The primers were
tested with several clostridial strains and resulting melting
curves were compared to those of the bioreactor samples. The
hydA quantification and melting curve results were examined
in relation to hydrogen production and community structure
analyzed by DGGE.
2. Materials and methods
2.1. Bioreactor
This study presents a follow up on the previous study where C.
butyricum hydrogenase was quantified from bioreactor
samples [10]. The bioreactor was a sucrose supplemented,
continuous-flow, completely-stirred tank reactor (CSTR)
(working volume 400 ml) operated at 37  C for 150 days and
inoculated with pretreated sludge from anaerobic digester.
The DNA samples analyzed here were taken during operation
days 114–144. The bioreactor was re-inoculated once during
the operation on day 120 with a similar seed as in the begin-
ning to reduce the lag period.
Gases (H2, CO2) were measured using an HP 5890II gas
chromatograph equipped with a 6 ft Porapak N column (80/100
mesh) and a thermal conductivity detector. The oven, injector,
and detector temperatures were 50, 80, and 80  C, respectively.
N2 was used as a carrier gas.
2.2. DGGE analysis of bioreactor samples
DNA samples taken from the bioreactor during operation were
prepared for analyses as described in [10]. For the DGGE analysis,
partial bacterial 16S rRNA genes were amplified from the
genomic DNA using the primer pair GC-BacV3f [20] and 907r [21]
as described in [5]. DGGE was performed with INGENYphorU2x2
system (Ingeny International, Goes, The Netherlands) using 8%
polyacrylamide gels (acrylamide/bisacrylamide gel stock solu-
tion 37.5:1) with a denaturing gradient from 40% to 60% (100%
denaturing solution contains 7 M of urea and 40% formamide).
Gels were run at 60  C in 1  TAE with 100 V for 21.5 h, and
stained with SYBR Gold (Molecular Probes, Eugene, OR, USA).
The dominant bands were excised from the gel, eluted in sterile
H2O, and re-amplified for sequencing as previously described
[5]. Sequences were compared with those in GenBank (http://
www.ncbi.nlm.nih.gov/blast/) and the Ribosomal Database
Project II (http://rdp.cme.msu.edu/index.jsp).
2.3. Primer design for hydrogenase amplification
The previously characterized [FeFe]-hydrogenase coding hydA
gene sequences of Clostridium acetobutylicum (CAU15277),
Clostridium perfringens (AB016820), Clostridium pasteurianum
(M81737), Clostridium paraputrificum (AB159510), Clostridium
saccharobutylicum P262 (CAU09760), and C. butyricum
(EU689097) were aligned using ClustalW algorithm [22]. Based
on the alignment (a part of the alignment is shown in Fig. 1)
a primer set (hydA_f GCTGATATGACAATTATGGAAGAAG,
hydA_r TCCAAATATTTGTTGTGGTGATTT) was designed to
amplify a conserved domain region of the hydA gene. The
oligonucleotide binding sites are shown in Fig. 1. The designed
primers were analyzed with BLAST (http://blast.ncbi.nlm.nih.
gov/Blast.cgi) and Primer BLAST with maximum number of
mismatches allowed (http://www.ncbi.nlm.nih.gov/tools/
primer-blast/) to confirm that based on the sequence data
available, they only target hydrogenases.
2.4. Microbial cultures
Several clostridia cultures were used to determine the speci-
ficity, amplification efficiency, and linear range of the qPCR as
well as make reference melting curve analyses. Serial dilutions
of genomic DNA from C. acetobutylicum (792T), C. pasteurianum
(525T), C. saccharobutylicum (13864T), and C. butyricum previ-
ously isolated from a bioreactor [7] were analyzed using qPCR
and standard curves were made to determine the amplification
efficiencies. Amplification efficiencies were calculated using
the Equation (1). Standard dilution series were made by calcu-
lating the genome numbers using the genome sizes of 4 Mb,
5 Mb, 5 Mb, and 4.5 Mb, respectively.
E ¼ 101=slope  1 (1)
2.5. Quantitative PCR and melting curve analysis
The qPCR and melting curve analyses were performed with
Applied Biosystems StepOne Plus instrument (Carlsbad, CA,
USA) on duplicate reactor samples. Each 20 ml PCR reaction
contained 1 Dynamo Flash mastermix with SYBR Green and
 international journal of hydrogen energy 35 (2010) 3433–3439 3435

Fig. 1 – A part of a nucleic acid sequence alignment of clostridial hydA with previously characterized clostridial hydrogenase
sequences. HydA_f and hydA_r denote the oligonucleotide binding sites and gray highlights denote identical bases at the
binding sites. The numbering is according to hydA of C. butyricum.

ROX passive reference dye (Finnzymes, Espoo, Finland), 0.3 mM acetobutylicum, C. butyricum, C. pasteurianum and C. saccha-
primers (Thermo Fisher Scientific, Ulm, Germany), and robutylicum was used to determine the amplification efficien-
template. PCR program was as follows: initial denaturation at cies and linear ranges for different strains (Fig. 2). The result
95  C for 7 min followed by 40 cycles of 95  C for 15 s, 52  C for was that the amplification of these hydrogenases was almost
10 s, and 72  C for 15 s. Each PCR run included triplicates from equally effective and highly linear between 5E1 and 5E6
all samples. C. butyricum genomic DNA was used as a standard genomes. Similar amplification efficiencies of different clos-
and negative control included a run with no template. Another tridia allow the use of these primers for quantitative analyses.
control with [NiFe]-hydrogenase gene containing Escherichia coli Melting curve analysis was also performed to the amplified
K-12 MG1655 genomic DNA as template, was used to ensure
that no unspecific amplification occurred. Melting curve anal- 34 C. acetobutylicum
ysis was performed at the end of PCR with temperature range 32
C. butyricum
C. pasteurianum
from 52  C to 95  C at heating ramp of 0.3  C. Quantitative PCR 30 C. saccharobutylicum
data analyses were performed using the StepOne Plus software 28
version 2.0.2 (Applied Biosystem, Carlsbad, CA, USA). Melting
26
curves were drawn based on the multicomponent data
24
obtained from the StepOne Plus software using the equation (2)
Ct

22
where i is the temperature point, x is the fluorescence at that
point, and Dt is the temperature difference between measure- 20
ment points in melting curve analysis. 18
16
xði þ 1Þ  xði  1Þ
DxðiÞ ¼ (2) 14
2Dt
2 3 4 5 6 7
10 10 10 10 10 10
Number of hydA

3. Results and discussion Fig. 2 – Standard curves for C. acetobutylicum, C. butyricum,

C. pasteurianum and C. saccharobutylicum hydA after
A primer pair was designed to amplify a segment of clostridial quantitative PCR. Error bars represent the standard
[FeFe]-hydrogenase genes. DNA extracted from C. deviation of triplicate samples.
3436 international journal of hydrogen energy 35 (2010) 3433–3439

possible additional copies of [FeFe]-hydrogenases in the

Table 1 – PCR efficiencies of different clostridial hydA
amplifications and melting temperatures of different
clostridial hydrogenases determined by melting curve
analyses of the standard curve samples.
Strain PCR efficiency (%)
C. acetobutylicum 83
C. butyricum 83
C. pasteurianum 78
C. saccharobutylicum 83
clostridial hydA sequences after qPCR. The amplification effi-
ciency of about 80% was most likely due to some mismatches
in the primer binding sites that can be seen from Fig. 1. The
resulting melting temperatures (Tm) were within 1  C of each
other for these four strains and the values are listed in Table 1.
Designing the hydrogenase primers to universally target
the [FeFe] hydrogenase sequence based on the data available
resulted in a few mismatches in the primer sequences
compared to the target sequences (Fig. 1). Most of the
mismatches are in the middle of the sequence or closer to the
50 end and were, therefore, not considered to cause problems
in amplification. The only mismatch more disturbing to the
primer binding is the A/C mismatch close to the 30 end of the
primer hydA_F when comparing it to the C. pasteurianum
hydrogenase sequence (Fig. 1). After testing the amplification
on pure cultures, similar amplification efficiencies were
observed for different strains. The mismatch can affect the
threshold cycle of the sample in question, since the mismatch
affects the amplification in the early cycles until most of the
genome, which affect the calculated amount of the gene in the
standard.
The primers were used to quantify clostridial [FeFe]-
R2 hydA Tm ( C) hydrogenases from mixed-culture bioreactor samples
(Fig. 3). The hydrogenase numbers in the first samples were
0.999 75.9  0.1
barely detectable and also the H2% was low in the reactor.
0.995 76.2  0.1
Both the hydrogenase numbers and the H2% were the lowest
0.998 75.5  0.1
0.999 75.5  0.2 on day 120. An increase in hydrogenase numbers and H2% can
be seen on day 121, after the re-inoculation on day 120. The
H2% was quite stable after the re-inoculation but the numbers
of hydrogenases continued to increase until day 130, and also
from day 135 onwards. It seems that although the number of
hydrogenases, and therefore hydrogen producing organisms
increased, the maximum hydrogen production capacity of the
reactor had already been reached since the H2% did not
increase further. The hydA results are in good correlation with
the previously reported C. butyricum specific hydA results and
show a similar trend after the re-inoculation [10]. The differ-
ence of hydA numbers and H2% can be the result of varying
hydA expression, varying enzyme activity, metabolic state of
A 120000
C. butyricum
day 114
day 116
100000
day 120
80000
dRFU/dT

template contains the primer sequence. In the future, the

60000
mismatches can be accommodated better by inserting some
degenerate bases in the primer sequences. This might also be
40000
required to accommodate the sequences of new [FeFe]
hydrogenases, which are constantly updated in the sequence
databases. The different threshold cycles (Fig. 2) can also be 20000

affected by the accuracy of the genome size estimations and

0
50 55 60 65 70 75 80 85 90
Number of hydA DNA per

Temperature (°C)
ng of extracted DNA

10000

8000 B 120000
C. butyricum
day 121
6000
100000 day 127
4000 day 130
day 134
2000 80000 day 142
oper day vs DNA
day 144
dRFU/dT

oper day vs DNA

0
60000
30
Hydrogen %

20 40000

10
20000

0
115 120 * 125 130 135 140 145
0
Operation day 50 55 60 65 70 75 80 85 90
Temperature (°C)
Fig. 3 – Time course of hydA concentrations (top) and H2%
(bottom) in a mixed-culture, hydrogen-fermenting Fig. 4 – Melting curves of bioreactor sample amplification
bioreactor. The bioreactor was re-inoculated on day 120. after quantitative PCR. (A) Melting curves from operation
Error bars (top) denote the standard deviation of two days before reactor re-inoculation, (B) melting curves after
reactor samples. In some cases the error bars are smaller re-inoculation. Light gray curve represents the melting
than the symbol. curve of C. butyricum.
 international journal of hydrogen energy 35 (2010) 3433–3439 3437

Fig. 5 – A DGGE profile of the reactor samples from operation day 114 to 144. Sequence information according to the band
markings (roman numbers I–VII) is presented in Table 2.

the cell [23,24], and hydrogen consumers and other hydrogen
producers in the reactor community.
Melting curve analysis was performed on the reactor
samples after PCR, and it showed several different melting
peaks and melting temperatures compared to the sharp peaks
of the pure strains around 75–76  C (Fig. 4, C. butyricum melting
curve is shown as a reference). These results indicate that the
primers are able to amplify previously unknown sequences
from mixed-culture samples, and based on the quantitative
analysis of the samples (Fig. 3), the target DNA amounts
during the first sampling days are very low. Fig. 4A shows the
melting curves before reactor re-inoculation and Fig. 4B after.
When the results were compared to the H2% it was clear that
the further the melting peaks are from those of clostridia, the
lower the H2% in the reactor. In the first two days (days 114
and 116) (Fig. 3) some hydrogen is produced despite of the very
low numbers of clostridial hydrogenase gene detected. This
indicates high hydrogenase expression or presence of
unknown hydrogen producers, such as Enterobacter cloacae
(Fig. 5 and Table 2). The melting peak around 82.5  C increases
from day 114 to day 120, with declining H2%. Unknown
sequences might not be amplified well with the clostridial
hydrogenase primers resulting in detectable melting curves
but still low quantities of target. Neither the hydrogenase
expression nor hydrogen production by other species is stable
since the H2% is declining. At the highest point in H2% on day
121 the melting peak is also closest to that of clostridia. Since
clostridia are often dominating the mesophilic, hydrogen-
fermenting bioreactors, the shift in hydrogenase melting
curve position could be an indicator of bioreactor performance
deterioration. A rapid analysis following hydrogenase quan-
tification could reduce the response time to adjust reactor
parameters and reduce the risks of unstable hydrogen
production.

Table 2 – Affiliations of partial 16S rRNA gene sequences excised from DGGE gel (Fig. 5).
BM (acc)a Familyb SLc Closest affiliation (acc)d Sim (%)e

I (GU170369) Clostridiaceae 524 Clostridium butyricum (DSM2478) (X68177) 100

II (GU170370) Clostridiaceae 525 Clostridium sulfatireducens (AY943861) 99.6
III (GU170371) Enterobacteriaceae 549 Enterobacter cloacae (AM778415) 100
IV (GU170372) Enterobacteriaceae 549 Enterobacter cloacae isolate HQ040619-1 1 (EU073021) 99.8
V (GU170373) Clostridiaceae 524 Clostridium sporosphaeroides (X66002) 96.8
VI (GU170374) Clostridiaceae 524 Clostridium sporosphaeroides (X66002) 96.9
VII (GU170375) Clostridiaceae 525 Clostridium intestinale (AY781385) 100

a Band mark in Fig. 5 with GenBank accession number in parentheses.

b Family according to Ribosomal Database Project II or GenBank databases.
c Sequence length.
d Closest species in the GenBank database with an accession number.
e Similarity (%).
3438 international journal of hydrogen energy 35 (2010) 3433–3439
A DGGE analysis (Fig. 5 and Table 2) of the bioreactor
community was made and the results are compared to the
melting curve and H2% data. Several clostridial species were
detected in the reactor samples during days 114–144 (Table
2). Clear changes in the community structure can be seen
around day 120 when H2% was very low. After re-
inoculation C. butyricum and Clostridium sulfatireducens
begin to dominate the culture and continue to be present
until the end. The shift in community structure towards
clostridia domination after re-inoculation is also visible
from the hydrogenase melting curve analysis, H2%, and the
quantitative analysis of clostridial hydrogenase genes. The
presence of good hydrogen producer E. cloacae (Fig. 5 and
Table 2) [25,26] might have an effect on the H2% during
operation and might be the reason why before day 120 and
right after the H2% shows greater fluctuation than the
numbers of clostridial hydrogenases. It is noted, however,
that the highest H2% was measured when clostridia were
present in the reactor, and not at day 120 when clostridia
seem to be less dominant and E. cloacae is detected (Fig. 5).
The problems with the forward primer regarding the C.
pasteurianum sequence were not considered to be a problem
in this case since it was not detected by DGGE analysis of
the reactor samples.
In our previous studies, we have used probe based qPCR
systems to specifically quantify C. butyricum 16S and hydA
from bioreactor samples [7,10]. In this case we chose to use
SYBR Green based qPCR because as an intercalative dye it is
not sequence specific and is therefore able to detect variable
sequences. A probe would have added another level of
specificity and is therefore better suited for single target,
specific analyses. Additionally, it seems that melting curve
analysis gives very interesting information from reactor
samples at a functional level, and this analysis could not be
done using probe based systems. The clear correlation
between the melting curve results and H2% indicate that
this method could be an easy and fast tool for bioreactor
performance monitoring and analysis. When the hydroge-
nase is detected from the reactor samples at a point of low
hydrogen production, the problem can be investigated
deeper than the community structure as such. Melting
curve analysis of the hydrogenases gives more information
than just performing a qualitative PCR because melting
curves provide information on the sequences. Changes can
be seen in the reactor samples instead of just a positive or
negative result. We used the H2% rather than the hydrogen
production rate because the H2% describes better the situ-
ation at a specific time in the reactor, just like community
sampling for DNA analyses are only able to capture one
point in time. Hydrogen production rate is often calculated
as the average of two measurement points and can, there-
fore, be misleading.
Mertoglu et al. [11] studied population shifts in an enriched
nitrifying system under increased cadmium loading by tar-
geting the ammonia monooxygenase (amoA) gene and per-
forming melting curve analysis. They also observed several
different melting peaks during operation and linked the
differences to microbial community changes analyzed by
DGGE. Xing et al. [27] presented degenerate hydrogenase tar-
geting primers, which were used to analyze the diversity of
hydrogenases from acidophilic ethanol-hydrogen producing
reactor by DGGE. Their forward primer was designed to target
the same conserved region as the forward primer presented
here, but the reverse primer targeted different sequence than
the primers presented in Xing et al. [27]. The resulting frag-
ments were 500–600 bp in length and could be separated using
DGGE and sequenced. The longer amplicon is well suited for
DGGE analysis, but for quantitative PCR shorter amplicons are
usually preferred due to more efficient amplification.
Similar to DGGE analysis, the melting curve method is an
end point method and therefore not quantitative. In DGGE the
number of bands in lanes can be used to qualitatively estimate
the number of targets in one sample and a similar qualitative
analysis can be done using melting curves. The resolution of
melting curves is not as good as for DGGE due to shorter
amplicons in quantitative PCR and because clamped primers
are used in DGGE to obtain high resolution. In melting curve
analysis the sequences are not separated and therefore
cannot be separately sequenced. The strain specific informa-
tion obtained by DGGE analysis might, however, not be
necessary if the bioreactor is viewed as a functional entity.
Functional information based on known hydrogenase stan-
dards linked to hydrogen production could provide a func-
tional landscape describing population distribution and
eliminating the need for sequencing and individual strain
assessment. More studies are still needed to link the rapid
melting curve analysis to quantitative DNA and gene expres-
sion (RNA) analyses and to operational changes and hydrogen
production.
4. Conclusions
[FeFe]-hydrogenase targeting primers were designed and
applied in quantitative PCR and melting curve analysis of
hydrogen-fermenting bioreactor samples. Quantification of
hydrogenases showed changes in the amounts of hydroge-
nases during operation. Melting curve analysis showed that
the closer the curves are to that of clostridia, the higher the
hydrogen % in the bioreactor. The melting curve and hydrogen
production data also correlated with community changes
during operation. Correlation of the hydrogen production data
to shifts in hydrogenase melting curves can provide reactor
function based information at a molecular level quickly with
a single assay. This can reduce the response time to adjust
reactor parameters and therefore reduce the risk of bioreactor
malfunction and interruptions in hydrogen production.
Acknowledgements
The authors would like to acknowledge Perttu Koskinen’s
work in the lab and Sakari Halttunen for assistance with data
analysis. The research was funded by the Tampere University
of Technology Graduate School (K.E.S.T.), the Academy of
Finland (HYDROGENE project no. 107425; GM-Hydro project
no. 108623; Äärimikro project no. 126974) and The Nordic
Energy Research (BIOHYDROGEN project no. 28-02).
 international journal of hydrogen energy 35 (2010) 3433–3439 3439

references [15] Cho MH, Ciulla D, Klanderman BJ, Raby BA, Silverman EK.
High-resolution melting curve analysis of genomic and
whole-genome amplified DNA. Clin Chem 2008;54:2055–8.
[16] Elenitoba-Johnson KS, Bohling SD, Witter CT, King TC.
[1] Fontecilla-Camps JC, Volbeda A, Cavazza C, Nicolet Y.
Multiplex PCR by multicolor fluorimetry and fluorescence
Structure/function relationships of [NiFe]- and [FeFe]-
melting curve analysis. Nat Med 2001;7:249–53.
hydrogenases. Chem Rev 2007;107:4273–303.
[17] Desar IM, de Boer M, Bens CC, Jacobs JA, Mouton JW,
[2] Vignais PM, Billoud B. Occurrence, classification, and
Dofferhoff AS, et al. Rapid and reliable identification of
biological function of hydrogenases: an overview. Chem Rev
Streptococcus anginosus group isolates to the species level by
2007;107:4206–72.
real-time PCR and melting curve analysis. J Microbiol
[3] Fang HH, Zhang T, Liu H. Microbial diversity of a mesophilic
Methods 2008;75:372–4.
hydrogen-producing sludge. Appl Microbiol Biotechnol 2002;
[18] Juvonen R, Koivula T, Jaikara A. Group-specific PCR-RFLP and
58:112–8.
real-time PCR methods for detection and tentative
[4] Iyer P, Bruns MA, Husen Z, Van Ginkel S, Logan BE.
discrimination of strictly anaerobic beer-spoilage bacteria of
H2-producing bacterial communities from a heat-treated soil
the class Clostridia. Int J Food Microbiol 2008;125:162–9.
inoculum. Appl Microbiol Biotechnol 2004;66:166–73.
[19] Denman SE, Tomkins NW, McSweeney CS. Quantitation and
[5] Koskinen PE, Kaksonen AH, Puhakka JA. The relationship
diversity analysis of ruminal methanogenic populations in
between instability of H2 production and compositions of
response to the antimethanogenic compound
bacterial communities within a dark fermentation fluidized-
bromochloromethane. FEMS Microbiol Ecol 2007;62:313–22.
bed bioreactor. Biotechnol Bioeng 2007;97:742–58.
[20] Muyzer G, de Waal EC, Uitterlinden AG. Profiling of complex
[6] Lin C, Chang C, Hung C. Fermentative hydrogen production
microbial populations by denaturing gradient gel
from starch using natural mixed cultures. Int J Hydrogen
electrophoresis analysis of polymerase chain reaction-
Energy 2008;33:2445–53.
amplified genes coding for 16S rRNA. Appl Environ Microbiol
[7] Tolvanen KE, Koskinen PE, Ylikoski AI, Ollikka PK,
1993;59:695–700.
Hemmilä IA, Puhakka JA, et al. Quantitative monitoring of
[21] Muyzer G, Hottenträger S, Teske A, Waver C. Denaturing
a hydrogen-producing Clostridium butyricum strain from
gradient gel electrophoresis of PCR-amplified 16S rDNA –
a continuous-flow, mixed culture bioreactor employing real-
a new molecular approach to analyse the genetic diversity of
time PCR. Int J Hydrogen Energy 2008;33:542–9.
mixed microbial communities. In: Akkermans ADL, van
[8] Ueno Y, Haruta S, Ishii M, Igarashi Y. Microbial community in
Elsas JD, De Bruijn F, editors. Molecular microbial ecology
anaerobic hydrogen-producing microflora enriched from
manual. Dordrecht: Kluwer Academic Publishers; 1996. p.
sludge compost. Appl Microbiol Biotechnol 2001;57:555–62.
1–23. 3.4.4.
[9] Wang X, Hoefel D, Saint CP, Monis PT, Jin B. The isolation and
[22] Thompson JD, Higgins DG, Gibson TJ. Clustal W: improving
microbial community analysis of hydrogen producing
the sensitivity of progressive multiple sequence alignment
bacteria from activated sludge. J Appl Microbiol 2007;103:
through sequence weighting, position-specific gap penalties
1415–23.
and weight matrix choice. Nucleic Acids Res 1994;22:4673–80.
[10] Tolvanen KE, Koskinen PE, Raussi HM, Ylikoski AI,
[23] Santangelo JD, Durre P, Woods DR. Characterization and
Hemmilä IA, Santala VP, et al. Profiling the hydA gene and
expression of the hydrogenase-encoding gene from
hydA gene transcript levels of Clostridium butyricum during
Clostridium acetobutylicum P262. Micorbiology 1995;141:171–80.
continuous, mixed-culture hydrogen fermentation. Int J
[24] Gorwa M, Croux C, Soucaille P. Molecular characterization
Hydrogen Energy 2008;33:5416–21.
and transcriptional analysis of the putative hydrogenase
[11] Mertoglu B, Smerci N, Guler N, Calli B, Cecen F, Saatci AM.
gene of Clostridium acetobutylicum ATCC 824. J Bacteriol 1996;
Monitoring of population shifts in an enriched nitrifying
178:2668–75.
system under gradually increased cadmium loading.
[25] Kumar N, Das D. Enhancement of hydrogen production by
J Hazard Mater 2008;160:495–501.
Enterobacter cloacae IIT-BT 08. Process Biochem 2000;35:
[12] Ririe KM, Rasmussen RP, Wittwer CT. Product differentiation
589–93.
by analysis of DNA melting curves during the polymerase
[26] Mishra J, Kumar N, Gosh AK, Das D. Isolation and molecular
chain reaction. Anal Biochem 1997;245:154–60.
characterization of hydrogenase gene from a high rate of
[13] Fisher SG, Lerman LS. Separation of random fragments of
hydrogen-producing bacterial strain Enterobacter cloacae IIT-
DNA according to properties of their sequences. Proc Natl
BT 08. Int J Hydrogen Energy 2002;27:1475–9.
Acad Sci U S A 1980;77:4420–4.
[27] Xing D, Ren N, Rittman BE. Genetic diversity of hydrogen-
[14] Myers RM, Fisher SG, Maniatis T, Lerman LS. Modification of
producing bacteria in an acidophilic ethanol–H2-coproducing
the melting properties of duplex DNA by attachment of a GC-
system, analyzed using the [Fe]-hydrogenase gene. Appl
rich DNA sequence as determined by denaturing gradient gel
Environ Microbiol 2008;74:1232–9.
electrophoresis. Nucleic Acids Res 1985;13:3111–29.