Graduation Project - After Revision

Suez Canal University
Faculty of Agriculture
Department of Food Technology
Program of Food Safety
“Detection Methods of Meat

Adulteration”
Prepared by:
Sohila Adel
Shaimaa Adly
Supervised by:
Prof. Dr/ Sayed Mokhtar
2022-2023
Detection Methods of Meat Adulteration
Content
List of figures…………………………………................... Page 4
List of tables…………………………………................... 4
List of abbreviations……………………………………… 4
1 Abstract…………………………………………………… 5
2 Introduction……………………………………................. 6
3 Technologies based on DNA…………………………….. 8
3.1 Direct PCR…………………………………...…................ 11
3.2 Real-time PCR…………………………………................. 14
3.3 Polymerase chain reaction-restriction fragment length 15
polymorphism…………………………………………......
3.4 Loop-mediated isothermal amplification………………..... 17
3.5 Droplet digital PCR…………………………….................. 18
3.6 DNA barcoding and next-generation sequencing………..... 20
4 Protein-based technologies………....................................... 21
4.1 Enzyme-linked immunosorbent assay…………………...... 23
4.2 Immunosensors…………………………………................. 26
4.3 Protein mass spectrometry analysis……………………...... 27
5 Technologies based on metabolite profiling………………. 29
6 Non-destructive technologies………................................... 30
6.1 Infrared spectroscopy……………………………................ 32
6.2 Raman spectroscopy………………………………………. 33
6.3 Hyperspectral imaging…………………………………...... 35
6.4 Laser-induced breakdown spectroscopy………................... 37
7 Conclusions and future trends……...................................... 38
8 References…………………………………......................... 40
2|P a ge
List of figures
Figure 1 Commonly applied technologies for meat product Page 8
adulteration detection……………………………….
Figure 2 Flowchart of meat adulteration detection 9
technologies based on DNA………………………...
Figure 3 Detection principle of droplet digital 19
PCR……………………………………....................
Figure 4 Schematic representation of ELISA………………... 25
Figure 5 Flowchart for meat adulteration detection and 36
visualization of the HIS method……………………
3|P a ge
List of tables
Table 1 Comparative analysis of the common applied meat Page 10
adulteration techniques……………………………...
Table 2 Recent 5 years representative studies of DNA-based 13
technologies for meat adulteration identification…...
Table 3 Recent 5 years representative studies of protein- 22
based technologies for meat adulteration
identification………………………………………...
Table 4 Recent 5 years representative studies of non- 31
destructive analytical technologies for meat
adulteration detection……………………………….
4|P a ge
List of abbreviations
DNA Deoxyribonucleic acid
PCR Polymerase Chain Reaction
ND Not determined
LOD limit of detection
GA genetic algorithm
ELISA enzyme-linked immunoassay
SNV standard normal variation
MAb monoclonal antibody technique
5|P a ge
1. Abstract
Meat adulteration, mainly for the purpose of economic pursuit, is

widespread and leads to serious public health risks, religious violations, and
moral loss, it affects market growth by destroying consumer confidence.
Therefore, authentication of food is important for food processors, retailers, and

consumers, but also for regulatory authorities. However, a complex nature of food
and an increase in types of adulterants make their detection difficult, so that food
authentication often poses a challenge. Rapid, effective, accurate, and reliable
detection technologies are keys to effectively supervising meat adulteration.
Considering the importance and rapid advances in meat adulteration detection
technologies, a comprehensive review to summarize the recent progress in this
area and to suggest directions for future progress is beneficial.
In this review, analytical approaches to authentication of food of animal origin

based on DNA, protein, and metabolite analyses and non-destructive technologies
based on spectroscopy were comparatively analysed.
In the future, determining suitable indicators or markers is particularly important

for destructive methods. To improve sensitivity and save time, new
interdisciplinary technologies, such as biochips and biosensors, are promising for
application in the future.
For non-destructive techniques, convenient and effective chemometric models

are crucial, and the development of portable devices based on these technologies
for onsite monitoring is a future trend. Moreover, omics technologies, especially
proteomics, are important methods in laboratory detection because they enable
multispecies detection and unknown target screening by using mass spectrometry
databases.
6|P a ge
2. Introduction
Meat and meat products are an important food source for humans in both
developed and developing countries (Daniel, Cross, Koebnick, & Sinha, 2011).
Many important nutrients, such as proteins, fats, minerals, and vitamins, can be
supplied by meats (Cascella et al., 2018; Kamruzzaman, Makino, &
Oshita 2015b; Zheng, Li, Wei, & Peng, 2019). Although there are various
national and international laws for supervising the quality and safety of meat and
meat products, meat adulteration is still widespread. Most meat adulteration is
economically motivated, such as the low-cost addition of duck meat to mutton
(Zheng et al., 2019), which causes consumers to suffer economic losses. A small
amount of adulteration is due to adventitious contamination during processing
(Naaum et al., 2018).
Either way, meat adulteration may lead to serious public health risks, such as the
exposure to toxins, pathogens, or allergens in these products (Magiati, Myridaki,
Christopoulos, & Kalogianni, 2019; Spink & Moyer, 2011). For example,
coronaviruses, such as Middle East respiratory syndrome (MERS-CoV) and
severe acute respiratory syndrome coronavirus (SARS-CoV), might be
transmitted to humans through the consumption of adulterated wild animal meat
(Amin, Hamid, & Ali, 2016; Kingsley, 2016). In addition, meat adulteration could
also violate religious concerns; for example, pork or pork-associated products are
not acceptable in Kosher and Halal food laws (Lim & Ahmed, 2016).
Furthermore, meat adulteration has become a problematic concern for all meat
industry chains at all levels of the production and distribution process, from
farmers to regulators and from producers to consumers.
Although many strategies have been adopted to assure the authenticity of meat
and meat products, such as protected designation of origin, protected
geographical indication, certificate of specific characteristics, and so on (Abbas
7|P a ge
et al., 2018), the coverage is too small, and it is unrealistic to certify all meat
products for protection from adulteration. Therefore, effective supervision is very
important for ensuring the suitable development of the meat industry, and rapid,
effective, accurate, and reliable detection technologies are fundamental technical
support for this goal.
In the last two decades, authenticity detection technologies for meat and meat
products have been established or optimized for different markers, such as
polymerase chain reactions (PCRs) based on deoxyribonucleic acids (DNAs),
immunological technologies based on proteins, spectroscopic technologies based
on specific metabolites, and so on (Figure 1). These technologies have their own
characteristics and have some disadvantages regarding adulteration detection for
meat and meat products. In this review, recent advances of the detection
technologies were comprehensively discussed, and the merits and demerits
between technologies were compared. Finally, the future perspectives about the
detection technologies of meat adulteration are also discussed. Although many
older literatures were included, this review mainly focused the references
published in near 5 years.
8|P a ge
FIGURE (1) Commonly applied technologies for meat product adulteration detection
3. Technologies based on DNA
DNA is the main material for storing, replicating, and transmitting genetic
information. DNA exists in all tissues of individual animals and is more
conserved than proteins (Kumar et al., 2015; Xiang et al., 2017). More
importantly, DNA fragments have shown better thermal stability than that of
proteins in processed meat, so they could be chosen as markers for authenticity
determination in processed meat (Kaltenbrunner, Hochegger, & Cichna-Markl,
2018a; Kang & Tanaka, 2018; Kumar et al., 2015; Ruiz-Valdepeñas Montiel et
al., 2017; Xu et al., 2018). Although the variation of DNA content in meat tissues
and species could impact the meat quantification, the PCR and its derived
technologies based on DNA are the most used techniques in the detection of meat
and meat product adulteration due to their sensitivity, simplicity, and reliability
(Table 1).
The target genes and DNA fragments used as markers for identifying meat
product adulteration have mainly been derived from mitochondrial DNA (Mt
9|P a ge
DNA) (Figure 2) (Dai et al., 2015), such as the mitochondrial D-loop region,
cytochrome b (CytB) genes, cytochrome c oxidase subunit I, II, and III (COI,
COII, and COIII) genes, ATPase subunit 6 and 8 (ATPase6 and ATPase8),
12SrRNA and 16SrRNA (Table 2), because Mt DNA possesses several
advantages over genomic DNA, such as being more efficiently arranged and
easily accessible, not undergoing recombination (Kumar et al., 2015), and so on.
In addition, new genomic DNA has also been identified as a stable marker for the
detection of meat product adulteration, such as replication protein A1 (RPA1)
(Ren, Deng, Huang, Chen, & Ge, 2017), prion protein PrP (Prnp) (Kaltenbrunner
et al., 2018a), and so on.
As a molecular marker, Mt DNA possess several advantages over nuclear DNA

for studies of speciation in meat products (Lockley and Bardsley, 2000). There
are many mt DNA molecules within each mitochondrion, making mt DNA a
naturally amplified source of genetic variation. It evolves faster than nuclear
DNA (Brown et al., 1982). Different regions of the mitochondrial genome evolve
at different rates (Saccone et al., 1991) allowing suitable regions to be chosen for
the question under study. The mt DNA tends to be maternally inherited so that
individual normally possess only one allele and thus sequence ambiguities from
heterozygous genotypes are generally avoided (Gyllesten et al., 1991); biparental
inheritance in marine mussels (Zouros et al., 1992). The mt DNA does not
recombine (Hayashi et al., 1985), though some evidence of recombination events
has recently been reported (Hagelberg et al., 1999).
FIGURE (2) Flowchart of meat adulteration detection technologies based on DNA.
10 | P a g e
TABLE (1) Comparative analysis of the common applied meat adulteration techniques
Technique Specificity Sample preparation Detection Multi- Operator Detection Commercial Application
time species requirement cost availability locations
detection
Direct High but Sampling→ Time- Yes Professional High Commercia Lab
PCR vulnerable Smashing/ground→ consuming kits available
DNA extraction→
purification→
quantification
Real-time High Sampling→ Time- Yes Professional High Commercia Lab
PCR Smashing/ground→ consuming kits available
DNA extraction→
purification→
quantification
PCR High Sampling→ Time- Yes Professional High Commercia Lab
RFLP Smashing/ground→ consuming kits available
DNA extraction→
purification→
quantification
LAMP High Sampling→ Less time- Yes Professional High Commercia Lab or
Smashing/ground→ consuming kits available onsite
DNA extraction→
purification→
quantification
ddPCR High Sampling→ Less time- Yes Professional High No Lab
Smashing/ground→ consuming
DNA extraction→
purification→
quantification
DNA High Sampling→ Less time- Yes Professional High Public Lab
barcoding Smashing/ground→ consuming Databases
DNA extraction→ Available
purification→ (BOLD)
quantification
ELISA High Sample ground→ Less time- No Simple Low Commercia Lab or
protein extraction→ consuming training kits available onsite
quantification
Protein High Sample ground→ Less time- No Simple Low No Lab or
Immune- protein extraction→ consuming training onsite
sensor quantification
Protein High Sample ground→ Time- Yes Professional High No Lab
mass protein extraction→ consuming
purification→
digestion
Metabolite Low and Metabolomics: Time- Yes Professional High No Lab
profiling vulnerable sample ground→ consuming
metabolites extraction→
purification
electronic nose:
no or little
IRS Low and No or little Time- Yes Simple Low Commercia Lab or
vulnerable saving training Portable onsite
Device
available
11 | P a g e
RS Low and No or little Time- Yes Simple Low Commercia Lab or

vulnerable saving training Portable onsite
Device
available
HSI Low and No or little Time- Yes Professional Low No Lab or
vulnerable saving onsite
LIBS High No or little Time- Yes Professional Low No Lab or

saving onsite
The relatively high mutation rate compared to nuclear genes has tended to result
in the accumulation of enough point mutations to allow the discrimination of
closely related species. It should be noted that mt DNA also exhibits a degree of
intra specific variability and so care has to be taken when studying differences
between organisms based on single polymorphisms (Chow and Inogue, 1993).
The cytochrome b (cyt b) sequences are good tools for studying phylogenetics of
closely related species.
Within species, control region sequences usually are a better choice, because
more relaxed structural and functional constraints lead to a faster average
substitution rate. Since D-loop region is a hyper variable region of mitochondrial
DNA and hence it is possible to select the sequences, which are specific to
particular species. The mitochondrial D-loop region was initially selected to
accomplish meat identification because it has the highest substitution rate of all
mitochondrial genes, and is the most rapidly evolving region of the mitochondrial
genome. The D-loop is included in the control region of the mt DNA and is
flanked by the tRNApro and tRNAphe mt genes (Sbisa et al., 1997). The variable
regions of the cyt b gene (Kocher et al., 1989; Matsunaga et al., 1999a and
Veerkaar et al., 2002) offer two main advantages:(a) mt DNA is present in
thousands of copies per cell (as many as 2,500 copies), especially in the case of
post-mitotic tissues such as skeletal muscle (Greenwood and Paboo, 1999).
12 | P a g e
This increase the probability of achieving a positive result even in the case of
samples suffering severe DNA fragmentation due to intense processing
conditions (Bellagamba et al., 2001) and (b) the large variability of mt DNA
targets as compared with nuclear sequences facilitates the discrimination of
closely related animal species even in the case of mixture of species (Hopwood
et al., 1999 and Prado et al., 2002).
The heat stability and large copy number of mitochondrial DNA in meat tissue
contribute to the protection and survivability of the fragments of DNA that are
sufficient enough to be amplified by PCR (Girish et al., 2004). Using an
appropriate primer pairs, mitochondrial sequences have been amplified in many
species and the resulting differences used for species identification (DiPinto et
al., 2005; Herman, 2001). The mitochondrial encoded gene for 12S rRNA was
selected in this work for meat species identification because it has an adequate
length and grade of mutation, exhibiting a typical mosaic structure of
phylogenetically conserved and variable regions (Cronin, 1992). Further, it was
proved that mitochondrial markers were more efficient than nuclear markers
(RAPD finger printing and Actin gene barcoding) in species identification and
authentication purposes (Rastogi et al., 2007). Other workers also suggested that
mitochondrial markers are more efficient than nuclear markers for the purpose of
identification and authentication meat species (Hopwood et al., 1999).
3.1. Direct PCR
The PCR is an in vitro enzymatic method which allows several million-

fold amplifications of a specific DNA sequence within few hours. This technique
was invented by Mullis et al. (1986) and is not only useful for molecular biologist
and geneticist but also useful for forensic experts and food technologists. Now-a-
days PCR assay is gaining immense popularity in identification of species origin
of meat and meat products. This is a sensitive, cost effective, precise, authentic,
13 | P a g e
and potentially applicable technique for authentication of meat and meat products
due to its lesser complexity and fast reliable nature. The PCR assays are also
proving useful in solving the issues of traceability of live animals and derived
products (Cunningham and Meghen, 2001).
The direct PCR method has the characteristics of high sensitivity, high resolution,
and specificity, so it is commonly used in meat authenticity and origin traceability
(Bhat et al., 2016; Ha et al., 2017). Ha et al. (2017) developed speciesspecific
PCR methods of the mitochondrial D-loop to detect pork adulteration in
commercial beef and/or chicken products, and the methods were able to detect as
little as 1% pork in heat-treated pork-beef-chicken mixtures. However, the
conventional single-species PCR method could only detect one specific species
of adulterant in products (Kumar, 2015), which is of low commercial value
because there might be many other adulterants in the products.
PCR assays based on its amplification were shown to be more sensitive as
compared to single or low copy nuclear DNA targets (Partis et al., 2000). Since,
the quantity of PCR products generated corresponds to the copy number of the
target DNA sequence (Partis et al., 2000).
Girish et al. (2005) reported that a higher copy number of mitochondrial DNA
ensures a sufficiently high quantity of PCR product, even when small amounts of
fresh/or processed meat samples were used.
PCR based method have used the mitochondrial DNA (mt DNA) as well as
genomic DNA sequences, however mt DNA sequences have certain unique
advantages over the genomic DNA sequences. Animal mt DNA is a small (15-20
kb) circular molecule, composed of about 37 genes coding for 22 tRNAs, 2
rRNAs and 13 mRNAs, the latter coding for proteins mainly involved in the
electron transport and oxidative phosphorylation of the mitochondria. The mt
genome is arranged very efficiently. It lacks introns, has small intergenic spacers
where the reading frames even sometimes overlap. The control region is the
primary no coding region, and is responsible for the regulation of heavy (H) and
14 | P a g e
light (L) strand transcription and of H-strand replication. The mt DNA sequences
have been widely used in evolutionary genetic studies because they are easily
accessible, have a high rate of evolution, and generally follow a clonal pattern of
inheritance highly suited to phylogenetic reconstruction.
Multiplex PCR assays with multiple species-specific primers have been greatly
developed since they offer multiple target detection in a single reaction (Ali et al.,
2015; Böhme, Calo-Mata, Barros-Velázquez, & Ortea, 2019; Dai et al., 2015;
Hou et al., 2015). Ali et al. (2015) designed five pairs of species-specific primers
targeting mitochondrial ND5, ATPase 6 gene, and CytB to simultaneously detect
cat, dog, pig, monkey, and rat meats in Islamic foods. The detection limits were
0.01 to 0.02 ng DNA in the raw product and 1% suspected meats in meatballs,
which showed potential value in the Halal food industry and Halal regulatory
bodies. In addition, the authors successfully applied this method in commercial
sample identification. Multiplex PCR technologies for other meat species, such
as chicken, lamb, ostrich, horse, rat, buffalo, fox species, and so on, have also
been developed (Hossain et al., 2016; Kitpipit, Sittichan, & Thanakiatkrai, 2014;
Li, Li et al., 2019; Liu, Wang et al., 2019; Qin et al., 2019; Wang, Hang, & Geng,
2019).
However, the multiplex PCR method usually applies comparatively longer and
variable-length DNA templates (Köppel, Ruf, Zimmerli, & Breitenmoser, 2008;
Sakai et al., 2011), which are not stable under the harsh conditions of food
processing, such as high-temperature autoclaving and baking (Al Amin, Abd
Hamid, & Ali, 2016). In addition, some closely related species may not be
differentiated by direct PCR technologies (Doosti et al., 2014). Moreover, the
direct PCR method is still time-consuming, requires complex operation and gel
electrophoresis, and cannot be accurately quantified (Li, Jalbani et al., 2019;
Shabani et al., 2015) through spectrophotometric methods because the PCR
products easily undergo interference with single-stranded DNA, RNA, proteins,
15 | P a g e
and so on (Kang & Tanaka, 2018), which restricts its application in industry and
commercial settings (Ali, Hashim, Mustafa, & Man, 2012; Ali et al., 2012).
Therefore, an upgraded technology has been developed in recent years, that is
PCR associated with biochips (Cottenet, Sonnard, Blancpain, Ho, Leong, &
Chuah, 2016; Iwobi, Huber, Hauner, Miller, & Busch, 2011; Li, Li et al., 2019).
The DNA biochip technologies have the advantages of the highly sensitive and
simultaneous detection of multispecies compared to simplex PCR methods
(Cottenet et al., 2016; Iwobi et al., 2011).
The ingredient required for successful PCR amplification are template DNA, pair
of forward and reverse oligonucleotide primers, all four deoxynucleotide
triphosphates, a thermostable DNA polymerase enzyme and reaction buffer. The
PCR technique involves denaturation, primer annealing and elongation steps for
a set number of times depending on the degree of amplification required. This
generates billions of copies of desired DNA segment from picograms quantities
of starting DNA in matter of few hours (Chikuni et al., 1994). However, the other
parameters are also important for successful amplification of desired PCR
products, such as DNA quality, primer concentration, different thermocyclers,
brand of DNA polymerase, Mg++ concentration, annealing temperature and final
extension periods (Meunier and Grimont, 1993; Macpherson et al., 1993).
Recently, Li, Li et al. (2019) developed two independent multiplex PCR methods
based on 12S rRNA, 16S rRNA, ND2, and COI. Using microchip electrophoresis
to replace traditional gel electrophoresis, 14 animal species could be
simultaneously detected with detection limits as low as 0.02 ng DNA. This study
provides a good reference for improving the traditional PCR methods for meat
adulteration detection (Table 2) TABLE (2) Recent 5 years representative studies of
DNA-based technologies for meat adulteration identification
16 | P a g e
Detection Detection Target marker (primer, 5′ → 3′) Limits of References

items technology detection
Pork Simplex Mitochondrial D-loop region for pork 1% pork Ha et al.
adulteration PCR (GGTTCTTACTTCAGGACCATC/GTGTACGCACGTGTATGTAC) in the heat- (2017)
in beef, treated meat
chicken, samples
and mutton
Beef Simplex Mitochondrial D-loop region for beef 0.1% beef Karabasanavar
adulteration PCR (TATCAAAAATCCCAATAACTCAACACA/GGCCCGGAGCGAGAAG) adulteration et al.
in other in raw, cooked, (2017)
meat autoclaved, and
micro-oven
processed
samples
Pork Multiplex CytB for beef 0.5% to 1% w/w Skouridou et
adulteration PCR (CATCGCACGAATATAATACA-C3- pork al.
in beef or TGGAGTAATCCTTCTGCTCACAGT/TGTAAAACGACGGCCAGT-C3- could be detected (2019)
chicken GGATTGCTGATAAGAGGTTGGTG) when mixed with
products CytB for chicken beef or chicken
(ATTACGACGAACTCAATGAA-C3-
ATTCCCTACATTGGACACA/TGTAAAACGACGGCCAGTC3-
TGATAGTAATACCTGCGATTGCA)
CytB for pork
(ATAGGCTGGTTCGTAATCGG-C3-
CATCCCAATTATAATATCCAACTC/TGTAAAACGACGGCCAGT-C3-
ATTTCTTGGCCTGTGTGT)
Fox, Multiplex COXI gene for fox 1% (w/w) level Li and Guan
raccoon, or PCR (ACCGCACATGCCTTCGTAA/CGTGAAGTATGCTCGTGTATCC) (2019)
mink in COXI gene for raccon
commercial (TTAGTAGCTCATAACGCCTTG/CGTGAGTATGTTCTTGGTTAG)
beef and 12S rRNA gene for mink
mutton (TTGACTGGTTCCACTGATG/CCGTTAGGAGTATTGTGATTC)
meat
Cattle, pig, Multiplex COI for buffalo 1 pg. pure DNA Wang, Hang et
duck, and PCR (CTGTGTTCGCCATTATAGGA/GTGGTTAGATCTACGGTTGAG) and al.
buffalo COI for cattle 0.1% (w/w) (2019)
meat (GAACTCTGCTCGGAGACGAC/GGTACACGGTTCAGCCTGTT) adulterated meat
COI for pig
(GGAGCAGTGTTCGCCATTAT/TTCTCGTTTTGATGCGAATG)
COI for duck
(TAATTGGCACAGCACTCAGC/TTATCAGGGGGACCAATCAG)
Chicken, Multiplex Cytb for chicken 0.05% (w/w) for Qin et al.
duck, pork, PCR (AATCGCAGGTATTACTATCATCCAC/GGTGAGTATGAGAGTTAAGCCCAG) each species (2019)
and beef COIII for duck
(GCCATCCTACTACTCCTCACCA/CCAGATTTTAGAGATTGGAAGTCA)
ATPase subunit 8/6 for pork
(TACCCAGCAAGCCCAGAATC/GAGATTGTGCGGTTATTAATGAGTC)
Cytb for beef
(CAACAGGAATCTCCTCAGACGTAGA/GCTAGAATTAGTAAGAGGGCCCCTAA)
17 | P a g e
Rat, fox, Multiplex ATPase 6 for rat 0.1 ng/𝜇L Mt DNA Liu, Wang et
duck, and PCR (ATCATCAGAACGCCTTATTAGC/GGTTCGTCCTTTTGGTGTATG) for rat, duck, and al.
mutton COX2 for fox goat meat; 0.05 (2019)
(GTCAAATCATAGGTGAAACCCC/TAGAGAAGGAAGAGCAATCAGG) ng/𝜇L Mt DNA for
tRNA, ND1 for duck fox meat
(CATCAACAAAGAGTGCGTCAAA/GTTTAACCTAGGTCACTGGGCA)
Cytb for goat
(GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA/AGGTTTGTGCCAATATATGGAATT)
3.2. Real-time PCR
Real-time PCR Compared to direct PCR, real-time PCR showed higher

specificity, higher sensitivity, and scope for automation, and it can effectively
mitigate PCR contamination (Al-Kahtani, Ismail, & Asif Ahmed, 2017). More
importantly, real-time PCR methods can achieve quantitative analysis through
the linear relationship between the amount of DNA and the Ct value (Fang &
Zhang, 2016; Kumar et al., 2015). Real-time PCR technology has been applied
for the identification of pork, beef, turkey, chicken, and lamb in quantities less
than 0.1%, even in heat-processed meat products (Kumar et al., 2015).
Real-time PCR is performed by monitoring the fluorescence signal, which allows

for deducing the initial quantity of the target genes without additional steps (Xu
et al., 2018). SYBR Green and TaqMan technology are commonly used in
quantitative methods (the working principle is outlined in the review of Kumar et
al., 2015). SYBR Green technology can only detect a single species, but the
detection cost was lower than that of TaqMan technology. Li, Jalbani et al. (2019)
developed a novel reference primer-based mitochondrial 12S rRNA for
quantitative determination of goat meat adulterated with pork by using real-time
PCR. The method showed high specificity and sensitivity for goat meat mixed
with pork within the 10% to 100% mixture-level range. TaqMan technology has
higher specificity and sensitivity than those of SYBR Green technology. More
importantly, it can be used for multispecies detection (Xu et al., 2018). Pegels et
18 | P a g e
al. (2015) selected the 12S rRNA of 73 base pairs of horse DNA as the target
gene to design primers and amplified them by TaqMan real-time PCR. The primer
had high specificity and sensitivity and had no cross reaction with other species.
The detection limit was 1 pg/mg horse DNA. Through the specific primers and
TaqMan probe design based on the CytB gene, less than 1 pg. of DNA per
reaction and 0.1% murine contamination in mutton could be identified (Fang &
Zhang, 2016)
During real-time PCR design, the quality of template DNA and primers is the
key. Reynisson et al. (2006) proved that the combination of locked nucleic acids
with TaqMan probes could increase the fluorescence signal. Based on these
results, Xu et al. (2018) developed a multiplex TaqMan locked nucleic acid real-
time polymerase chain reaction assay to simultaneously detect multiple meat
sources (duck, pork, beef, and chicken). The detection limit reached 0.01% (w/w)
for each species, and the method showed 2% higher accuracy than that of a
conventional real-time PCR method. The purity of the templates DNA has also a
great impact on the realtime PCR results. The single-stranded DNA, RNA, and
DNA polymerase could cause the results false positive or false negatives.
Besides, the quantitative results of real-time PCR are largely affected by the
template DNA concentrations. Recently, Kang and Tanaka (2018) compared two
common DNA quantification methods of template DNA, spectrophotometric and
spectrofluorometric methods, and the results indicated that the
spectrofluorometric DNA quantification method was more appropriate for qPCR
assays for processed food products because the spectrofluorometric methods only
measured double-stranded DNA in the DNA extracts, which eliminated the
interference of single-stranded DNA, RNA, proteins, and organic contaminants.
However, the current research application of real-time PCR is limited by the
relatively high cost of reagents and equipment compared to those for conventional
PCR (Liu, Wang et al., 2019).
19 | P a g e
3.3. Polymerase chain reaction-restriction fragment length

polymorphism
Polymerase chain reaction-restriction fragment length polymorphism (PCR-

RFLP) is a technique for variation analysis by using restriction endonuclease
digestion to identify specific sequences of conserved regions of DNA amplified
by using PCR. PCR-RFLP is a sensitive, accurate, and versatile method for meat
authenticity verification (Hsieh & Hwang, 2004; Rashid et al., 2015), and
misplead timesaving than real-time PCR (Ali et al., 2018). Rahman et al. (2015)
used PCR-RFLP coupled with a lab-on-a-chip detection platform to detect dog
meat in burger formulations and designed primers for CytB with the ability to
detect 0.01% (w/w) dog meat in chicken and beef burgers. Using the variation
sequence in a defined region of DNA, the differentiation of even closely related
species could be identified (Hossain et al., 2016; Hsieh & Hwang, 2004). The
PCR amplification size with species-specific oligonucleotide primers and the Mt
DNA segments of both donkey and horse are the same, so direct PCR could not
be used to discriminate these two species. Doosti et al. (2014) used PCR-RFLP
coupled with Alu restriction enzyme to successfully identify donkey and horse
species in Halal food. In addition, cattle-buffalo, and sheep-goat (Girish et al.,
2005), cattle, yak, and buffalo (Chen, Liu, & Yao, 2010), swine and wild boar
(Mutalib et al., 2012), and chicken, beef, and sheep meat (Kušec et al., 2017)
have also been successfully differentiated by using PCR-RFLP technologies.
However, the PCR-RFLP technique is complex and requires a suitably equipped

laboratory and expensive enzymes (Kumar et al., 2015), and the enzymatic
process is prone to incomplete digestion and leads to unreliable results. In
addition, some of the disadvantages of direct speciesspecific PCR technologies
could also affect PCR-RFLP, such as not being able to be utilized for
quantification (Hossain, Ali, Hamid, Hossain et al., 2017). Therefore, some
20 | P a g e
researchers committed to improving this approach through combined methods.

Hossain et al. (2016) developed multiplex PCR coupled with RFLP to
simultaneously quantitatively and qualitatively differentiate cattle, buffalo, and
porcine meat by restricting the PCR products of ND5 and CytB through the AluI,
EciI, and FatI enzymes, and 0.1% (w/w) of adulterated species could be detected
in autoclaved frankfurters. This technique not only ensured accuracy but also
improved the detection sensitivity and quantitation.
3.4. Loop-mediated isothermal amplification
Loop-mediated isothermal amplification (LAMP) is a newly developed

meat adulteration identification technology based on DNA markers in recent
years (Lee, Kim, Hong, & Kim, 2016; Zhang, Lowe, & Gooding, 2014). The
LAMP assay requires four to six different primers to recognize six to eight precise
gene sequences (Notomi et al., 2000), and DNA amplification is performed by a
Bst or Gsp DNA polymerase with strand-displacing activity (Cho, Dong, & Cho,
2014), which endows the technology with high sensitivity and specificity. In
addition, amplification is carried out under isothermal conditions (60 to 65 ◦C)
for 30 to 60 min and does not require sophisticated and expensive instruments
(Azam et al., 2018; Cho et al., 2014; Deb et al., 2016; Wang, Wan et al., 2019).
More importantly, the reaction results of LAMP could be directly monitored by
naked eye observation because precipitation of white pyrophosphate ions had
been produced during the reaction. Adding fluorescent dyes for colour reactions
could improve the sensitivity and achieve real-time monitoring of the reaction
(Zhang et al., 2014; Zhang et al., 2019)
he reaction (Zhang et al., 2014; Zhang et al., 2019). A number of studies have
demonstrated that LAMP might be a fast, efficient, and economical method for
meat adulteration detection (Azam et al., 2018; Cho et al., 2014; Deb et al., 2016;
Ran et al., 2016; Sul et al., 2019; Wang, Wan et al., 2019; Xu et al., 2017; Zhang
21 | P a g e
et al., 2019). Using LAMP combined with colorimetric detection technology for
the COI gene, 0.1% of horse meat could be detected from processed meats (Wang,
Wan et al., 2019), and this method had obvious advantages in commercially
processed meat products. However, LAMP technology has high requirements for
primer design. The primers cannot undergo dimer formation, complementation
of the primer itself, and the formation of the hairpin structure of the 3’ ends.
Recently, Sul et al. (2019) designed five primers of the chicken mitochondrial
16S rRNA gene, including two outer primers (forward primer F3 and reverse
primer B3), two inner primers (forward inner primer FIP and reverse inner primer
BIP), and one loop primer (reverse loop primer LB) to identify chicken in
processed meat; by using LAMP techniques, 0.1% chicken meat in a raw meat
sample and 1% chicken meat in a heat- and pressure-treated meat sample could
be detected, the detection time was only approximately 30 min, and this method
had been successfully applied to commercial monitoring.
3.5. Droplet digital PCR
Droplet digital PCR (ddPCR) is a new method for nucleic acid detection and
quantification. The principle of this method is to perform independent PCR on a
large number of small reactors in the form of droplets that contain or do not
contain one copy of the target molecule template in each reactor (Figure 3), to
achieve “single-molecule template PCR amplification” (Cai et al., 2017; Li, Bai
et al., 2018; Pohl & Shih Ie, 2004). After amplification, the number of copies of
the target sequence can be counted by the number of positive reactors based on
the fluorescence signal (Figure 3). The ddPCR method achieved absolute DNA
quantification, and no standard curve was required. In addition, because the
droplet distribution principle was adopted, each PCR system contained only one
template, which mitigated the interference of foreign genes and improved the
accuracy and sensitivity of detection. Based on these advantages, the ddPCR
method has been used in the field of food quality safety control, such as
22 | P a g e
genetically modified foods (Demeke & Dobnik, 2018; Košir, Demšar, Štebih, Žel,
& Milavec, 2019), foodborne diseases (Li, Zhang et al., 2019; Suresh, Harlow, &
Nasheri, 2019), and food adulteration (or food ingredient content) (Naaum et al.,
2018; Noh et al., 2019; Shehata et al., 2017; Shehata et al., 2019; Xiang et al.,
2017). By using ddPCR, direct relative quantification could be achieved because
low-concentration templates could be detected in high numbers of nontarget
nucleic acids (Floren et al., 2015; Morisset, Štebih, Milavec, Gruden, & Žel,
2013; Noh et al., 2019), which is very common in processed meat products.
Shehata et al. (2017) developed a ddPCR method to detect adulterations in
processed meats; as low as 0.05% and 0.01% (w/w) of bovine and turkey targets
and pork and chicken targets could be identified, respectively, and this method
has been gradually introduced to commercial applications (Naaum et al., 2018;
Shehata et al., 2019).
However, ddPCR still has many problems in practical applications. For example,
some of the existing ddPCR methods cannot be converted from the gene copy
number to the meat mass ratio, and some of the conversion steps are complicated
(Basu, 2017) because the cell density, genome size, and copy numbers of target
genes in the genomic DNA vary among different animal species (Ballin,
Vogensen, & Karlsson, 2009; Ren et al., 2017). In addition, the ddPCR
experimental process requires highly precise operation because the droplet
partition and volumes may affect the detection results (Basu, 2017; Demeke &
Dobnik, 2018). These shortcomings limit the application of this method.
Therefore, the establishment of a simple, convenient, and accurate digital PCR
quantitative detection system to improve the stability and commercial
applicability of meat adulteration detection is necessary.
23 | P a g e
FIGURE 3 Detection principle of droplet digital PCR
3.6. DNA barcoding and next-generation sequencing
The above reviewed DNA-based technologies are mainly targeted detection

methods, but in meat adulteration detections, many unknown meat species should
be identified (Cottenet, Blancpain, Chuah, & Cavin, 2020). Following this need,
an untargeted detection technology named DNA barcoding had been developed
(Cavin, Cottenet, Cooper, & Zbinden, 2018; Hebert, Cywinska, & Ball, 2003).
Through PCR amplification and sequencing of specific gene fragments, and then
search it in the Barcode of Life Data (BOLD) system and the U.S. National Centre
for Biotechnology Information database, the adulterated meat species could be
identified (Fiorino et al., 2018). Since the DNA barcoding method provides a
rapid, accurate, and unknown species identification, it is considered a promising
meat adulteration detection technique and is already used in animal meat
identification (Ahmed et al., 2018; Cottenet, et al., 2020; Shehata et al., 2019;
Xing, Hu, Han, Deng, & Chen, 2020; Xing et al., 2019) and fish authentication
(Fiorino et al., 2018; Giusti, & Armani, 2017; Ha, Huong, Hung, & Guiguen,
2018; Xing, Zhang et al., 2020).
The early DNA barcoding technology mainly relied on Sanger DNA sequencing
for an approximately 650 bp region of COI and CtyB gene of the animal species
(Böhme et al., 2019; Xing, Zhang et al., 2020). However, when there are (<200
24 | P a g e
bp) depending on the treatment (Cavin et al., 2018). Thus, a minibarcoding

method, which focuses on shorter DNA fragments (100 to 200 bp), had been
developed by using NGS technology (Böhme et al., 2019; Xing, Hu et al., 2020).
Compared to the early DNA barcoding technology, mini barcoding has the
advantages of a higher throughput and higher sensitivity (Böhme et al., 2019;
Xing, Hu et al., 2020).
In addition, it is applicable for meat identification even on highly processed meat

products when targeting small fragments (Cottenet et al., 2020; Guisti & Armani,
2017). Recently, Cottenet et al. (2020) successfully applied a commercial NGS
Food Authenticity Workflow to identify untargeted meat species, 46 pure and
mixture meat species were successfully tested, including some close-related
species, such as bison versus beef and red deer versus reindeer. Furthermore, the
method was also suitable for processed (grounded, cooked, and canned) samples
identification. However, the DNA barcoding technology also has some
disadvantages, such as expensive sequencing costs, time-, and sample-consuming
(Fiorino et al., 2018). Meanwhile, developing more unique barcode candidates
should also be focused on the future research.
In addition to the technologies reviewed above, some other DNA-based meat

adulteration detection technologies, such as DNA lateral flow (Ha, Thienes et al.,
2018; Magiati et al., 2019; Masiri et al., 2016), randomly amplified polymorphic
DNA-polymerase chain reaction (Böhme et al., 2019; Kumar et al., 2015), high-
resolution melting (Fernandes, Costa, Oliveira, & Mafra, 2018; Lopez-Oceja,
Nuñez, Baeta, Gamarra, & de Pancorbo, 2017), and so on, have also been
developed in recent years. Because these technologies are not commonly used,
this review did not focus on them.
25 | P a g e
4. Protein-based technologies
Meat adulteration detection by using PCR methods is usually affected by

many factors, such as poor trace quantitative analysis, sampling pollution, and
DNA degradation in meat processing (Di Pinto et al., 2015; Li, Bai et al., 2018;
Naveena et al., 2017). Moreover, DNA extraction is timeconsuming and must be
optimized for each particular case to ensure that enough DNA was obtained for
the analysis (Song et al., 2017). Protein is the main component of meat. The
specific protein composition and three-dimensional structure of specific proteins
have certain conservation and specificity between species, which is suitable for
meat adulteration detection. Moreover, some protein molecules are tissue specific
and can be used for the identification of less valuable additives, such as
connective tissue, blood plasma, or milk preparations (Jiang, Fuller, Hsieh, &
Rao, 2018; Montowska & Spychaj, 2018; Ofori & Hsieh, 2007, 2015).
Protein-based food adulteration identification technologies mainly include the

following three methods: electrophoretic analysis based on protein band
characteristics, immunoassays based on antigen antibody-specific reactions, and
mass spectrometric analysis based on proteins or short peptides. Traditional
electrophoretic techniques have seldom been used because their sensitivity is
insufficient. Therefore, meat adulteration detection techniques based on proteins
mainly include immunoassays and mass spectrometric analysis methods (Table
3)
26 | P a g e
TABLE 3 Recent 5 years representative studies of protein-based technologies for meat

adulteration identification
Detection items Detection technology Immunogen and antibody Method sensitivity References
(Limit of detection)
Pork adulteration Direct ELISA Porcine immunoglobulins G 0.01% (w/w) of pork Seddaoui and
in beef (IgG) and polyclonal antibodies in beef Amine (2020)
Pork adulteration Indirect competitive Porcine IgG and polyclonal 0.1% of pork Mandli et al.
in meat ELISA antibodies adulteration (2018)
Porcine Indirect competitive Mammalian haemoglobin 13F7 0.5 ppm of PHb Jiang, Fuller,
haemoglobin in ELISA and monoclonal antibodies Hsieh, and Rao
meat products (MAbs 13F7) (2018)
Pork fat protein in Indirect ELISA Thermal stable-soluble protein 1% (w/w) of pork fat Kim et al. (2017)
other animal (TSSP) and monoclonal adulteration
meats antibodies (MAbs PF 2B8-31)
Fat adulteration in Indirect ELISA Skeletal muscle troponin I ND Park et al. (2015)
cooked and (smTnI) and monoclonal
noncooked of antibodies (commercial
pork, beef, and ab97427)
chicken
Cooked wild rat Sandwich ELISA Rat heat-resistant proteins and 0.01 𝜇g/L based OD Chen, Ran, Zeng,
meat in pork, beef, polyclonal antibodies values and Xin (2020)
and chicken
Heated Sandwich ELISA Mammalian skeletal troponin 1% (g/g) of heated Jiang, Rao, Mittl,
mammalian meats and monoclonal antibodies meats adulterated and Hsieh (2020)
adulterated in (MAbs 6G1 and 8F10) in poultry meats
poultry meats
4.1. Enzyme-linked immunosorbent assay
There are two kinds of immunoassay techniques used in meat adulteration

detection: enzyme-linked immunosorbent assay (ELISA) and immunosensors.
ELISA is the most widely applied immunoassay method of meat adulteration
detection (Ha, Thienes et al., 2018). During ELISA detection, an enzyme
conjugate is first prepared by using a known antigen or antibody adsorbed on the
surface of the solid phase, and the enzyme conjugate can specifically bind to
samples containing antibodies or antigens. After washing and incubation, the
substrates are added and reacted a colour, and the extent of colour development
27 | P a g e
is positively correlated with the amount of the antibody or antigen in the samples
(Figure 4).
The commonly used ELISA methods for meat adulteration detection are direct
ELISA (Mandli, El Fatimi, Seddaoui, & Amine, 2018; Seddaoui & Amine, 2020),
sandwich ELISA (Ayaz, Ayaz, & Erol, 2006; Hsieh & Ofori, 2014; Thienes et al.,
2018; Zvereva et al., 2015), and indirect competitive ELISA (Hsieh & Ofori,
2014; Jiang et al., 2018; Mandli et al., 2018) (Figure 4). Compared to DNA-
based detection technologies, ELISA methods show simplicity of sample
preparation, low cost, and less time consumption. In addition, ELISA detection
does not require complex equipment and is easily feasible for onsite monitoring
(Mandli et al., 2018; Thienes, Masiri, Benoit, Barrios-Lopez, Samuel, Krebs et
al., 2019). Using direct ELISA methods developed for anti-pig IgG polyclonal
antibody, as low as 0.01% (w/w) pork adulteration in raw meat, could be
determined in 14 hr and 15 min, but the detection time decreased to 45 min when
using a competitive ELISA method that was developed by immobilizing an IgG
standard and competed with the IgG in samples (Mandli et al., 2018). To
implement fast and onsite quantitative determination, researchers were
committed to developing speciesspecific ELISA kits for meat adulteration, and
these detection kits have been applied in meat processing factories or food
regulatory agencies. For example, a sandwich ELISA method was suggested as a
reference method for animal meat aduteration identification in cooked and canned
meat and poultry products by the USDA Food Safety and Inspection Service
(Perestam, Fujisaki, Nava, & Hellberg, 2017). Besides, a sandwich ELISA kit
developed with the monoclonal antibody (MAb) technique had been successfully
applied in meat adulteration of commercial meat products in Turkey, and 22.0%
of the samples were determined to not be in compliance with the Turkish Food
Codex (Ayaz et al., 2006). Recently, microbiology, Inc. developed a series of
sandwich ELISA kits for the quantitative detection of pork, beef, and
28 | P a g e
chicken/turkey in cooked meat, and 0.1% (w/w) of the target species could be
detected in 70 min with no interference by common food matrices, such as pizza,
eggs, milk, and so on (Thienes et al., 2018; Thienes, Masiri, Benoit, Barrios-
Lopez, Samuel, Krebs et al., 2019; Thienes, Masiri, Benoit, Barrios-Lopez,
Samuel, Meshgi et al., 2019).
Because ELISA methods depend on the specific reaction of antigen and antibody,
it can only detect meat species for which specific antibodies have already been
developed. Therefore, developing proper protein markers for ELISA methods is
essential. The optimal protein marker should meet the following criteria: (1)
uniqueness between species, (2) high concentrations in raw meats or meat
products, (3) fairly stable during meat processing, especially during heat
processing and pickling, and (4) stable in the presence of food additives, such as
sodium nitrate or nitrite, sodium chloride, edible phosphates, citrates, ascorbates,
and so on (Zvereva et al., 2015). Skeletal troponin I (TnI) is a part of myofibrils
and is present as a constituent of the stable tropomyosin–troponin complex; it is
considered a protein specific to muscle cells. Therefore, Zvereva et al. (2015)
developed a sandwich ELISA method based on TnI to detect beef, pork, lamb,
and horse meat, but this protein marker could not identify poultry chicken, turkey,
and duck meat. Animal porcine haemoglobin could retain molecular integrity and
stability after heat treatment and remain stable under acidic and alkaline
conditions. Therefore, Jiang et al. (2018) proposed a MAb 13F7-based indirect
competitive ELISA to quantitatively detect porcine haemoglobin in meat
products, and the limit of detection (LOD) was as low as l.5 mg/kg. More
importantly, this method has potential application value in detecting diseased
pork, a serious food safety issue in developing countries, by determining the
residual porcine haemoglobin level in pork because the porcine haemoglobin
concentration is much higher in diseased pork than in healthy pork due to
ineffective bleeding. In addition, the ELISA methods cannot implement
29 | P a g e
multispecies detection, which is also one of the main disadvantages of this

technology.
FIGURE 4 Schematic representation of ELISA. (a): Direct ELISA, (b): sandwich ELISA,
and (c): indirect competitive ELISA
4.2. Immunosensors
As mentioned above, the ELISA methods show some limitations during

meat adulteration detection due to false positives caused by cross-reactivity and
proteolysis caused by heat processing. Therefore, researchers are dedicated to
developing more sensitive, time-saving, and low-cost protein-based methods to
identify meat adulteration. Recently, immunosensors have been reported to
identify food adulteration detection (Ruiz-Valdepeñas Montiel et al., 2019). The
principle of immunosensor methods is similar to that of ELISA methods, but the
former uses a biosensor to transit and amplify the optical, electrical, or other
signal of immune response to a detectable signal, so the sensitivity of the method
is better than that of ELISA. The immunosensor technique has been widely used
in food allergy, pesticide residue, and milk adulteration analyses, among others.
30 | P a g e
However, only a few reports have utilized immunogens for meat adulteration
detection (Kuswandi, Gani, & Ahmad, 2017; Lim & Ahmed, 2016; Mandli et al.,
2018; Masiri et al., 2016). Using an electrochemical competitive immunosensor
based on an antipig IgG polyclonal antibody, as low as 0.01% pork adulteration,
could be identified within 20 min. Compared with competitive ELISA methods
(0.1% pork adulteration could be identified in 45 min), the detection limit and
detection time were greatly improved (Mandli et al., 2018). By using a lateral
flow device, 0.01%, 0.1%, and 1% pork could be identified from raw meat, beef
meatballs, and cooked meat, respectively (Kuswandi et al., 2017; Masiri et al.,
2016). Although the immunosensor method is not widely used, we think it has
good application prospects in the field of meat adulteration identification,
especially in manufactory onsite monitoring.
4.3. Protein mass spectrometry analysis
Because DNA-based technologies and immunoassay technologies are

limited by DNA and protein stability, respectively, most of these methods exhibit
false positives and high detection limits when identifying heat processed meat. In
addition, for the detection of meat in complex food matrices (such as emulsion-
type processed meat) and distinction between similar meat species, such as sheep
and goat, chicken and turkey, and duck and goose (Table 3), DNAbased
technologies and immunoassay technologies are usually not suitable (Fornal &
Montowska, 2019; Prandi et al., 2017; Song et al., 2017; Stader, Judas, & Jira,
2019). Therefore, researchers are dedicated to developing techniques that are
more accurate and have a wider range of applications for meat adulteration
identification. Recently, mass spectrometry technologies based on protein and
peptide analysis have rapidly evolved and have been increasingly applied for
meat species identification. Since the amino acid sequence of peptides are more
stable than DNA during meat processing, they have an incomparable advantage
in meat adulteration identification, especially for highly processed meat products
31 | P a g e
and similar meat species (Prandi et al., 2017). By using a UHPLCMS/MS

method, 0.7% of porcine blood plasma could be identified from emulsion-type
pork sausages (Stader et al., 2019). Skeletal muscle proteins are processing stable
and species specific, so Montowska et al. (2015) developed a rapid LESAMS
method with no fractionation steps before and after protein digestion to identify
species-specific markers for meat adulteration detection, and 25 species and heat
stable peptide markers have been identified in processed beef, pork, horse,
chicken, and turkey meat. This method has potential application value in meat
quality evaluation by assessing fibre-type composition.
Generally, mass spectrometry technologies can identify species by

simultaneously monitoring multiple specific peptides (Jira & Munch, 2019; Li,
Zhang et al., 2018), which reduces the probability of false positives. In addition
to specificity, a good peptide marker should be of well process stability, suitable
size (≥ 6 amino acids), and containing no cysteine (Johnson et al., 2011). Through
quantification and evaluation of 11 species-specific proteins and 14 unique
peptides, Montowska and Spychaj (2018) developed a label-free quantification
method utilizing high-resolution mass spectrometry to determine the authenticity
of cooked and smoked sausages. The LOD was 5% (w/w) for pork and beef in a
three-component matrix and 1% (w/w) for horse meat. Because mass
spectrometry technologies can achieve multimarket detection, it can be
implemented to identify similar species (Fornal & Montowska, 2019; Montowska
& Fornal, 2017). Poultry species, especially duck versus goose and chicken
versus turkey, are more difficult to identify than mammalian species in meat
products. Recently, Fornal and Montowska (2019) developed an LC-QQQ
method for the detection of chicken, duck, and goose meat in highly processed
meat products, and the methods showed a high ability for quantification and
qualification and low matrix interference. More importantly, this method
successfully identified two adulterations of products with undeclared species in
32 | P a g e
commercial products subject to homogenization, smoking, cooking, semidrying,

and sterilization processing. Water buffalo, sheep, and goats have relatively high
homogeneity, and mixtures of their meat are difficult to distinguish (Naveena et
al., 2017; Naveena et al., 2018). Using 2DE-MS and OFFGEL-MS technologies
based on the marker of myosin light chain 1 and 2, Naveena et al. (2018)
successfully determined sheep and goat meat from raw and cooked water buffalo
meat, and the detection limits were as low as 0.1% (w/w) in the OFFGEL-MS
method.
In addition to the detection of adulterated species, mass spectrometry also plays

an important role in the detection of inferior meat. Freezing is a commonly used
method in meat preservation, but long-term frozen meat, which is called “zombie
meat” in China, often causes nutrient loss and an excess of pathogenic
microorganisms and poses serious health risks. However, some illegal
manufacturers use zombie meat instead of fresh meat during meat product
processing, and DNA-based and immunoassay techniques do not easily
discriminate between the same species of fresh and zombie meat. Therefore, Kim
et al. (2015) developed a 2DE-MS-based proteomics method to detect fresh meat
and freeze-thawed pork. A total of 450 protein spots from meat exudates were
identified, and 22 proteins, mainly myofibrillar protein, myoglobin, and so on,
could be selected as markers to discriminate between fresh and freeze-thawed
pork. However, the cost of equipment and maintenance of mass spectrometric
instruments are high, and sample pre-treatment is expensive. Moreover, the
analysis of MS data is very complicated, especially proteomics data analysis
based on mass spectrometry, which requires a strong mathematical statistics
background; thus, the technicians must be highly trained (Table 1), which restricts
its promotion and application.
5. Technologies based on metabolite profiling
33 | P a g e
Small-molecule metabolites, except proteins and nucleic acids, vary in

different meats. Therefore, meat adulteration can be identified by comparative
analysis of metabolite profiles in the samples. This technology can better reveal
the physiological and biochemical status of the processed samples and reflect the
small differences in metabolites between samples with excellent sensitivity and
accuracy (Lim et al., 2017). In meat adulteration identification, lipidomic and
flavoromics are the main focus. For each meat species, the type and quantity of
fatty acids in tissues are specific, so the lipidome could be used to distinguish the
species of a meat adulterant (Ballin, 2010). By using GC-MS and UHPLCMS in
tandem with principal component analysis (PCA) and partial least squares
discriminant analysis (PLS-DA), Trivedi et al. (2016) established a metabolomics
and lipidomic method to detect pork adulteration in beef. The results indicated
that 23 metabolites were significantly correlated with pork adulteration in beef.
Volatile compounds are another target marker for meat adulteration identification
because the flavour of meat products of different species has special
characteristics. By using an electronic nose and GC-MS detection, Nurjuliana et
al. (2011), Zhang et al. (2015), and Haddi et al. (2015) successfully developed a
method using an electronic nose and multivariate analysis to identify meat
adulteration. These methods provide some new ideas for the identification of
adulterated meats. However, because the animal growth environment, meat
storage, and processing conditions have a great impact on the metabolite content,
whether these metabolites are species specific requires further confirmation. In
addition, from the current literatures report, the technologies based on metabolite
profiling cannot achieve quantitative analysis in the meat adulteration detection.
Therefore, these technologies are not commonly applied currently.
6.Non-destructive technologies
DNA-, protein-, and metabolite-based meat adulteration identification
techniques require sample pre-treatment, such as tissue disruption, target analyte
34 | P a g e
extraction, and purification, and these pre-treatment processes are invasive,

cumbersome, and time-consuming (Wang, Peng, Sun, Zheng, & Wei, 2018).
Therefore, researchers are dedicated to developing new simple and non-invasive
sample pre-treatment techniques for the detection of meat adulteration, of which
spectroscopic techniques are the most widely used. Spectroscopic analysis is
based on the principle that different components, such as moisture, proteins, fatty
acids, lipids, or elements, in meat and meat products produce different spectra at
different wavelengths (Rady & Adedeji, 2018; Wang, Peng et al., 2018). Spectral
technologies have been gradually applied to food quality and safety control in
recent years due to their time savings, simple sample preparation, and lack of
need for sample pre-treatment (Table 1), which are called non-destructive
technologies (Wang, Peng et al., 2018; Zheng et al., 2019). The current non-
destructive techniques applied in meat adulteration mainly include infrared
spectroscopy (IRS), Raman spectroscopy (RS), hyperspectral imaging (HSI), and
laserinduced breakdown spectroscopy (LIBS) (Table 4).
TABLE 4 Recent 5 years representative studies of non-destructive analytical technologies

for meat adulteration detection
35 | P a g e
Detection Detection Wavenumber Spectral pre- Data Performance summary References

items technology range treatment analysis
Minced beef Vis/NIR 350 to 2,500 Standardization CARS, CARS-RF model provided optimal Weng et al.
adulteration nm and SG RF, and performance for beef adulterated (2020)
PLSR with pork (Rp2 and RMSEP were
0.973 and 2.145).
CARS-PLSR showed the best
prediction for beef adulterated
with beef heart (Rp2 and RMSEP
were 0.960 and 2.758)
Pork, NIRS 1,100 to SNV, MSC, DT, PCA Classification of validation sets López
chicken, dog, 2,300 nm and 1st/2nd and between 78.95% and 100%. Maestresalas
and horse derivative PLS-DA The limit detection of foal meat et al.
meat adulteration in minced beef as low (2019)
adulteration as 1%, Lidia breed cattle in minced
in minced beef as low as 2%
lamb and
beef
Classification NIRS 900 to 1,700 SG and KS LDA, RF, Differentiating breast samples Nolasco-
of chicken nm and from thighs and drumstick with Perez et al.
parts SVM 98.8% accuracy (2018)
Plant and Vis/NIR 400 to 1,700 1st/2nd LDA, The highest correlation coefficient Rady and
animal nm derivative, NOR decision values of the prediction models Adedeji
protein SNV, MSC, and trees, are 0.85 (1.77), 0.86 (1.95), 0.86 (2018)
adulterants MC CART, (1.98), 0.86 (1.87), and 0.87 (1.64)
in minced KNN, for assessing pork, TVP, chicken,
beef and PLS-DA, WG, TVP, and pork.
pork FFNN, +TVP in minced beef,
SVM, respectively, and 0.86 (1.79) for
NB, and assessing TVP in minced pork
PLSR-
IPLS
Beef UV/Vis/NIR 200 to 1,100 NOR MSC, SNV, PW-AF The best UV-Vis-NIR model was Chen et al.
adulteration nm and 1st/2nd and PW-AF model, (2018)
with spoiled derivative PLSR which selected 29 wavelengths to
beef obtain RMSEs of 0.10 and 0.12 for
cross validation and prediction,
respectively
Beef and FT-IRS 1,700 to SNV, MSC, and PLSR ANN showed higher R2 of 0.999 Keshavarzi,
chicken in 1,071 cm-1 Min-Max NOR and and lower training and testing Banadkoki,
meat ANN performance errors. Faizi,
products (RMSEcv = 0.32 and RMSEp = Zolghadri,
0.73) in comparison with and Shirazi.
PLSR model (R2 = 0.889, RMSEcv = (2020)
1.02, and RMSEp = 1.74)
Pork FT-IRS 4,000 to 450 1st/2nd PLS-DA PLS-DA showed better Yang, Wu et
adulterated cm-1 derivative, and identification than the SVM. al.
SVM (2018)
36 | P a g e
in the beef MSC, SNV, SG, The R2 of calibration and testing

and mutton and NOR sets in PLS-DA reached 0.99 and
0.99,
RMSEC was 0.06, and both the
RMSECV and RMSEP were 0.08
6.1. Infrared spectroscopy
IRS is an optical technique that detects molecular bond (such as C-H, O-

H, N-H, C-O, etc.) vibrations and rotations upon absorption of infrared light.
Because different chemical functional groups absorb infrared light at different
frequencies, IRS can be used for meat adulteration identification because the
composition of various meats is different, and its absorption spectrum is specific
(Fu & Ying, 2016). The most commonly used infrared spectrum technologies in
meat adulteration are near-infrared spectroscopy (NIRS), from 4,000 to 12,500
cm−1, and mid-infrared spectroscopy, from 400 to 4,000 cm−1 (Abu-Ghoush et
al., 2017; Wu et al., 2018). Using Fourier transform infrared spectroscopy (FT-
IRS), 10% of animal offal in ground beef could be detected, and the accuracy was
as high as 99% (Hu et al., 2017). Recently, Wu et al. (2018) developed an FT-IR
method combined with improved PLS-DA to detect Norwegian salmon
adulteration with Chinese Heilongjiang salmon. Absorption peaks of CH2, C =
O, and C–O–C stretching vibrations from lipids or protein were identified to
distinguish Chinese Heilongjiang salmon from Norwegian salmon. Moreover,
IRS methods also showed a certain application prospect in meat quality detection.
Sinanoglou et al. (2018) established an FT-IRS method that suggested that the
absorbance bands of proteins, triglycerides, fatty acids, and carbohydrates of raw
meat and processing meat products are different, and the refrigeration storage
time could be predicted by the partial degradation of triglycerides and proteins.
To improve the accuracy and simplicity of IRS methods, spectral pre-treatment

and multivariate analysis are very important. Infrared scanning can obtain a
number of spectra, including sample information and interference information.
37 | P a g e
Spectral pre-treatment eliminates irrelevant information and noise. Commonly

used spectral pre-treatment methods include normalization, smoothing,
derivation, standard normal variation (SNV), multiplicative scatter correction
(MSC), and so on (Alamprese et al., 2016; Chen et al., 2018). Multivariate
analysis is used to calculate the useful sample information and quantitative
analysis of the target components. Commonly used multivariate tools include
PLS-DA, PLS, multiple linear regression (MLR), principal component
regression, support vector machine (SVM), and so on (Rohman, 2019; Wang,
Peng et al., 2018) (Table 4). Alamprese et al. (2016) applied FT-NIR coupled
with PCA and the PLS-DA model to discriminate turkey adulteration in fresh,
frozen-thawed, and cooked minced beef. PLS-DA classification models are able
to distinguish between low (<20%) and high (≥20%) levels of adulteration.
Recently, Chen et al. (2018) developed UV-Vis-NIR in tandem with a novel
synchronous wavelength selection and pre-treatment methods, artificial fish
swarm algorithm (AF), to detect beef adulteration with spoiled beef. By using
spectral pre-treatment before wavelength selection (PW-AF model), 29
wavelengths were selected for PLS regression analysis, and the rootmean-square
errors (RMSEs) were 0.10 and 0.12 for crossvalidation and prediction,
respectively. The study also found that the sequence of spectral pre-processing
and wavelength selection is very important for the final detection results.
6.2. Raman spectroscopy
RS is a technique for analysing the composition of a substance and its

structure based on the Raman scattering effect (Hu, He, Zhang, Yang, & Liu,
2019). Raman bands are independent of the intensity of the incident light and are
related to the polarizability of the sample constituent itself. The vibrational
frequency fingerprint and intensity in RS could be applied in the analysis of the
nature of molecules and their concentrations (Lee et al., 2017), and, more
importantly, this technique is non-invasive, requires small sample volumes, is
38 | P a g e
insensitive to water, does not require sample preparation, and is suitable for
opaque samples (Hu et al., 2019; Lee et al., 2017; Lee et al., 2018). By using RS
and the PLS-DA model based on functional groups of amino acids, lipids, and
proteins, the non-meat ingredients sodium chloride, sodium tripolyphosphate,
and carrageenan could be determined in pork products (Nunes et al., 2019).
Recently, Lee et al. (2018) successfully established an RS method to distinguish
beef tallow, pork lard, chicken fat, and duck oil when the lard contents ranged
from 0% to 100% (v/v), and the results showed good correlated linear
relationships.
Similar to other vibrational spectroscopic methods, chemometric operations, such

as spectral data pre-processing and multivariate analysis, are also very important
for Raman spectroscopic methods (Teixeira & Sousa, 2019). The common pre-
processing techniques mainly include first derivation, second derivation, MSC,
SNV, and so on, and commonly used multivariate analytical methods include
PCA, hierarchical cluster analysis, PLS-DA, soft independent modelling of class
analogy (SIMCA), artificial neural networks, and so on (Table 4). Chen et al.
(2019) applied different data pre-processing methods to quickly identify rainbow
trout adulteration in Atlantic salmon, and the results indicated that the MSC
method was better than first derivation (FD), second derivation (SD) and SNV.
By using RS in tandem with PLS-DA and SIMCA, offal-adulterated and
authentic beef burgers could be identified, and the accuracy rate was as high as
90% (Zhao et al., 2015).
6.3. Hyperspectral imaging
39 | P a g e
IRS and RS are single-point detection methods and only collect

information about local areas of the samples (Feng & Sun, 2012), which suggests
that the spectral information cannot fully represent the information of the samples
due to uneven distribution of the adulterated ingredients (Zhao et al., 2019; Zheng
et al., 2019). Moreover, these methods could also not intuitively reflect the real
aspect of the samples. Therefore, the combined application of spectroscopic and
imaging technologies, such as multispectral imaging (MSI) and HSI, developed
in recent years further overcomes these shortcomings (Ropodi et al., 2017; Zheng
et al., 2019). MSI technology is limited in meat adulteration detection because
few wavelengths could be applied (Zheng et al., 2019). HSI technology has been
proven to be a promising method in meat adulteration detection (Al-Sarayreh,
Reis, Yan, & Klette, 2018; Kamruzzaman, Makino, & Oshita 2015a;
Kamruzzaman et al. 2015b; Kamruzzaman et al., 2016; Velásquez, Cruz-Tirado,
Siche, & Quevedo, 2017; Xiong et al., 2015; Zhao et al., 2019; Zheng et al.,
2019). A hyperspectral image contains a great deal of information in a three-
dimensional (3D) form called a “hypercube”: two of the dimensions are
coordinate information of spatial pixels (x and y), and the third dimension (𝜆) is
wavelength information (Ropodi, Panagou, & Nychas, 2016; Wang, Peng et al.,
2018; Xiong et al., 2015) (Figure 5). As a combination and extension of
traditional spectroscopy and digital imaging, HSI provides detailed information
about external attributes (such as shape, size, and colour of the samples) and
internal attributes (such as chemical composition) (Kamruzzaman et al. 2015b;
Wang, Peng et al., 2018). Kamruzzaman and co-workers (2015a) used a visible
near-infrared hyperspectral imaging (Vis/NIR-HSI) system to detect pork
adulteration in minced beef. Wavelengths of 430, 605, 665, and 705 nm were
selected to replace the full-range spectra to build the MLR model. This method
could predict 2% to 50% pork adulteration in minced beef, and the correlation
coefficient and standard errors were 0.985 and 4.172%, respectively. Recently,
Zheng et al. (2019) established a Vis/NIR-HSI system for the detection of duck
40 | P a g e
meat in minced lamb. By using the second derivative by Savitzky-Golay to reduce

dimensionality, 14 effective wavelengths were identified to establish the partial
least square regression (PLSR) model, and the correlation coefficient and
standard errors were 0.98 and 2.51%, respectively.
FIGURE 5 Flowchart for meat adulteration detection and visualization of the HIS
method. Figure derived from Kamruzzaman et al. (2015a), Li et al. (2020), and Zhao et
al. (2019). Abbreviations: ROI, regions of interest; Rp 2, coefficient of the prediction
model
To date, HSI technology has seldom been applied in industry settings due
to technical challenges. One of the most challenging aspects is data processing
(Reis et al., 2018). The rich information in hyperspectral images also results in
difficulties in data processing, and complex data models are needed for dimension
reduction (Ropodi et al., 2016). In addition, the establishment of a quantitative
41 | P a g e
prediction model requires a large number of samples. Al-Sarayreh et al. (2018)

developed a self-extraction of spectral and spatial features by using a deep
convolution neural network model to detect fresh and processed red-meat
adulteration. This model showed a 94.4% overall classification accuracy, and it
is simpler and more timesaving than the manual extraction of spectral and spatial
features by using the SVM model. Recently, Zhao et al. (2019) compared the
application of four multivariate statistical analysis methods, including PLSR,
SVM, least squares SVM (LS-SVM), and extreme learning machine, in beef
adulteration. The results indicated that the LS-SVM model showed good
coefficients of determination (0.94 and 0.94, respectively) and RMSEs (5.39%
and 6.29%, respectively) for calibration and prediction.
6.4. Laser-induced breakdown spectroscopy
LIBS is a laser-based optical emission spectroscopy technique used to

detect elemental emission signals from organic and inorganic molecules (Bilge et
al., 2016; Nespeca, Vieira, Junior, Neto, & Ferreira, 2020). Because different
meat products have different elemental composition characteristics, the spectral
fingerprint of LIBS can predict adulterations. The greatest advantages of LIBS
were efficiency and little to no sample pre-treatment (Caceres et al., 2013;
Casado-Gavalda et al., 2017). By using LIBS coupled with PLS analysis, Bilge
et al. (2016) investigated the K, Na, Ca, Mg, and Zn composition characteristics
to identify pork and chicken adulteration in beef. The LODs for pork and chicken
in beef were 4.4% and 2.0%, respectively, and the correlation coefficients (R2)
were as high as 0.994 and 0.999, respectively. Chu et al. (2018) developed a LIBS
method in tandem with MSC spectral pre-treatment and a K-nearest neighbour
identification model to improve the accuracy and stability of meat adulteration
identification.
42 | P a g e
Approximately 240 spectra of scallop, shrimp, pig liver, chicken, beef, and mixed
samples (shrimp powder in scallop powder at a 1:1 ratio) were acquired for
metallic elements (Mg, Na, K, Ca, and Al) and non-metallic elements (C, H, O,
N, and C-N), 120 processed spectra were selected to build the model, the
identification rate improved to 100%, and the prediction coefficient of variance
decreased to 0.56%. Recently, Casado-Gavalda et al. (2017) developed a LIBS
method based on the copper content in beef and beef liver. Using PLSR analysis,
the LOD was 1 ppm with an RSD of 5% to8%. Similarly, Velioglu and co-
workers (2018) developed a LIBS method based on Na, K, Mg, Ca, and Fe and
combined with the PLS analysis to distinguish beef and beef offal. The test
samples were only stored for 2 hr in a refrigerator, and there was no need for
sample preparation. The LOD was as low as 3.8%, and the relative standard
deviation (RSD) was 23.5%. However, the LIBS method is still in the early stages
of laboratory development, and there are many shortcomings, such as low
sensitivity, poor repeatability, and so on, that need to be addressed. In addition,
because the sample size is small, the results may not be representative.
7.Conclusions and future trends
As one of the main food safety issues, meat and meat production
adulteration has attracted increasing attention in recent years. The literature
review has shown that each of the techniques has its advantages and
disadvantages, so a method should be selected or developed according to the
actual application. For example, for food safety monitoring and enforcement
agencies, high sensitivity and accuracy techniques are required, and DNA- and
protein-based methods are more appropriate than spectroscopic methods.
However, for market screening or manufactory onsite monitoring, time savings
and ease of operation are required, so ELISA kit-based protein and small portable
device-based spectroscopic methods are more suitable. In the future, as for the
43 | P a g e
authors’ concerns, the development of meat adulteration technologies should

focus on the following aspects.
First, for DNA-, protein-, and metabolic profiling-based technologies, the mining
of identification indicators/markers is particularly important; markers directly
determine the accuracy of the method, especially for highly processed meat
products, such as high-temperature processing and emulsification processing, or
for distinction between similar species, such as sheep and goat, chicken and
turkey, and duck and goose. For example, the N-glycosylation modification of
proteins is very stable and has high species specificity (Shi et al., 2019), so future
research could use glycosylation proteins as identification indicators for
developing new technologies based on proteins. Second, new interdisciplinary
technologies, such as biochips and biosensors (Mansouri et al., 2019; Wang, Zhu,
Chen, Xu, & Zhou, 2015), are promising applications in the field of meat
adulteration identification to improve sensitivity and save time.
. For example, a recent study reported that a DNA-based electrochemical Geno

sensor was developed to detect donkey adulteration in cooked sausages, and the
limit of quantitation reached a target probe concentration of 148 pM with an RSD
of 0.16%, which indicated better sensitivity and reproducibility than those of
qRT-PCR (Mansouri et al., 2019). Third, omics technologies, especially
proteomics, are important methods in laboratory detection. By detecting multiple
targets at once, the accuracy of detection can be improved, and multispecies
detection can be achieved.
More importantly, unknown meat species could be screened by searching MS

databases. Finally, regardless of any method, effective data processing is
essential. In the future, an effective and convenient chemometric model should
be developed to popularize the application of these techniques. For example, a
deep convolutional neural network (DCNN) has shown outstanding performance
44 | P a g e
in image recognition for automatic self-learning from large amounts of data,

which is suitable for large sets of spectral data (Weng et al., 2020), so it is a good
choice for large sample sizes in non-destructive technologies. However, the
DCNN algorithm is relatively complicated and not suitable for popularization, so
it needs to be further improved in the future.
8. References
Abbas, O., Zadravec, M., Baeten, V., Mikus, T., Lesic, T., Vulic, A., … Pleadin,
J. (2018). Analytical methods used for the authentication of food of animal
origin. Food Chemistry, 246, 6–17.
Abu-Ghoush, M., Fasfous, I., Al-Degs, Y., Al-Holy, M., Issa, A. A., Al-Reyahi,
A. Y., & Alshathri, A. A. (2017). Application of mid-infrared spectroscopy
and PLS-Kernel calibration for quick detection of pork in higher value
meat mixes. Journal of Food Measurement and Characterization, 11, 337–
346.
Ahamad, M. N. U., Hossain, M. A. M., Uddin, S. M. K., Sultana, S., Nizar, N. N.

A., Bonny, S. Q., … Ali, M. E. (2019). Tetraplex real-time PCR with
TaqMan probes for discriminatory detection of cat, rabbit, rat, and squirrel
DNA in food products. European Food Research and Technology, 245,
2183–2194.
Ballin, N. Z., Vogensen, F. K., & Karlsson, A. H. (2009). Species

determination—Can we detect and quantify meat adulteration? Meat
Science, 83, 165–174.
Basu, A. S. (2017). Digital assay’s part I: Partitioning statistics and digital PCR.
SLAS Technology, 22, 369–386.
Bhat, M. M., Salahuddin, M., Mantoo, I. A., Adil, S., Jalal, H., & Pal, M. A.
(2016). Species-specific identification of adulteration in cooked mutton
45 | P a g e
Rista (a Kashmiri Wazwan cuisine product) with beef and buffalo meat
through multiplex polymerase chain reaction. Veterinary World, 9, 226–
230.
Caceres, J. O., Moncayo, S., Rosales, J. D., de Villena, F. J., Alvira, F. C., &
Bilmes, G. M. (2013). Application of laser induced breakdown
spectroscopy (LIBS) and neural networks to olive oils analysis. Applied
Spectroscopy, 67, 1064–1072.
Cao, W., Li, Y., Chen, X., Chang, Y., Li, L., Shi, L., … Ye, L. (2020). Species
identification and quantification of silver pomfret using the droplet digital
PCR assay. Food Chemistry, 302, 125331.
Casado-Gavalda, M. P., Dixit, Y., Geulen, D., Cama-Moncunill, R., Cama-

Moncunill, X., Markiewicz-Keszycka, M., … Sullivan, C. (2017).
Quantification of copper content with laser induced breakdown
spectroscopy as a potential indicator of offal adulteration in beef. Talanta,
169, 123–129.
Dai, Z., Qiao, J., Yang, S., Hu, S., Zuo, J., Zhu, W., & Huang, C. (2015). Species
authentication of common meat based on PCR analysis of the
mitochondrial COI gene. Applied Biochemistry and Biotechnology, 176,
1770–1780.
Daniel, C. R., Cross, A. J., Koebnick, C., & Sinha, R. (2011). Trends in meat
consumption in the USA. Public Health Nutrition, 14, 575–583.
Dantas, V. V., Cardoso, G. V. F., Araujo, W. S. C., de Oliveira, A. C. D., da Silva,

A. S., da Silva, J. B., … Lourenco, L. D. H. (2019). Application of a
multiplex polymerase chain reaction (mPCR) assay to detect fraud by
substitution of bovine meat cuts with water buffalo meat in Northern
Brazil. CyTA-Journal of Food, 17, 790–795.
46 | P a g e
Fang, X., & Zhang, C. (2016). Detection of adulterated murine components in

meat products by TaqMan(c) real-time PCR. Food Chemistry, 192, 485–
490.
Feng, Y. Z., & Sun, D. W. (2012). Application of hyperspectral imaging in food

safety inspection and control: a review. Critical Reviews in Food Science
and Nutrition, 52, 1039–1058.
Fernandes, T., Costa, J., Oliveira, M., & Mafra, I. (2018). COI barcode-HRM as
a novel approach for the discrimination of hake species. Fisheries
Research, 197, 50–59.
Girish, P. S., Anjaneyulu, A. S., Viswas, K. N., Shivakumar, B. M., Anand, M.,
Patel, M., & Sharma, B. (2005). Meat species identification by polymerase
chain reaction-restriction fragment length polymorphism (PCR-RFLP) of
mitochondrial 12S rRNA gene. Meat Science, 70, 107–112.
Giusti, A., & Armani, A. (2017). Advances in the analysis of complex food
matrices: Species identification in surimi-based products using next
generation sequencing technologies. PLoS One, 12, e0185586.
Haddi, Z., El Barbri, N., Tahri, K., Bougrini, M., El Bari, N., Llobet, E., …
Bouchikhi, B. (2015). Instrumental assessment of red meat origins and
their storage time using electronic sensing systems. Analytical Methods, 7,
5193–5203.
Hebert, P. D., Cywinska, A., & Ball, S. L. (2003). Biological identifications

through DNA barcodes. Proceedings of the Royal Society B-Biological
Sciences, 270, 313–321.
Hossain, M. A., Ali, M. E., Abd Hamid, S. B., Asing, Mustafa, S., Mohd Desa,
M. N., & Zaidul, I. S. (2016). Double gene targeting multiplex polymerase
chain reaction-restriction fragment length polymorphism assay
47 | P a g e
discriminates beef, buffalo, and pork substitution in frankfurter products.

Journal of Agricultural and Food Chemistry, 64, 6343–6354.
Iwobi, A. N., Huber, I., Hauner, G., Miller, A., & Busch, U. (2011). Biochip
technology for the detection of animal species in meat products. Food
Analytical Methods, 4, 389–398.
Iwobi, A., Sebah, D., Spielmann, G., Maggipinto, M., Schrempp, M., Kraemer,
I., … Huber, I. (2017). A multiplex real-time PCR method for the
quantitative determination of equine (horse) fractions in meat products.
Food Control, 74, 89–97.
Jiang, H., Wang, W., Zhuang, H., Yoon, S.-C., Yang, Y., & Zhao, X. (2019).
Hyperspectral imaging for a rapid detection and visualization of duck meat
adulteration in beef. Food Analytical Methods, 12, 2205–2215.
Jiang, T. L., Cai, Q. F., Shen, J. D., Huang, M. J., Zhang, L. J., Liu, G. M., &
Cao, M. J. (2015). Establishment of immunological methods for the
detection of soybean proteins in surimi products. LWT-Food Science and
Technology, 64, 344–349.
Jira, W., & Munch, S. (2019). A sensitive HPLC-MS/MS screening method for
the simultaneous detection of barley, maize, oats, rice, rye, and wheat
proteins in meat products. Food Chemistry, 275, 214– 223.
Kamruzzaman, M., Makino, Y., Oshita, S., & Liu, S. (2015). Assessment of
visible near-infrared hyperspectral imaging as a tool for detection of
horsemeat adulteration in minced beef. Food and Bioprocess Technology,
8, 1054–1062.
Kang, T. S., & Tanaka, T. (2018). Comparison of quantitative methods based on

SYBR Green real-time qPCR to estimate pork meat adulteration in
processed beef products. Food Chemistry, 269, 549–558.
48 | P a g e
Kim, G.-D., Jeong, T.-C., Yang, H.-S., Joo, S.-T., Hur, S. J., & Jeong, J.-Y.
(2015). Proteomic analysis of meat exudates to discriminate fresh and
freeze-thawed porcine longissimus thoracis muscle. LWT-Food Science
and Technology, 62, 1235–1238.
Lim, S. A., & Ahmed, M. U. (2016). A label free electrochemical immunosensor

for sensitive detection of porcine serum albumin as a marker for pork
adulteration in raw meat. Food Chemistry, 206, 197–203.
Liu, W. W., Tao, J., Xue, M., Ji, J. G., Zhang, Y. H., Zhang, L. J., & Sun, W. P.
(2019). A multiplex PCR method mediated by universal primers for the
identification of eight meat ingredients in food products. European Food
Research and Technology, 245, 2385–2392.
López-Maestresalas, A., Insausti, K., Jarén, C., Pérez-Roncal, C., Urrutia, O.,
Beriain, M. J., & Arazuri, S. (2019). Detection of minced lamb and beef
fraud using NIR spectroscopy. Food Control, 98, 465–473.
Magiati, M., Myridaki, V. M., Christopoulos, T. K., & Kalogianni, D. P. (2019).

Lateral flow test for meat authentication with visual detection. Food
Chemistry, 274, 803–807.
Mandli, J., El Fatimi, I., Seddaoui, N., & Amine, A. (2018). Enzyme
immunoassay (ELISA/immunosensor) for a sensitive detection of pork
adulteration in meat. Food Chemistry, 255, 380–389.
Mansouri, M., Khalilzadeh, B., Barzegari, A., Shoeibi, S., Isildak, S., Bargahi,
N., … Rashidi, M. R. (2019). Design a highly specific sequence for
electrochemical evaluation of meat adulteration in cooked sausages.
Biosensors & Bioelectronics, 150, 111916.
Naveena, B. M., Jagadeesh, D. S., Kamuni, V., Muthukumar, M., Kulkarni, V.

V., Kiran, M., & Rapole, S. (2018). In-gel and OFFGEL-based proteomic
49 | P a g e
approach for authentication of meat species from minced meat and meat
products. Journal of the Science of Food and Agriculture, 98, 1188–1196.
Nespeca, M. G., Vieira, A. L., Junior, D. S., Neto, J. A. G., & Ferreira, E. C.
(2020). Detection and quantification of adulterants in honey by LIBS. Food
Chemistry, 311, 125886.
Nizar, N. N. A., Hossain, M., Sultana, S., Ahamad, M. N., Johan, M. R., & Ali,
M. E. (2019). Quantitative duplex real-time polymerase chain reaction
assay with TaqMan probe detects and quantifies Crocodylus porosus in
food chain and traditional medicines. Food Additives and Contaminants
Part A, 36, 825–835.
Ofori, J. A., & Hsieh, Y. H. (2007). Sandwich enzyme-linked immunosorbent

assay for the detection of bovine blood in animal feed. Journal of
Agricultural and Food Chemistry, 55, 5919–5924.
Ofori, J. A., & Hsieh, Y. H. (2015). Characterization of a 60-kDa thermally stable

antigenic protein as a marker for the immunodetection of bovine plasma-
derived food ingredients. Journal of Food Science, 80, C1654–C1660.
Orduna, A. R., Husby, E., Yang, C. T., Ghosh, D., & Beaudry, F. (2017)
Detection of meat species adulteration using high resolution mass
spectrometry and a proteogenomic strategy. Food Additives &
Contaminants: Part A, 34(7), 1110–1120.
Park, B. S., Oh, Y. K., Kim, M. J., & Shim, W. B. (2015). Skeletal muscle
troponin I (TnI) in animal fat tissues to be used as biomarker for the
identification of fat adulteration. Korean Journal for Food Science of
Animal Resources, 34, 822–828.
50 | P a g e
Pegels, N., García, T., Martín, R., & González, I. (2015). Market analysis of food
and feed products for detection of horse DNA by a TaqMan real-time PCR.
Food Analytical Methods, 8, 489–498.
Perestam, A. T., Fujisaki, K. K., Nava, O., & Hellberg, R. S. (2017). Comparison
of real-time PCR and ELISA-based methods for the detection of beef and
pork in processed meat products. Food Control, 71, 346–352.
Qin, P. Z., Qu, W., Xu, J. G., Qiao, D. Q., Yao, L., Xue, F., & Chen, W. (2019).
A sensitive multiplex PCR protocol for simultaneous detection of chicken,
duck, and pork in beef samples. Journal of Food Science and Technology,
56, 1266–1274.
Qin, P., Hong, Y., & Kim, H. Y. (2016). Multiplex-PCR assay for simultaneous
identification of lamb, beef, and duck in raw and heat-treated meat
mixtures. Journal of Food Safety, 36, 367–374.
Raharjo, T. J., Nuryanti, I., Patria, F. P., & Swasono, R. T. (2018). Mitochondrial
ND-1 gene-specific primer polymerase chain reaction to determine mice
contamination in meatball. International Food Research Journal, 25, 638–
642.
Rahman, M. M., Ali, M. E., Hamid, S. B. A., Bhassu, S., Mustafa, S., Al Amin,
M., & Razzak, M. A. (2015). Lab-on a-chip PCR-RFLP assay for the
detection of canine DNA in burger formulations. Food Analytical Methods,
8, 1598–1606.
Rahmania, H., Sudjadi, & Rohman, A. (2015). The employment of FTIR

spectroscopy in combination with chemometrics for analysis of rat meat in
meatball formulation. Meat Science, 100, 301–305.
Sakai, Y., Kotoura, S., Yano, T., Kurihara, T., Uchida, K., Miake, K., … Tanabe,
S. (2011). Quantification of pork, chicken, and beef by using a novel
51 | P a g e
reference molecule. Bioscience, Biotechnology, and Biochemistry, 75,

1639–1643.
Schmutzler, M., Beganovic, A., Böhler, G., & Huck, C. W. (2015). Methods for
detection of pork adulteration in veal product based on FTNIR
spectroscopy for laboratory, industrial and on-site analysis. Food Control,
57, 258–267.
Seddaoui, N., & Amine, A. (2020). A sensitive colorimetric immunoassay based

on poly(dopamine) modified magnetic nanoparticles for meat
authentication. LWT-Food Science and Technology, 122, 109045.
Tafvizi, F., & Hashemzadegan, M. (2016). Specific identification of chicken and

soybean fraud in premium burgers using multiplex-PCR method. Journal
of Food Science and Technology, 53, 816–823.
Teixeira, A. M., & Sousa, C. (2019). A review on the application of vibrational

spectroscopy to the chemistry of nuts. Food Chemistry, 277, 713–724.
Thienes, C. P., Masiri, J., Benoit, L. A., Barrios-Lopez, B., Samuel, S. A., Cox,
D. P., … Samadpour, M. (2018). Quandetection of pork contamination in
cooked meat products by ELISA. Journal of AOAC International, 101,
810–816.
Velásquez, L., Cruz-Tirado, J. P., Siche, R., & Quevedo, R. (2017). An

application based on the decision tree to classify the marbling of beef by
hyperspectral imaging. Meat Science, 133, 43–50.
Velioglu, H. M., Sezer, B., Bilge, G., Baytur, S. E., & Boyaci, I. H. (2018).
Identification of offal adulteration in beef by laser induced breakdown
spectroscopy (LIBS). Meat Science, 138, 28–33.
Wang, Z. C., Wang, Z. Y., Li, T. T., Qiao, L., Liu, R., Zhao, Y., … Chen, A. L.
(2019). Real-time PCR based on single-copy housekeeping genes for
52 | P a g e
quantitative detection of goat meat adulteration with pork. International

Journal of Food Science and Technology.
Weng, S., Guo, B., Tang, P., Yin, X., Pan, F., Zhao, J., … Zhang, D. (2020).
Rapid detection of adulteration of minced beef using Vis/NIR reflectance
spectroscopy with multivariate methods. Spectrochimica Acta Part A, 230,
118005.
Wiedemair, V., De Biasio, M., Leitner, R., Balthasar, D., & Huck, C. W. (2018).
Application of design of experiment for detection of meat fraud with a
portable near-infrared spectrometer. Current Analytical Chemistry, 14, 58–
67.
Xing, R., Wang, N., Hu, R., Zhang, J., Han, J., & Chen Y. (2019). Application of
next generation sequencing for species identification in meat and poultry
products: A DNA metabarcoding approach. Food Control, 101, 173–179.
Xiong, Z., Sun, D.-W., Pu, H., Zhu, Z., & Luo, M. (2015). Combination of spectra
and texture data of hyperspectral imaging for differentiating between free-
range and broiler chicken meats. LWT-Food Science and Technology, 60,
649–655.
Xu, J., Zhao, W., Zhu, M., Wen, Y., Xie, T., He, X., … Zhong, T. (2016).
Molecular identification of adulteration in mutton based on mitochondrial
16S rRNA gene. Mitochondrial DNA A, 27, 628–632.
Yang, C. T., Ghosh, D., & Beaudry, F. (2018) Detection of gelatine adulteration
using bio-informatics, proteomics, and high-resolution mass spectrometry.
Food Additives & Contaminants: Part A, 35, 599–608.
Yang, F., Ding, F., Chen, H., He, M. Q., Zhu, S. X., Ma, X., … Li, H. F. (2018).
DNA barcoding for the identification and authentication of animal species
53 | P a g e
in traditional medicine. Evidence Based Complementary and Alternative

Medicine, 2018, 5160254
Yang, L., Wu, T., Liu, Y., Zou, J., Huang, Y. M., Babu, V. S., & Lin, L. (2018).
Rapid identification of pork adulterated in the beef and mutton by infrared
spectroscopy. Journal of Spectroscopy, 6, 1–10.
Zhao, M., Downey, G., & O’Donnell, C. P. (2015). Dispersive Raman

spectroscopy and multivariate data analysis to detect offal adulteration of
thawed beefburgers. Journal of Agricultural and Food Chemistry, 63,
1433–1441.
Zheng, X., Li, Y., Wei, W., & Peng, Y. (2019). Detection of adulteration with
duck meat in minced lamb meat by using visible near-infrared
hyperspectral imaging. Meat Science, 149, 55–62.
Zvereva, E. A., Kovalev, L. I., Ivanov, A. V., Kovaleva, M. A., Zherdev, A. V.,
Shishkin, S. S., … Dzantiev, B. B. (2015). Enzyme immunoassay and
proteomic characterization of troponin I as a marker of mammalian muscle
compounds in raw meat and some meat products. Meat Science, 105, 46–
52.
54 | P a g e

Graduation Project - After Revision

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Graduation Project - After Revision

Uploaded by

Copyright:

Available Formats

Suez Canal University

“Detection Methods of Meat

Prof. Dr/ Sayed Mokhtar

Meat adulteration, mainly for the purpose of economic pursuit, is

Therefore, authentication of food is important for food processors, retailers, and

In this review, analytical approaches to authentication of food of animal origin

In the future, determining suitable indicators or markers is particularly important

For non-destructive techniques, convenient and effective chemometric models

3. Technologies based on DNA

As a molecular marker, Mt DNA possess several advantages over nuclear DNA

FIGURE (2) Flowchart of meat adulteration detection technologies based on DNA.

RS Low and No or little Time- Yes Simple Low Commercia Lab or

LIBS High No or little Time- Yes Professional Low No Lab or

The PCR is an in vitro enzymatic method which allows several million-

Detection Detection Target marker (primer, 5′ → 3′) Limits of References

3.2. Real-time PCR

Real-time PCR Compared to direct PCR, real-time PCR showed higher

Real-time PCR is performed by monitoring the fluorescence signal, which allows

3.3. Polymerase chain reaction-restriction fragment length

Polymerase chain reaction-restriction fragment length polymorphism (PCR-

However, the PCR-RFLP technique is complex and requires a suitably equipped

researchers committed to improving this approach through combined methods.

3.4. Loop-mediated isothermal amplification

Loop-mediated isothermal amplification (LAMP) is a newly developed

3.5. Droplet digital PCR

FIGURE 3 Detection principle of droplet digital PCR

3.6. DNA barcoding and next-generation sequencing

The above reviewed DNA-based technologies are mainly targeted detection

bp) depending on the treatment (Cavin et al., 2018). Thus, a minibarcoding

In addition, it is applicable for meat identification even on highly processed meat

In addition to the technologies reviewed above, some other DNA-based meat

Meat adulteration detection by using PCR methods is usually affected by

Protein-based food adulteration identification technologies mainly include the

TABLE 3 Recent 5 years representative studies of protein-based technologies for meat

4.1. Enzyme-linked immunosorbent assay

There are two kinds of immunoassay techniques used in meat adulteration

multispecies detection, which is also one of the main disadvantages of this

As mentioned above, the ELISA methods show some limitations during

4.3. Protein mass spectrometry analysis

Because DNA-based technologies and immunoassay technologies are

and similar meat species (Prandi et al., 2017). By using a UHPLCMS/MS

Generally, mass spectrometry technologies can identify species by

commercial products subject to homogenization, smoking, cooking, semidrying,

In addition to the detection of adulterated species, mass spectrometry also plays

5. Technologies based on metabolite profiling

Small-molecule metabolites, except proteins and nucleic acids, vary in

extraction, and purification, and these pre-treatment processes are invasive,

TABLE 4 Recent 5 years representative studies of non-destructive analytical technologies

Detection Detection Wavenumber Spectral pre- Data Performance summary References

in the beef MSC, SNV, SG, The R2 of calibration and testing

6.1. Infrared spectroscopy

IRS is an optical technique that detects molecular bond (such as C-H, O-

To improve the accuracy and simplicity of IRS methods, spectral pre-treatment

Spectral pre-treatment eliminates irrelevant information and noise. Commonly

6.2. Raman spectroscopy

RS is a technique for analysing the composition of a substance and its

Similar to other vibrational spectroscopic methods, chemometric operations, such

6.3. Hyperspectral imaging

IRS and RS are single-point detection methods and only collect

meat in minced lamb. By using the second derivative by Savitzky-Golay to reduce

prediction model requires a large number of samples. Al-Sarayreh et al. (2018)

6.4. Laser-induced breakdown spectroscopy

LIBS is a laser-based optical emission spectroscopy technique used to

7.Conclusions and future trends