Food &

Function
View Article Online
PAPER View Journal

Anticancer potential against cervix cancer (HeLa)

Published on 07 May 2018. Downloaded by Universite Pierre et Marie Curie on 17/05/2018 07:44:22.

Cite this: DOI: 10.1039/c8fo00547h

cell line of probiotic Lactobacillus casei and
Lactobacillus paracasei strains isolated from
human breast milk
Muhammad Shahid Riaz Rajoka, a Haobin Zhao,a Yao Lu,a Ziyang Lian,a Na Li,a
Nazim Hussain,b Dongyan Shao,a Mingliang Jin,a Qi Lia and Junling Shi *a

Received 21st March 2018,
Accepted 7th May 2018
DOI: 10.1039/c8fo00547h
rsc.li/food-function
Lactic acid bacteria have been categorized as probiotics and play a crucial role in human health by stimu-
lating the supply of nutrients, shaping the immune system, and preventing the colonization of pathogenic
microbes. This study investigated the mechanisms for the action of three potential probiotic Lactobacillus
strains: Lactobacillus casei SR1, Lactobacillus casei SR2, and Lactobacillus paracasei SR4 isolated from
human breast milk. These Lactobacillus strains were identified via 16S DNA sequencing and characterized
via biochemical assays including acid resistance, bile resistance, antioxidant activity, and antibiotic suscep-
tibility. The bioactivity of the cell-free culture supernatant (CFCS) secreted by these strains on the cervix
cancer (HeLa) cell line was also evaluated via cytotoxicity assay and apoptosis analysis. The mechanism
of anticancer activity was also investigated via RT-qPCR and western blotting. The results demonstrated
that these newly isolated Lactobacillus strains from human milk displayed noticeable probiotic character-
istics such as excellent antibiotic susceptibility, outstanding antioxidant activity, and promising resistance
to low pH and high concentration of bile salts. The results of the conducted bioactivity assays verified that
the CFCSs had acceptable anticancer effects on cervix cancer (HeLa) cells by upregulating the expression
of apoptotic genes BAX, BAD, caspase3, caspase8, and caspase9 and by downregulating the expression
of the BCl-2 gene. Overall, these results indicate that the Lactobacillus strains isolated from human breast
milk could be considered as a topical medication with a potential therapeutic index due to their efficacy
against cervix cancer cells.

1. Introduction Disturbances in this balance can cause infections of the uro-

Cervical cancer is the fourth most common cancer and one of
the most common cancers in women.1 It is a cancer arising
from the cervix due to abnormal growth of cells that have the
ability to spread to other parts of the body.2 Typically, no
symptoms are seen during the early stages; however, later
symptoms may include pain during sexual intercourse, pelvic
pain, and abnormal vaginal bleeding.3 The human body hosts
thousands of bacterial species that contribute to and maintain
host health.4,5 Based on bacterial sharing by body site, 9% of
sequenced microbial species are linked to the urogenital
tract.4 Therefore, a balancing connection must exist between
the host immune system and urogenital tract microbiota to
maintain the homeostasis of a healthy urogenital system.
a
Key Laboratory for Space Bioscience and Space Biotechnology, School of Life
Sciences, Northwestern Polytechnical University, Xi’an 710072, Shaanxi, People’s
Republic of China. E-mail: sjlshi2004@nwpu.edu.cn; Fax: +86-29-88460541
b
Center for applied Molecular Biology, University of Punjab, Pakistan
genital tract, which could lead to cervical cancer.6,7 Most
chemotherapeutic interventions that are currently used to treat
cervical cancer are cytotoxic to the host. Therefore, it is vital to
identify an anticancer therapy with low side effects.8
Lactobacillus is the dominant component of gastrointestinal
tract microbiota and improves the health of the vaginal tract
by lowering the risk of infections. It is also one of the common
genera that are commonly used as probiotics.9 Probiotics are
live microbes that benefit the host health if occurring at
sufficient quantities.10 To act as a probiotic, the bacteria must
have the ability to survive in the acidic condition of the
stomach and bile acid at the start of the intestine.11,12
Furthermore, the live cells and the metabolites of Lactobacillus
strains could protect the vagina against invading pathogens
and improve the intestinal immune response.13 Recent studies
showed that numerous lactobacillus strains can induce the pro-
duction of anti-inflammatory cytokines (interleukins IL-10 and
IL-12) and pro-inflammatory cytokines (interleukins IL-1 and
IL-6) in animal models. They can secrete cytotoxic agents.

This journal is © The Royal Society of Chemistry 2018 Food Funct.


Paper
Moreover, the evaluation of their toxicity on various cell types
is normally performed by analyzing the mechanisms of apop-
tosis in treated cancer cells and by in vitro cytotoxicity tests.14
Induction of apoptosis to regulate the cancer cell growth
involves complex anticancer activities of various therapeutic
substances.15 The cervical cancer cell line (HeLa) is a suitable
model to study both cervix cancer and apoptosis.16 Necrosis
and apoptosis are key forms of cell death that both involve
Published on 07 May 2018. Downloaded by Universite Pierre et Marie Curie on 17/05/2018 07:44:22.
sequences of consecutive morphological and biochemical
events. Apoptosis occurred throughout the embryonic growth
and in the course of organ enfolding.17 Various methods have
been used to characterize, identify, and quantify apoptosis;
however, flow cytometry was most commonly used to study
apoptosis due to its applicability to a wide range of cells,
times, and stimulants.4 Furthermore, the evaluation of apopto-
sis via flow cytometry provides information on incidence and
symptoms of apoptosis that can be interpreted as signs.18
The present study characterized the probiotic potential of
L. casei SR1, L. casei SR2, and L. paracasei SR4, originally iso-
lated from human breast milk. The acid tolerance, bile toler-
ance, antibiotics susceptibility, and antioxidant activity of
these strains was evaluated. The HeLa cell line was used to test
the anticancer potential of these strain secretions. The induc-
tion of apoptosis was analyzed via 4′,6-diamidino-2-phenyl-
indole (DAPI) staining, flow cytometry, and expression of apo-
ptotic genes. The molecular mechanism of apoptosis was ana-
lyzed via Real-time Quantitative PCR Detecting (qPCR) and
western blotting analysis.
2. Material and methods
2.1. Subjects and cultivation of samples
Fifteen milk samples of healthy women (aged 25 to 34 years
and their infant aged in the range of 8 days to 45 days) were
collected from the first affiliated hospital Xi’an Jiaotong
University, Xi’an, Shaanxi, China. All participants signed an
informed consent prior to study enrollment. The participants
were enrolled according to the following criteria: (1) healthy
and without present or past underlying conditions; (2) no anti-
biotics prescription for at least three months prior to the
study; (3) did not taken any probiotics prior to study; (4)
normal pregnancy. The milk samples were filled in a sterile
container and processed immediately upon receipt.
2.2. Isolation and screening of lactic acid bacteria isolates
The samples were diluted in phosphate buffer saline (PBS) (0.1
M, pH 7.2) and spread on de Man-Rogosa-Sharpe agar plates
supplemented with 0.05% L-cysteine (MRSc), a selective media
for the lactic acid bacteria. To indicate the acid producing
lactic acid bacteria (LAB), 1% CaCO3 was added to the MRSc
agar medium.19 The plates were aerobically incubated at 37 °C
for 72 h. Acid producing colonies were identified by a clear
zone around each colony and those with different mor-
phologies were separately selected for further purification in
newly prepared MRSc agar plates. Single, pure colonies were
Food Funct.
View Article Online
Food & Function
isolated and sub cultured for further experiments. Each
selected LAB strains was subjected to tests of morphology, cat-
alase, and Gram’s reaction. The isolates of Gram’s positive, cat-
alase negative and rod shape were suspected to be lactobacilli
and then maintained in MRSc supplemented with 20% gly-
cerol at −80 °C. Prior to experiments, all lactic acid bacteria
(LAB) isolates were grown twice in MRSc medium.
2.3. Identification of lactic acid bacteria
Molecular identification was used to identify the obtained
strains. The total genomic DNA of selected LAB strains was
extracted using the Genomic DNA purification kit (TransGen
Biotech Co., Ltd, Beijing, China) following the manufacturer
instructions. The primers used to amplify the 16S rDNA
sequences of these strains were forward 5″-AGAGTT TGATCC
TGG CTC AG-3″ and reverse 5″-CCGTCA ATT CCT TTGAGT
TT-3″.20 The fragments were amplified in a Techne-TC 512
Thermocycler (England) under the following conditions: 94 °C,
30 cycles of 94 °C for 45 s, 55 °C for 30 s, and finally 72 °C for
10 min. The amplified fragment was screened on an agarose
gel and sequenced by GenScript, Nanjing, China. All obtained
sequences were searched by using the Basic Local Alignment
Tool (BLAST) program (https://blast.ncbi.nlm.nih.gov/Blast.
cgi). The sequences were deposited into Gene Bank. The
sequence alignment was performed by using the ClustalW2
(http://www.ebi.ac.uk/Tool/mas/clustalw2/) and a phylogenetic
tree was constructed by using neighbor-joining21 and
maximum composite likelihood methods22 using the Mega 6.0
software (http://megasoftware.net/).
2.4. Survival under GIT conditions
2.4.1. Acid tolerance. The ability of Lactobacillus strains to
survive at low pH was evaluated as previously described23,24
with slight modification. Briefly, overnight cultures of
Lactobacillus strains were inoculated (1% v/v) to MRSc broths at
a final cell concentration of 1.0 × 107 to 1.0 × 108. The MRSc
broths were adjusted to pH 2.0, 2.5, 3.0, and 6.5 with 0.1 N
HCl and that with pH 6.5 was used as control. The pH toler-
ance was evaluated by measuring the survival rate after incu-
bation for 3 h at 37 °C to simulate intestinal conditions.
Bacterial counts were determined in triplicate on MRSc agar
plates and plates were incubated at 37 °C for 3 d. The survival
rate was calculated according to eqn (1):
Survival rate ð%Þ ¼ final ð cfu ml1 Þ=initial ðlog cfu ml1 Þ
 100: ð1Þ
2.4.2. Bile salt tolerance. The bile salt tolerance of isolated
Lactobacillus strains that survived for 3 h in acidic conditions
was measured by using previously described methods.24,25 The
overnight cultures of isolates were prepared at a final inocu-
lation concentration of 1.0 × 107 to 1.0 × 108 (1% v/v) in the
MRS liquid medium supplemented with 0.3%, 0.5%, and 1.0%
bile salt. Unadjusted MRS was used as control. After 3 h incu-
bation at 37 °C, the bile salt tolerance was assessed by calculat-
This journal is © The Royal Society of Chemistry 2018

Food & Function
ing the number of surviving cells on MRSc agar plates accord-
ing to eqn (1).
2.5. Antibiotic resistance test
The isolated Lactobacillus strains were screened for possible
resistance against ten antibiotics including streptomycin
(10 μg ml−1), ampicillin (10 μg ml−1), erythromycin (15
μg ml−1), tetracycline (30 μg ml−1), gentamicin (10 μg ml−1),
kanamycin (30 μg ml−1), penicillin (10 μg ml−1), cephalotoxin
Published on 07 May 2018. Downloaded by Universite Pierre et Marie Curie on 17/05/2018 07:44:22.
(15 μg ml−1), ciprofloxacin (5 μg ml−1), and amoxicillin (30
μg ml−1) using the previously described disc diffusion
method.26,27 Each MRSc agar plate was overlaid with 100 μl of
L. casei SR1, L. casei SR2 and L. paracasei SR4 strains culture at
a final cell concentration of 1.0 × 108 and all antibiotics discs
were placed on the surface of inoculated MRS agar plate. After
24 h of incubation at 37 °C, the diameter of the inhibition
zone was measured.
2.6. DPPH free radical scavenging ability
The DPPH (2,2-diphenyl-1-picrylhydrazyl) free radical scaven-
ging abilities of each Lactobacillus strain were determined for
the supernatants from the 24 h MRSc medium cultures. 100 μl
of the supernatant cultures was mixed with 100 μl of ethanolic
DPPH solution. 96 well plates were used to conduct the experi-
ments. The plates were darkly incubated for 30 min at room
temperature. The control contained ethanol and DPPH solu-
tion. The absorbance was measured at 517 nm and the scaven-
ging ability was calculated according to eqn (2):
Scavenging ability ð%Þ ¼ ½1  ðA517 of sample=A517 of blankÞ
 100:
ð2Þ
2.7. Preparation of cell-free culture supernatant (CFCS)
The liquid cultures of L. casei SR1, L. casei SR2 and L. paracasei
SR4 strains were centrifuged at 1000g for 10 min to precipitate
the cells. The pH of the collected supernatant was adjusted to
7.3 by using 1 N NaOH. To completely remove the proteins, we
first added proteinase at a concentration of 1 mg ml−1 (Sigma,
Aldrich) and the reaction mixture was incubated at 37 °C for
30 min for protein digestion. After that, the proteinase was de-
activated (100 °C for 10 min) and the supernatant was
obtained after centrifugation (1000g for 10 min at 4 °C) and
then lyophilized for further experiments. The lyophilized CFCS
were dissolved in cell culture medium and filtered through the
0.22 µm filters (Millipore) prior to treatment of HeLa cells.
2.8. Cell line and growth condition
The human cervix cancer HeLa cell line was obtained from Key
Laboratory for Space Bioscience and Space Biotechnology,
School of Life Sciences, Northwestern Polytechnical University,
Xi’an 710072, Shaanxi, People’s Republic of China and cells
were cultured in Dulbecco’s Modified Eagle Medium (DMEM)
supplemented with 2 mM L-glutamine, 10% heat-inactivated
fetal bovine serum, 100 μg streptomycin per ml, 1% non-essen-
This journal is © The Royal Society of Chemistry 2018
View Article Online
Paper
tial amino acid, and 100 Ul penicillin per ml at 37 °C and 5%
CO2 for 24 h.
2.9. Anti-proliferative activity
The anti-proliferative activity of CFCS of isolated L. casei SR1,
L. casei SR2 and L. paracasei SR4 was tested via CCK-8 assay
(Cell Counting Kit 8, Dojindo Japan).28 The HeLa cells were
seeded into 96 well plates and incubated for 24 h. After incu-
bation, the cells were treated with 50 μl of (45 μg ml−1) super-
natant and incubate for another 24 h. Fresh MRSc medium
was also used as control. After that, the absorbance was
measured at 450 nm using a Microplate reader (BioTek
Synergy-4) and results were represented as inhibition rate. All
results were transformed into percentage based on their
respective control by using eqn (3):
Inhibition rate ð%Þ ¼ ½1  ðsample OD450 Þ=ðcontrol OD450 Þ
 100:
ð3Þ
2.10. DAPI staining and fluorescence microscopy
The DAPI (4′,6-diamidino-2-phenylindole) staining method
was used to detect the visual symptoms of apoptosis in cancer-
ous cells. The treated and control cells (treated with MRSc
medium only) were cultured on sterile coverslip set at the
bottom of each six-well culture plate. At the end of the incu-
bation period (24 h), cells were fixed with 4% paraforma-
ldehyde for 5 min and then permeabilized with Triton X-100
(0.1%) for 5 min. Then, 50 μl of diluted DAPI (1 : 2000) and its
buffer were added into each well and cells were incubated in
the dark for 5 min at room temperature. After that, the cells
were washed thrice with PBS. The stained cells on the cover-
slips were reversely placed on the slide and analyzed via fluo-
rescence microscopy.
2.11. Mitochondria membrane potential (MMP) assay
The decrease of the mitochondrial membrane potential (MMP)
is a typical indicator of early apoptosis.29 HeLa cells were
treated with 45 μg ml−1 supernatant for 24 h in six-well culture
plates and then washed thrice with PB. The HeLa cells were
detached with a trypsin–EDTA solution, and the collected cells
were incubated for 20 min with 1 μg ml−1 JC-1 in culture
medium at 37 °C in the dark. After incubation, the cells were
centrifuged at 1000g for 5 min to remove the supernatant and
pellets were suspended in PBS and analyzed via fluorescence
microscopy.
2.12. Reactive oxygen species (ROS) detection
The ROS level in treated HeLa cells was measured using the
dichloro-dihydro-fluorescein diacetate (DCFH-DA) assay.30
HeLa cells were plated at a density of 2 × 105 ml−1 in six-well
plates and incubated at 37 °C for 24 h prior to (DCFH-DA)
assay. After 24 h, the 45 μg ml−1 supernatant was added and
the treatment was continued for another 24 h. After that, the
cells were stained with 10 µmol L−1 DCFH-DA (Beyotime,
Food Funct.

Paper
China) for 20 min at 37 °C. Then, the fluorescence intensity
was checked via multi-wavelength multifunctional enzyme
spectrometer (Synergy HT) and observed under a fluorescence
microscope (Nikon 80i).
2.13. Flow cytometry assay
Apoptosis was evaluated by using the FITC Annexin V
Apoptosis detection kit (BD Bioscience) following the manu-
Published on 07 May 2018. Downloaded by Universite Pierre et Marie Curie on 17/05/2018 07:44:22.
facturer’s instructions. Annexin V has the potential to bind
with phosphatidylserine and could be applied to identify the
cells at all stages of apoptosis.4 Propidium iodides (PI) stained
cells with the disturbed cell membrane and could be used to
identify dead and late apoptotic cells.31 Cells cultured in the
supernatant free medium were applied as control and the
experiment was repeated twice with triplicate samples for each
experiment. Analyses were performed on 150 000 cells
obtained at a rate of 300 cells per s and FL-1 and FL-3 were rep-
resented in dot plots; viable, apoptotic, and necrotic cells were
recorded.
2.14. Gene expression analysis
2.14.1. RNA isolation and real-time quantitative PCR. After
treatment, HeLa cells were washed thrice with PBS ( pH, 7.3)
and total RNA was isolated using the TRIzol reagent following
the manufacturer instructions. The 260/280 and 260/230 ratios
were carried by using Nanodrop (BioTek, Epoch, USA). 1 μg of
isolated RNA was used for cDNA synthesis using the Prime
Script RT reagent kit following the manufacturer instructions.
The primers used to amplify particular genes are listed in
Table 1. The experimental mixture (20 μl) contained 10 μl
SYBR Green PCR master mix, 1 μl primers (forward and
reversed), 3 μl cDNA, and 6 μl water, and was subjected to ABI
step-1 plus (applied biosystem, USA) instruments. The thermal
cycling condition was as follows; 1 cycle at 95 °C for 5 min fol-
lowed by 40 cycles at 95 °C for 20 s, 60 °C for 35 s, and 72 °C
for 10 s. All amplification reactions were performed in tripli-
cate for each sample and the melting curve was determined at
60 °C to 95 °C. The relative gene expression was calculated as
2−DΔCt.
2.14.2. Western blot analysis. The cervix cancer (HeLa)
cells were plated and treated with 45 μg ml−1 supernatant for
24 h at 37 °C. Cell culture medium was then removed and cells
were washed with PBS ( pH, 7.3) and lysis in 200 (radio-
immunoprecipitation assay) RIPA buffer, containing protein-
ase inhibitor ( phenylmethylsulfonyl fluride) PMSF (1 mM) and
aprotinin (245 μg ml−1). The lysate was centrifuged (11 400g)
Table 1 Sequence of primer pairs used in this study
Gene Forward primer
BAD TGGACTCCTTTAAGAAGGGAC
BAX AGGGTTTCATCCAGGATCGAGCAG
BCl-2 GGTGGGGTCATGTGTGTGG
Caspase-3 TGCCTGTAACTTGAGAGTAGATGG
Caspase-8 ACATGGACTGCTTCATCTGC
Caspase-9 TGCTGCGTGGTGGTCATTCTC
Food Funct.
View Article Online
Food & Function
for 30 min at 4 °C and the concentration of the protein was
determined via BCA protein assay (Sigma Aldrich). An appro-
priate amount of proteins was boiled in loading buffer, separ-
ated by SDS-PAGE, and transferred onto a nitrocellulose mem-
brane. Membranes were blocked with milk (5% w/v) in TBST.
Immunodetection was performed as described in the ECL kit
protocol (Servicebio, China) and blots were incubated over-
night at 4 °C with a specific antibody, washed with TBST, and
incubated for another 30 min at room temperature with peroxi-
dase-conjugated antibodies. Antibodies of Bcl-2, Bax, Bad,
caspase3, caspase8, caspase9, and GADPH were used in the
assay.
2.15. Statistical analysis
All experiments were performed in triplicate. All data are pre-
sented as means ± standard deviation (SD). Statistical signifi-
cance was determined using the Student’s t-test. The signifi-
cance level was set at P < 0.05.
3. Results and discussion
3.1. Identification of Lactobacilli
In infants, the establishment of the gastrointestinal tract
microbiota is critical for sustaining the health and homeo-
stasis of animals, including humans. Mother milk is a most
vital factor in immunological programming, metabolome, and
microbiome.32 It is also an important source for the gut micro-
flora of newborn babies since it is the only food babies
receive.33 It plays a central role in the construction of the
immune system of newborn babies.34 Numerous studies have
indicated that the decrease of the abundance of lactic acid bac-
teria in the gut is one of the major factors related to the
reduction of immunology capability and metabolism disturb-
ance in adults and aging persons.35 Therefore, the microorgan-
isms from mother milk have been suggested to be good for
maintaining human health. To verify this hypothesis and to
obtain lactic acids bacteria with high potential for retaining
human health, we tested isolates from different mother milk
samples and their potential in health keeping in aspects of
different conditions similar to that in stomach and gut.
In the present study, a total of 15 isolates were isolated
from human milk. Out of these, three isolated strains that
showed the appearance of lactic acid bacteria on MRSc
medium were randomly selected for further experiments. All of
the selected three isolated strains were Gram’s positive, cata-
Reverse primer
CAAGTTCCGATCCCACCAG
ATCTTCTTCCAGATGGTGAGCGAG
CGGTTCAGGTACTCAGTCATCC
CTTCACTTTCTTACTTGGCGATGG
AAGGGCACTTCAAACCAGTG
CCGACACAGGGCATCCATCTG
This journal is © The Royal Society of Chemistry 2018
 View Article Online

Food & Function Paper

Published on 07 May 2018. Downloaded by Universite Pierre et Marie Curie on 17/05/2018 07:44:22.

Fig. 1 Position of the three isolated Lactobacilli strains in the neighbor-joining phylogenetic tree. A phylogenetic tree was constructed on the basis
of 16S rDNA sequences. The scale bar 0.01 indicates the nucleotide substitution rate at each site. Bootstrap probabilities were determined using
1000 replicates and are presented as percentage values. The filled circles indicate that the strains are from NCBI and the empty circles indicate the
out groups used for tree construction.

lase negative, rod-shaped (in pairs or short chains), and
showed clear zone around the colonies on MRSc medium. A
phylogenetic tree was constructed based on their 16S rDNA
sequences by using the neighboring methods (Fig. 1). The
results showed that all three strains belonged to genus
Lactobacillus. The 16S rDNA gene sequence results showed that
isolates SR1 (MH037164) and SR2 (MH037165) had 99%
homology with L. casei, while isolates SR4 (MH037166) had
98% homology with L. paracasei.
3.2. Acid and bile salt tolerance
Many lactic acid bacteria have been developed as probiotic
microbes to improve the health of animals and humans. The
acid and bile salt tolerance is an important characteristic of all
strains that are thought to impact the gastrointestinal tract
(GIT).36 Probiotics should have the ability to survive at low pH
and high bile salt conditions in the stomach and survive for a
minimum of 90 min before they can colonize the GIT tract and
elicit their health-promoting effects.37 Therefore, we become
aware of the degree of acid resistance exhibited by the selected
L. casei SR1, L. casei SR2 and L. paracasei SR4 strains. When
the isolated Lactobacillus strains were subjected to acidic con-
ditions ( pH 2.0, 2.5, 3.0, and 6.5), all strains showed similar
acid resistance capability to low pH values (Fig. 2A). After 3 h,
the survival rates of L. casei SR1, L. casei SR2, and L. paracasei
SR4 retained more than 80%, 85%, and 91% after exposure to
pH 2.0, 2.5, and 3.0, respectively. The results indicate that all
tested strains showed high resistance to acidic conditions.
Furthermore, the survival rates of different Lactobacillus
strains did not differ significantly compared to the control (P >
0.05) at each of the tested pH values. A recent study suggested
that Lactobacillus should be tolerant to low pH value ( pH: 2.5

Fig. 2 Resistance of the isolated Lactobacillus strains against acidic conditions (A) and bile salt (B). (A) The treatments were conducted under pH
2.0, pH 2.5, or pH 3.0 for 3 h. The results are the mean value ± SD of three independent runs. The data are significantly different from that of the
controls ( pH 6.2) at the level of p < 0.05. (B) The broth is supplemented with 0.3%, 0.5%, and 1% bile salt. The control is MRSc broth without bile salt.
The results are expressed as means ± SD of three independent replicates. All treatments are significantly different from the control at the level of p <
0.05.

This journal is © The Royal Society of Chemistry 2018 Food Funct.

 View Article Online

Paper Food & Function

to 3.5) to colonize and survive in the gastrointestinal tract.38

Our results indicate that the selected Lactobacillus strains from
human breast milk could have successful transited to the
stomach pH 2.5 and reached the intestinal tract.
Evaluating the probiotic potential of Lactobacillus strains
towards bile tolerance is needed as well. The bile salt concen-
tration in the intestinal tract was not stable, ranging from
1.5% to 2% (w/v) during the first hour of digestion and the
concentration decreased afterward to 0.3% (w/v).39 Fig. 2(B)
Published on 07 May 2018. Downloaded by Universite Pierre et Marie Curie on 17/05/2018 07:44:22.

shows the survival rate of the selected Lactobacillus strains in

MRSc medium supplemented with 0.3%, 0.5%, and 1% bile
salt after 3 h of incubation. The results showed that all
selected Lactobacillus strains were resisted to various concen-
trations of bile salt. However, with the increase of bile salt con-
centration, their growth rate decreased. After 3 h, the survival Fig. 3 DPPH scavenging ability of the CFCS samples. All data are the
rates of all selected Lactobacillus strains retained more than means ± SD values of three independent experiments of three analyses.
87%, 66%, and 51% after exposure to 0.3%, 0.5%, and 1% bile The results are significantly different among different isolates at the level
of p < 0.05 as measured via Tukey’s test.
salt, respectively. Comparatively, L. casei SR2 showed a slightly
higher tolerance to 0.3% (89%), 0.5% (74%), and 1% (57%)
bile salt than the other two strains. This might be related the
specific properties of species L. casei. Fig. 3 shows that L. casei SR2 and L. paracasei SR4 have the
DPPH scavenging ability above 92%, while L. casei SR1 (80%).
In this study, the cell-free supernatant culture of isolated
3.3. Antibiotics resistance assay
L. casei SR1, L. casei SR2 and L. paracasei SR4 strains showed
Due to safety considerations, the isolated Lactobacillus strains strong antioxidant activity. This is similar and even exceeds
were also tested for their capability of antibiotics resistance. previously detected strains.24,43,44
The minimum inhibitory concentrations (MIC) of the
Lactobacillus strains were measured for 10 antibiotics 3.5. Anti-proliferative activity
(Table 2). All isolated Lactobacillus strains were resistant to
The anti-tumor activity of probiotic bacteria has been demon-
streptomycin (10 μg ml−1), ampicillin (10 μg ml−1), gentamicin
strated both in vivo and in vitro.45 The anticancer effect of
(10 μg ml−1), kanamycin (30 μg ml−1), penicillin (10 μg ml−1),
Lactobacilli was attributed to different mechanisms such as
cephalotoxin (15 μg ml−1), and ciprofloxacin (5 μg ml−1) and
inducing apoptosis, interacting with the immune system,
susceptible to amoxicillin (30 μg ml−1) according to the pub-
binding of genotoxins carcinogens, exerting anti-proliferating
lished breakpoint.40 The results are consistent with previous
activity, and differentiation of cancer cell lines.46,47 In our
results for L. rhamnosus GG species.41
study, the supernatant of cell free cultures from three
Lactobacillus strains (L. casei SR1, L. casei SR2 and L. paracasei
3.4. DPPH radical scavenging activity SR4) were tested for their antiproliferative activity against
The evaluation of antioxidant activity is a further standard for cervix cancer (HeLa) cells (Fig. 4). The cell free culture super-
probiotic selection. Several recent investigations showed that natant from isolated Lactobacillus strains exhibited the stron-
Lactobacilli could act as an antioxidant by releasing some gest anti-proliferative activity with inhibition rate 82%, 84%,
peptide that has the ability to quench the oxygen radical.42 and 89% in contrast to untreated cell (>3%). A similar effect
was previously described47 and the obtained results far exceed
previously reported results.39
Table 2 Resistance of the selected Lactobacillus strains against
different antibiotics 3.6. DAPI staining and fluorescence microscopy
The staining of treated cancer cell lines and examination via
Antibiotics SR1 SR2 SR4
fluorescent microscopy are suitable methods for the assess-
Erythromycin (15 μg ml−1) + + + ment of morphological changes and cytotoxicity expression in
Tetracycline (30 μg ml−1) + + +
Streptomycin (10 μg ml−1) − + + the cell membrane and chromatins.37 The DAPI staining
Ampicillin (10 μg ml−1) + + − method was employed to observe the visual symptoms of apop-
Gentamicin (10 μg ml−1) + + + tosis in treated cells. To evaluate the apoptosis incidence and
Cephalotoxin (15 μg ml−1) + + +
Penicillin (10 μg ml−1) + + + to show the effects of isolated Lactobacillus strains (L. casei
Kanamycin (30 μg ml−1) + + + SR1, L. casei SR2 and L. paracasei SR4) on the viability of cervix
Ciprofloxacin (5 μg ml−1) + + + cancer (HeLa) cells, the latter was exposed to 45 μg ml−1 filter
Amoxicillin (30 μg ml−1) − − −
supernatant of late stationary phase growth of Lactobacillus
+ = resistance. − = susceptible. strains after 24 h incubation. To visualize the apoptosis, DAPI

Food Funct. This journal is © The Royal Society of Chemistry 2018


Food & Function
Published on 07 May 2018. Downloaded by Universite Pierre et Marie Curie on 17/05/2018 07:44:22.
Fig. 4 Inhibitory effect of the CFCS samples on cervix cancer (HeLa)
cell line. The data were obtained after treatment with CFCS samples for
24 h. The treatment with MRSc medium was used as control. Error bars
represent the standard deviation of three individual replicates.
staining and observation via fluorescent microscopy were
used. Viable cells were characterized by blue intact cells, while
apoptotic cells were characterized by blue shrinking cells with
condensed nucleus or fragments (Fig. 5A–D). The fluorescent
microscopy results showed apoptosis to be the main cytotoxic
mechanism with a vast range of apoptotic bodies in terms of
number, size, and composition. These variations of apoptotic
bodies have been reported by other researchers.48
3.7. Mitochondria membrane potential (MMP) assay
JC-1 is a cationic dye that can bilaterally change colors from
red to green as the mitochondria membrane potential
decreases.49 The mitochondrial membrane integrity will be
Fig. 5 Detection of apoptotic and normal cells by DAPI staining. (A)
cells without treatment with the CFCS of Lactobacillus strains (normal,
treated with only MRSc culture medium); (B), (C), and (D) are cells
treated for 24 h with the CFCS of Lactobacillus casei SR1, Lactobacillus
casei SR2, and Lactobacillus paracasei SR4, respectively.
This journal is © The Royal Society of Chemistry 2018
View Article Online
Paper
Fig. 6 The mitochondria membrane potential (MPP) of the cells tested
via JC-1 staining methods. (A) cells without treatment by the CFCS
extracts (normal, treated with only MRSc culture medium); (B), (C), and
(D) are the cells treated for 24 h with the CFCS of SR1, SR2, and SR4,
respectively. The fluorescence image was captured via fluorescence
microscopy with the emission wavelength of 535 nm and the excitation
wavelength of 485 nm. The experiments were performed in triplicate
with similar results and representative image from one experiment was
shown. All treatment groups were significantly different from the
control group (treated with MRSc medium only) at the level of p < 0.05.
Fig. 7 Intracellular ROS assays of HeLa cells. (A) cells without treatment
by the CFCS extracts (normal, treated with only MRSc culture medium);
(B), (C), and (D) are cells treated for 24 h with the CFCS of SR1, SR2, and
SR4, respectively. (E) The contrast of ROS fluorescence intensity
between the control and the treated cells.
Food Funct.

Paper
broken at the early stage of cell apoptosis if apoptosis is
induced through the mitochondrial pathway, and ΔΨm should
be reduced. The JC-1 will exist mainly in a monomeric form in
the cells and emit green fluorescence.50 The results shown in
Fig. 6(A–D) suggest that mitochondria membrane potentials of
HeLa cells after 45 μg ml−1 CFCS treatment decreased com-
pared to the control group. This suggests that the cell apopto-
sis induced by CFCS may be associated with the decline of
Published on 07 May 2018. Downloaded by Universite Pierre et Marie Curie on 17/05/2018 07:44:22.
mitochondrial membrane potential.
3.8. Reactive oxygen species (ROS) detection
Reactive oxygen species (ROS) are strong oxidizing substances
in aerobic organisms (including oxygen radicals and their
derivatives) and are closely related to apoptosis. To determine
the effect of CFCS on intracellular ROS generation, DCHF-DA
was used as fluorescent probe. DCFH-DA is a fluorescent dye
that diffuses through cell membranes and is hydrolyzed by
intracellular esterases to DCFH. In the presence of ROS, DCFH
Fig. 8 Flow cytometric analysis of HeLa cells. (A) cells without treat-
ment with the CFCS of Lactobacillus strains (normal, treated with only
MRSc culture medium); (B), (C), and (D) are cells treated for 24 h with the
CFCS of Lactobacillus casei SR1, Lactobacillus casei SR2, and
Lactobacillus paracasei SR4, respectively. The dots with Annexin V−/−PI
(lower left), Annexin V+/PI− (lower right), and Annexin V+/PI+ (upper
right) Annexin V−/PI+ (upper left) features represent viable intact, early
apoptotic, dead late apoptotic cells, and necrotic cells, respectively. (E)
Total percentage of apoptotic cells.
Food Funct.
View Article Online
Food & Function
is oxidized to DCF, which is fluorescent and its level corres-
ponds to the level of generated ROS. As shown in Fig. 7(A–D),
in the control, less obvious fluorescence images were found.
Following treatment of HeLa cells with 45 μg ml−1 supernatant
for 24 h, bright green fluorescence images were observed. The
results indicate that CFCS increased the levels of ROS.
Furthermore, the fluorescence intensity of CFCS treated cells
was much higher than that of control cells as shown in Fig. 7
(E). Overall, the three strains did not show statistically signifi-
cant difference in the capability to induce the increase of ROS
in HeLa cells, although L. casei SR1 showed a slightly higher
value of ROS fluorescence intensity.
Fig. 9 Relative mRNA expression and western blot analysis of apoptosis
related genes. (A) expression of the apoptosis-related genes in HeLa
cells after exposure to 45 μg ml−1 CFCS from Lactobacillus strains; (B)
western blot of the expression of apoptosis-related genes. The data are
expressed as the mean of three independent experiments; S.D. *, P =
0.05.
This journal is © The Royal Society of Chemistry 2018

Food & Function
3.9. Flow cytometry assay
The fluorescent microscopy results alone are not convincing
for apoptosis detection. Thus, the exact mode of cell death was
characterized via flow cytometry analysis.37 Flow cytometry
analysis was used to quantitatively determine apoptosis in
HeLa cells treated with CFCS for 24 h. The flow cytometry
results of L. casei SR1, L. casei SR2, and L. paracasei SR4
secreted CFCS treated HeLa cells indicated 64%, 68%, and
Published on 07 May 2018. Downloaded by Universite Pierre et Marie Curie on 17/05/2018 07:44:22.
86% total apoptotic cells. In contrast, untreated cells showed
<12% cell death (Fig. 8A–E). By considering the higher late
apoptosis percentage compared to early apoptosis, we suggest
that the detected necrosis in treated cells could be related to
total DNA fragmentation in apoptotic cells during 24 h, which
was determined as necrosis by using flow cytometry. Thus,
apoptosis can be considered as the main phenomenon of cell
death rather than necrosis.
3.10. The expression level of apoptosis-associated genes
To evaluate the molecular mechanism related to the selected
Lactobacillus strains induced apoptosis in cervix cancer (HeLa)
cell, the mRNA expression level of BAX, BAD, BCl-2, caspase3,
caspase8, and caspase9 were examined via RT-qPCR. The HeLa
cells treated with 45 μg ml−1 supernatant from isolated
Lactobacillus strains showed significantly increased mRNA
expression level compared to control (untreated HeLa cells),
p < 0.05. The expression level of BAX, BAD, BCl-2, caspase3,
caspase8, and caspase9 genes in HeLa cells treated with 45
μg ml−1 supernatant from L. casei SR1 increased by (2.03, 1.60,
0.70, 1.76, 1.80, and 2.43), L. casei SR2 (1.80, 1.60, 0.60, 1.90,
2.0, and 2.56), and L. paracasei SR4 (2.10, 1.63, 0.46, 2.10, 2.13,
and 2.63) fold, respectively, compared to the control (Fig. 9A).
Previous studies demonstrated that the overexpression of pro-
Fig. 10 Overall apoptosis mechanisms induced by Lactobacillus on
HeLa cells.
This journal is © The Royal Society of Chemistry 2018
View Article Online
Paper
apoptotic gene inhibits the proliferation of cancer cells.51
Furthermore, the activation of caspase3 (executioner) and
caspase8 (initiator) used as an important biomarker to identify
cell apoptosis.52
Furthermore, western blot analysis showed that the
expression level of BAX, BAD, caspase3, caspase8, and caspase9
was remarkably upregulated and the expression level of BCl-2
downregulated (Fig. 9B). The overall mechanisms for the induc-
tion of apoptosis in HeLa cells by the CFCS prepared from the
selected Lactobacillus strains were summarized as Fig. 10.
4. Conclusions
In the present study, the probiotic characteristics and anti-
tumor activity of three Lactobacillus strains namely L. casei
SR1, L. casei SR2 and L. paracasei SR4 isolated from healthy
human breast milk were investigated. Our results demon-
strated that all Lactobacillus strains exhibited typical probiotic
characteristics such as higher survival rate under gastric con-
ditions (lower pH and higher bile salt), antibiotics resistance,
and acceptable antioxidant activity against free radicals. In
addition, all three isolated Lactobacillus strains exhibited
higher anticancer activity against the cervix cancer (HeLa) cell
line by promoting the upregulation of BAX, BAD, caspase3,
caspase8, and caspase9 genes and by downregulating the BCl-
2 gene compared to control cells. The results presented in this
study enhance our understanding of the probiotics role of
L. casei SR1, L. casei SR2 and L. paracasei SR4 strains isolated
from human breast milk and support their application as a
starter culture in the production of functional food products.
Conflicts of interest
The authors declare that there are no conflicts of interests.
Acknowledgements
This study was supported by the National Key Technology
R&D Program (grant number 2015BAD16B02), the Modern
Agricultural Industry Technology System (CARS-30), Key
Research and Development Plan of Shaanxi Province
(2017ZDXL-NY-0304), National Natural Science Foundation of
China (NSFC) (grant Number 31701722 and 31471718), the
Seed Foundation of Innovation and Creation for Graduate
Students in Northwestren Polytechnical University (ZZ2017242),
Innovation Fund of Excellent Doctorial Dissertation, the China
Postdoctoral Science Foundation (2017M613211), and the
Shaanxi Postdoctoral Science Foundation.
References
1 A. Majidi, R. Ghiasvand, M. Hadji, A. Nahvijou,
A. S. Mousavi, M. Pakgohar, N. Khodakarami, M. Abedini,
Food Funct.

Paper
F. Amouzegar Hashemi, M. Rahnamaye Farzami,
R. Shahsiah, S. Sajedinejhad, M. A. Mohagheghi, F. Nadali,
A. Rashidian, E. Weiderpass, O. Mogensen and K. Zendehdel,
Priority setting for improvement of cervical cancer prevention
in Iran, Int. J. Health Policy Manag., 2015, 5, 225–232.
2 K. D. Wang, D. J. Xu, B. Y. Wang, D. H. Yan, Z. Lv and
J. R. Su, Inhibitory effect of vaginal Lactobacillus super-
natants on cervical cancer cells, Probiotics Antimicrob.
Published on 07 May 2018. Downloaded by Universite Pierre et Marie Curie on 17/05/2018 07:44:22.
Proteins, 2017, DOI: 10.1007/s12602-017-9339-x.
3 L. Kumar, P. Harish, P. S. Malik and S. Khurana,
Chemotherapy and targeted therapy in the management of
cervical cancer, Curr. Probl. Cancer, 2018, DOI: 10.1016/j.
currproblcancer.2018.01.016.
4 Y. Nami, N. Abdullah, B. Haghshenas, D. Radiah, R. Rosli
and A. Y. Khosroushahi, Probiotic potential and biotherapeu-
tic effects of newly isolated vaginal Lactobacillus, acidophilus
36YL strain on cancer cells, Anaerobe, 2014, 28, 29–36.
5 M. S. Riaz Rajoka, J. Shi, J. Zhu, D. Shao, Q. Huang,
H. Yang and M. Jin, Capacity of lactic acid bacteria in
immunity enhancement and cancer prevention, Appl.
Microbiol. Biotechnol., 2017, 101, 35–45.
6 M. S. Riaz Rajoka, J. Shi, H. M. Mehwish, J. Zhu, Q. Li,
D. Shao, Q. Huang and H. Yang, Interaction between diet
composition and gut microbiota and its impact on gastro-
intestinal tract health, Food Sci. Human Wellness, 2017, 6,
121–130.
7 A. Audirac-Chalifour, K. Torres-Poveda, M. Bahena-Roman,
J. Tellez-Sosa, J. Martinez-Barnetche, B. Cortina-Ceballos,
G. Lopez-Estrada, K. Delgado-Romero, A. I. Burguete-
Garcia, D. Cantu, A. Garcia-Carranca and V. Madrid-
Marina, Cervical microbiome and cytokine profile at
various stages of cervical vancer: A pilot study, PLoS One,
2016, 11, e0153274.
8 H. Yu, W. Xu, F. Gong, B. Chi, J. Chen and L. Zhou,
MicroRNA-155 regulates the proliferation, cell cycle, apop-
tosis and migration of colon cancer cells and targets CBL,
Exp. Ther. Med., 2017, 14, 4053–4060.
9 J. M. Wessels, J. Lajoie, D. Vitali, K. Omollo, J. Kimani,
J. Oyugi, J. Cheruiyot, M. Kimani, J. N. Mungai, M. Akolo,
J. C. Stearns, M. G. Surette, K. R. Fowke and C. Kaushic,
Association of high-risk sexual behaviour with diversity of
the vaginal microbiota and abundance of Lactobacillus,
PLoS One, 2017, 12, e0187612.
10 G. Saxami, A. Karapetsas, E. Lamprianidou, I. Kotsianidis,
A. Chlichlia, C. Tassou, V. Zoumpourlis and A. Galanis,
Two potential probiotic lactobacillus strains isolated from
olive microbiota exhibit adhesion and anti-proliferative
effects in cancer cell lines, J. Funct. Foods, 2016, 24, 461–
471.
11 R. Rubio, A. Jofré, B. Martín, T. Aymerich and M. Garriga,
Characterization of lactic acid bacteria isolated from infant
faeces as potential probiotic starter cultures for fermented
sausages, Food Microbiol., 2014, 38, 303–311.
12 S. Erkkilä and E. Petäjä, Screening of commercial meat
starter cultures at low pH and in the presence of bile salts
for potential probiotic use, Meat Sci., 2000, 55, 297–300.
Food Funct.
View Article Online
Food & Function
13 E. Motevaseli, M. Shirzad, S. M. Akrami, A. S. Mousavi,
A. Mirsalehian and M. H. Modarressi, Normal and tumour
cervical cells respond differently to vaginal lactobacilli,
independent of pH and lactate, J. Med. Microbiol., 2013, 62,
1065–1072.
14 L. Huang, Y.-J. Shan, C.-X. He, M.-H. Ren, P.-J. Tian and
W. Song, Effects of L. paracasei subp. paracasei X12 on cell
cycle of colon cancer HT-29 cells and regulation of mTOR
signalling pathway, J. Funct. Foods, 2016, 21, 431–439.
15 Y. Li, F. Ahmed, S. Ali, P. A. Philip, O. Kucuk and
F. H. Sarkar, Inactivation of nuclear factor kappaB by soy
isoflavone genistein contributes to increased apoptosis
induced by chemotherapeutic agents in human cancer
cells, Cancer Res., 2005, 65, 6934–6942.
16 C. W. Park, Y. S. Song, H. P. Lee, J. T. Hong and D. Y. Yoon,
(E)-2-Methoxy-4-(3-(4-Methoxyphenyl)Prop-1-en-1-yl)
Phenol induces apoptosis in HeLa cervical cancer cells via
the extrinsic apoptotic pathway, J. Microbiol. Biotechnol.,
2017, 27, 1359–1366.
17 D. C. Dartsch, A. Schaefer, S. Boldt, W. Kolch and
H. Marquardt, Comparison of anthracycline-induced death
of human leukemia cells: programmed cell death versus
necrosis, Apoptosis, 2002, 7, 537–548.
18 B. F. Trump, I. K. Berezesky, S. H. Chang and P. C. Phelps,
The pathways of cell death: oncosis, apoptosis, and necro-
sis, Toxicol. Pathol., 1997, 25, 82–88.
19 Z. Chen, J. Shi, X. Yang, Y. Liu, B. Nan and Z. Wang,
Isolation of exopolysaccharide-producing bacteria and
yeasts from Tibetan kefir and characterisation of the exopo-
lysaccharides, Int. J. Dairy Technol., 2016, 69(3), 410–417.
20 S. S. Beasley and P. E. Saris, Nisin-producing Lactococcus
lactis strains isolated from human milk, Appl. Environ.
Microbiol., 2004, 70, 5051–5053.
21 N. Saitou and M. Nei, The neighbor-joining method: a new
method for reconstructing phylogenetic trees, Mol. Biol.
Evol., 1987, 4, 406–425.
22 K. Tamura, M. Nei and S. Kumar, Prospects for inferring
very large phylogenies by using the neighbor-joining
method, Proc. Natl. Acad. Sci. U. S. A., 2004, 101, 11030–
11035.
23 J. Lee, H. S. Yun, K. W. Cho, S. Oh, S. H. Kim, T. Chun,
B. Kim and K. Y. Whang, Evaluation of probiotic character-
istics of newly isolated Lactobacillus spp.: immune modu-
lation and longevity, Int. J. Food Microbiol., 2011, 148, 80–
86.
24 Y. J. Oh and D. S. Jung, Evaluation of probiotic properties
of Lactobacillus, and Pediococcus strains isolated from
Omegisool, a traditionally fermented millet alcoholic bever-
age in Korea, LWT – Food Sci. Technol., 2015, 63, 437–444.
25 F. Sabir, Y. Beyatli, C. Cokmus and D. Onal-Darilmaz,
Assessment of potential probiotic properties of
Lactobacillus spp., Lactococcus spp., and Pediococcus spp.
strains isolated from kefir, J. Food Sci., 2010, 75, M568–
M573.
26 A. Jimenez-Serna and H. Hernandez-Sanchez, Effect of
different antibiotics and non-steroidal anti-inflammatory
This journal is © The Royal Society of Chemistry 2018

Food & Function
drugs on the growth of Lactobacillus casei Shirota, Curr.
Microbiol., 2011, 62, 1028–1033.
27 K. Angmo, A. Kumari and T. C. Bhalla, Probiotic character-
ization of lactic acid bacteria isolated from fermented
foods and beverage of Ladakh, LWT – Food Sci. Technol.,
2016, 66, 428–435.
28 D. Shao, L. Yao, M. s. riaz, J. Zhu, J. Shi, M. Jin, Q. Huang
and H. Yang, Simulated microgravity affects some biologi-
Published on 07 May 2018. Downloaded by Universite Pierre et Marie Curie on 17/05/2018 07:44:22.
cal characteristics of Lactobacillus acidophilus, Appl.
Microbiol. Biotechnol., 2017, 101, 3439–3449.
29 P. Y. Lin, C. T. Tsai, W. L. Chuang, Y. H. Chao, I. H. Pan,
Y. K. Chen, C. C. Lin and B. Y. Wang, Chlorella sorokiniana
induces mitochondrial-mediated apoptosis in human non-
small cell lung cancer cells and inhibits xenograft tumor
growth in vivo, BMC Complementary Altern. Med., 2017, 17, 88.
30 L. M. Eike, N. Yang, O. Rekdal and B. Sveinbjornsson, The
oncolytic peptide LTX-315 induces cell death and DAMP
release by mitochondria distortion in human melanoma
cells, Oncotarget, 2015, 6, 34910–34923.
31 Y. Nami, N. Abdullah, B. Haghshenas, D. Radiah, R. Rosli
and A. Y. Khosroushahi, Assessment of probiotic potential
and anticancer activity of newly isolated vaginal bacterium
Lactobacillus plantarum 5BL, Microbiol. Immunol., 2014,
58, 492–502.
32 J. Aaltonen, T. Ojala, K. Laitinen, T. Poussa, S. Ozanne and
E. Isolauri, Impact of maternal diet during pregnancy and
breastfeeding on infant metabolic programming: a pro-
spective randomized controlled study, Eur. J. Clin. Nutr.,
2011, 65, 10–19.
33 M. Arici, B. Bilgin, O. Sagdic and C. Ozdemir, Some charac-
teristics of Lactobacillus, isolates from infant faeces, Food
Microbiol., 2004, 21, 19–24.
34 E. W. Rogier, A. L. Frantz, M. E. Bruno, L. Wedlund,
D. A. Cohen, A. J. Stromberg and C. S. Kaetzel, Lessons
from mother: long-term impact of antibodies in breast
milk on the gut microbiota and intestinal immune system
of breastfed offspring, Gut Microbes, 2014, 5, 663–668.
35 Y. T. Tsai, P. C. Cheng and T. M. Pan, The immunomodula-
tory effects of lactic acid bacteria for improving immune
functions and benefits, Appl. Microbiol. Biotechnol., 2012,
96, 853–862.
36 M. S. Riaz Rajoka, H. M. Mehwish, M. Siddiq, Z. Haobin,
J. Zhu, L. Yan, D. Shao, X. Xu and J. Shi, Identification,
characterization, and probiotic potential of Lactobacillus
rhamnosus isolated from human milk, LWT – Food Sci.
Technol., 2017, 84, 271–280.
37 B. Haghshenas, Y. Nami, N. Abdullah, D. Radiah, R. Rosli
and A. Y. Khosroushahi, Anticancer impacts of potentially
probiotic acetic acid bacteria isolated from traditional dairy
microbiota, LWT – Food Sci. Technol., 2015, 60, 690–697.
38 Y. Tuo, W. Zhang, L. Zhang, L. Ai, Y. Zhang, X. Han and
H. Yi, Study of probiotic potential of four wild
Lactobacillus rhamnosus strains, Anaerobe, 2013, 21, 22–
27.
39 S. M. Wang, L. W. Zhang, R. B. Fan, X. Han, H. X. Yi,
L. L. Zhang, C. H. Xue, H. B. Li, Y. H. Zhang and
This journal is © The Royal Society of Chemistry 2018
View Article Online
Paper
N. Shigwedha, Induction of HT-29 cells apoptosis by lacto-
bacilli isolated from fermented products, Res. Microbiol.,
2014, 165, 202–214.
40 E. F. Panel, Guidance on the assessment of bacterial sus-
ceptibility to antimicrobials of human and veterinary
importance, EFSA J., 2012, 10, 2740.
41 L. Chang, Z.-Y. Zhang, D. Ke, Y. Jian-Ping and G. Xiao-Kui,
Antibiotic resistance of probiotic strains of lactic acid bac-
teria isolated from marketed foods and drugs, Biomed.
Environ. Sci., 2009, 22, 401–412.
42 S. Siragusa, M. De Angelis, R. Di Cagno, C. Rizzello,
R. Coda and M. Gobbetti, Synthesis of γ-aminobutyric
acid by lactic acid bacteria isolated from a variety of
Italian cheeses, Appl. Environ. Microbiol., 2007, 73, 7283–
7290.
43 S. K. Palaniswamy and V. Govindaswamy, In vitro probiotic
characteristics assessment of feruloyl esterase and gluta-
mate decarboxylase producing Lactobacillus, spp. isolated
from traditional fermented millet porridge (kambu koozh),
LWT – Food Sci. Technol., 2016, 68, 208–216.
44 S. Li, Y. Zhao, L. Zhang, X. Zhang, L. Huang, D. Li, C. Niu,
Z. Yang and Q. Wang, Antioxidant activity of Lactobacillus
plantarum strains isolated from traditional Chinese fer-
mented foods, Food Chem., 2012, 135, 1914–1919.
45 A. C. Ouwehand, Antiallergic effects of probiotics, J. Nutr.,
2007, 137, 794s–797s.
46 Y. F. Tuo, L. W. Zhang, H. X. Yi, Y. C. Zhang, W. Q. Zhang,
X. Han, M. Du, Y. H. Jiao and S. M. Wang, Short communi-
cation: Antiproliferative effect of wild Lactobacillus, strains
isolated from fermented foods on HT-29 cells, J. Dairy Sci.,
2010, 93, 2362–2366.
47 V. J. Koller, B. Marian, R. Stidl, A. Nersesyan, H. Winter,
T. Simic, G. Sontag and S. Knasmuller, Impact of lactic acid
bacteria on oxidative DNA damage in human derived colon
cells, Food Chem. Toxicol., 2008, 46, 1221–1229.
48 D. A. Elliott, W. S. Kim, D. A. Jans and B. Garner, Apoptosis
induces neuronal apolipoprotein-E synthesis and localization
in apoptotic bodies, Neurosci. Lett., 2007, 416, 206–210.
49 P. Elumalai, D. N. Gunadharini, K. Senthilkumar,
S. Banudevi, R. Arunkumar, C. S. Benson, G. Sharmila and
J. Arunakaran, Induction of apoptosis in human breast
cancer cells by nimbolide through extrinsic and intrinsic
pathway, Toxicol. Lett., 2012, 215, 131–142.
50 J. Chen, J. Chen, Z. Li, C. Liu and L. Yin, The apoptotic
effect of apigenin on human gastric carcinoma cells
through mitochondrial signal pathway, Tumor Biol., 2014,
35, 7719–7726.
51 R. Hassankhani, M. R. Sam, M. Esmaeilou and P. Ahangar,
Prodigiosin isolated from cell wall of Serratia marcescens
alters expression of apoptosis-related genes and increases
apoptosis in colorectal cancer cells, Med. Oncol., 2015, 32,
366.
52 N. H. Shafie, N. M. Esa, H. Ithnin, N. Saad and
A. K. Pandurangan, Pro-apoptotic effect of rice bran inosi-
tol hexaphosphate (IP6) on HT-29 colorectal cancer cells,
Int. J. Mol. Sci., 2013, 14, 23545–23558.
Food Funct.