Received: 10 October 2019 | Revised: 25 November 2019 | Accepted: 5 December 2019

DOI: 10.1111/jfbc.13135

FULL ARTICLE

A novel oligosaccharide isolated from Hericium erinaceus

and its protection against LPS-induced Caco-2 cells via the
TLR4/NF-κB pathway

Dandan Wang1,2 | Duoduo Xu2,3 | Yanqiu Zhang1,2 | Daqing Zhao2,3 |

Mingxing Wang1,2

1
Research Center of Traditional Chinese
medicine, Affiliated Hospital, Changchun Abstract
University of Chinese Medicine, Changchun, A novel oligosaccharide showed that protection against LPS-induced Caco-2 cells
China
2 was purified from the mycelium of Hericium erinaceus (HE). WEP-1 is mainly com-
Jilin Provincial Key Laboratory of
BioMacromolecules of Chinese Medicine, posed of neutral monosaccharides with molecular weight of 4,010 Da and of man-
Jilin Ginseng Academy, Changchun
nose, glucose, and galactose in a molar ratio of 1.2:16.9:1. The structure of WEP-1
University of Chinese Medicine, Changchun,
China includes α-D-Glc (1 → 3) and β-D-Gal (1 → 3) as the backbone with β-D-Glc (1 → 3) as
3
Jilin Ginseng Academy, Changchun branches attached to the C-4 position and β-D-Man as a terminal residue. The oligo-
University of Chinese Medicine, Changchun,
China
saccharide reduced acetic acid-induced colonic mucosa injury in rats. It also showed
significant protection against LPS-induced Caco-2 cells via the TLR4/NF-κB pathway.
Correspondence
Mingxing Wang, Research Center of Practical applications
Traditional Chinese Medicine, Affiliated
In the study, the oligosaccharide from HE has the potential to be developed into
Hospital, Changchun University of Chinese
Medicine, Changchun 130021, China. functional foods or medicines for the treatment of intestinal diseases. The protection
Email: cc_wmx@163.com
against LPS-induced Caco-2 cells via the TLR4/NF-κB pathway may be a key target
Funding information for the pharmacological activity of HE.
National Natural Science Foundation of
China, Grant/Award Number: 81603276
KEYWORDS

Caco-2, Hericium erinaceus, NF-κB, oligosaccharide

1 | I NTRO D U C TI O N with rarely adverse reactions on digestive system diseases, such as

Hericium erinaceus (HE), a scarce fungus with various pharma-
cological functions, is a well-known as a valuable medicinal food
in Asia countries (Choi et al., 2011). Accumulating evidence have
shown that water-soluble oligosaccharides (Guihong et al., 2018),
polysaccharides (Xiao-yin, Duo-Duo, Jun-Yi, Shao-Ping, & Ming-
Yong, 2019), and glycoproteins (Zhe et al., 2018) are the main ac-
tive component of the HE, which response to the antioxidant and
anti-inflammatory functions. Importantly, it has received a great
deal of attention for its pharmacological activity in the prevention
and therapies of gastrointestinal diseases (Abdulla et al., 2011).
Extensive clinical practice has shown that the Chinese traditional
medicine HE, either applied alone or used as an assistant together
with other chemical drugs, has preventive or therapeutic effects
chronic gastritis, dyspepsia, ulcerative colitis (UC), gastric, and duo-
denal ulceration, etc., (Xiao-Yin et al., 2019). Our recent researches
also confirmed the therapeutic effect of low molecular weight
polysaccharides (3,000 Da approximate) from the HE mycelium
on digestive diseases. In the past, there have been many studies
on large molecular weight polysaccharides of HE and its activity.
Most of polysaccharides are heteropolysaccharides consisting of
two or more kinds of monosaccharides like glucose (Glc), xylose
(Xyl), rhamnose (Rha), mannose (Man), fucose (Fuc), galactose (Gal),
and arabinose (Ara). (1 → 3) and (1 → 6) glycosidic linkages were
found in HE polysaccharides (Mingxing, Yang, Duoduo, Tetsuya, &
Qipin, 2014). However, the research on the oligosaccharides with
small molecular weight was still essential but not enough studied
in-depth.

J Food Biochem. 2020;44:e13135. wileyonlinelibrary.com/journal/jfbc © 2020 Wiley Periodicals, Inc. | 1 of 9

https://doi.org/10.1111/jfbc.13135

2 of 9 | WANG et al.
The incidence and prevalence rates of UC, inflammation that
undermines the integrity and function of the intestinal mucosal epi-
thelial cells, have been increasing worldwide (Burisch & Munkholm,
2015). In addition, UC constitutes major risk factors for the develop-
ment of colorectal cancer (Fiocchi, 1998). Recently, inflammation is
widely considered as one of the basic mechanisms in the pathophys-
iology of UC (Philippe, Catherine, Trinh, Xavier, & Rioux, 2007). It is
generally regarded that The TLR4/NF-κB pathway is closely related
to regulating the expression of inflammatory cytokines (Yamamoto
& Gaynor, 2001). Cytokines, which involved in intestinal immune in-
flammation of inflammatory bowel disease (IBD), act as the essential
mediators in the activating of immune cells. Increased the expres-
sion of tumor necrosis factor α (TNF-α), interleukin-1β (IL-1β) and
interleukin-6 (IL-6), are detected in active UC, correlating with the
severity of inflammation (Wiest, Krag, & Gerbes, 2012), and have
proved to damage tight junctions and intestinal permeability (Swann
et al., 2007). Anti-inflammation may favor the repair of damaged
intestinal mucosa and decrease blood endotoxemia caused by lipo-
polysaccharides (LPS). Hence, the study on the screening anti-in-
flammation components from HE would help with the therapy of the
digestive system diseases (Chang-Ming et al., 2019).
In the study, a water-soluble oligosaccharide (wHEP-1) from the
mycelium of HE were isolated and purified successfully. The pro-
tective activity of Colon mucosa was evaluabled by using acetic ac-
id-induced rats and LPS-simulated Caco-2 cells. It was found that
wHEP-1 significantly reduces the damage of colonic mucosa caused
by acetic acid in rats. In addition, wHEP-1 decreased the inflamma-
tion induced by LPS in Caco-2 cells via the TLR4/NF-κB pathway and
exhibited the protective effects against over-apoptosis. Further elu-
cidation of the structural features of water-extractable wHEP-1 was
studied by GC-MS and NMR.
2 | M ATE R I A L S A N D M E TH O DS
2.1 | Reagents and materials
The extract of the HE mycelium culture was provided by Hangzhou
Johncan International and complies with the National Drug Standards
NO. HI4023098. The ultrafiltration system and filtration membranes
were purchased from Millipore Company Ltd (USA). Dialysis tubes
(USA, MD10), standard monosaccharides, and BSA were acquired
from Sigma Co Ltd (USA). All other chemicals and reagents, which
were of analytical grade, were obtained from local sources.
2.2 | Extraction and purification of the
oligosaccharides
The cultured HE mycelium (Hongjian Company, Jilin, China) was
extracted with water (material/water w/v, 1:5) at 80°C for 12 hr,
followed by two additional extractions of the residue via the same ex-
traction procedure. Subsequently, after combined the concentrated
17454514, 2020, 3, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jfbc.13135 by University Of Primorska Up Fvz, Wiley Online Library on [03/06/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
was precipitated with 95% ethanol (the final concentration of 80%)
to obtain an ethanol-soluble and ethanol-precipitated fraction. The
two fractions (EP-L and EP-H) were separated by a hollow fiber ultra-
filtration cartridge (Millipore Company Ltd, USA) by of 3 Kd. Further
EP-L fraction into a permeate solution and a concentrated fractions
was performed using a 0.2 K hollow fiber ultrafiltration column. EP-1
was purified by a DEAE Sephadex A-50 (GE, USA) column. EP-1 was
weighed at 200 mg, dissolved with 5 ml deionized water, centrifuged
to remove the supernatant, and further purified on the p30 (GE,
USA) (1.5 cm × 100 cm) column with 15 ml distilled water per tube
at a flow rate of 1 ml/min. The elution fractions named wHEP-1 was
obtained, dialyzed, and lyophilized.
2.3 | Chemical and physical property analysis
The total carbohydrate, uronic acid, and protein contents were deter-
mined using phenol-sulfuric acid (Dubois, Gilles, Hamilton, Rebers, &
Smith, 1951) m-hydroxydiphenyl, and Bradford methods (Bradford,
1976) with the standards of glucose, glucuronic acid, and bovine
serum albumin (BSA) (Wulfman et al., 1976), respectively. Sugars
components were analyzed by PMP pre-column derivatization,
which were then detected by HPLC (Shimadzu, Japan) with a C-18
column (Shimadzu, Japan).The molecular weight analysis was used
HPLC-GPC method. An HPLC system (Shimadzu, Japan) with a re-
fractive index detector, TSKgel G3000PWXL column (7.8 × 300 mm,
Tosoh, Japan) were used in the study. Samples were compared with
standard dextrans to obtain calibration curves, which were calcu-
lated with GPC software (Shimadzu, Japan).
2.4 | Methylation analysis
Following methylation of samples using the reported method pre-
viously (Ciucanu & Kerek, 1984), the resulting partially methyl-
ated alditol acetates were analyzed by GC (Agilent7890, USA) and
GC-MS (Agilent 6890–5973, USA) with a DB-1 capillary column
(30 m × 0.25 mm). Under an injector temperature of 250°C, the
column temperature was set to 60°C (hold for 5 min), and then in-
creased to 220°C at 5°C/min. The samples were dissolved in acetone
and filtered with a 20µm filter membrane with a sample volume of
2µl. The peak areas and response factors of the flame ionization
detector in the GC were analyzed to determine the molar ratios of
sugar components (Sweet, Shapiro, & Albersheim, 1975).
2.5 | FT-IR spectroscopic analysis
The vibrations of molecules and polar bonds among different atoms
were studied by FT-IR spectra (USA) with recorded frequency rang-
ing from 4,000 to 500 cm−1 (Yu & Irudayaraj, 2005). FT-IR measure-
ment was performed for each sample, which was mixed with dried
KBr powder, and then compressed into a salt disc.

WANG et al.
2.6 | NMR analysis
The freeze-dried wHEP-1 (20 mg) was multiple times deuterium-
exchanged D2O. 1H NMR and 13
C NMR were recorded (BRUKER
600M AVANCE III, German) AV 600 spectrometer, the temperature
is 25°C. Data were processed using MestReNova NMR software.
2.7 | Animals model assessing the protective
effect of colon mucosa
Forty Sprague Dawley (SD) rats (200–220 g each) were obtained
from Jilin University College of Pharmacy and were accompanied
by a health and safety certificate of conformity administered by the
Chinese government (ShengChanXuKe number SCXK2016-0001).
All rats were randomly divided into the following four groups: Blank
group (no UC), Model group (untreated UC), wHEP-1 (L) (0.5 g/kg
treated UC), and wHEP-1 (H) (1.0 g/kg treated UC). Each group was
composed of 10 rats (5 males and 5 females per group).The animal
model of colitis was based on a protocol reported previously (Shao
et al., 2019). After being weighed, the animals were killed. The distal
10 cm of the colon, measured by insertion of a ballpoint syringe, was
removed and opened by making a longitudinal incision. The occur-
rence of diarrhea was noted. The colon segment was briefly washed
in saline and scored for gross changes in morphology: 0 = no damage,
1 = hyperemia, 2 = ulcers less than 25% of the total area, 3 = ulcers
25%–50% of the total area, and 4 = ulcers more than 50% of the total
area. The segment was weighed to obtain the wet weight, and pieces
were removed for histologic examination.
2.8 | Cell treatment and assays of inflammatory
cytokines expression
To determine the expression of inflammatory cytokines, Caco-2 cells
were seeded onto 6-well plates (Corning Inc., Corning NY, USA) at
a density of 5 × 105 cells/well. Cells were incubated with 0.1M/mL
(low dose, L) and 0.5M/mL (high dose, H) wHEP-1 for 24 hr, and fol-
lowed by simulating with LPS for 6 hr.
After treatment and incubation as described above, a Trizol re-
agent was used to extract the total mRNA. The concentration and
purity of RNA in samples were determined spectrophotometrically
after dissolving samples in DEPC water. The RNA was reverse-tran-
scribed and determined with a Primer-Script RT-PCR kit and real-time
PCR (SYBR Premix Ex Taq) following the manufacturer's protocol.
Related primer sequences were listed as follow: TNF-α: 5′ AGCC
CATGTTGTAGCAAACC 3′ and 5′ TGAGGTACAGGCCCTCTGAT 3′;
IL-1β: 5′ TGAGCACCTTCTTTCCCTTC 3′ and 5′ GTCATTACTTTCTT
CTCCTTGTAC 3′; HO-1:5′CAG TCTATG CCC CAC TCTAC3′ and 5′AAG
GCG GTC TTA GCC TCT TC3′; Nrf2:5′-CTCCTTAGACTCAAATCCCA
CCTTAA-3′, and 5′-TGGGCTCTGCTATGAAAGCA-3′; GAPDH: 5′ AGA
AGCTGGGGCTCATTTG 3′ and 5′ AGGGGCCATCCACAGTCTTC 3′.
17454514, 2020, 3, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jfbc.13135 by University Of Primorska Up Fvz, Wiley Online Library on [03/06/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
| 3 of 9
2.9 | Western blot
To evaluate the expressions of inflammation-related proteins, cells
were pretreated with 0.1 M/ml (L) and 0.5 M/ml (H) wHEP-1 for
24 hr, followed by simulation with 1 μg/ml LPS for 60 min. The cel-
lular proteins were obtained for western blot analysis as described
previously (Wang et al., 2017). Samples (40 μg each) were separated
onto 12% SDS-PAGE gels and transferred to a PVDF membrane
(Millipore Corp., Billerica, USA). Membranes were incubated over-
night with related primary antibodies.
2.10 | Evaluation of apoptotic cells by Annexin
V-FITC assay
Cells were plated into a 6-well plate at a density of 2 × 105 cells/
well and incubated overnight. The percentage of apoptotic cells
was analyzed using a BD FACS Calibur flow cytometer (BD
Biosciences, San Jose, CA, USA) after staining using an Annexin
V-FITC Apoptosis Detection Kit (Biyuntian Biotech, Guangzhou,
China).
2.11 | Statistical analysis
Experiments were repeated in triplicate, and results are presented
as mean ± standard deviation (SD). The Student's t test was per-
formed for statistical evaluation using the SPSS 16.0 statistical
software package (SPSS Inc., USA) with p < .05 set as the statistical
significance.
3 | R E S U LT S A N D D I S CU S S I O N
3.1 | Extraction and purification of the major
oligosaccharides
The crude oligosaccharide were obtained after water-extraction
and precipitation with ethanol from HE mycelium, and then sepa-
rated by hollow fiber column with pore sizes of 3 and 0.2 K, respec-
tively. Further the sample was purified by DEAE-Sephadex A-50 and
P30 column chromatography. The wHEP-1 fraction was obtained
(Figure 1).
3.2 | Chemical and physical properties analysis
The carbohydrate contents of wHEP-1 were 99.23%. No uronic acid
and protein content was detected. wHEP-1 was composed of glu-
cose (Glc), mannose (Man), and galactose (Gal) in the molar ratio of
1.2:16.9:1. The molecular weights of wHEP-1was determined to ap-
proximately be 4,010 Da.
 17454514, 2020, 3, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jfbc.13135 by University Of Primorska Up Fvz, Wiley Online Library on [03/06/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
4 of 9 | WANG et al.

3.3 | FT-IR spectra analysis

In order to more structure characterize of wHEP-1, FT-IR spectrum

in the region 4,000–500 cm−1 was used (Figure 2). The stretching
vibration of the hydroxyl groups is represented by the intense broad
peak at 3,389 cm−1, while the stretching vibration of the C-H bond
is indicated by the weak absorption peak at 2,929 cm−1. wHEP-1 dis-
plays a specific bond in between 1,200 and 1,000 cm−1, the region
that is often considered the fingerprint of molecules. Absorption
at 858 and 777 cm−1 indicates both β-glycosidic and α-glycosidic
linkages.

3.4 | Methylation analyses of wHEP-1

According to the retention time, eight peaks were obtained and

identified as: non-reducing terminal of Manp, (1 → 3)-linked-Glcp,
(1 → 3)-linked-Galp, and (1 → 3, 4)-linked-Glcp with the molar
ratio of 6.2:82.8:5.7:5.3 (Table 1). The results of the methylation
analysis of WEP-1 reveal that the terminal of the polysaccharide is
mainly composed of Man with a content of 6.2%. The side chains
are mainly composed of (1 → 3, 4)-linked-Glcp. The total amounts
of (1 → 3)-Glcp and (1 → 3)-Galp residues were 88.5%, collec-
tively indicating their potential composition as the backbone of
FIGURE 1 Extraction and isolation procedure of wHEP-1 WEP-1.

FIGURE 2 FT-IR spectra of wHEP-1 in the range of 4,000‒500

TA B L E 1 Results of the methylation

RT(min) Configuration Molar percentage (%) Major mass fragment (m/z)
analyses of wHEP-1 by GC-MS
16.80 Manp-1→ 6.2 71, 87, 101, 117, 145, 161, 189, 205
21.43 →3)-Glcp-(1→ 82.8 71, 87, 101, 117, 129, 161, 233
22.22 →3)-Galp-(1→ 5.7 71, 87, 101, 117, 129, 161, 233, 277
26.209 →3,4)-Glcp-(1→ 5.3 71, 87, 101, 117, 129, 261, 305
 17454514, 2020, 3, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jfbc.13135 by University Of Primorska Up Fvz, Wiley Online Library on [03/06/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
WANG et al. | 5 of 9

3.5 | NMR analysis of wHEP-1 1H-NMR spectrum of WEP-1 consists mostly of signals for four
anomeric protons at δ5.30, 5.11, 4.84, and 4.53 ppm (Figure 3a).
Structural properties of WEP-1 were further elucidated by NMR The isobaric hydrogens in the sugar residues are designated as
spectroscopy. 600-MHz spectra are shown in Figure 4. The A, B, C, and D. The chemical shifts at 5.30 and 5.11 ppm were

FIGURE 3 NMR spectra of wHEP-1: (a) 1H spectrum, (b) 13C spectrum, (c) 1H-1H COSY spectrum, (d) 1H-13C HSQC spectrum, (e) HMBC
spectrum
 17454514, 2020, 3, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jfbc.13135 by University Of Primorska Up Fvz, Wiley Online Library on [03/06/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
6 of 9 | WANG et al.

F I G U R E 4 wHEP-1 prevents the inflammation induced by LPS in Caco-2 cell via NF-κB signaling pathway. (a) Western blotting of TLR4,
p-IκBα, IκBα, NF-κB p-p65, and NF-κB p65 with GADPH as the internal control. (b)–(d) Quantitative analysis of the protein production
levels. Values represent mean ± SD of three independent experiments, *p < .05, **p < .01 versus blank group; #p < .05, ##p < .01 versus
model group

previously assigned to an α-glycosidic linkage, and the signals
at δ4.84 and 4.53 ppm assigned to a β-glycosidic linkage. These
findings are consistent with our FT-IR spectrum, which indicates
that WEP-1 has both α- and β- configurations. The 13C-NMR spec-
trum of WEP-1 displays four strong signals in the region from δ
110 to 90 ppm. The chemical shifts at δ 99.58, 98.07, 95.79, and
91.94 ppm are ascribed to the four isobaric carbons in the sugar
residues (Figure 3b). Starting from anomeric carbon and anomeric
hydrogen, the peak signal of the anomeric hydrogen crossing
and coupling relationship between anomeric hydrogen and the
adjacent hydrogen can be found in two-dimensional H-H COSY
(Figure 3c), and the chemical shifts of adjacent hydrogen can be
identified in turn. According to the confirmed chemical shifts of
hydrogen, the corresponding chemical shifts of hydrogen can
be found in HSQC (Figure 3d) spectra. Cross signals are used to
identify chemical shifts of carbon corresponding to hydrogen.
Then, the remote related information is inferred by the HMBC
(Figure 3e) spectrum, where the link mode between sugar chains
is confirmed.
3.6 | wHEP-1 relieves the symptoms of acetic acid
induced colon mucosal injury in rats
In this study, gross examination of the colonic segment comprised of
the proximal 10 cm section of the colon adjacent to the anus dem-
onstrated that non-diseased rat colon (Blank group) had a smooth
surface and clear folds; however, in the Model group, the colonic
mucosa were congested, with hyperemia and obvious mucosal epi-
thelial erosion. In the wHEP-1 groups, epithelial mucosal hyperemia
and erosion of the colonic epithelium were significantly reduced
compared with the untreated model group. The gross morphologic
scores in different groups were shown in Table2.
3.7 | The protection of wHEP-1 in LPS simulated
Caco-2 cell
The integrity and function of the epithelial barrier is the foundation
for maintaining intestinal homeostasis. Inflammation induced over
 17454514, 2020, 3, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jfbc.13135 by University Of Primorska Up Fvz, Wiley Online Library on [03/06/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
WANG et al. | 7 of 9

apoptosis of intestinal epithelial cells have been found to contribute group, low and high wHEP-1 treatments markedly inhibited LPS-
to the pathogenesis of UC. induced up-regulation of TLR4 expression by ratios of 51% and 67%,
The TLR4/NF-κB signaling pathway is the classical innate im- respectively (Figure 4).
mune pathway. LPS is the most important ligand of TLR4 that can As the downstream target of TLR4, NF-κB transcription in inflam-
significantly increase the expression of TLR4, which enhances in- mation induces the transcription of pro-inflammatory genes (Jobin
flammation response and promotes various inflammatory cytokine et al., 1999). LPS enhances the activation of NF-κB by promoting the
gene expressions via activating NF-κB. Compared with the model degradation and phosphorylation of IκBα. In our study, western blot
analysis indicated that wHEP-1 suppressed the degradation of IκBα
TA B L E 2 Colonic mucosa score in each group and activation of NF-κB in a dose-dependent response (Figure 4).
We demonstrated that wHEP-1 significantly inhibited inflammation
Group n Scores (Mean ± SD)
via the TLR4/ NF-κB pathway.
Blank 10 0.2 ± 0.1
Moreover, high expression of HO-1 inhibited the release of
Group 10 3.1 ± 0.4**
cytokine including IL-1β and TNF-α, thereby inhibiting endotoxin
wHEP(L) 10 1.7 ± 0.1# and oxidative stress induced inflammatory responses of endothe-
wHEP−1(H) 10 1.4 ± 0.2## lial cells and macrophages (Higashimura et al., 2013). Our RT-PCR
**p < .01, versus normal control group; results showed that wHEP-1 can reduce the excessive production
#
p < .05; ##
p < .01 versus model group. of cytokines induced by LPS and alleviate systemic inflammatory

F I G U R E 5 Expression of IL-1β (a), TNF-α (b), HO-1(c), and Nrf2 (d). Data are expressed as mean ± SD, n = 3. **p < .01 versus. blank group;
#p < .05, ##p < .01 versus. model group
 17454514, 2020, 3, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jfbc.13135 by University Of Primorska Up Fvz, Wiley Online Library on [03/06/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
8 of 9 | WANG et al.

F I G U R E 6 wHEP-1 protect Caco-2 cell from inflammatory apoptosis. (a) and (b) Typical histogram of Caco-2 apoptosis ratio; (c) Western
blotting analysis of apoptotic related proteins Bcl-2, Bax and Caspase-3. (d) Quantitative analysis of the protein production levels. Values
represent mean ± SD of three independent experiments, *p < .05, **p < .01 versus blank group; #p < .05, ##p < .01 versus model group

response. It was demonstrated that wHEP-1 upregulated Nrf2-
dependently expression of HO-1 in LPS-induced Caco-2 cells
(Figure 5).
Further, wHEP-1 reversed the over--apoptosis of Caco-2 cell
concomitantly with the relief of inflammation. Flow cytometry
results showed that after simulation of LPS, the apoptosis rate in-
creased to 5.8% compared with that of untreated group but nor-
malized when treated with 0.1 and 0.5 M/ml wHEP-1 (Figure 6a).
To further confirm the intestinal epithelial protection effect of
wHEP-1, three apoptosis relative protein were studied by western
blot. As expected, apoptosis suppressor molecule Bcl-2 showed an
increase trend in wHEP-1 treated groups and in a dose-indepen-
dent, while the apoptosis promoting factor Bax and mitochondrial
damage marker Caspase-3 fell back to normal level (Figure 6b,c).
The quantitative analysis of the protein production levels was
showed in the Figure 6d. We demonstrated that wHEP-1 pro-
tected Caco-2 cell from inflammatory damage via reducing mito-
chondrial pathway apoptosis.
attached to the C-4 position and β-D-Man to a terminal residue. This
chemical structure may be attributable for the anti-UC activity of
wHEP-1, which also possesses a strong inhibitory effect on the pro-
duction of inflammation in LPS-simulated Caco-2 cells via the TLR4/
NF-κB pathway and reducing the apoptosis via mitochondrial pathway.
Our results suggest that the novel oligosaccharide wHEP-1 may have
potential in the UC therapies, providing a foundation for the potential
utilization of HE for functional foods and complementary medicines.
AC K N OW L E D G M E N T S
The work was supported by the National Natural Science Foundation
of China (No. 81603276).
C O N FL I C T S O F I N T E R E S T
The authors declare no conflicts of interest.
ORCID
Mingxing Wang https://orcid.org/0000-0001-7930-9665

4 | CO N C LU S I O N S
In the present study, the oligosaccharide (wHEP-1) was successfully
isolated from the mycelium of HE. wHEP-1 showed the anti-UC ac-
tivities using LPS-induced Caco. Further chemical structure studies
of wHEP-1 reveal that its backbone is composed of α-D-Glc-(1 → 3)
and β-D-Gal-(1 → 3), where β-D-Glc-(1 → 3) is artibuted to branches
REFERENCE
Abdulla, M. A., Fard, A. A., Sabaratnam, V., Wong, K. H., Kuppusamy,
U. R., Abdullah, N., & Ismail, S. (2011). Potential activity of aque-
ous extract of culinary-medicinal Lion's Mane mushroom, Hericium
erinaceus (Bull.: Fr.) Pers. (Aphyllophoromycetideae) in accelerating
wound healing in rats. International Journal of Medicinal Mushrooms,
13(1), 33–39.
Bradford, M. M. (1976). A rapid and sensitive method for the quanti-
tation of microgram quantities of protein utilizing the principle of

WANG et al.
protein-dye binding. Analytical Biochemistry, 72, 248–254. https​://
doi.org/10.1016/0003-2697(76)90527-3
Burisch, J., & Munkholm, P. (2015). The epidemiology of inflammatory
bowel disease. Scandinavian Journal of Gastroenterology, 50(8), 942–
951. https​://doi.org/10.3109/00365​521.2015.1014407
Bushmarinov, I. S., Ovchinnikova, O. G., Kocharova, N. A., Blaszczyk, A.,
Toukach, F. V., Torzewska, A., … Rozalski, A. (2004). Structure of
the O-polysaccharide of Providencia stuartii O49. Carbohydrate
Rese­arch, 339(8), 1557–1560. https​://doi.org/10.1016/j.carres.2004.
03.021
Chang-Ming, S., Gui-Ge, H., Chun-Hua, W., Hong-Qin, Z., Cheng,
Y., Mei, L., & Yun, H. (2019). Potential multifunctional agents
with anti-hepatoma and anti-inflammation properties by inhib-
iting NF-кB activation. Journal of Enzyme Inhibition and Medicinal
Chemistry, 34(1), 1287–1297. https​://doi.org/10.1080/14756​366.
2019.1635124
Choi, D. B., Lee, J. H., Kim, Y.-S., Na, M.-S., Choi, O.-Y., Lee, H.-D., … Cha,
W.-S. (2011). A study of mycelial growth and exopolysaccharide pro-
duction from a submerged culture of Mycoleptodonoides aitchisonii
in an air-lift bioreactor. Korean Journal of Chemical Engineering, 28(6),
1427–1432. https​://doi.org/10.1007/s11814-011-0109-2
Ciucanu, I., & Kerek, F. (1984). Rapid and simultaneous methylation
of fatty and hydroxy fatty acids for gas—Liquid chromatographic
analysis. Journal of Chromatography A, 284(1), 179–185. https​://doi.
org/10.1016/S0021-9673(01)87813-4
Dubois, M., Gilles, K., Hamilton, J. K., Rebers, P. A., & Smith, F. (1951).
A colorimetric method for the determination of sugars. Nature,
168(4265), 167–167. https​://doi.org/10.1038/168167a0
Fiocchi, C. (1998). Inflammatory bowel disease: Etiology and pathogene-
sis. Gastroenterology, 115(1), 182–205.
Higashimura, Y., Naito, Y., Takagi, T., Mizushima, K., Hirai, Y., Harusato,
A., … Yoshikawa, T. (2013). Oligosaccharides from agar inhibit murine
intestinal inflammation through the induction of heme oxygenase-1
expression. Journal of Gastroenterology, 48(3), 897–909. https​://doi.
org/10.1007/s00535-012-0719-4
Jobin, C., Bradham, C. A., Russo, M. P., Juma, B., Narula, A. S., Brenner,
D. A., & Sartor, R. B. (1999). Curcumin blocks cytokine-mediated NF-
kappa B activation and proinflammatory gene expression by inhibit-
ing inhibitory factor I-kappa B kinase activity. Journal of Immunology,
163(6), 3474–3483.
Mingxing, W., Yang, G., Duoduo, X., Tetsuya, K., & Qipin, G. (2014).
Hericium erinaceus (Yamabushitake): A unique resource for develop-
ing functional foods and medicines. Food & Function, 5(12), 3055–
3064. https​://doi.org/10.1039/C4FO0​0511B​
Philippe, G., Catherine, L., Trinh, T. T., Xavier, R. J., & Rioux, J. D. (2007).
Molecular pathogenesis of inflammatory bowel disease: Genotypes,
phenotypes and personalized medicine. Annals of Medicine, 39(3),
177–199. https​://doi.org/10.1080/07853​89070​1197615
Ren, G., Miao, Y., Zhen, D., Mahfuz, S., Zhao, F., & Song, H. (2018). Partial
purification and antioxidant activities of oligosaccharides from
Hericium caput-medusae (Agaricomycetes). International Journal of
Medicinal Mushrooms, 20(10), 947–960. https​://doi.org/10.1615/
IntJM​edMus​hrooms.20180​28326​
17454514, 2020, 3, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jfbc.13135 by University Of Primorska Up Fvz, Wiley Online Library on [03/06/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
| 9 of 9
Shao, S., Wang, D., Zheng, W., Li, X., Zhang, H., Zhao, D., & Wang, M.
(2019). A unique polysaccharide from Hericium erinaceus mycelium
ameliorates acetic acid-induced ulcerative colitis rats by modulating
the composition of the gut microbiota, short chain fatty acids levels
and GPR41/43 respectors. International Immunopharmacology, 71,
411–422. https​://doi.org/10.1016/j.intimp.2019.02.038
Swann, J. B., Hayakawa, Y., Zerafa, N., Sheehan, K. C. F., Scott, B.,
Schreiber, R. D., … Smyth, M. J. (2007). Type I IFN contributes to
NK cell homeostasis, activation, and antitumor function. Journal of
Immunology, 178(12), 7540–7549. https​://doi.org/10.4049/jimmu​
nol.178.12.7540
Sweet, D. P., Shapiro, R. H., & Albersheim, P. (1975). Quantitative analy-
sis by various g.l.c. response-factor theories for partially methylated
and partially ethylated alditol acetates. Carbohydrate Research, 40(2),
217–225.
Wang, M., Kanako, N., Zhang, Y., Xiao, X., Gao, Q., & Tetsuya, K. (2017).
A unique polysaccharide purified from Hericium erinaceus mycelium
prevents oxidative stress induced by H2O2 in human gastric mucosa
epithelium cell. PLoS One, 12(7), e0181546. https​://doi.org/10.1371/
journ​al.pone.0181546
Wiest, R., Krag, A., & Gerbes, A. (2012). Spontaneous bacterial peritoni-
tis: Recent guidelines and beyond. Gut, 61(2), 297–310. https​://doi.
org/10.1136/gutjnl-2011-300779
Wulfman, D. S., McGibboney, B. G., Steffen, E. K., Thinh, N. V., McDaniel,
R. S., & Peace, B. W. (1976). Metal salt catalyzed carbenoids—XV: The
synthetic and structural aspects of copper salt catalyzed additions of
bis-methoxycarbonyl carbene to olefins. Tetrahedron, 32(11), 1257–
1265. https​://doi.org/10.1016/0040-4020(76)80080-4
Xiao-Yin, W., Duo-Duo, Z., Jun-Yi, Y., Shao-Ping, N., & Ming-Yong, X.
(2019). Recent developments in polysaccharides: Extraction, puri-
fication, structural characteristics and biological activities. Critical
Reviews in Food Science and Nutrition, 59, S96–S115.
Yamamoto, Y., & Gaynor, R. B. (2001). Therapeutic potential of inhibition
of the NF-kappaB pathway in the treatment of inflammation and can-
cer. Journal of Clinical Investigation, 107(2), 135–142.
Yu, C., & Irudayaraj, J. (2005). Spectroscopic characterization of mi-
croorganisms by Fourier transform infrared microspectroscopy.
Biopolymers, 77(6), 368–377. https​://doi.org/10.1002/bip.20247​
Zhe, R., Tao, Q., Xiaopan, L., Yang, L., Fuan, Q., Yufang, L., … Yifan, H.
(2018). Optimization of Hericium erinaceus polysaccharide-loaded
Poly (lactic-co-glycolicacid) nanoparticles by RSM and its absorp-
tion in Caco-2 cell monolayers. International Journal of Biological
Macromolecules, 118, 932–937.
How to cite this article: Wang D, Xu D, Zhang Y, Zhao D,
Wang M. A novel oligosaccharide isolated from Hericium
erinaceus and its protection against LPS-induced Caco-2 cells
via the TLR4/NF-κB pathway. J Food Biochem.
2020;44:e13135. https​://doi.org/10.1111/jfbc.13135​