MICROBIAL ECOLOGY

crossm

Effects of Antimicrobial Peptide GH12 on the Cariogenic

Properties and Composition of a Cariogenic Multispecies
Biofilm
Wentao Jiang,a,b Yufei Wang,a,b Junyuan Luo,a,b Xinwei Li,a,b Xuedong Zhou,a,b Wei Li,a,b Linglin Zhanga,b

a
State Key Laboratory of Oral Diseases, National Clinical Research Centre for Oral Disease, West China Hospital
of Stomatology, Sichuan University, Chengdu, China
b Department of Cariology and Endodontics, West China Hospital of Stomatology, Sichuan University,
Chengdu, China

ABSTRACT Dental caries is a biofilm-mediated disease that occurs when acido-

genic/aciduric bacteria obtain an ecological advantage over commensal species. In
previous studies, the effects of the antimicrobial peptide GH12 on planktonic bacte-
ria and monospecies biofilms were confirmed. The objectives of this study were to
investigate the effects of GH12 on a cariogenic multispecies biofilm and to prelimi-
narily explain the mechanism. In this biofilm model, Streptococcus mutans ATCC
70061 was the representative of cariogenic bacteria, while Streptococcus gordonii ATCC
35105 and Streptococcus sanguinis JCM 5708 were selected as healthy microbiota.
The results showed that GH12 was more effective in suppressing S. mutans than the
other two species, with lower MIC and minimal bactericidal concentration (MBC) val-
ues among diverse type strains and clinical isolated strains. Therefore, GH12, at no
more than 8 mg/liter, was used to selectively suppress S. mutans in the multispecies
biofilm. GH12 at 4 mg/liter and 8 mg/liter reduced the cariogenic properties of the
multispecies biofilm in biofilm formation, glucan synthesis, and lactic acid produc-
tion. In addition, GH12 suppressed S. mutans within the multispecies biofilm and
changed the bacterial composition. Furthermore, 8 mg/liter GH12 showed a selective
bactericidal impact on S. mutans, and GH12 promoted hydrogen peroxide produc-
tion in S. sanguinis and S. gordonii, which improved their ecological advantages. In
conclusion, GH12 inhibited the cariogenic properties and changed the composition
of the multispecies biofilm through a two-part mechanism by which GH12 directly
suppressed the growth of S. mutans as well as enhanced the ecological competitive-
ness of S. sanguinis and S. gordonii.
IMPORTANCE Dental caries is one of the most prevalent chronic infectious diseases
worldwide, with substantial economic and quality-of-life impacts. Streptococcus mu-
tans has been considered the principal pathogen of dental caries. To combat dental Received 14 June 2018 Accepted 8 October
2018
caries, an antimicrobial peptide, GH12, was designed, and its antibacterial effects on
Accepted manuscript posted online 19
planktonic S. mutans and the monospecies biofilm were confirmed. As etiological October 2018
concepts of dental caries evolved to include microecosystems, the homeostasis be- Citation Jiang W, Wang Y, Luo J, Li X, Zhou X,
tween pathogenic and commensal bacteria and a selective action on cariogenic viru- Li W, Zhang L. 2018. Effects of antimicrobial
peptide GH12 on the cariogenic properties and
lence have increasingly become the focus. The novelty of this research was to study
composition of a cariogenic multispecies
the effects of the antimicrobial peptides on a controlled cariogenic multispecies bio- biofilm. Appl Environ Microbiol 84:e01423-18.
film model. Notably, the role of an antimicrobial agent in regulating interspecific https://doi.org/10.1128/AEM.01423-18.
competition and composition shifts within this multispecies biofilm was investigated. Editor Hideaki Nojiri, University of Tokyo
With promising antibacterial and antibiofilm properties, the use of GH12 might be of Copyright © 2018 American Society for
Microbiology. All Rights Reserved.
importance in preventing and controlling caries and other dental infections.
Address correspondence to Linglin Zhang,
zhll_sc@163.com.
KEYWORDS Streptococcus gordonii, Streptococcus mutans, Streptococcus sanguinis, W.J. and Y.W. contributed equally to this work.
antimicrobial peptides, biofilms, cariogenesis, dental caries, dental plaque

December 2018 Volume 84 Issue 24 e01423-18 Applied and Environmental Microbiology aem.asm.org 1
Jiang et al. Applied and Environmental Microbiology

D ental caries is a global epidemic disease with substantial economic and quality-
of-life impacts (1). One of the primary etiological factors of dental caries is the
colonization of pathogenic microorganisms on the tooth surfaces. Dental plaque is a
complex cariogenic biofilm composed of oral bacteria and the matrix, in which micro-
bial communities show stronger resistance to antimicrobial agents. The close contact of
microorganisms in the plaque biofilm increases the probability of interactions, which
may promote the pathogenic potential of cariogenic bacteria (2). An increase in the
proportion of cariogenic bacteria that are capable of demineralizing enamel in the
plaque biofilm is closely associated with dental caries (3). Under normal conditions, a
dynamic balance of demineralization and remineralization is maintained between the
plaque biofilm and the tooth surface in the oral environment. A disruption of this
balance leads to dental caries (4). Therefore, focusing on the plaque biofilm is essential
for developing anticaries agents.
Plaque biofilms consist of pathogenic and commensal bacteria at the same time and
have complicated coexistence and competition relationships within the microbial
communities (5). The application of a biofilm model involving multiple species is
indispensable for further exploration of the effects of anticaries agents. Streptococcus
sanguinis and Streptococcus gordonii are usually associated with caries-free tooth
surfaces and are considered somewhat beneficial (6). Streptococcus mutans is consid-
ered the primary cariogenic bacterium (7) with several cariogenic virulence properties,
including acidogenicity, acidurance, and the synthesis of extracellular polysaccharides
(EPSs). EPSs, especially water-insoluble glucan, assist bacterial adhesion and contribute
to biofilm formation and integrity (8, 9). Acid accumulation leads to a reduced pH and
demineralization. Therefore, the inhibition of the growth and virulence of S. mutans
within a multispecies plaque biofilm is the main approach to reduce its cariogenic
properties.
Numerous antimicrobial peptides (AMPs) have the ability to inhibit both planktonic
bacteria and biofilms and have shown a close relationship to oral health (10, 11). The
interest in using AMPs as therapeutic alternatives and adjuvants to combat dental
caries is continually growing (12). To date, the effects of many natural or synthetic AMPs
against cariogenic bacteria have been studied, including KSL (13), L-K6 (14), mPE (15),
magainin 2 (16), MUC7 20-mer (17), LFb 17-30 (18), and Bac8c (19). The rapid killing
ability, multimodal mechanisms, and adjunctive bioactive functions render AMPs ex-
citing candidates as adjuncts in the treatment of caries (12). However, these studies
focused on planktonic bacteria and monospecies biofilms with S. mutans only instead
of biofilms containing multiple species of bacteria. In previous studies, a cationic
amphipathic ␣-helical AMP GH12 was de novo designed and synthesized. It was
confirmed that the peptide had low cytotoxicity to human gingival fibroblasts, good
stability in human saliva, and excellent antimicrobial properties (20, 21). GH12 also
inhibited biofilm formation of S. mutans effectively and penetrated the biofilm matrix
to kill the S. mutans within the preformed biofilm (20). Furthermore, GH12 inhibited
various virulence factors of S. mutans, resulting in reduced acidogenicity, compromised
aciduricity, decreased EPS synthesis, defects in the ability to form biofilm, and an
attenuation of the stress response and environmental adaptation at enzymatic and
transcriptional levels (22). However, considering the diversity and complexity of the
microorganisms associated with dental caries, the effects of GH12 on multispecies
biofilm and bacterial interactions remain to be examined further.
Considering all of the above, we speculated that GH12 would change the microbiota
composition of a controlled multispecies biofilm, decrease the ratio of cariogenic S.
mutans, reestablish a healthier equilibrium of the microorganisms, and thus inhibit the
cariogenic properties of this biofilm. The objectives of this study were (i) to investigate
the effects of GH12 on cariogenic properties of a controlled cariogenic multispecies
biofilm in vitro, including acid production, EPS synthesis, and biofilm formation, (ii) to
explore the effects of GH12 on biofilm composition, and (iii) to further explore the
mechanism of the observed effects. The innovations of this study are that a controlled
cariogenic multispecies biofilm was utilized to study the effects of an antimicrobial

December 2018 Volume 84 Issue 24 e01423-18 aem.asm.org 2

Effects of GH12 on a Cariogenic Multispecies Biofilm Applied and Environmental Microbiology

TABLE 1 MIC and MBC values of GH12 against the three bacteria
GH12a
Species Strain MIC (mg/liter) MBC (mg/liter)
S. mutans ATCC 700610 6.7 ⫾ 1.9 8.0 ⫾ 0.0
GS-5 8.0 ⫾ 0.0 9.3 ⫾ 3.0
COCC32-3 4.0 ⫾ 0.0 8.0 ⫾ 0.0
COCC31-8 8.0 ⫾ 0.0 9.3 ⫾ 3.0
COCC33-12 8.0 ⫾ 0.0 8.0 ⫾ 0.0

S. gordonii ATCC 35105 37.3 ⫾ 11.9 64.0 ⫾ 0.0

ATCC 10558 42.7 ⫾ 15.1 64.0 ⫾ 0.0
COCC26-9 58.7 ⫾ 11.9 64.0 ⫾ 0.0

S. sanguinis JCM 5708 16 ⫾ 0.0 37.3 ⫾ 11.9

SK36 18.7 ⫾ 6.0 32.0 ⫾ 0.0
COCC25-23 26.7 ⫾ 7.5 32.0 ⫾ 0.0
aData are represented as mean ⫾ standard deviation of six independent experiments.

peptide and that the role of an antimicrobial agent in bacterial interactions within this
controlled multispecies biofilm was investigated.

RESULTS
GH12 showed different antimicrobial effects against the three bacterial spe-
cies. Although GH12 inhibits and kills all three bacterial species, it showed different
inhibition and killing effects on S. mutans, S. gordonii, and S. sanguinis (Table 1). For S.
mutans, the MIC of GH12 was 4.0 to 8.0 mg/liter and the MBC was 8.0 to 9.3 mg/liter.
For S. gordonii, the MIC of GH12 was 37.3 to 58.7 mg/liter and the MBC was 64.0 mg/
liter. For S. sanguinis, the MIC of GH12 was 16.0 to 26.7 mg/liter and the MBC was 32.0
to 37.3 mg/liter. Among the diverse type culture strains and clinical isolated strains,
GH12 was more effective against S. mutans, with lower MIC and MBC values than for the
other two bacteria. On the basis of these results, GH12 at concentrations of no more
than 8 mg/liter was used in the following tests to selectively inhibit S. mutans in the
multispecies biofilms.
GH12 suppressed S. mutans within the multispecies biofilm in vitro. Fluorescent
in situ hybridization (FISH) of the 24-h and 48-h multispecies biofilms was conducted to
preliminarily visualize the effects of GH12 on this multispecies biofilm composition. As
shown in Fig. 1A, S. mutans was gradually diminished, while S. sanguinis and S. gordonii
became dominant in the 24-h multispecies biofilms. When treated with 8 mg/liter
GH12, S. mutans in the multispecies biofilm was eliminated. The images of the 48-h
multispecies biofilms in Fig. 1B followed the same trend; the quantity of S. mutans
decreased and those of the other two species were maintained. Furthermore, changes
in the structures of the multispecies biofilms were also observed. Biofilms had a less
typical appearance and were less dense when treated with 4 mg/liter and 8 mg/liter
GH12 compared to those of the control groups. GH12 significantly suppressed S.
mutans within the multispecies biofilm and changed the morphology of the biofilms.
GH12 inhibited the cariogenic properties of the multispecies biofilm in vitro.
The effects of GH12 on the cariogenic properties were detected by measuring the biofilm
formation, water-insoluble glucan synthesis, and lactic acid production of the multispe-
cies biofilms. As shown in Fig. 2A, compared with that of the control, the formation
of multispecies biofilms was decreased by 4 mg/liter and 8 mg/liter GH12 signifi-
cantly (P ⬍ 0.05). When treated with 4 mg/liter and 8 mg/liter GH12, water-insoluble
glucan synthesis (Fig. 2B) and lactic acid production (Fig. 2C) were also significantly
suppressed (P ⬍ 0.05), which were consistent with the results of the biofilm forma-
tion assay. GH12 at 8 mg/liter showed much stronger effects. In contrast, 2 mg/liter
GH12 showed few benefits in reducing the cariogenic properties.
GH12 changed the microbiota composition of the multispecies biofilm in vitro.
The results of quantitative real-time PCR revealed the variation in the ratios of the three
species of bacteria in the multispecies biofilms caused by different concentrations of

December 2018 Volume 84 Issue 24 e01423-18 aem.asm.org 3

Jiang et al. Applied and Environmental Microbiology

FIG 1 Fluorescent in situ hybridization images of the 24-h multispecies biofilms and the 48-h multispecies biofilms
reveals the shift of the composition of the biofilms (green, S. mutans; red, S. sanguinis; blue, S. gordonii). The images
are of samples from the same batch and are representative of the three independent experiments.

GH12 over time. As shown in Fig. 3A, in the first 24 h, the ratio of S. mutans in the
control decreased from 32.89% to 25.87%. However, when treated with GH12, the
proportion of S. mutans dropped much more sharply. With the treatment of 4 mg/liter
GH12, the proportion of S. mutans decreased to 9.5%. Moreover, when treated with
8 mg/liter GH12, the proportion of S. mutans dropped to 0.01%. S. gordonii was
dominant, reaching 88.25%, while S. sanguinis was maintained, accounting for 11.74%
of the biofilm. Furthermore, as shown in Fig. 3B, the changes in the microbiota
composition in the multispecies biofilms followed the same trend and were more
obvious at 48 h. The ratio of S. mutans decreased to 6.31% when treated with 4 mg/liter
GH12, and 8 mg/liter GH12 decreased the proportion of S. mutans to 0.01%. The
proportion of S. gordonii increased steadily. The proportion of S. sanguinis decreased
over time but remained in the multispecies biofilm. The results of the quantitative
real-time PCR were relatively consistent with the FISH images and verified that GH12
changes the microbiota composition of the multispecies biofilms significantly.
GH12 had different antibacterial activity against S. mutans, S. sanguinis, and S.
gordonii growth in vitro. As shown in Fig. 4A, GH12 did not significantly affect the
growth pattern of S. gordonii as it reached the logarithmic phase at the second hour
and plateaued at the fifth hour. The growth of S. sanguinis (Fig. 4B) was not affected by
GH12. The growth inhibition kinetics of all treatment groups were the same as the
control; they started the logarithmic phase around the third hour and plateaued around
the fifth hour. However, as shown in Fig. 4C, GH12 impacted the growth of S. mutans.
The growth of S. mutans was delayed by 4 mg/liter GH12, as an extended lag phase and
lower absorbance during logarithmic phase were observed. In addition, its step into
stationary phase was delayed for approximately 2 h. The growth of S. mutans was
totally inhibited by 8 mg/liter GH12 during the 24 h of observation. In conclusion, GH12
showed much more efficient growth inhibition on S. mutans than on S. gordonii and S.
sanguinis.
GH12 promoted the hydrogen peroxide production of S. sanguinis and S.
gordonii in vitro. GH12 increased the hydrogen peroxide production of S. gordonii and
S. sanguinis. As shown in Fig. 5A, GH12 significantly promoted the hydrogen peroxide
production of S. gordonii at the concentrations of 2 mg/liter, 4 mg/liter, and 8 mg/liter
(P ⬍ 0.05). For S. sanguinis (Fig. 5B), GH12 at 2 mg/liter, 4 mg/liter, and 8 mg/liter also
significantly promoted the production of hydrogen peroxide (P ⬍ 0.05). Moreover, as
shown in Fig. 5C and D, GH12 at 4 mg/liter and 8 mg/liter significantly upregulated the

December 2018 Volume 84 Issue 24 e01423-18 aem.asm.org 4

Effects of GH12 on a Cariogenic Multispecies Biofilm Applied and Environmental Microbiology

FIG 2 Measurements of the cariogenic properties of the multispecies biofilms. Biofilm formation (A) and
water-insoluble glucan synthesis (B) of the control group without GH12 treatment and groups with GH12
at 2 mg/liter, 4 mg/liter, or 8 mg/liter after 24 h were measured by a crystal violet staining assay and the
anthrone method, respectively. (C) Lactic acid production of the 24-h multispecies biofilm was measured
after treatment with 2 mg/liter, 4 mg/liter, and 8 mg/liter GH12 or without GH12 for 2 h. Data are means ⫾
standard deviations from three independent experiments. Different lowercase letters indicate significant
differences (P ⬍ 0.05) among treatments.

expression of the hydrogen peroxide production-related gene spxB in these two

bacteria (P ⬍ 0.05). However, GH12 at 2 mg/liter did not upregulate the expression of
spxB in S. gordonii or in S. sanguinis (P ⬎ 0.05). GH12 at 4 mg/liter and 8 mg/liter
promoted the hydrogen peroxide production of S. gordonii and S. sanguinis at pheno-
typic and transcriptional levels.

DISCUSSION
To investigate cariogenic properties in defined environments with a practical and
ethical manner, caries models have been developed, which offer a valuable approach
to study cariogenic properties as well as the colonization by S. mutans under different
situations (23). A controlled simulation multispecies biofilm model containing both
pathogenic bacteria (S. mutans) and commensal bacteria (S. gordonii and S. sanguinis)
was adopted in this study. The reproducible three-species streptococci biofilm model
has been widely used in caries research (24–27). S. mutans ATCC 700610 is strongly
cariogenic and well characterized (28) and exhibits cariogenic virulence in this multi-
species biofilm. S. sanguinis JCM 5708 and S. gordonii ATCC 35105 combat S. mutans via
hydrogen peroxide production as well as alkali production from arginine metabolism

December 2018 Volume 84 Issue 24 e01423-18 aem.asm.org 5

Jiang et al. Applied and Environmental Microbiology

FIG 3 Microbiota compositions of the multispecies biofilms (red, S. sanguinis; blue, S. gordonii; green, S.
mutans). The ratios of S. mutans, S. sanguinis, and S. gordonii in the multispecies biofilms at the initial
time, 24 h, and 48 h without or with GH12 at the concentrations of 2 mg/liter, 4 mg/liter, and 8 mg/liter
were determined by quantitative real-time PCR. The ratios were calculated from three independent
experiments.

(29); thus, the proportion of S. mutans in the biofilm can be decreased naturally by S.
sanguinis and S. gordonii as shown in Fig. 3A and other studies (24, 30, 31). S. sanguinis
and S. gordonii are associated with low caries risk and sound enamel (6, 32), while S.
mutans constitutes a high proportion of the microbiota in individuals with dental caries
(33). The microbiota composition change represents the shift to a higher caries risk or
to a healthier condition (24) and demonstrates the alteration of cariogenic potential
from the perspective of bacterial quantity.
With the gradual understanding of the oral microecosystem, the novel strategies in
the antimicrobial treatment of dental caries are to suppress the colonization and
virulence of cariogenic bacteria and to reduce the cariogenic properties of dental
plaque (34, 35). In this study, the multispecies biofilms became atypical and structurally
loose when treated with 4 mg/liter and 8 mg/liter GH12, which suggested damage to
the structure and integrity of the biofilms. GH12 at 4 mg/liter and 8 mg/liter dramati-
cally suppressed S. mutans, but S. sanguinis and S. gordonii were not eliminated and
remained at considerable levels. In addition, 4 mg/liter and 8 mg/liter GH12 decreased
water-insoluble EPS synthesis and biofilm formation, which contributed to the weak-
ened adherence, persistence, and resistance of the multispecies biofilm (36). An accu-
mulation of lactic acid leads to a pH drop, and demineralization occurs when the pH is
below 5.5 (37). Decreased lactic acid production caused by GH12 might alleviate the
acid attack by biofilms to tooth surfaces and theoretically inhibit demineralization.
Several studies showed that saliva enhanced the effectiveness of the cationic AMPs,
as electrostatic interactions with acidic glycoproteins helped maintain cationic AMPs
(38–41). When a saliva pellicle was present, GH12 at 4 mg/liter and 8 mg/liter showed
stronger effects on inhibiting the cariogenic properties and changing the microbiota
composition of the multispecies biofilm (see Fig. S1 and S2 in the supplemental
material). For instance, when treated with 8 mg/liter GH12, the synthesis of water-
insoluble glucan by the biofilm without saliva was 36.04 mg/liter, while that of the
biofilm including the saliva pellicle was 26.48 mg/liter. The S. mutans proportion after
the 4-mg/liter GH12 treatment in the 48-h multispecies biofilms including saliva
pellicles decreased 17.48% compared with that in the control, while that of the biofilm
without saliva only decreased 8.22%. All of the findings described above demonstrate
the enhancement of saliva on GH12 and provide support for the practical application
of the peptides in the oral environment.
Although GH12 was originally designed on the basis of the sequences and struc-
tures of broad-spectrum antimicrobial peptides (20), it showed more potent antimi-

December 2018 Volume 84 Issue 24 e01423-18 aem.asm.org 6

Effects of GH12 on a Cariogenic Multispecies Biofilm Applied and Environmental Microbiology

FIG 4 Growth inhibition kinetics of S. gordonii (A), S. sanguinis (B), and S. mutans (C). Growth levels (A600)
in BHI broth in the presence of 2 mg/liter, 4 mg/liter, and 8 mg/liter GH12 or in untreated controls for 24
h. Data are means ⫾ standard deviations from three independent experiments.

crobial effects on S. mutans than on the other two species. The growth inhibition
kinetics showed that the growth of S. mutans was inhibited by 8 mg/liter GH12. A
previous study (22) also showed that GH12 at 4 mg/liter reduced the acidogenicity and
attenuated the stress response of S. mutans. It was assumed that 8 mg/liter GH12
selectively inhibited the growth of S. mutans, while 4 mg/liter GH12 interfered with the
environmental adaptation and cell persistence of S. mutans in the multispecies biofilm,
which explained why 4 mg/liter and 8 mg/liter GH12 reduced the cariogenic properties
and changed the microbiota composition of the multispecies biofilm. However, it must
be emphasized that when used at concentrations higher than 64 mg/liter, GH12 still
exerted broad-spectrum antimicrobial effects in this multispecies biofilm. From the
perspective of microecology, it is more suitable to use a small dose of GH12 to regulate
the cariogenic properties and suppress S. mutans rather than to kill all bacteria with a
large dose of GH12.
S. sanguinis and S. gordonii are known to produce hydrogen peroxide catalyzed by
pyruvate oxidase encoded by spxB (42–44). Hydrogen peroxide exerts its antimicrobial
effects on neighboring hydrogen peroxide-susceptible species, such as S. mutans (25,
45, 46). GH12 promoted the production of hydrogen peroxide by S. sanguinis and S.
gordonii with a short-term treatment and upregulated the expression of spxB signifi-
cantly, which helped S. sanguinis and S. gordonii antagonize S. mutans more effectively
and improved their ecological competitiveness. With the addition of GH12 to this

December 2018 Volume 84 Issue 24 e01423-18 aem.asm.org 7

Jiang et al. Applied and Environmental Microbiology

FIG 5 Hydrogen peroxide production of S. sanguinis and S. gordonii. The production of hydrogen peroxide by S.
gordonii (A) and S. sanguinis (B) in 2 h was measured in untreated controls or with treatment of 2 mg/liter,
4 mg/liter, and 8 mg/liter GH12 in BPW medium. The expression of the related gene spxB in S. gordonii (C) and S.
sanguinis (D) was quantified by reverse-transcript quantitative PCR using a 2⫺ΔΔCT method. Data are means ⫾
standard deviations from three independent experiments. Different lowercase letters indicate significant differ-
ences (P ⬍ 0.05) among treatments.

ecologic niche, the advantage of S. sanguinis and S. gordonii was substantially enlarged.
The promotion of hydrogen peroxide also supported the result that GH12 at 4 mg/liter
reduced the S. mutans proportion and the cariogenic properties of the multispecies
biofilm, although it did not impact the growth and colonization of S. mutans.
Notably, S. gordonii had proportional dominance in both the 24-h and 48-h biofilms
when treated with 4 mg/liter and 8 mg/liter GH12. As shown in Table 1, S. sanguinis was
more sensitive to GH12 than S. gordonii. Nobbs et al. (47) found that S. gordonii was
inherently more competitive in interspecific antagonism for binding sites. S. gordonii
weakly inhibits the growth of S. sanguinis (30). Hence, it was speculated that when
treated with GH12, S. mutans was significantly inhibited or eliminated, while S. gordonii
acquired a relative competitive advantage over S. sanguinis and became dominant. In
contrast, S. sanguinis was dominant in the control group and with the treatment of
2 mg/liter GH12. Saliva promotes the binding of S. sanguinis (48); therefore, when
unaffected by GH12, S. sanguinis was dominant in this multispecies biofilm. All of the
findings mentioned above further demonstrate that GH12 possesses the ability to
change the bacterial composition of this microecosystem and to regulate the interspe-
cific relationships within the multispecies biofilm. Additionally, the effect of GH12 on
the microbiota composition of the multispecies biofilm remained for a period of time
in the fresh culture medium without the existence of the peptides, especially after the
treatments of 4 mg/liter and 8 mg/liter GH12 (see Fig. S3). The S. mutans proportion in
the 4-mg/liter GH12 group was much lower than that in the control. Furthermore, S.
mutans in the 8-mg/liter GH12 group did not recover at all and remained absent. GH12
showed persistent effects on the multispecies biofilm, which provides support for the
practical potential of GH12.
There are still some limitations in this research. To further explore the properties of
GH12 and its potential utility, GH12 should be used in a more realistic and complex
biofilm model (49, 50), and the mechanism of the selective inhibition on S. mutans that
GH12 displayed in this multispecies biofilm also remains to be explored.

December 2018 Volume 84 Issue 24 e01423-18 aem.asm.org 8

Effects of GH12 on a Cariogenic Multispecies Biofilm Applied and Environmental Microbiology

TABLE 2 Bacteria tested and their sources

Tested strain Source and/or reference
Type strains
S. mutans ATCC 700610 American Type Culture Collection
S. mutans GS-5 Guangdong Culture Collection Center
S. gordonii ATCC 35105 American Type Culture Collection
S. gordonii ATCC 10558 American Type Culture Collection
S. sanguinis JCM 5708 Japan Collection of Microorganisms
S. sanguinis SK36 American Type Culture Collection

Clinical isolated strains

S. mutans COCC32-3 West China Hospital of Stomatology, 51
S. mutans COCC31-8 West China Hospital of Stomatology, 51
S. mutans COCC33-12 West China Hospital of Stomatology, 51
S. gordonii COCC26-9 West China Hospital of Stomatology, 51
S. sanguinis COCC25-23 West China Hospital of Stomatology, 51

In conclusion, GH12 was able to inhibit the cariogenic properties of the multispecies
biofilm, change the composition of this microecosystem, and shift its tendency to a
healthier condition not only by selectively inhibiting the growth of cariogenic S. mutans
directly but also by helping S. sanguinis and S. gordonii to enlarge their ecological
advantages through the promotion of hydrogen peroxide production. Moreover, GH12
possessed persistent antibiofilm effects and showed enhanced potency with the pres-
ence of saliva. All of the above showed the potential of GH12 to act as an anticaries
agent in clinical use.

MATERIALS AND METHODS

Peptides, chemicals, and assay kits. The peptide GH12 (Gly-Leu-Leu-Trp-His-Leu-Leu-His-His-
Leu-Leu-His-NH2) was synthesized, identified, and purified to 98% by GL Biochem (Shanghai, China)
as described previously (20). The peptide was dissolved in sterile deionized water and stored at
⫺20°C. Unless otherwise stated, the chemicals and assay kits were purchased from Sigma-Aldrich (St.
Louis, MO, USA).
Bacteria inoculation and biofilm cultivation. The tested type strains (Table 2) were from Guang-
dong Culture Collection Center, American Type Culture Collection (ATCC), and Japan Collection of
Microorganisms (JCM). The clinical isolated strains (Table 2) were isolated and identified by Lu et al. (51)
from West China Hospital of Stomatology, Chengdu, China. The bacteria were routinely cultured in brain
heart infusion (BHI) broth (Oxoid, Basingstoke, Hampshire, UK) and incubated anaerobically (85% N2, 10%
H2, and 5% CO2) at 37°C.
Saliva was included prior to biofilm cultivation as described previously to enable attached pellicle
growth (52). Mixed whole saliva was collected from three volunteers aged from 20 to 23 years old with
the approval of the institutional review board of West China Hospital of Stomatology (WCHSIRB-D-2015-
103). The collected saliva was clarified by centrifugation (8,500 ⫻ g, 4°C, 10 min). The supernatant was
further filter sterilized (0.22 ␮M, ultralow binding protein filter; Millipore, Billerica, MA), and 200 ␮l sterile
saliva was added to each well. The plates were incubated at 37°C for 2 h.
The multispecies biofilm was cultivated as described previously (24). Bacterial suspensions were
mixed in 1 ml BHI containing 1% sucrose (BHIS) with or without GH12 in 24-well plates to obtain a
defined microbial population with S. mutans ATCC 700610 (1 ⫻ 106 CFU/ml), S. gordonii ATCC 35105
(1 ⫻ 106 CFU/ml), and S. sanguinis JCM 5708 (1 ⫻ 106 CFU/ml). The plates were incubated at 37°C for 24 h
anaerobically. The bacterial culture medium was changed every 24 h when 48-h multispecies biofilms
were needed.
Bacterial susceptibility assay. The MIC and MBC values of GH12 against the eleven bacterial strains
were determined using a modified broth microdilution method (53). BHI broth, 2-fold serial dilutions of
GH12, and bacteria were placed in 96-well plates with a final concentration of bacteria of 5.0 ⫻ 107
CFU/ml. The control contained only BHI broth and the bacteria. The plates were incubated at 37°C
anaerobically (85% N2, 10% H2, and 5% CO2) according to the CLSI guideline (54). Absorbance at 600 nm
(A600) was recorded using a microplate spectrophotometer (Multiskan GO; Thermo Scientific, USA). MIC
was defined as the lowest peptide concentration where no visible growth was observed (A600(test)/
A600(control) ⬍ 0.1) (55). Aliquots taken from the microwells without visible bacterial growth in the MIC
assay were cultured on BHI agar anaerobically for 48 h at 37°C. The lowest peptide concentration where
no colonies grew was recorded as the MBC.
Fluorescent in situ hybridization. FISH was conducted as described previously (24) with the specific
fluorescent probes listed in Table 3 (24, 56, 57). The biofilms were fixed in 4% paraformaldehyde
overnight, rinsed with sterile water, and dried at 46°C. Each sample was treated with 0.5 ml of lysis buffer
(50 mM EDTA, 100 mM Tris-HCl, pH 8.0) containing 30 mg/ml of lysozyme at 37°C for 20 min. The samples
were rinsed, serially dehydrated in 50%, 80%, and 100% ethanol for 3 min, dried at 46°C for 10 min, and
incubated in 50 ␮l of hybridization buffer (20 mM Tris-HCl [pH 8.0], 0.9 M NaCl, 20% formamide, 0.01%

December 2018 Volume 84 Issue 24 e01423-18 aem.asm.org 9

Jiang et al. Applied and Environmental Microbiology

TABLE 3 Probes used in fluorescent in situ hybridization

Probe Sequence (5=¡3=) Reference
S. mutans Alexa Fluor 488-5=-ACTCCAGACTTTCCTGAC-3= 56
S. gordonii Alex Fluor 594-5=-GCATACTATGGTTAAGCCACAGCC-3= 57
S. sanguinis DEA-5=-ACTGTGCGTTCTACTTGC-3= 24

SDS) containing 2 nM specific probes at 46°C for 90 min in the dark. The samples were rinsed with
preheated wash buffer (20 mM Tris-HCl [pH 8.0], 5 mM EDTA, 215 mM NaCl, 0.01% SDS) at 48°C for 15 min
and rinsed in nuclease-free water. The multispecies biofilms were imaged with a confocal laser scanning
microscope (CLSM, FV1000; Olympus, Tokyo, Japan).
Biofilm formation assay. The effect of GH12 on biofilm formation for 24 h was evaluated as
described previously (58, 59). The biofilms were rinsed with phosphate-buffered saline (PBS), fixed with
methanol for 15 min, and stained with 0.1% crystal violet for 5 min, after which the excess dye was rinsed
off. The dye bound to the biofilm was resolubilized with 33% glacial acetic acid. The absorbance at
595 nm was measured to quantify the biofilm formation, and the results were expressed as the
percentage relative to the absorbance of the control.
Water-insoluble EPS measurement. The water-insoluble EPS production in the 24-h multispecies
biofilms was determined by the anthrone method (38). The biofilms were collected with PBS. After
centrifugation (8,000 rpm, 5 min), the precipitate was thoroughly washed with sterile water and resus-
pended in 1 ml of 0.4 M NaOH. After centrifugation, 200 ␮l of the supernatant was mixed with 600 ␮l
anthrone reagent at 95°C for 5 min. The absorbance at 625 nm was measured, and the concentrations of
the water-insoluble EPSs were calculated with a standard curve.
Lactic acid measurement. Lactic acid produced by the 24-h multispecies biofilms was measured as
described previously (60). The biofilms were rinsed with PBS, and 1 ml of buffered peptone water (BPW;
Haibo, Qingdao, China) containing 0.2% sucrose with or without GH12 was added to each well, after
which the plate was incubated at 37°C anaerobically for 2 h. The supernatants were tested according to
the instructions for the lactate assay kit (A019-2; Jiancheng, Nanjing, China). The absorbance at 570 nm
was measured, and the lactic acid concentrations were calculated with a standard curve.
DNA isolation and quantitative real-time PCR. The 24-h and the 48-h multispecies biofilms were
rinsed with PBS and collected. Total DNA from the biofilms was isolated and purified using a QIAamp
DNA minikit (51304; Qiagen, Germany). The purity and concentration of DNA were detected by a
NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). The specific primers are
listed in Table 4 (24, 56, 57). Quantitative real-time PCR was performed on a CFX96 real-time System
(C1000 Thermal Cycler; Bio-Rad, Hercules, CA, USA) with the same cycle conditions as used in a previous
study (61) with SYBR Premix Ex Taq II (RR820A; TaKaRa Bio, Shiga, Japan). The numbers of the bacteria
were determined with standard curves, and the results were displayed as the percentage of the bacteria
in the multispecies biofilm.
Growth inhibition kinetics. Growth inhibition kinetics of GH12 on S. mutans ATCC 700610, S.
gordonii ATCC 35105, and S. sanguinis JCM 5708 were determined as described previously (62). Bacteria
were inoculated in BHI broth with or without GH12. The initial concentrations of the bacteria were

TABLE 4 Specific primers used in quantitative real-time PCR and reverse transcription-
quantitative PCR
Primer Directiona Sequence (5=¡3=) Reference
S. mutans F GCCTACAGCTCAGAGATGCTATTCT 56
R GCCATACACCACTCATGAATTGA

S. sanguinis F GAGCGGATGGCCAATTATATCT 24
R CCGGATGATGTCGGCAATA

S. gordonii F GGTGTTGTTTGACCCGTTCAG 57
R AGTCCATCCCACGAGCACAG

S. sanguinis spxB F AATTCGGCGGCTCAATCG 30

R AAGGATAGCAAGGAATGGAGTG

S. gordonii spxB F GGATGCTTTGGCTGAAGAC 31

R GGACCACCTGAACCTACTG

S. sanguinis 16S RNA F AAGCAACGCGAAGAACCTTA 30

R GTCTCGCTAGAGTGCCCAAC

S. gordonii 16S RNA F AAGCAACGCGAAGAACCTTA 31

R GTCTCGCTAGAGTGCCCAAC
aF, forward; R, reverse.

December 2018 Volume 84 Issue 24 e01423-18 aem.asm.org 10

Effects of GH12 on a Cariogenic Multispecies Biofilm Applied and Environmental Microbiology

adjusted to 1 ⫻ 106 CFU/ml. The inoculums were incubated at 37°C anaerobically. A600 values were
recorded over 24 h to determine the growth inhibition kinetics.
Hydrogen peroxide measurement. The effect of GH12 on hydrogen peroxide production in S.
gordonii ATCC 35105 and S. sanguinis JCM 5708 was measured as described previously (63). Briefly, 10 ml
bacterial culture was centrifuged at 8,000 rpm for 5 min. The sediments was washed with PBS and
centrifuged. The bacteria were resuspended in BPW with or without GH12 and incubated anaerobically
at 37°C for 2 h. A hydrogen peroxide assay kit (S0038; Beyotime, Beijing, China) was used to test
hydrogen peroxide production. The absorbance at 560 nm was recorded, and hydrogen peroxide
production was calculated using a standard curve.
RNA isolation and reverse transcription-quantitative PCR. S. gordonii ATCC 35105 and S. sanguinis
JCM 5708 were grown in BHI broth with or without GH12 until late exponential phase. RNA isolation and
purification were conducted as described previously (64). The tested genes and specific primers are listed
in Table 4 (30, 31). The cDNAs were synthesized using the PrimeScript RT reagent kit with gDNA Eraser
(RR047A; TaKaRa Bio). Reverse transcription-quantitative PCR (RT-qPCR) was performed under the same
conditions described above in “DNA isolation and quantitative real-time PCR.” The 2⫺ΔΔCT method was
used to calculate gene expression fold changes normalized to the levels of the 16S RNA gene transcripts.
Statistical analysis. All experiments were independently repeated at least three times. One-way
analyses of variance (ANOVAs) and Tukey’s honestly significant difference (HSD) tests were used to
compare the differences, and the differences were considered significant at a P value of ⬍0.05. Statistical
analyses were performed with SPSS 20.0 (IBM, Chicago, IL, USA).

SUPPLEMENTAL MATERIAL
Supplemental material for this article may be found at https://doi.org/10.1128/AEM
.01423-18.
SUPPLEMENTAL FILE 1, PDF file, 0.4 MB.

ACKNOWLEDGMENTS
This work was supported by the National Natural Science Foundation of China under
grant number 81470734 and the Key Technology Program of Sichuan Province under
grant number 2014SZ0024.
W. Jiang, Y. Wang, and L. Zhang contributed to the study conception and design. W.
Jiang, Y. Wang, J. Luo, X. Li, X. Zhou, and W. Li contributed to the acquisition, analysis,
or interpretation of the data. W. Jiang and Y. Wang drafted the manuscript. All authors
critically revised the manuscript, gave final approval, and agreed to be accountable for
all aspects of the work ensuring integrity and accuracy. The authors declare no
potential conflicts of interest with respect to the authorship and/or publication of this
article.

REFERENCES
1. Kassebaum NJ, Bernabe E, Dahiya M, Bhandari B, Murray CJ, Marcenes
W. 2015. Global burden of untreated caries: a systematic review and
metaregression. J Dent Res 94:650 – 658. https://doi.org/10.1177/
0022034515573272.
2. Marsh PD, Head DA, Devine DA. 2015. Dental plaque as a biofilm and a
microbial community—implications for treatment. J Oral Biosci 57:
185–191. https://doi.org/10.1016/j.job.2015.08.002.
3. Gross EL, Beall CJ, Kutsch SR, Firestone ND, Leys EJ, Griffen AL. 2012.
Beyond Streptococcus mutans: dental caries onset linked to multiple
species by 16S rRNA community analysis. PLoS One 7:e47722. https://
doi.org/10.1371/journal.pone.0047722.
4. Belstrom D, Fiehn NE, Nielsen CH, Holmstrup P, Kirkby N, Klepac-Ceraj V,
Paster BJ, Twetman S. 2014. Altered bacterial profiles in saliva from
adults with caries lesions: a case-cohort study. Caries Res 48:368 –375.
https://doi.org/10.1159/000357502.
5. Davey ME, Costerton JW. 2006. Molecular genetics analyses of biofilm
formation in oral isolates. Periodontol 2000 42:13–26. https://doi.org/10
.1111/j.1600-0757.2006.00052.x.
6. Ge Y, Caufield PW, Fisch GS, Li Y. 2008. Streptococcus mutans and
Streptococcus sanguinis colonization correlated with caries experience in
children. Caries Res 42:444 – 448. https://doi.org/10.1159/000159608.
7. Takahashi N, Nyvad B. 2011. The role of bacteria in the caries process:
ecological perspectives. J Dent Res 90:294 –303. https://doi.org/10.1177/
0022034510379602.
8. Banas JA. 2004. Virulence properties of Streptococcus mutans. Front
Biosci 9:1267–1277. https://doi.org/10.2741/1305.
9. Krzyściak W, Jurczak A, Kościelniak D, Bystrowska B, Skalniak A. 2014. The
virulence of Streptococcus mutans and the ability to form biofilms. Eur J
Clin Microbiol Infect Dis 33:499 –515. https://doi.org/10.1007/s10096
-013-1993-7.
10. Sullivan R, Santarpia P, Lavender S, Gittins E, Liu Z, Anderson MH, He J,
Shi W, Eckert R. 2011. Clinical efficacy of a specifically targeted antimi-
crobial peptide mouth rinse: targeted elimination of Streptococcus mu-
tans and prevention of demineralization. Caries Res 45:415– 428. https://
doi.org/10.1159/000330510.
11. da Cunha NB, Cobacho NB, Viana JFC, Lima LA, Sampaio KBO, Dohms
SSM, Ferreira ACR, de la Fuente-Núñez C, Costa FF, Franco OL, Dias
SC. 2017. The next generation of antimicrobial peptides (AMPs) as
molecular therapeutic tools for the treatment of diseases with social
and economic impacts. Drug Discov Today 22:234 –248. https://doi
.org/10.1016/j.drudis.2016.10.017.
12. Mai S, Mauger MT, Niu LN, Barnes JB, Kao S, Bergeron BE, Ling JQ, Tay FR.
2017. Potential applications of antimicrobial peptides and their mimics
in combating caries and pulpal infections. Acta Biomater 49:16 –35.
https://doi.org/10.1016/j.actbio.2016.11.026.
13. Liu Y, Wang L, Zhou X, Hu S, Zhang S, Wu H. 2011. Effect of the
antimicrobial decapeptide KSL on the growth of oral pathogens and
Streptococcus mutans biofilm. Int J Antimicrob Agents 37:33–38. https://
doi.org/10.1016/j.ijantimicag.2010.08.014.
14. Shang D, Liang H, Wei S, Yan X, Yang Q, Sun Y. 2014. Effects of
antimicrobial peptide L-K6, a temporin-1CEb analog on oral pathogen
growth, Streptococcus mutans biofilm formation, and anti-inflammatory
activity. Appl Microbiol Biotechnol 98:8685– 8695. https://doi.org/10
.1007/s00253-014-5927-9.

December 2018 Volume 84 Issue 24 e01423-18 aem.asm.org 11

Jiang et al.
15. Beckloff N, Laube D, Castro T, Furgang D, Park S, Perlin D, Clements D,
Tang H, Scott RW, Tew GN, Diamond G. 2007. Activity of an antimicrobial
peptide mimetic against planktonic and biofilm cultures of oral patho-
gens. Antimicrob Agents Chemother 51:4125– 4132. https://doi.org/10
.1128/AAC.00208-07.
16. McLean DT, McCrudden MT, Linden GJ, Irwin CR, Conlon JM, Lundy
FT. 2014. Antimicrobial and immunomodulatory properties of PGLa-
AM1, CPF-AM1, and magainin-AM1: potent activity against oral
pathogens. Regul Pept 194 –195:63– 68. https://doi.org/10.1016/j
.regpep.2014.11.002.
17. Altman H, Steinberg D, Porat Y, Mor A, Fridman D, Friedman M, Bachrach
G. 2006. In vitro assessment of antimicrobial peptides as potential agents
against several oral bacteria. J Antimicrob Chemother 58:198 –201.
https://doi.org/10.1093/jac/dkl181.
18. Groenink J, Walgreen-Weterings E, van ’t Hof W, Veerman EC, Nieuw
Amerongen AV. 1999. Cationic amphipathic peptides, derived from
bovine and human lactoferrins, with antimicrobial activity against oral
pathogens. FEMS Microbiol Lett 179:217–222. https://doi.org/10.1111/j
.1574-6968.1999.tb08730.x.
19. Ding Y, Wang W, Fan M, Tong Z, Kuang R, Jiang W, Ni L. 2014. Antimi-
crobial and anti-biofilm effect of Bac8c on major bacteria associated
with dental caries and Streptococcus mutans biofilms. Peptides 52:61– 67.
https://doi.org/10.1016/j.peptides.2013.11.020.
20. Wang Y, Fan Y, Zhou Z, Tu H, Ren Q, Wang X, Ding L, Zhou X, Zhang L.
2017. De novo synthetic short antimicrobial peptides against cariogenic
bacteria. Arch Oral Biol 80:41–50. https://doi.org/10.1016/j.archoralbio
.2017.03.017.
21. Tu H, Fan Y, Lv X, Han S, Zhou X, Zhang L. 2016. Activity of synthetic
antimicrobial peptide GH12 against oral streptococci. Caries Res 50:
48 – 61. https://doi.org/10.1159/000442898.
22. Wang Y, Wang X, Jiang W, Wang K, Luo J, Li W, Zhou X, Zhang L. 2018.
Antimicrobial peptide GH12 suppresses cariogenic virulence factors of
Streptococcus mutans. J Oral Microbiol 10:1442089. https://doi.org/10
.1080/20002297.2018.1442089.
23. Forssten SD, Bjorklund M, Ouwehand AC. 2010. Streptococcus mutans,
caries and simulation models. Nutrients 2:290 –298. https://doi.org/10
.3390/nu2030290.
24. Zhang K, Wang S, Zhou X, Xu HH, Weir MD, Ge Y, Li M, Wang S, Li Y, Xu
X, Zheng L, Cheng L. 2015. Effect of antibacterial dental adhesive on
multispecies biofilms formation. J Dent Res 94:622– 629. https://doi.org/
10.1177/0022034515571416.
25. Kreth J, Zhang Y, Herzberg MC. 2008. Streptococcal antagonism in oral
biofilms: Streptococcus sanguinis and Streptococcus gordonii interference
with Streptococcus mutans. J Bacteriol 190:4632– 4640. https://doi.org/
10.1128/JB.00276-08.
26. Garcia SS, Blackledge MS, Michalek S, Su L, Ptacek T, Eipers P, Morrow C,
Lefkowitz EJ, Melander C, Wu H. 2017. Targeting of Streptococcus mutans
biofilms by a novel small molecule prevents dental caries and preserves
the oral microbiome. J Dent Res 96:807– 814. https://doi.org/10.1177/
0022034517698096.
27. Ge Y, Ren B, Zhou X, Xu HHK, Wang S, Li M, Weir MD, Feng M, Cheng
L. 2017. Novel dental adhesive with biofilm-regulating and reminer-
alization capabilities. Materials (Basel) 10:E26. https://doi.org/10.339
0/ma10010026.
28. Quivey RG, Grayhack EJ, Faustoferri RC, Hubbard CJ, Baldeck JD, Wolf AS,
MacGilvray ME, Rosalen PL, Scott-Anne K, Santiago B, Gopal S, Payne J,
Marquis RE. 2015. Functional profiling in Streptococcus mutans: construc-
tion and examination of a genomic collection of gene deletion mutants.
Mol Oral Microbiol 30:474 – 495. https://doi.org/10.1111/omi.12107.
29. Burne RA, Marquis RE. 2000. Alkali production by oral bacteria and
protection against dental caries. FEMS Microbiol Lett 193:1– 6. https://
doi.org/10.1111/j.1574-6968.2000.tb09393.x.
30. Zheng LY, Itzek A, Chen ZY, Kreth J. 2011. Oxygen dependent pyruvate
oxidase expression and production in Streptococcus sanguinis. Int J Oral
Sci 3:82– 89. https://doi.org/10.4248/IJOS11030.
31. Zheng L, Itzek A, Chen Z, Kreth J. 2011. Environmental influences on
competitive hydrogen peroxide production in Streptococcus gordonii.
Appl Environ Microbiol 77:4318 – 4328. https://doi.org/10.1128/AEM
.00309-11.
32. Marsh PD. 2009. Dental plaque as a biofilm: the significance of pH in
health and caries. Compend Contin Educ Dent 30:76 –78.
33. Becker MR, Paster BJ, Leys EJ, Moeschberger ML, Kenyon SG, Galvin JL,
Boches SK, Dewhirst FE, Griffen AL. 2002. Molecular analysis of bacterial
December 2018 Volume 84 Issue 24 e01423-18
Applied and Environmental Microbiology
species associated with childhood caries. J Clin Microbiol 40:1001–1009.
https://doi.org/10.1128/JCM.40.3.1001-1009.2002.
34. He J, Hwang G, Liu Y, Gao L, Kilpatrick-Liverman L, Santarpia P, Zhou X,
Koo H. 2016. L-Arginine modifies the exopolysaccharide matrix and
thwarts Streptococcus mutans outgrowth within mixed-species oral bio-
films. J Bacteriol 198:2651–2661. https://doi.org/10.1128/JB.00021-16.
35. Li LN, Guo LH, Lux R, Eckert R, Yarbrough D, He J, Anderson M, Shi WY.
2010. Targeted antimicrobial therapy against Streptococcus mutans
establishes protective non-cariogenic oral biofilms and reduces sub-
sequent infection. Int J Oral Sci 2:66 –73. https://doi.org/10.4248/
IJOS10024.
36. Bowen WH, Koo H. 2011. Biology of Streptococcus mutans-derived
glucosyltransferases: role in extracellular matrix formation of cariogenic
biofilms. Caries Res 45:69 – 86. https://doi.org/10.1159/000324598.
37. Touger-Decker R, van Loveren C. 2003. Sugars and dental caries. Am J
Clin Nutr 78:881S– 892S. https://doi.org/10.1093/ajcn/78.4.881S.
38. Koo H, Hayacibara MF, Schobel BD, Cury JA, Rosalen PL, Park YK,
Vacca-Smith AM, Bowen WH. 2003. Inhibition of Streptococcus mutans
biofilm accumulation and polysaccharide production by apigenin
and tt-farnesol. J Antimicrob Chemother 52:782–789. https://doi.org/
10.1093/jac/dkg449.
39. Koo H, Pearson SK, Scott-Anne K, Abranches J, Cury JA, Rosalen PL, Park
YK, Marquis RE, Bowen WH. 2002. Effects of apigenin and tt-farnesol on
glucosyltransferase activity, biofilm viability and caries development in
rats. Oral Microbiol Immunol 17:337–343. https://doi.org/10.1034/j.1399
-302X.2002.170602.x.
40. Koo H, Schobel B, Scott-Anne K, Watson G, Bowen WH, Cury JA, Rosalen
PL, Park YK. 2005. Apigenin and tt-farnesol with fluoride effects on S.
mutans biofilms and dental caries. J Dent Res 84:1016 –1020. https://doi
.org/10.1177/154405910508401109.
41. Na DH, Faraj J, Capan Y, Leung KP, DeLuca PP. 2005. Chewing gum of
antimicrobial decapeptide (KSL) as a sustained antiplaque agent: pre-
formulation study. J Control Release 107:122–130. https://doi.org/10
.1016/j.jconrel.2005.05.027.
42. Ryan CS, Kleinberg I. 1995. Bacteria in human mouths involved in the
production and utilization of hydrogen-peroxide. Arch Oral Biol 40:
753–763. https://doi.org/10.1016/0003-9969(95)00029-O.
43. Carlsson J, Edlund MB. 1987. Pyruvate oxidase in Streptococcus sanguis
under various growth conditions. Oral Microbiol Immunol 2:10 –14.
https://doi.org/10.1111/j.1399-302X.1987.tb00263.x.
44. Carlsson J, Edlund MB, Lundmark SK. 1987. Characteristics of a hydrogen
peroxide-forming pyruvate oxidase from Streptococcus sanguis. Oral
Microbiol Immunol 2:15–20. https://doi.org/10.1111/j.1399-302X.1987
.tb00264.x.
45. Kreth J, Merritt J, Shi W, Qi F. 2005. Competition and coexistence
between Streptococcus mutans and Streptococcus sanguinis in the
dental biofilm. J Bacteriol 187:7193–7203. https://doi.org/10.1128/JB
.187.21.7193-7203.2005.
46. Podbielski A, Spellerberg B, Woischnik M, Pohl B, Lutticken R. 1996.
Novel series of plasmid vectors for gene inactivation and expression
analysis in group A streptococci (GAS). Gene 177:137–147. https://doi
.org/10.1016/0378-1119(96)84178-3.
47. Nobbs AH, Zhang Y, Khammanivong A, Herzberg MC. 2007. Streptococ-
cus gordonii Hsa environmentally constrains competitive binding by
Streptococcus sanguinis to saliva-coated hydroxyapatite. J Bacteriol 189:
3106 –3114. https://doi.org/10.1128/JB.01535-06.
48. Clark WB, Bammann LL, Gibbons RJ. 1978. Comparative estimates of
bacterial affinities and adsorption sites on hydroxyapatite surfaces. In-
fect Immun 19:846 – 853.
49. Guggenheim B, Guggenheim M, Gmur R, Giertsen E, Thurnheer T. 2004.
Application of the Zurich biofilm model to problems of cariology. Caries
Res 38:212–222. https://doi.org/10.1159/000077757.
50. Giertsen E, Arthur RA, Guggenheim B. 2011. Effects of xylitol on
survival of mutans streptococci in mixed-six-species in vitro biofilms
modelling supragingival plaque. Caries Res 45:31–39. https://doi.org/
10.1159/000322646.
51. Lu W, Wu F, Zhou X, Wu L, Li M, Ren B, Guo Q, Huang R, Li J, Xiao L, Li
Y. 2015. Isolation and identification of aerobic and facultative anaerobic
bacteria in the oral cavity. Nan Fang Yi Ke Da Xue Xue Bao 35:
1710 –1714. (In Chinese.)
52. Edlund A, Yang Y, Hall AP, Guo L, Lux R, He X, Nelson KE, Nealson KH,
Yooseph S, Shi W, McLean JS. 2013. An in vitro biofilm model system
maintaining a highly reproducible species and metabolic diversity ap-
aem.asm.org 12
Effects of GH12 on a Cariogenic Multispecies Biofilm
proaching that of the human oral microbiome. Microbiome 1:25. https://
doi.org/10.1186/2049-2618-1-25.
53. Joycharat N, Thammavong S, Limsuwan S, Homlaead S, Voravuthikun-
chai SP, Yingyongnarongkul BE, Dej-Adisai S, Subhadhirasakul S. 2013.
Antibacterial substances from Albizia myriophylla wood against cario-
genic Streptococcus mutans. Arch Pharm Res 36:723–730. https://doi.org/
10.1007/s12272-013-0085-7.
54. Chenicheri S, R U, Ramachandran R, Thomas V, Wood A. 2017. Insight
into oral biofilm: primary, secondary and residual caries and phyto-
challenged solutions. Open Dent J 11:312–333. https://doi.org/10.2174/
1874210601711010312.
55. Guan X, Zhou Y, Liang X, Xiao J, He L, Li J. 2012. Effects of compounds
found in Nidus Vespae on the growth and cariogenic virulence factors of
Streptococcus mutans. Microbiol Res 167:61– 68. https://doi.org/10.1016/
j.micres.2011.03.002.
56. Yoshida A, Suzuki N, Nakano Y, Kawada M, Oho T, Koga T. 2003.
Development of a 5’ nuclease-based real-time PCR assay for quantitative
detection of cariogenic dental pathogens Streptococcus mutans and
Streptococcus sobrinus. J Clin Microbiol 41:4438 – 4441. https://doi.org/
10.1128/JCM.41.9.4438-4441.2003.
57. Suzuki N, Nakano Y, Yoshida A, Yamashita Y, Kiyoura Y. 2004. Real-
time TaqMan PCR for quantifying oral bacteria during biofilm forma-
tion. J Clin Microbiol 42:3827–3830. https://doi.org/10.1128/JCM.42.8
.3827-3830.2004.
58. Costa EM, Silva S, Madureira AR, Cardelle-Cobas A, Tavaria FK, Pintado
December 2018 Volume 84 Issue 24 e01423-18
Applied and Environmental Microbiology
MM. 2014. A comprehensive study into the impact of a chitosan mouth-
wash upon oral microorganism’s biofilm formation in vitro. Carbohydr
Polym 101:1081–1086. https://doi.org/10.1016/j.carbpol.2013.09.041.
59. Stepanovic S, Vukovic D, Dakic I, Savic B, Svabic-Vlahovic M. 2000. A
modified microtiter-plate test for quantification of staphylococcal bio-
film formation. J Microbiol Methods 40:175–179. https://doi.org/10
.1016/S0167-7012(00)00122-6.
60. Cheng L, Weir MD, Xu HH, Kraigsley AM, Lin NJ, Lin-Gibson S, Zhou X.
2012. Antibacterial and physical properties of calcium-phosphate and
calcium-fluoride nanocomposites with chlorhexidine. Dent Mater 28:
573–583. https://doi.org/10.1016/j.dental.2012.01.006.
61. Li MY, Huang RJ, Zhou XD, Gregory RL. 2013. Role of sortase in Strepto-
coccus mutans under the effect of nicotine. Int J Oral Sci 5:206 –211.
https://doi.org/10.1038/ijos.2013.86.
62. Mirzajani F, Askari H, Hamzelou S, Farzaneh M, Ghassempour A. 2013.
Effect of silver nanoparticles on Oryza sativa L. and its rhizosphere
bacteria. Ecotoxicol Environ Saf 88:48 –54. https://doi.org/10.1016/j
.ecoenv.2012.10.018.
63. Ocana VS, Pesce de Ruiz Holgado AA, Nader-Macias ME. 1999. Selection
of vaginal H2O2-generating Lactobacillus species for probiotic use. Curr
Microbiol 38:279 –284. https://doi.org/10.1007/PL00006802.
64. Xu X, Zhou XD, Wu CD. 2011. The tea catechin epigallocatechin
gallate suppresses cariogenic virulence factors of Streptococcus mu-
tans. Antimicrob Agents Chemother 55:1229 –1236. https://doi.org/
10.1128/AAC.01016-10.
aem.asm.org 13