Biomedicine & Pharmacotherapy 101 (2018) 599–607

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy

journal homepage: www.elsevier.com/locate/biopha

Curcumin protects against hepatic stellate cells activation and migration by T

inhibiting the CXCL12/CXCR4 biological axis in liver fibrosis：A study in
vitro and in vivo
⁎
Lifeng Qin, Jinmei Qin, Xiumei Zhen, Qian Yang, Liyi Huang
Department of Infectious Diseases, The First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi, 530021, China

A R T I C L E I N F O A B S T R A C T

Keywords: The C-X-C motif chemokine 12/C-X-C chemokine receptor type 4 (CXCL12/ CXCR4) biological axis plays an
Curcumin important role in the pathogenesis of liver fibrosis. Curcumin is known to have an anti-fibrosis effect, but the
Liver fibrosis specific mechanism needs to be elucidated. There is currently no evidence illustrating a connection between
Hepatic stellate cell curcumin and the CXCL12/CXCR4 axis in liver fibrosis. Here, we investigated the contribution of curcumin on
CXCL12/CXCR4 axis
CXCL12/ CXCR4 biological axis in liver fibrosis. Our results showed that curcumin remarkably improved hepatic
function and liver fibrosis, and the effects are similar as silymarin. The alleviation of liver fibrosis with curcumin
treatment was associated with a reduction of CXCL12, CXCR4, α-SMA and RhoA. In addition, curcumin mark-
edly inhibited the proliferation and migration of HSC-T6 cells. This study indicates that curcumin could protect
against hepatic stellate cells activation and migration by inhibiting the CXCL12/CXCR4 biological axis in liver
fibrosis.

1. Introduction
Liver fibrosis, a repair response of the liver against various injuries,
is caused by the excess hyperplasia and deposition of extracellular
matrix (ECM) in the liver. Liver fibrosis is a necessary stage by which all
chronic liver injury develops into cirrhosis. Previous studies [1,2] have
shown that liver fibrosis is a reversible pathological process; therefore,
looking for effective drugs to block or reverse the occurrence and
progress of liver fibrosis can avoid liver cirrhosis or liver cancer, which
can significantly improve the prognosis of patients and save medical
resources. Hepatic stellate cells (HSCs) are the cellular source of most of
the ECM, and the activation and migration of HSCs is the central link of
liver fibrosis. These processes are primarily regulated by cytokines,
especially chemokines [3,4].
The C-X-C motif chemokine 12/C-X-C chemokine receptor type 4
(CXCL12/CXCR4) biological axis, mainly composed of chemokine
CXCL12 and its receptor CXCR4, has been a hot topic in recent years.
The CXCL12/CXCR4 axis is involved in a variety of pathological and
physiological processes, such as inflammation, immunity, wound
healing, tissue and organ fibrosis, etc.; in particular, it participates in
the pathogenesis of liver fibrosis.
Chinese medicine has shown unique advantages and excellent pro-
spects in the prevention and treatment of liver fibrosis, such as salvia,
colchicine, silymarin, and so on. They can reverse liver fibrosis or early
cirrhosis, and have been widely used in a clinical setting. Curcumin, a
monomer extracted from the root of turmeric plants, is a kind of natural
phenolic antioxidant. It has been found that curcumin has many
pharmacological effects such as anti-inflammatory, anti-lipid perox-
idation, anti-tumor and liver protection, etc. [5]. In recent years, cur-
cumin has attracted widespread attention with regard to anti-fibrosis,
but its pharmacological mechanism is not entirely clear. There is cur-
rently no evidence illustrating a connection between curcumin and the
CXCL12/CXCR4 axis in liver fibrosis. This study aims to verify the role
of CXCL12/CXCR4 axis in pathogenesis of liver fibrosis and investigate
the effect of curcumin on the CXCL12/CXCR4 axis in liver fibrosis in
vitro and in vivo.
2. Materials and methods
2.1. Chemical and reagents
Carbon tetrachloride (CCl4) and Olive oil were purchased from
Aladdin Biochemical Technology Co., Ltd (Shanghai, China). Curcumin
(purity: 98%) was purchased from Macklin Biochemical Technology
Co., Ltd (Shanghai, China). Silymarin was purchased from MADAUS
GmbH (Cologne, Germany). RIPA and PMSF were purchased from

⁎
Corresponding author.
E-mail address: huangliyi175@163.com (L. Huang).

https://doi.org/10.1016/j.biopha.2018.02.091
Received 22 November 2017; Received in revised form 6 February 2018; Accepted 20 February 2018
0753-3322/ © 2018 Elsevier Masson SAS. All rights reserved.
L. Qin et al.
Beyotime Biotechnology Co., Ltd (Shanghai, China). RNA Extraction Kit
and PrimeScript RT Master Mix were purchased from Takara
Biotechnology co., Ltd (TaKaRa, Shiga, Japan). All primers were syn-
thesized by Takara Biotechnology co., Ltd (TaKaRa, Shiga, Japan).
Primary antibodies against CXCR4, Tubulin and horseradish peroxidase
(HRP)-conjugated anti-rabbit secondary antibodies were purchased
from Abcam (Cambridge, MA, USA); primary antibodies against
CXCL12 were purchased from Cell Signaling Technology, Inc. (Danvers,
MA, USA). Primary antibodies against alpha-smooth muscle actin (α-
SMA), ras homolog gene family (member A) (RhoA) and biotinylated
goat anti-rabbit secondary antibodies were purchased from Boster
Biological Technology Co., Ltd (Wuhan, China). Rat Collagen I (COL I),
hyaluronic acid (HA), laminin (LN) and procollagen type III (PCIII)
ELISA Kit were purchased from Shanghai Enzyme-linked Biotechnology
Co., Ltd (Shanghai, China). Platelet-derived growth factor-BB (PDGF-
BB) and CXCL12α was purchased from R&D Systems, Inc. (Minneapolis,
MN, USA).
2.2. Animals and experiment protocols
Sixty 8-week-old, male Sprague-Dawley rats weighing 200–220 g
were purchased from the Experimental Animal Center of Guangxi
Medical University (Nanning, China) (Animal Use Certificate Number:
SYXK Gui 2014-0003), and housed in an environmentally controlled
room (23 ± 3 °C, 55 ± 10% humidity) on a 12 h light-dark cycle
(06:00–18:00, light), with standard food and water provided ad libitum.
The animal studies were carried out in strict accordance with the
guidelines for the Care and Use of Laboratory Animals of Guangxi
Medical University, Nanning, China. All efforts were made to minimize
the pain and discomfort of the animals.
After a week-long acclimation period, rats were randomly divided
into six groups according to random number table, including the fol-
lowing groups: control, model, silymarin, curcumin low dose ((CUR-L)),
curcumin middle dose ((CUR-M)) and curcumin high dose ((CUR-H))
(n = 10/group). Liver fibrosis was induced by the administration of
1.5 ml of CCl4/olive oil (2:3, v/v) ∕ kg body weight by subcutaneous
injection. Rats in all groups except the control group were injected with
an olive oil solution of CCl4 every three days for 8 weeks. Rats in the
control group were injected with the same volume of saline for 8 weeks.
The treatments were performed simultaneously with the establishment
of the fibrosis model. Rats in the silymarin group were given silymarin
orally at 50 mg/kg every day for 8 weeks. Rats in the (CUR-L), (CUR-M)
and (CUR-H) groups were given curcumin orally at 50 mg/kg, 100 mg/
kg and 200 mg/kg, respectively, every day for 8 weeks. Rats in the
model group were orally given the same volume of saline as curcumin
every day for 8 weeks.
2.3. Measurement of functional liver levels
At 48 h after the last treatment in the experiment, all rats were
weighed and killed after being anaesthetized by an intraperitoneal in-
jection of 10% chloral hydrate solution at 3 ml/kg. Immediately after
blood sample collection, alanine aminotransferase (ALT), aspartate
aminotransferase (AST), total bilirubin (TBIL) and albumin (ALB) levels
in serum were measured with an automated analyzer (LX20; Beckman
Coulter, Fullerton, United States) at the First Affiliated Hospital of
Guangxi Medical University (Nanning, China).
2.4. Histopathology and immunohistochemistry
Harvested liver tissues were fixed in 40 g/L formaldehyde, em-
bedded in paraffin and sectioned at a thickness of 4 μm. Hematoxylin
and eosin (HE) staining and Masson’s trichrome staining were used for
histological structure analysis and fibrosis area analysis, respectively.
Five random views of Masson trichrome-stained sections from each
sample (n = 10/group) were captured by a light microscope (Olympus,
600
Biomedicine & Pharmacotherapy 101 (2018) 599–607
Table 1
Primer sequences for polymerase chain reaction.
Gene name Direction Sequences(5′→3′) Product Length
(bp)
CXCL12 Forward GAGCCAACGTCAAACATCTGAA 147
Reverse ACTTGTTTAAGGCTTTGTCCAGGTA
CXCR4 Forward ATTGTCCACGCCACCAACAG 119
Reverse ACATCGGCGAAGATGATGTCAG
GAPDH Forward GGCACAGTCAAGGCTGAGAATG 143
Reverse ATGGTGGTGAAGACGCCAGTA
Tokyo, Japan). The fibrotic area was checked with the Image J 1.44s
software (National Institutes of Health, Bethesda, MD, United States)
[6]. The percentage of the fibrotic area was calculated by comparing
the collagen stained area to the total area.
The liver tissue sections were de-waxed, hydrated and subjected to
5% H2O2 for 10min. Then, slides were transferred to sodium citrate
buffer for heat-induced antigen retrieval. Sections were blocked and
incubated overnight at 4 °C with rabbit anti-α-SMA antibody (1:200) or
rabbit anti–RhoA antibody (1:150), respectively. All antibodies were
diluted in tris buffered saline 5% bovine serum albumin, while nega-
tive-control sections were incubated with Phosphate Buffered Saline
(PBS) instead. After that, the slides were incubated with biotinylated
goat anti-rabbit secondary antibodies for 15 min at 37 °C according to
the instructions. The immunoreactivities were visualized with 3,3′-
diaminobenzidine tetrahydrochloride (DAB) solution, followed by
staining the nucleus with hematoxylin, dehydrating, and mounting. The
sections were analyzed under a light microscope. The Image-Pro Plus
6.0 system (Media Cybernetics Inc., Bethesda, MD, USA) was used for
the semi-quantitative evaluation. Integrated optical density per area
(IOD/area) was applied to indicate the level of corresponding protein
expression [7].
2.5. Cell culture and cell proliferation assay
The HSC-T6 cell line sample was purchased from Procell Life
Science & Technology Co., Ltd (Wuhan, China). The cells were cultured
in Dulbecco's modified Eagle's medium (DMEM) (Gibco, Thermo Fisher
Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bo-
vine serum (FBS) (Tianjin Haoyang Biological Manufacture Co., Ltd.,
Tianjin, China), and incubated at 37 °C in 5% CO2 air. Following 2
weeks of culture on plastic tissue-culture dishes, the cells were plated at
a density of 2 × 104 cells/well in 96-well plates. The HSC-T6 cells were
activated with PDGF-BB. The concentration of PDGF-BB used for
treatment was 10 ng/ml for 24 h at 37 °C.
Cell proliferation was evaluated using a 3-(4,5-dimethyl-2-thia-
zolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) assay. After HSC-
T6 cells were digested by trypsin (0.25%), single suspended state cells
were cultured in DMEM medium supplemented with 10% FBS and then
seeded in a 96-well plate with 180 μL (5 × 104 cells/mL) per well. After
24–96 h incubation, cells were exposed to curcumin dissolved in 0.1%
dimethyl sulfoxide (DMSO) at different concentrations (0, 10, 20, 40,
80, 160 μM) for 24 h. Untreated cells were used as controls. MTT so-
lution (20 μL, 5 mg/mL, diluted in PBS) was added to each well and the
plate was incubated at 37 °C in a 5% CO2 atmosphere for 4 h. Then, the
supernatants were removed and 150 μL/well DMSO was added to dis-
solve formazan crystals. After 5 min of shaking dissolution, the absor-
bance at 490 nm was read using ELx800 Microplate Reader (BioTek
Instruments, Inc., Winooski, VT, USA).
To carry out follow-up experiments, HSC-T6 cells were randomly
divided into four groups: the control group, the PDGF-BB group, the
PDGF-BB+curcumin (20 μM) group and the PDGF-BB+curcumin
(40 μM) group. The concentration and use of PDGF-BB are the same as
above. All cells except the control group were activated with PDGF-BB.
Cells in the PDGF − BB + curcumin (20 μM) group and the
L. Qin et al. Biomedicine & Pharmacotherapy 101 (2018) 599–607

Fig. 1. Graphical abstract.

Table 2
Comparison of functional liver levels in serum (mean ± SD).

Group n ALT AST TBIL ALB

* * *
Model 10 156.31 ± 24.57 287.12 ± 33.89 34.78 ± 13.69 8.45 ± 2.64*
Silymarin 10 78.22 ± 8.45** 185.10 ± 26.78** 12.91 ± 3.56** 15.78 ± 1.67**
CUR-L 10 124.36 ± 17.54 258.61 ± 30.18 26.47 ± 10.37 10.30 ± 2.42
CUR-M 10 103.54 ± 12.48 219.18 ± 27.05 18.75 ± 7.25 13.47 ± 2.03
CUR-H 10 76.72 ± 8.36**,*** 188.34 ± 25.14**,*** 13.03 ± 3.74**,*** 15.89 ± 1.75**,***
Control 10 62.05 ± 12.23 152.33 ± 22.56 9.64 ± 2.03 16.63 ± 1.18

Note: ALT: Alanine aminotransferase; AST: Aspartate aminotransferase; TBIL: Total bilirubin; ALB: Albumin.
* P < 0.05 vs. control group.
** P < 0.05 vs. model group.
*** P > 0.05 vs. Silymarin group.

PDGF − BB + curcumin (40 μM) group were exposed to curcumin dis-
solved in 0.1% DMSO at 20 μM and 40 μM for 24 h, respectively.
2.6. Reverse Transcription and Real time Quantitative Polymerase Chain
Reaction (RT-qPCR)
RT-qPCR was used to assess the mRNA expression of molecules in-
volved in the CXCL12/CXCR4 axis (CXCL12 and CXCR4). Total RNA
was extracted from the liver tissues of each rat using the RNA
Extraction Kit. First-strand cDNA synthesis was performed with 1 μg of
total RNA. Moreover, cDNA samples were thereafter amplified in the
ABI Prism 7500 Sequence Detection system (Applied Biosystems,
Massachusetts, United States) for 40 cycles (95 °C for 5 s, 60 °C for 30 s)
with specific oligonucleotide primers (Takara Bio Inc., Shiga, Japan).
Each sample was analyzed in triplicate, with glyceraldehyde 3-phos-
phate dehydrogenase (GAPDH) used for normalization. The relative
quantification of target genes was determined using the 2−ΔΔCT
method. Primers used in RT-qPCR analyzes are listed in Table 1.
2.7. Enzyme linked immunosorbent assay (ELISA)
The levels of HA, LN, and PCIII in serum or COL I in cell culture
supernatant were detected by ELISA according to the manufacturer’s
instructions. Each sample was analyzed in triplicate.
2.8. Western blot analysis
Total protein from liver tissue samples and cells was extracted by
the standard procedure [8]. The BCA assay was used to determine the
protein concentration. Equal amounts of protein were resolved by 15%
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
and transferred to a polyvinylidene fluoride (PVDF) membrane. The
membrane was blocked with 5% nonfat milk in TBS-Tween 20 (0.1%
TBST) at room temperature for 1 h. After a brief rinse, the membrane
was incubated overnight at 4 °C in TBST with corresponding primary
antibodies including rabbit mAb of CXCL12 (1:1000), CXCR4 (1:1000),
α-SMA (1:1500), RhoA (1:1500) and Tubulin (1:2000). After that, the
membrane was incubated with horseradish peroxidase (HRP)-con-
jugated anti-rabbit secondary antibodies (1:10000) for 1 h at room
temperature. Then the membrane was washed in TBST and protein was
detected by enhanced chemical luminescence (ECL). Each sample was
analyzed in triplicate.
2.9. Transwell assay
The migration ability of the HSC-T6 cells was evaluated with 24-

601
L. Qin et al. Biomedicine & Pharmacotherapy 101 (2018) 599–607

Fig. 2. Histopathological change of liver tissue in different groups. (A) Representative sections stained with HE are shown for each group (original magnification, 200×). (B)
Representative sections stained with Masson’s trichrome are shown for each group (original magnification, 200×). (C) Quantitative analyzes of liver fibrosis were performed using
Masson stained sections. *p < 0.05, **p < 0.01 compared with control group；#p < 0.05, ##p < 0.01 compared with model group；+p < 0.05, ++p < 0.01 compared with sily-
marin group.

well Transwell chambers (Corning, Tewksbury, MA, USA). Cells were
randomly divided into four groups: the control group, the CXCL12
group, the CXCL12 + curcumin (20 μM) group and the
CXCL12 + curcumin (40 μM) group. Cells in the CXCL12 + curcumin
(20 μM) group and the CXCL12 + curcumin (40 μM) group were treated
with curcumin 20 μM and 40 μM respectively, and subsequently culti-
vated for 24 h. Each group cells were harvested, and 1 × 104 cells in
100 μL of non-serum medium was placed in the upper chamber of an
insert (pore size, 8 μm). The lower chamber was filled with 600 μL
DMEM medium with 4% FBS and 100 ng/mL CXCL12α, and the lower
chamber of control group was filled with 600 μL DMEM medium with
4% FBS. After 24 h of incubation, cells were removed from the upper
chamber of the filter, using a cotton swab. Cells on the underside were
washed with PBS and fixed with 5% glutaraldehyde 30 min, stained
with 0.5% crystal violet 20 min. The films were cut along the edge with
blade and sealed with a neutral gum, and counted in five randomly

602
L. Qin et al. Biomedicine & Pharmacotherapy 101 (2018) 599–607

Table 3
Comparison of liver fibrosis parameters in serum (mean ± SD).

Group n HA LN PCⅢ

Model 10 186.24 ± 26.42* 237.64 ± 35.12* 215.06 ± 30.18*

Silymarin 10 95.87 ± 12.97** 145.81 ± 21.12** 138.22 ± 17.62**
CUR-L 10 157.35 ± 21.89 198.63 ± 31.23 184.34 ± 25.73
CUR-M 10 112.69 ± 17.24 174.30 ± 26.47 151.03 ± 21.39
CUR-H 10 97.34 ± 13.23**,*** 143.56 ± 22.75**,*** 136.46 ± 18.55**,***
Control 10 45.04 ± 7.35 69.79 ± 13.48 77.53 ± 15.36

Note: HA: Hyaluronic acid; LN: Laminin; PCⅢ: Procollagen type Ⅲ.

* P < 0.05 vs. control group.
** P < 0.05 vs. model group.
*** P > 0.05 vs. Silymarin group.

Fig. 3. Effect of curcumin on the mRNA and protein expression of molecules of the CXCL12/CXCR4 axis. (A–B) The bar graph shows mean relative mRNA expression levels of CXCL12 and
CXCR4 in liver tissues. Each sample was repeated three times from each cluster. Data are normalized to GAPDH mRNA expression levels. (C) Representative Western blot analysis of
CXCL12 and CXCR4 protein expression levels in each group. ((DeE)) The bar graph represents mean relative protein expression levels of CXCL12 and CXCR4. Data are normalized to
tubulin protein expression levels. *p < 0.05, **p < 0.01 compared with control group；#p < 0.05, ##p < 0.01 compared with model group；+p < 0.05, ++p < 0.01 compared with
silymarin group.

selected fields under a phase contrast microscope. Assays were per- followed by the Student-Newman-Keuls post hoc test. P-values less than
formed in triplicate. 0.05 were considered statistically significant. All of the statistical ana-
lyses were performed with the statistical software package SPSS version
2.10. Statistical analysis 20.0 (SPSS Inc., Chicago, United States).

All data are expressed as the mean ± SD. Comparisons between

groups were performed using one-way analysis of variance (ANOVA)

603
L. Qin et al. Biomedicine & Pharmacotherapy 101 (2018) 599–607

Fig. 4. Effects of curcumin on α-SMA and RhoA expression and hepatic distribution. (A) Immunohistochemical staining of α-SMA (original magnification, 200×). (B)
Immunohistochemical staining of RhoA (original magnification, 200×). (C–D) Quantification of α-SMA and RhoA staining by digital image analysis. The ocular fields per specimen were
assessed as mean IOD, and data are presented as mean ± SD (n = 10).*p < 0.05, **p < 0.01 compared with control group；#p < 0.05, ##p < 0.01 compared with model
group；+p < 0.05, ++p < 0.01 compared with silymarin group.

3. Results model group.

Taken together, it was clearly indicated that curcumin obviously
3.1. Curcumin treatment reduces CCl4-induced liver injury in rats improved liver injury in liver fibrosis. Moreover, the effect was similar
as silymarin.
During feeding, the rats in the control group were lively and sen-
sitive to external stimuli, with soft and shiny hair, a strong appetite and
3.2. Curcumin treatment attenuates CCl4-induced liver fibrosis
a good mental state, while the rats in the model group were feeble and
inactive, with bleak hair, poor appetite and slow response to external
Compared with the control group, the levels of HA, LN and PCIII in
stimuli. In eight weeks, the body weight of rats in the control group
the serum of the model group were significantly increased (P < 0.05).
showed a remarkable upward trend, while the body weight of rats in
The levels of HA, LN and PCIII in the curcumin and silymarin treatment
the model group increased slowly. Moreover, the general condition of
groups were obviously lower than those in the model group
rats in the curcumin treatment groups and the silymarin group were
(P < 0.05), in a dose-dependent manner. When comparing the (CUR-
between the control and model groups (Fig. 1).
H) group with the silymarin group, there was no significant difference
Compared with the control group, the levels of ALT, AST and TBIL
between the two groups (P > 0.05) (Table 3).
in the serum of the model group were significantly increased
After livers were harvested, compared with the macropathology of
(P < 0.05) and ALB was significantly decreased (P < 0.05). The levels
the livers in the control group, the color of livers in the model group
of ALT, AST, TBIL and ALB in the curcumin treatment groups and si-
were darker, the surfaces were less smooth, the edge of the livers be-
lymarin group were obviously improved compared with the model
came blunt, and the texture was more real with a nodular sense. There
group (P < 0.05), and the changes showed a dose-dependent manner
were no significant changes in the volume of the liver. The macro-
in the curcumin treatment group. Compared (CUR-H) group with the
pathology in the curcumin treatment groups and silymarin group was
silymarin group, there was no significant difference between the two
between that of the control and model groups.
groups (P > 0.05) (Table 2).
Histological examination using Masson’s staining was performed to
Histological examination using hematoxylin-eosin (HE) were per-
show the extent of liver fibrosis. The control group showed the normal
formed to show the extent of liver damage (Fig. 2A). Liver tissue
architecture while the model group presented extensive liver bridging
samples from the control group showed normal lobular architecture
fibrosis and substantial collagen deposition. However, bridging fibrosis
with radiating hepatic cords pointing to the central veins, whereas the
and collagen were distinctly decreased by the curcumin or silymarin
model group exhibited fatty degeneration, ballooning changes of he-
treatment compared with the model group (Fig. 2B and C).
patocytes and necrosis. In contrast, the curcumin and silymarin treat-
The above results show that curcumin significantly improved liver
ment remarkably ameliorated the adipose degeneration of hepatocytes
fibrosis in a dose-dependent manner. Moreover, the effect was similar
and reduced the immigration of inflammatory cells compared with the
as silymarin.

604
L. Qin et al.
Fig. 5. Effect of curcumin on expression levels of CXCL12/CXCR4 axis and relevant
molecules in HSC-T6 cells. (A) Representative Western blot analysis of CXCR4, α-SMA
and RhoA protein expression levels in curcumin treated HSC-T6 cells. (B) The bar graph
represents mean relative protein expression levels of CXCR4, α-SMA and RhoA. Data are
normalized to tubulin protein expression levels. (C) Elisa analysis of COL I protein ex-
pression levels in curcumin treated HSC-T6 cells.*p < 0.05, **p < 0.01 compared with
PDGF-BB only group. ##P < 0.01 compared with HSC-T6 treated with solvent but no
PDGF-BB and curcumin.
Fig. 6. Effect of curcumin on proliferation rate of HSC-T6 cells. *p < 0.05, **
p < 0.01
compared with HSC-T6 treated with solvent but no curcumin.
605
Biomedicine & Pharmacotherapy 101 (2018) 599–607
3.3. Curcumin treatment inhibits the CXCL12/CXCR4 axis in vivo
As shown in Fig. 3, compared with the control group, the mRNA and
protein level of CXCL12 and CXCR4 were significantly increased in the
model group (P < 0.01). In the curcumin treatment groups, the mRNA
and protein expression levels of CXCL12 and CXCR4 were significantly
decreased in a dose-dependent manner. However, in the silymarin
group, there were no obvious changes in the mRNA and protein ex-
pression levels of CXCL12 and CXCR4 compared with the model group
(P > 0.05). These data indicate that CXCL12/CXCR4 axis is involved in
the pathogenesis of liver fibrosis, and curcumin effectively inhibit the
CXCL12/CXCR4 axis to improve liver fibrosis. However, silymarin has
no obvious effects on the CXCL12/CXCR4 axis.
3.4. Curcumin treatment suppresses the expression levels of α-SMA and
RhoA in vivo
α-SMA (an indicator of the activation of HSCs) and RhoA (a
downstream target of CXCL12/CXCR4 axis, which may be closely cor-
related with cells migration) were evaluated by immunohistochemical
staining. Compared with the control group, the model group sig-
nificantly increased α-SMA-positive and RhoA-positive cells in fibrotic
areas and vessel walls in liver sections, and the curcumin treatment
groups showed less α-SMA-positive and RhoA -positive cells compared
to the model group (Fig. 4A and B). Moreover, the expression level is
inversely proportional to the dosage of curcumin. However, there was
little change for RhoA-positive cells in the silymarin group. Semi-
quantitative analysis by Image-Pro Plus 6.0 confirmed the findings by
immunohistochemistry (Fig. 4C and D). The data suggest that curcumin
inhibit activation and migration of HSCs.
3.5. Curcumin treatment inhibits the expression levels of α-SMA, RhoA and
COL I and CXCL12/ CXCR4 axis in vitro
As shown in Fig. 5, treatment of HSC-T6 cells with 10 ng/ml PDGF-
BB for 24 h significantly increased CXCR4, α-SMA, RhoA and COL I
expressions (P < 0.01). Western blot analysis showed that curcumin
reduced PDGF-BB-stimulated CXCR4, α-SMA and RhoA production in a
concentration-dependent manner (Fig. 5A and B). ELISA showed that
PDGF-BB-induced COL I was also suppressed by curcumin in a con-
centration-dependent manner (Fig. 5C). These results suggest that
curcumin attenuates liver fibrosis by inhibiting activation of HSCs and
CXCL12/ CXCR4/ RhoA axis.
3.6. Curcumin treatment suppresses the proliferation of HSC-T6 cells
As shown in Fig. 6, curcumin reduced proliferation of HSC-T6 cells
in a concentration-dependent manner (0–160 μM) and significant sup-
pression was observed at 20–160 μM (P < 0.05). The data confirmed
that curcumin effectively suppressed the proliferation of HSCs.
3.7. Curcumin treatment inhibits the migration of HSC-T6 cells
CXCL12/CXCR4/ RhoA axis may be closely correlated with cells
migration, so we investigated the effect of curcumin on migration of
HSC-T6 cells. Transwell assay indicated that CXCL12 prominently in-
creased migration of HSC-T6 cells in CXCL12 group compared with the
control group, moreover, curcumin notably inhibited HSC-T6 cells
migration in a concentration-dependent manner (Fig. 7). The results
clearly indicate that curcumin significantly inhibited HSC-T6 cells mi-
gration.
4. Discussion
Curcumin, a kind of plant polyphenol extracted from the rhizome of
turmeric, is an active ingredient in curry. Its molecular formula is
L. Qin et al.
Fig. 7. The effect of curcumin on the HSC-T6 cells migration ability. (Left) Representative pictures of transwell assay in each group. (Right) The bar graph shows the result of analysis of
five randomly selected fields. *p < 0.05, **p < 0.01 compared with CXCL12 only group. ##P < 0.01 compared with HSC-T6 treated with solvent but no CXCL12 and curcumin.
C21H20O6, with a molecular weight of 368.39. In traditional Chinese
medicine, turmeric is mainly used for the treatment of abdominal pain,
jaundice and other related diseases. Pharmacological studies [5] on
curcumin indicate that curcumin has a wide range of pharmacological
effects, such as anti-inflammatory, anti-oxidation, lipid-lowering, anti-
tumor and other effects. Researches show that [9,10] curcumin has an
anti-tissue/organ fibrosis effect, mainly in anti-liver fibrosis, pulmonary
fibrosis, renal fibrosis, pancreatic fibrosis, cystic fibrosis and so on.
However, the pharmacological mechanism of curcumin anti-liver fi-
brosis remains to be further elucidated. Our study showed that cur-
cumin obviously improved liver injury and fibrosis. These findings are
consistent with the results of other studies [11,12]. Moreover, inter-
vention effect in the (CUR-H) group was similar to that for the silymarin
group. Silymarin is the most commonly used drug to treat liver fibrosis
or injury owing to remarkable effect, so curcumin have an excellent
clinical application prospect.
CXCL12, also known as stromal cell derived factor (SDF-1) or pre-B-
cell-growth-stimulating factor (PBSF), is a small molecule cytokine,
belonging to the CXC chemokine family. The human CXCL12 gene is
located on the long arm of chromosome 10 and the length of the
CXCL12 cDNA is 1776 bp. The human and rats CXCL12 genes show
about 90% homology, with similar biological functions; therefore, rats
and HSC-T6 cells show good representation as study objects. CXCL12
has different isomers: CXCL12a and CXCL12β, which are caused by
hydrolyzing different parts of protein after translation from mRNA.
CXCL12 can be expressed in many tissues, including the brain, thymus,
liver, heart, lung, kidney, bone marrow, spleen and so on [13]. CXCR4
is the main receptor of CXCL12, which is highly conserved in evolution
and is a G protein-coupled receptor consisting of 352 amino acids. It has
a standard seven-membrane structure, the extracellular domain (N-
terminal region) combines with a ligand, the intracellular domain
coupling with G proteins and the C-terminal containing serine/threo-
nine. When involved in signal transduction, it can be phosphorylated.
CXCR4 is not only present on the cell membrane but also in the cyto-
plasm and nucleus. CXCR4 is expressed in most tissues and organs of
the body, which is widely involved in a variety of pathophysiological
processes [14]. The chemokine CXCL12 interacts with its receptor
CXCR4 to form a coupled molecular pair, also known as chemotaxis
axis, which is a very important signal transduction pathway in the
body. A variety of growth factors and cytokines act via this signal
pathway to regulate the expression of target genes, generally involved
in cell activation, proliferation, differentiation, migration, immune
modulation and other processes. CXCR4 combining with CXCL12 can
cause the calcium signal to rise instantaneously to activate downstream
signaling pathways, including RhoA/ROCK, ERK1/2, MAPK, JNK and
AKT and other signal pathways [15–18].
Under normal circumstances, HSCs are in resting state. When liver is
606
Biomedicine & Pharmacotherapy 101 (2018) 599–607
subject to biological, physical and chemical irritation or other injuries,
HSCs are activated into myofibroblast-like cells, showing proliferation,
migration, and secretion of ECM. Therefore, activation and migration of
HSCs are critical in pathogenesis of liver fibrosis. A large number of
studies [19–22] confirmed that CXCL12/CXCR4 axis is activated in
various of organs fibrosis, especially liver fibrosis. Sawitza [23] et al.
have shown that CXCL12/CXCR4 promotes HSCs migration and che-
motaxis in liver fibrosis. Hong [24] et al. confirmed that activated HSCs
express functional CXCR4, and that receptor engagement by its ligand,
CXCL12, leads to a pro-fibrogenic phenotype characterized by increased
proliferative capacity and COL I and α-SMA production. These reports
suggest that CXCL12/CXCR4 axis is closely related to the pathogenesis
of liver fibrosis. We showed that CXCL12/CXCR4 axis is involved in
liver fibrosis, which is consistent with above reports; and curcumin
could effectively inhibit the CXCL12/CXCR4 axis to improve liver fi-
brosis, while silymarin has no obvious effects on the CXCL12/CXCR4
axis. CXCL12/CXCR4 axis may be a target of curcumin, but not the
target of silymarin. However, no previous studies reported the effect of
silymarin on the CXCL12/CXCR4 axis in liver fibrosis, therefore, more
studies are needed to confirm our results.
It is generally believed that the activation of HSCs is the central link
of liver fibrosis, and α-SMA is a molecular marker of HSCs activation.
Furthermore, increased proliferation is the main manifestation of HSCs
activation [1,25]. In this study, we found that curcumin could effec-
tively inhibit activation of HSCs to play the role of anti-liver fibrosis.
This result is consistent with the results of Zhao et al. [11,26].
Under induction and chemotaxis of inflammatory mediators re-
leased from injured hepatocytes, HSCs migrate to areas of inflammatory
activation and then secreting ECM, which is an essential step in the
occurrence and progress of liver fibrosis. Studies [22,23] showed that,
CXCL12/CXCR4 biological axis is related to directed migration of HSCs.
In the present study, we found that curcumin could inhibit HSC-T6 cells
migration, which is consistent with report of Huang et al.[27].
RhoA, a downstream molecule of the CXCL12/CXCR4 biological
axis, is mainly involved in the RhoA/ROCK pathway, which is closely
related to the activation, migration and adhesion of HSCs [28–30]. On
the basis of above results, we concluded that curcumin may inhibit
CXCL12/CXCR4 biological axis so that downstream RhoA/ROCK
pathway is downregulated, and thus activation and migration ability of
HSCs is suppressed. Therefore, curcumin could attenuate liver fibrosis
by inhibiting CXCL12/CXCR4/RhoA axis.
In this study, we used 50, 100 and 200 mg / kg curcumin as low,
medium and high doses to intervene rat model of liver fibrosis, and
used 20 and 40 μM curcumin as low and high concentration to inter-
vene HSC-T6 cell line, which are the most commonly used doses and
concentrations of curcumin in the animal and cell experiments [5].
Curcumin 200 mg/kg/d for rats, converted to human use amount, is
L. Qin et al.
equivalent to 31.75 mg/kg/d, which is roughly equal to the re-
commended dose of health products of curcumin on the market. In
previous studies, curcumin was administered orally by gavage at
1200 mg/kg/d in animal experiment [11], and curcumin was taken
orally at 8000 mg/kg/d for three months in patients with high-risk or
pre-malignant lesions [31], which exerted good effects with no ap-
parent adverse reactions, this owing to safe range of curcumin is large.
Curcumin has great clinical application prospect, whereas application
was limited by poor solubility and low bioavailability, therefore, im-
proving bioavailability of curcumin will be an important research field
in the future.
5. Conclusion
In conclusion, the CXCL12/CXCR4 biological axis plays an im-
portant role in the pathogenesis of liver fibrosis, which may be a target
of curcumin in the treatment of liver fibrosis. In particular, curcumin
could exert an anti-liver fibrotic effect by protecting against HSCs ac-
tivation and migration via the CXCL12/CXCR4 biological axis.
Conflicts of interest
The authors declare no conflict of interest.
Acknowledgments
This work was funded by the National Natural Science Foundation
of China (No. 81472002) and Natural Science Foundation of Guangxi
(No. 2016GXNSFAA380312).
References
[1] V. Hernandez-Gea, S.L. Friedman, Pathogenesis of liver fibrosis, Annu. Rev. Pathol.
6 (2011) 425–456.
[2] J. Zhao, Z. Zhang, Y. Luan, Z. Zou, Y. Sun, Y. Li, L. Jin, C. Zhou, J. Fu, B. Gao, Y. Fu,
F.S. Wang, Pathological functions of interleukin-22 in chronic liver inflammation
and fibrosis with hepatitis B virus infection by promoting T helper 17 cell recruit-
ment, Hepatology 59 (4) (2014) 1331–1342.
[3] K. Iwaisako, D.A. Brenner, T. Kisseleva, What’s new in liver fibrosis? The origin of
myofibroblasts in liver fibrosis, J. Gastroenterol. Hepatol. 27 (Suppl. 2) (2012)
65–68.
[4] U.E. Lee, S.L. Friedman, Mechanisms of hepatic fibrogenesis, Best Pract. Res. Clin.
Gastroenterol. 25 (2) (2011) 195–206.
[5] A. Goel, A.B. Kunnumakkara, B.B. Aggarwal, Curcumin as "Curecumin": from
kitchen to clinic, Biochem. Pharmacol. 75 (4) (2008) 787–809.
[6] M. Chevallier, S. Guerret, P. Chossegros, F. Gerard, J.A. Grimaud, A histological
semiquantitative scoring system for evaluation of hepatic fibrosis in needle liver
biopsy specimens: comparison with morphometric studies, Hepatology 20 (2)
(1994) 349–355.
[7] C.T. Tu, J.S. Guo, M. Wang, J.Y. Wang, Antifibrotic activity of rofecoxib in vivo is
associated with reduced portal hypertension in rats with carbon tetrachloride-in-
duced liver injury, J. Gastroenterol. Hepatol. 22 (6) (2007) 877–884.
[8] B. Alvaro Mercadal, R. Imbert, I. Demeestere, C. Gervy, A. De Leener, Y. Englert,
S. Costagliola, A. Delbaere, AMH mutations with reduced in vitro bioactivity are
related to premature ovarian insufficiency, Hum. Reprod. 30 (5) (2015)
1196–1202.
[9] A. Goel, S. Jhurani, B.B. Aggarwal, Multi-targeted therapy by curcumin: how spicy
is it? Mol. Nutr. Food Res. 52 (9) (2008) 1010–1030.
607
Biomedicine & Pharmacotherapy 101 (2018) 599–607
[10] A.S. Strimpakos, R.A. Sharma, Curcumin: preventive and therapeutic properties in
laboratory studies and clinical trials, Antioxid. Redox Signal. 10 (3) (2008)
511–545.
[11] Y. Zhao, X. Ma, J. Wang, X. He, Y. Hu, P. Zhang, R. Wang, R. Li, M. Gong, S. Luo,
X. Xiao, Curcumin protects against CCl4-induced liver fibrosis in rats by inhibiting
HIF-1alpha through an ERK-dependent pathway, Molecules 19 (11) (2014)
18767–18780.
[12] Q. Yao, Y. Lin, X. Li, X. Shen, J. Wang, C. Tu, Curcumin ameliorates intrahepatic
angiogenesis and capillarization of the sinusoids in carbon tetrachloride-induced rat
liver fibrosis, Toxicol. Lett. 222 (1) (2013) 72–82.
[13] E.W. Smith, A.M. Nevins, Q. Zhen, L. Yan, A.E. Getschman, S.L. Vankayala,
M.T. Kemp, F.C. Peterson, R. Li, B.F. Volkman, Structure-based identification of
novel ligands targeting multiple sites within a chemokine-G protein–coupled re-
ceptor interface, J. Med. Chem. 59 (9) (2016).
[14] X. Sun, G. Cheng, M. Hao, J. Zheng, X. Zhou, J. Zhang, R.S. Taichman, K.J. Pienta,
J. Wang, CXCL12 / CXCR4 / CXCR7 chemokine axis and cancer progression, Cancer
Metastasis Rev. 29 (4) (2010) 709–722.
[15] R.L. Lee, J. Westendorf, M.R. Gold, Differential role of reactive oxygen species in
the activation of mitogen-activated protein kinases and Akt by key receptors on B-
lymphocytes: CD40, the B cell antigen receptor, and CXCR4, J. Cell Commun.
Signal. 1 (1) (2007) 33–43.
[16] D.Y. Lu, C.H. Tang, W.L. Yeh, K.L. Wong, C.P. Lin, Y.H. Chen, C.H. Lai, Y.F. Chen,
Y.M. Leung, W.M. Fu, SDF-1alpha up-regulates interleukin-6 through CXCR4, PI3K/
Akt, ERK, and NF-kappaB-dependent pathway in microglia, Eur. J. Pharmacol. 613
(1–3) (2009) 146–154.
[17] K. Princen, S. Hatse, K. Vermeire, E. De Clercq, D. Schols, Evaluation of SDF-1/
CXCR4-induced Ca2+ signaling by fluorometric imaging plate reader (FLIPR) and
flow cytometry, Cytometry A 51 (1) (2003) 35–45.
[18] J. Roland, B.J. Murphy, B. Ahr, V. Robert-Hebmann, V. Delauzun, K.E. Nye,
C. Devaux, M. Biard-Piechaczyk, Role of the intracellular domains of CXCR4 in SDF-
1-mediated signaling, Blood 101 (2) (2003) 399–406.
[19] R.J. Phillips, M.D. Burdick, K. Hong, M.A. Lutz, L.A. Murray, Y.Y. Xue,
J.A. Belperio, M.P. Keane, R.M. Strieter, Circulating fibrocytes traffic to the lungs in
response to CXCL12 and mediate fibrosis, J. Clin. Invest. 114 (3) (2004) 438–446.
[20] H.K. Shu, Y. Yoon, S. Hong, K. Xu, H. Gao, C. Hao, E. Torres-Gonzalez, C. Nayra,
M. Rojas, H. Shim, Inhibition of the CXCL12/CXCR4-axis as preventive therapy for
radiation-induced pulmonary fibrosis, PLoS One 8 (11) (2013) e79768.
[21] F. Tögel, J. Isaac, H.U. Zhuma, K. Weiss, C. Westenfelder, Renal SDF-1 signals
mobilization and homing of CXCR4-positive cells to the kidney after ischemic in-
jury, Kidney Int. 67 (5) (2005) 1772–1784.
[22] A. Liepelt, F. Tacke, Stromal cell-derived factor-1 (SDF-1) as a target in liver dis-
eases, Am. J. Physiol. Gastrointest. Liver Physiol. 311 (2) (2016) G203–G209.
[23] I. Sawitza, C. Kordes, S. Reister, D. Haussinger, The niche of stellate cells within rat
liver, Hepatology 50 (5) (2009) 1617–1624.
[24] F. Hong, A. Tuyama, T.F. Lee, J. Loke, R. Agarwal, X. Cheng, A. Garg, M.I. Fiel,
M. Schwartz, J. Walewski, A. Branch, A.D. Schecter, M.B. Bansal, Hepatic stellate
cells express functional CXCR4: role in stromal cell-derived factor-1alpha-mediated
stellate cell activation, Hepatology 49 (6) (2009) 2055–2067.
[25] G.O. Elpek, Cellular and molecular mechanisms in the pathogenesis of liver fibrosis:
an update, World J. Gastroenterol. 20 (23) (2014) 7260–7276.
[26] C. Lu, W. Xu, S. Zheng, Nrf2 activation is required for curcumin to induce lipocyte
phenotype in hepatic stellate cells, Biomed. Pharmacother. 95 (2017) 1–10.
[27] J.X. Huang, B.H. Zhu, D. He, L. Huang, K. Hu, B. Huang, Curcumine inhibits mi-
gration and invasion of hepatic stellate cells by reducing MMP-2 expression and
activity, Zhonghua gan zang bing za zhi 17 (11) (2009) 835–838.
[28] L. Li, J.Y. Wang, C.Q. Yang, W. Jiang, Effect of RhoA on transforming growth factor
beta1-induced rat hepatic stellate cell migration, Liver Int. 32 (7) (2012)
1093–1102.
[29] M.M. Wyse, S. Goicoechea, R. Garcia-Mata, A.L. Nestor-Kalinoski, K.M. Eisenmann,
mDia2 and CXCL12/CXCR4 chemokine signaling intersect to drive tumor cell
amoeboid morphological transitions, Biochem. Biophys. Res. Commun. 484 (2)
(2017) 255–261.
[30] C.R. Gandhi, Hepatic stellate cell activation and pro-fibrogenic signals, J. Hepatol.
67 (5) (2017) 1104–1105.
[31] A. Cheng, C. Hsu, J. Lin, M. Hsu, Y. Ho, T. Shen, J. Ko, J. Lin, B. Lin, W. MingShiang,
Phase I clinical trial of curcumin, a chemopreventive agent, in patients with high-
risk or pre-malignant lesions, Anticancer Res. 21 (4B) (2001) 2895–2900.