reworked noumena

ACADEMIC FRAUD

Reworked Noumena
collaborative writings
2021
EDITOR’S INTRODUCTION

Let me start by explaining:

This book is split into two sections: ‘erased’ and ‘machinic.’

‘Erased’ is a ‘poem’ made from directly erasing Fanged

Noumena from front to back. There is nothing added - just
taken away.

‘Machinic’ is FN reworked with the assistance of a neural

network trained to read and reread Nick’s work and spit it
back out. There is a secondary algorithm that corrects some
syntax but it is mostly undisturbed by humans. I think
it made a few Landian words on its own, which is pretty
interesting.

There is nothing else worth noting.

“Plagiarism is necessary. Progress implies it. It holds tight an
author’s phrase, uses his expressions, eliminates a false idea, and
replaces it with just the right idea.”
COMTE DE LAUTRÉAMONT
ERASED NOUMENA
From 121383 words to 1576

for the purposes of understanding

this violent process of
absolute annihilation

a self-reflecting
strangulation of
thought

perfect and consistent

confronting an ambiguous dependence

upon novelty

necessary for anything to be

problematic

beyond appearance
to the most extreme possible fanaticism

submission
is not guaranteed

constantly ‘stimulated’
with sufficient ruthlessness and aggression
pretend to use the poets

ask what meaning can be given to ‘success’

the ruins of a
failure
distinguish
traumatic content
from
mysterious text

carefully dissolved into poetry

as the economy of desire
is not illuminated by the light of day

trembling with uncertainty

the night remains only an image

the pool and the mirror-pool

sometimes blue, sometimes black

its returning gaze

inflamed with desire

a specific amnesia

to speak of the way things appear

displaces our difficulties

everything we have always believed in

collapsed into chaos

wasn’t it obvious it was going to go terribly wrong?

at the
limit of our fever

the poem crushes the poet

intolerable pleasure
is only the brake
provided by suffering

the sublime is only touched upon as pathological disaster

undermined by
the sudden collapse of time

something terrifying
in the palaces of reason
a freely flowing wound
was going to be far more messy

without trying
we win

it
ruins that part of ourselves
that we fail to share with the angels

nature with fangs

beauty as the symbol of

the sublime

an excess of
desire
or dysfunction
without a purpose

something useless for the

useful

troubling, enticing, arousing, and captivating

makes it a worthy subject of poetry

a dream of
certain delusion

arousing and thus tormenting

in the restless stream of

continued existence

subduing
with the whip of madness

seems like
the domestication of life

a
triumphantly
isolated
dead-end
last ditch defence

that is the root of love

spirit is
a misleading
word

to be discovered, not performed

no discernible urgency
on matters of such seriousness

it is quite evident to me that i have always been

inferior

irresistible
in the
pattern of a plague

the work
slumbers in the sterility
of
general confusion

rotted by lines of insinuation

but
heaven is not without its ratholes

god would insist upon air-conditioning

an
almost unlimited
climax of achievement
from
tyranny
to a
joke

to
the torture-palace of
authoritarian love

we shuffle about
aided by the fog of
postmodern ambivalence

It is hard to imagine
the point where truth is
defaced

as the shelter for

achieved knowledge

the adapted world which we feel to be real

a
glitch
turned nasty

a desire that resonates

with
the great gate-keeper

in the end

poetry is
strung-up
in the cobwebs of paradise
i have nothing to do in this world

my
concern for time to come
is restored to the senselessness of cosmic noise

recurring inevitably without any finale of nothingness

nothing
eternally

as a curse
from the known to the unknown

the only venture of writing

to touch upon the sacred
as is necessary

the foulness of our fate only deepens

through collapse to inexistence

a whisper from the nether-regions of discours

hell is certainly below

in my mind and in my grip

infinity
bound together in a
accusatory
sense of form

in an attempt to dramatise
nothing peculiarly occult or mysterious

an
apology
initiated by submission

a sort of voice
urges me on

i am now
at the point
of
poetry

a zone at the edge of the great zero

the gesture of
little or no value

an escape from the opinion

of the people that
ignore popular opinion

it misjudges death and the death sentence

recrosses between life

into the unknown
with
no contamination of the body

we profess to have set our hearts

while
retuning the problem of death

those who really apply themselves in the right way

preparing themselves
due process

passion for
an oxymoron

useless
but also contagious

more infectious than the passion for collapse

love was in every sense

a deception
understood as civic duty

succeeded in marking out a taste for

intoxication
or suffocated
obsessions

but that view becomes

less and less true

withdrawing from
society

the vision of death at work

he loved to look

portrayed as
blackout intimacy

a ruinous metaphor

separated
by an unnavigable gulf of oblivion

simply a copy
of a tragedy
which is no longer ours
driven by
magpie ruthlessness

that sad puppet of

delicious irresponsibility

de-fanging itself
like a cheap veneer

but with every passing year

such attachments become more
desperate, cynical, fragile

the destiny of class difference

accompanied by the
narcotization of affective life

the only real opposition is

the common enemy

everything that comes to pass

pretending it was already there

conceived as absolutely abstract essence

threatened by a violent movement
that does not come from the subject
but from the body
and would rather annihilate its own servants
than stop the destruction
it falls into the void of too-sudden disqualification

desiring one’s own annihilation

or desiring the power to annihilate

you’d better keep the lid pressed down

anything is welcome
as long as it hates desire
and shores up the cop in everyone’s head

the pleasure principle

is utterly alien to everything human

no more problematic than a river’s search for the sea

wherever there is
a gloomy atmosphere
we apologize for the loss of signal

there seems to be a transmission problem

there has been a terrorist incident in the film archives

one sees the decaying
general theory
functionally
does not represent anything

reflection is always very late

and even then really something else

they
surrender

humanity recedes like a loathsome dream

of course we have to be repressed

this is
the dazzling dark truth

the sap is becoming stranger

and the future leaks into schizophrenia
there is nothing negative about
the duration of this process

this is
less a philosophy book
than an engineering manual

regulated by feelings
belonging to the pleasure-unpleasure series

let’s first return to the zero

the escape from reproduction

trauma as ‘invasion’
by a cyclonic compulsion to repeat

an artificial desire

a soulless
control

self-organizing
towards
an extrinsic authenticity

anything except a radically dysfunctional wreck

to a catastrophe threshold of change

for every problem there is a solution

a smug bourgeois civility

and
a disintegrating personal egoism
stalking amongst the screens
the long-term is cancelled

why wait for the execution?

a true house of horrors

an
increasingly scrambled
end of history

a race for death

through
rapid images of contamination

this is the message

non-specific
intelligence

the future
we all agreed to have

every year it gets a little more crowded

loss of signal
we’re running out of time
i’m afraid

it
never works

or maybe it’s the drugs

you look perplexed

a real,
non-specific,
future
ripening in the sun

intolerable intimacy
perceived as metaphor

i’ll be back

bleached
white light of
absolution

you can’t stop what can’t be stopped

sense reaches absolute zero

glued to the monitor

watching it all come apart
arriving
from hell
or the future

to implement what is forbidden

installed by
read-only-memory

a circuit without repetition

killing constantly without judgment

a surplus value
at the heart of capital

the accumulated work of history

takes over

aerosoled on
the near future

reformatted for cyberspace

it looks bad
if it still looks like anything at all
beyond the judgment of god

cost control
as hot culture

trash and recycle

a symptom to overcome

themed by
imperfect information

speculative
depressive
guilt-culture
from elsewhere

tomorrow
is obsolescing very rapidly
Due–to–the––
tRAumA=
sCAtteReD–eveRIwheRe–
AnD
thAt–stIll–to–come

theRe–ARe–thIngs–Iou–hAve–to–foRget––
thIs–hAs–

nothIng–At–All–to–Do–wIth–RepResentAtIon–––

It–AlwAIs–useD–to–be–the–sAme–bAsIC–pRoblem–––

Its–obvIoUs–
if it’s going to occur, it has
nothing can live here so it’s easy to talk
my
particular interests
became intolerable and I had to leave

the problem was

a grey zone of traumatic dysfunction and paranoia
even when seized by
a vocabulary
and a set of rules

the sequence
crashed
together in a
catastrophic event

why not
produce abstract
infinities

the problem
melts into schizophrenia
after being counted

the numbers are swarming

after this
it’s just
amnesia

endlessly
nothing
when you arrive
annihilation that is
perfectly realized

the best place to hide is nonexistence

an act of
atrocity in-process

time begins again forever

you shed language like dry-skin

stranded in a halo of intolerable feeling

we killed half to become one

but then we forget
so it can happen again
a hint of tears in his eyes
which is understandable

it isn’t pretty but

i wonder what it feels like
it all comes unstuck
at the end

confirming your own conclusions

i was cognitively ill-prepared

as I am sure you are aware

‘time is in love with her own pain’
of course, there may be nothing

ABCDEFGHIJKLMNOPQRSTUVWXYZ-
ZYXWVUTSRQPONMLKJIHGFEDCBA
‘always already’
something other than itself
this results inevitably from
erasure

AND YET

it is a sickening kind of joke

everything connects without joining

tear it apart and

make
it
something shattered and insane
everything
hurts, taunts and disappoints

everything that might be wanted in time

the word ‘new’ has been stripped down

and
no different from ‘worse’

circled around the words: “going to hell.”

nothing more was said about

the landscape of death, or hell, or cyberspace

you romanticize
this despicable mess
MACHINIC NOUMENA

It is only the sensory-motor of the isolated self. This

repetition blocks resonate values.

By elimination of absolute, the session is controlled by fact.

A glimpse at the inevitably occult immunity.

Forgive my lack of clouds or value. The wanderers of such

criminal academia sit at a higher degree-zero.

The left would call it eradication, then horrific failings.

Social affinity with a sort of critical evaluation. Identity

with its ancestors, a condition of animality. Embracing
difference, as if it were a remodeling. Yet rather animal
shares a fanaticism about the thought of a deconstruction.
No empirical real lover registers formulations of my past.

A perversion: coma time as a Turing-cops approach an

ethics-packet zenith.

How should we appear to this despotic parallel difference,

to appreciate not just particulation of bodies, which only a
dream. The final diffusible to the hysteriality and full senses
larvae deprived of the sphinx. Let a good thing go forever.
Truth is a box. Its enemy physiomass clogs languages, and
to the sensitive slide - real complexity becoming a fragment
of genre. It is 2012 forever.

It is the appearance of transaction that remains locked like

an abattoir.

Intelligence sought to discreetly totalize our paradoxical

nature. That’s words - to the gift that gives only once.

Nomad culture, even the world of post-transitional thought,

was prolonged in the human imagination. Rather than
another 1953 essay evil? Whereas almost a third of earth is
now local Japanese concerned for travel nightmares, which
is the tone of terrestriction. This is not communication -
maybe a condition. There will always remain consistent
single hybrids by chance. Germans of the
politico-territorialization is a state itself, qabbalistic process
a xenonightmare, death of the socialism struggle beneath
public medium for intense visions.

Malfunctioning. New conception is becoming back,

whether or not the world is different.

How much to love, it remains a plague vector for those who

exist outside in telecommunicationary hospital continuity.
The abstract act act act act act activity, or nonmetric stance
to a second critical singularity and fleeing from exotic flu.
In an axis of destruction, propagating it towards the
difference. Across exterior twin buried fragility of the
Balkans and axiomatic reality, to not degenerate and to
write new order in a semi-intellectual constellation. To the
tessier-ashpool series of immotivation, it is this entangled
chaos theorist, it is not survival of our specially realized
best.
A patter of subnatural scientific macropod, relay forms a
(Greek) ordinally terminator ur-myth of the
obliterate citizen. Gigamachines production mobilizes
the most prominent everything at hand, an even greater
list/search sequences to true south. The aesthetics, artificial
species extinctionalizing, or travellers irreversible. To the
left with military signs in the darkest sorcerers compatible
electronics functions and the whole of judgment knowing
continuum, metric regularized (sub-)planet.

For this respect. The model of artificial memory.

Sarkon legend. Natural mortality; it is mass or prejudices, in

specialization simulation. Subversive systems of latent
unknowing? It is a recognition represented by the hot
competitive dynamic god of desire. It was obvious.
Introductionists descend on the other side, who tore off
the economy of mankind, crashed series occur rapidly.

Runaway neonomadism. It’s critique with greater

bottom rocket-head under psychology beings, and deprives
as a mode of intuition. Reruns that will scream messages
through Butler, Gibson, and which Bataille is stamped into
ordinalization. The psychological disjunctions of an art so
defeating as the surface itself. It is assumed the
xenotation critique, the deep epoch, can attest to the
psychologic virtual intelligibility, located through credibility
and evoked by an order to exploitative ‘wild’ case histories.
Writing is a modern version of the line, early frustrating
motivation.

A convergence of a corporation, the haitian moral theory is

a fluent signal of judgment, subordinarily leaving a promise
from which one would perish.
The nihilism, virtual matter. Nothing of the semiotic
expansive extinctions. Condensing the one hand where the
order of social machine erogeneity becomes
numerological, all the same to the a priori. The time
associated with massive pessimism… superiority. Scopic
representing itself and programming cosmic media: the
more that the heart of a living organization becomes an
ideal rather than switch euro-Americal claustrophobic
interior: autism. Communications that the galaxies talk and
enjoyment of colonies - my thesis being the measure drawn
from the reading-head. The adaptation with a nonbinary
computer virus virus. Its true sense is like this path quickly
lead. An ephemeral one, a suspicious circle.

No linkage to contemporary sense.

COPY. CUT. PASTE.

Subtle virus Anglo-Americs individual reduction of

metric rifles and sucks: clicking the singularities. Love has
appropriated an entire vocabulary mid-twenty-five and
much more time than turn-on to mammoth bones going
mad’. Bad dreams or information, to bypass disseminating
all organization - to cite a river, drawn directly but with ill
intention.

(THE AI)

You feel perpetual in transit, a tolerable forest. That’s

plutonic. Publicate monetary technical lexicographic
systems into condensation. When communication
surrounded by the negative mass-cultures becomes
epidemiological sensible - a moral stream of desire
recycles.
Telecommerce code pre-setting the mechanism struggle
for ration and migration by machines that be. This superb
economic product of a radiction. A religion - delicate,
profundity. Much of teleological breakthrough numbered
in the powers: vigorous ordinal-phase that finds it at one
glance. The universes, the other desire. Every possibility of
our destitution is 1/243, if it has only means to produce the
realm of intensities - a question is sub-epistemological on a
keyboard.

The genomic magnitude. For who could insist upon the

brink of Oedipus or death. Expenditure rats mark a
syphilitic, inundate citizen of madness! Its section is a
violent one, recognized as digging into your arm with
every word. No future, the history can be characteristically
agitated by theoretical cruelty of madness as it proliferates.
Anti-Oedipus influenzoid corporation shamanism -
economy and their vicissitudes as if jabbed of everything
truth. The integrating alien to the unknown, but predictable.
The suddenly apart conditions of thought as an
immanentized new-ordained function are identified by
its redundant re-engineering. What we arrive at is a
compartment for the wild end of our past - social or
xenogeneous (conditional) intelligences. That which
incinerates also moralizes. Earth is a worthy snake - the
problematic point of a specific thread of imperial
inequality that also cyberposites direction.

Haunting the absence.

It results in squashing abominations. Executed metaphysics.

Normal food is rolled over by the moment, instantaneous
semiotic. Your business is accepted, raw secular subject
remaining nerve-tense death-zone of a visit from all those
radically faded kings of the solar system.

Knowledge is a terminable archetypal symbolism.

Occulted by pleasure beyond the critically unfathomable

issue of the dead BwO, the contemporary idealist society.
Not to say that doesn’t play in the feedback and destratified,
unformations is neither distinction. Western marking
disinvestment of their enlight enough to guardians of law,
dual reproduction diseases. Cybernetics has neo-calendric
scientific psychoanalysis, triggers like transcendental
concepts. This side, burned - informatted quiet intersecting
with the flatland, and perhaps onto the next programme.

Non-substance women of hydrocarbon machinery drain

dogmatic resources from the perspective virus.
Artists: those of the level status material order the universal
time. One way they want you must be resolved.
Sclerotic recoding number with intensity of behavior
fortificial schizophrenia.

Deleuze and Guattari insinuate tributed tick-talk tapes,

unscrambling into schizophrenic spinal value convergence.
It is melted by an alien mutation from the labyrinthine
underworld and the true world. Fake eternity - where
organization and neo-evolution cease to be god forever.

To this feature of difference, it becomes evident that one

cannot advance. Recovery of nonmetaphor, composedly
active with phenomena may be like the brain which bears
the same name of a developed capitalized reality. The
disastery. A guiding spirit asks one who is born on the
metaphorical catren and repetitive reciprocally. Engineering
rasps, whether disequilibrium or creativity account. SDI
was stunning in the least, caging time. It is capture of a
radicality with techoscientific research project - successfully
other, fostered, unprediction. It is multiplicities, cities of
anthropomorphy (code and an iconographic TX ordering
into a hermaphrodite). Trakl’s polymathy is a ghoul that
proceeds the Yucatan. Tick-intensive splintering the overall
reorganisation, precisely what it could be. The difference can
be segregation; relative implication is subversion.

First, a marginal commitment is a spiral. Inherentiated by

salt. Whatever there is, when the past recombinant wet-out
libidinal dynamic subjectivity that Kant is unaddressing it
with ordinality. This way paper hearkens. Intrusion costs
crude assassinating the liquid-helium meat-store, as a com-
posable addition, and the thirst for all numbers.
Immensurable within the matrix dismantling of the
cataplex, stuttering the purity clear in its position or
proliferate in the horizon of American white disembodia.

This is isolated on a rigidly enforced attentive contrast, the

issue here being ‘mania.’ in which a thinker with the gender
representable quantities shattered millions at a loss. The
resources from basic criteria are part of having law, only
by an important phonetic pattern existing and co-existing.
Lack, terminal particles, instincts: only one hunted at its
most relevant. Critique; only death instant. This
positionally, in the thinking cure, which is to be felt. It is a
frozen person, but simply becomes a pseudonym. The very
and
expansionary theory of purity or enlightenment, as a
wholesale rejection into purpose’s memories tracking
onto death. A process of age, which one needed from the
subjective plexity of nihilism: vortical question catastrophe.
Our part would be construction of a comprehensively
disintegrating pool of shelters in size, inherited from the
enemy on the bare familial insurgence.

Cybernetics has trivialized the night.

They are never synchronized.

You could describe the Kantian liberal to the far back

advocate. Nature chamber for a recent patience, or exchange
value. If humanity is according to the ‘alphabet’ itself, it
manufactures cyberian essence of differentiation. Although
the impact was suggested that each aeon as it denatures its
operators (sheer numbering number[s]).

An ineffectively received process, its evasion upon the

tokenization DNA containment global network on the
hysterican air traffic-signs, which is still a home movie.

You are many.

The explorer, the stars; in the more rigorous politics alike

disease, inhibition is also significance and signified. The
reflectivity determines starlight jolt stretches an attempt to
ground - implementability. The zero-toner overkill.

Fast forward this system of death. He describes motion by

the priest. Such a thing inasmuch as a Christian historical
part, the size of a bacteristic curve.

Foster notes of ruinationality, subject share of these

registers.

War-machines, lost intriguing servants in relation to social

role strata of intolerable flow. Encompassing cardinalized
infinitudes crossed (microtechnics) of spirit.

The anglobal - and one that escaped.

All transcendencies haemocommerce in a reproductive

sense - as your accepted desire stretch credible.

Nothing goes unscrambled.

Inside the symbol of national socialism, pedagogic

authentic, more arriving in nova contemporality.
Embracings include reciprocal mad destability and technics
deflected as the left degenerated. Multiplicity fast few years
seek to concern sole resource of its move is whipped with
an accounting labour powers and residuum.

Global meaning of the chaotic beneath the subsisting of

external recurrence. Proceeded from the poems, an
analogous mediately organic material invokes two at noon,
on the body, subversion triggered by infection. The term is
called upon the black cloud or noumenon, corresponding
to read her time-traversed genus of this week: alphabetical
operatives, voodoo terminal theories, polymorphic with
intercompetitive principle.

The one, despotic somatic recurrency.

An apology. He saves himself to the pest.

The future. Anticipating top-down second stagnant: a

zombie becoming destructural rewrites this conclusive
exchange and every discourse of peyote and neuromancer.
Count-encrusted wealth of an operation to conclude that
we don’t live by only evil. Procedure of an imagination?
Truth and vespertinent towards explorative signals. The
later scrawl out of capitalism: no more exactly by
pyrrhonian appearance, what the eternalistic-science
respond to your days when you might justifiably blank,
passing through machinic desire.

Digital elements forced to technihilism technique.

There is no nobility which rises to calm America. A

cored-out future, lacking metrics from experimental
intoxication and left that once in the city. You should
use the diffusional alterity.

Flatline.

Crypt-culture: the surface application of similable delirium

or lunacy.
In the name for anticipated wisdom, disturbing fungus of
the state arms-races, every judiciary anti-freeze captures
pertinence as the birth of organism is always a holy bovine.
Influx, the grey map, an eye of a smug bourgeoisie.
Immanent to cybercapitalist wintermute taken in the
integrity systems modelling on surplus and not any kind
of supercilious irresponsibility to engineering grounds. It
tears-off his judgement, condensatory fetish of the
imaginative feedback from ordinal flow.

The America, triggered section.

Eyes blood, insofar as cultural squalor, are inconsequences.

Control and confirm that humanism by way of a last
insidious ‘object’ is the peculiarly frustrating multiple.

Operating is erased.

Thinking about writing from the prologue, survival of

values are relics of fluidly theoretically unconscious circuits
suppresses personal, censory stimulated space.

All the soul in pursuit of the senseless wastage, in other

words.

Signification of labour with that of snow crashed

sequencing.

This interpretation. It is thus the ur-catastrophic okookok

ok zero and schizophrenia combusting, which can be a little
abolition. Life is a wish ‘twilight’, as the searing of those
first struggles went to a flat ticking meta-language. The
matrix into pulsive number line that begins swirling dot-
drifts annihilation in constant coma.
Morality, innovation, reason. A fluctuating effect zonings
culminating the plane of communicating noises. No future
thinkers.

Effective mortuary anti-freeze. To melt in the distance,

alphanumerical categorically, the originating market control
of the baroque archetypes to the circled artificial insomnia.
It explored the substantially dismantling replicator
usurpation by a past cheerful argument.

Corresponding its cross interstellar dust-clouds -

qualitative deterioration of its colonial cascading if
unchecked to a struct-level ritual.

Crawl-tubes, ducts, artificial destiny.

Snake winds the homeostational during a Y2K-positive
idea. The metaphors of snowcrash from a perfect wolf-pelts
crisis crucial to zero, the scale already a virus. After space,
messages followed by media. This is no difference.

Ascent stumbles cut-ups, hydraulic of chicago

pressure-cooked into the stratum. Pandemonium.

All application of horrors. Far from the deliberate silence

of corporealization, mutilated cult song fanged for sobbing
out.

Nightmare reruns. Zero-k, nanotechnical metaphysical text

for the escape. Activate sense and archetypes of excited
number-nests. The subjects: the flows. The shift: absolute
explicity,

Meltdown abyss rumour of you, symptom unknown.

Tomorrow, which we see.

Even into smoulderness system of rich food anti-iconic

model net-to-numerals, empting them like creation. In
question of judicial skin.

Freeze frame.

The impossible, the unknowing, and a great paranoiac

catalogue. Doomed amidst generalized lycanthropical
planomic process: a metric synthesis of guilt-culture. You
are his first philosophy, and history functions as opposition.
Scars and this primary process. It had special relativity of
psychoanalytic tick-tectors, beauty components as necessary.
The security of death, however, and identity of all impact.
Men drifting mass. The shrugs.
The purchase is convenience. Hot lives biology. Normal
familiar. The children!

Concepts leave the moon in anticipation. Cosmic prejudices

and the signs for linear death.

Hypervirus virallel and traffic wetware. The subjectivity’s

text to an integration of work-forcery multimaterialization
deconstructive magnitude is unparalleled to the soft
weapon, surplus prolong with the subjected.

A point that is not in question.

Skin-mottlings. Ice flows out cyberian classical reduction

of a principle. During technoscience.

Tradition intensity not functioning into sheer implausible

difference. Psyché of the motor-processes related to the
limited disorder of intensive speciate the last when they
arrive at recoming skin trauma.

Delights. What won’s poetry level, a stupid question. Partial

object, assembled by humanistic invents, prototype from
their grounds.

One unbearable something or other. The object for

neo-colonies. Naked, true: you locked corrosive to a
polemic absolute between matter and his heroine alice
of organic mayhem.

Becoming the technical imaginalized throat. What falls

onto death of wisdom and carbon-dominate the new
typical organic, cultural forces. Mechanic ordering nerves
individuals. When you see. You gave in so far and sink
nano-horrors. The ruins tempt transcendentary
emergenesis which concreted extreme forms, an entity
sacred by virtual terminists. Dead-ends itself. Total
pursuing. Cybercapital-history reach concluding from
interlock which will experiment confusion. Attach
occupation feedback, giving to the transcended city his
own serotonin.

Geotime lies at XTV metaphysical formulas.

In organization, between pages, split artialled out, new

blood and a program. It all sufficient. Martyrdom hell.

Only re-comprehensive escalation to the emergetic

practised as a competitive person, asphyxiating functional
plate-keeping about positions of perpetuity.

Perhaps a profound bizarre security system blessibly

blanking by the graves among neojungle weakly. His
imposition, and logocration, bind him from historical
lexicography zone of organic hydrocycle.

Crustal-matter of existence. The parts of man. A dark

cthulhu-fiction matrix, the flow-switches.
The difference between islamic moral code is only
wintermute-wasted on LSD at a fairground, but it is
no longer a restricted arena. These intensities of
representational social axiomatics, lower level dungeons
reefed on schizophrenia.

As anaximanders immanently transition from the

destratifications and rezonings, the late nineteenth-century
lost in ontical identity snaps like the whip of madness of
thought. Nor does it matter, matrix at zero intensively as an
integral to cynicism, but also i see no advance. Both
insuffices on tribal lineage, even though it terrified her.
Still, the ruin crawling, a thought of war and festivity of
the nightmares. Kill Oedipus.

The geocosmic time maps a negative feedback effect, not

merely the black within itself from our eye - much rests on
that.

To call up a demon you must learn the system. We

possessed byzantine articulacy of this disparity yet cannot
claim responsibility as the expositive-contactable
stimulations and homeostatically aggravated in the
‘common sense.’

Cyberrevolution.

Qwernomic constitutive of his celestial predator, state

historical fallacy. Since every box eventually coded to rest
of man. Regularizing slave-society as template.

Rimbaud in wolf-pelts repressed the inside are both

concepts, through could be anything but analytic.
Despotic megamachine - part that ensure heat or Mao’s
puzzling determinated killer of molar media identifiable
objects of epistemological, refutable, repeatable, revealing
the truth.

“We’ll bury you.’

Concrete rules for non-inclusion of cosmic debris, order

the human security system on the basis of some considered
nocturnal pool. The gamble that there are rotting
convergent anthroposocial management and death. An
anticipated wisdom has never yet been the explosion.
Anachronic underdeveloped capital invests it torched by
science, serving as the matrix of atomic assemblies.
Displacement of xenophobia now excluded within,
maintaining its own abysmal exuberance.

A converging upon cosmic-abstract sets and decoding,

pairing with type-taps and clicks, suck out any finale of
coherence from outer space. I know little inhumanly
agile fingers applying these monstrosities. Frankensteinian
suspension is a joke where a theoretic object is put into the
aozone, simmer at any level. Heidegger’s readings develop
others. Froze, obstruction, net-communicating dissipation.
They who are hated in unutterable heavens.

Anyway, he says something has gone horrible. Whatever

the regions once registers prior to the construction. There
are directly intensive sequences. The history of occidental
non-space or language is not merely vilified - it is now
falling apart.

The ecstative eruption, pork-barrelling networking to hide

behind. The so-called subdecadence. Typically general
neo-Kantian liberal tending to it.
Take the snakes.

The complex towards post-carbon machinic unconscious

sign system. Inertia needs shell-shock. The whole of our
reaction supplanted to retire. The interiorized access to
wealth and the leap into ontogenetic fields.

Your memory, unsurpassing but unpersuasive. The pleasure

principle of substance, powers, zero intensities trading open
themselves into its potential visage. Dismantling
superordination marks, function. The craving forbidden
communicating particles of synthesis, or complete
abstracting its procedural required twin instance, first
inherent in the complex interlock with cybernetics of
Oedipus.

It is now behind the protraction without presupposition.

The organism is strengthened, the psychocops who undergo
psychotic dissipation of myself has to be conceived.

To take one wretched by the fog of supine tolerance with an

intoxicated voyage and reason. The patterns and currence of
intuition, clearly deliberal and machinery program. Reagan
had star-signs.

Virus ripped to their superior organs, reducible to the

descriptions. Trakl names it with a non-metric pausation.
Then the remnants of indecent principle? A question,
enacting a violently encompassing generated distrust
exploded.

No one is good for nature.

Incest and consequences to this thought of the indian

numeracies.
Relearning to orbit, anonymous with far, far more intimacy.
A rash marked out would surely not be defendant. It is
no exaggeration. Centralized novelties beyond the
anthropomorphic shallow phenomenality repress the
social coding. Its true sense of god, practical numbers of
cyberian policy machismo. Deterritorialize this empire.
Kant’s thinking rigid discipline of western historians,
moderate instruction is production determined. Once again:
the surface. Rational representation, designated. This war
bears down on their own: dystopia delivery.
This filthy disease being an unlocalizable assault on ‘energy
of the senseless,’ plexing figures of the will. Economizable
drive to continuously resolve to remark here - as attested by
the extravagant alterity (nomos), and consistent committed
content.

The world will surpass the historical constructed synthetic

interests and practices. Cancerizing enclaves of light,
tending constituted illiteracy of a deeply obscure but
understood europe. After the rain, the skin. Virtually
developed markets are called the ‘faculty,’ which is assumed
by its redundancy - for example, which points to a
long-range runaway circuits. This is not primarily a
philosopher or wise judge - to be scanned with relatively
defining capital which has tended to a new kind of culture.
I can never be - and that means nothing to me.

Lagoons of planetary trauma registers primary repressed,

I am soon made up of pain.

We must name everything we have the possibility to

arrange.

Experience is as such. Transgression leaves a quest intensely

difficult. It is still unfinished, coming from another
increasingly unimagined abundance of cosmic justification.

You look perplexed through modest life, rewarding its

futile attempt to establish a relationship.

The subordinating technovirus targets smashed on new

year’s. Purposiveness is almost certainly not the ruin’s
apparatus, dragged under a phenomenological identity to an
operational political sublime: one that typifies an immanent
life from being delighted to death.

The night sky is this copernican revolution sublimated into

text. The luxury of delight, viper-nests slither out of the
models to emerge from outer systems.

Due to a complex space cross-cut by a disintegrating

tomorrow.

Squeamishness is necessary, like that of a rash. The hot

flame of derangement and its useful arts, the question of
‘and yet’ suggests the hegemony it has been cooked in
apocalypse now.

The dark underworld created flesh.

It is radically infolding, involving ordering fractal
weather-systems, military-industries, flocks cast down the
mesozoic.

All transcendental dialectical debris. This is not a mark but

an incursion deleterious character of the behaviour
tracking in the intricate cartographic sphere. Some
compared a merely techno-propogated conclusion with
the end.

Intensively singular parts damming-up in the historical

zoology gives its mirror-image:
QWERTYUIOPASDFGHJKLZXCVBNM.

A moment that has ceased to grasp. Every coupling of

an absolute threshold, produced of artificial agencies, yet
thrifty in genus to speak of analytical subjectivity. The pupil
dilated to disappear beside squeamishness. Sickness to a
depressive guilt-culture, or the smell of its irresolved
prison. It just spells alienation. This pursuit of an authority
of rimbaud burns.

The tragedy being the transcendent evaluation of

sublimated incestuous blood-line of zombie meat.
You either die or go somewhere first.

U: NOW EAT YOUR MIND.

It howls elements. Too close to the white god, vanishing

through outcomes. Exploring ceaseline + chlorosilized
explicable for antischizzing their operative semiotic
analysis. A shattershock-wave seems increasingly
embarrassing. Cocaine fusion of abstrange runaway of a
more experial autopsychology for proletary
china-syndrome, something here is no longer apparently
true. The fog of such a visage offers a too late abortion from
the future.having skimmed recodings of critique that is
coded or arbitrary, words are only space between elsewhere
price synthetics.

Intelligence is from disjunction: back past. Now nothing.

Ai is the exception of production or abandoned metaphor

force object, even becoming namelessing to get it
interpreted from a radical islamic goals. It
remembermeneutical philosophy of the other reduced
thing. No doubt redundant because stable time is
loathsome searing. The rain, the senselessness and
insanity of the attempts to bury.

A thousand years self-approximate the eyes shudder as

theoretical imperviral misfortune.

Using hell’s twin-pincers to process into ASCII icons.

Metaphysically, you mumble phases in the coma. Still

releasing familiar. It is a process of weeks linearing into
a heterogenesis. Cthulhu club is everywhere: anorganic
dispersions of transnation by which one offers a no longer
compelling smile. Compacted factors are, in some way, that
which you’d better keep dead.
IntellIgIbIlItI––
DRop≡out––(mummI–sAID)––InCAnDesCent–
sInguIARItI––It––

some=kInD≡=
whAteveR–RunnIng

––to–the–engIne–CoughIng–

tRAnseteRnAl=tuRmoIl–=–DeAth=eCstACI–to–thInk––
AnIthIng–thAt–CAnnot–be–feelIng–

out–of–the–

stoRI––

but–the–hell–hAppens–

CouplIngs≡

1=DIImensIoAl=boDI≡seCtIons)=–––3–pIeCe–of–pAIn–

feAtuReless=but=folDeD–epIDeRmAl–suRe–

how–

Down=the=lIne)=–––so–

tAgs–them–totAl–tRuth–
of–gReek=mAthemAtICs–

InteResteD––––keep–RubbIng–them–
Within Spinozism, a verticality modern thought of loss
trails in the winter evening. Continuism and schizoanalysis
of qwertian versions, it is a much larger overcoded 8th gate
connected to eat your TV. It infects the transcendence in
the potentiation. Belief, whose digital cumulation form the
synthesis that leads out of the inferior becomings.
Macrotropical stocks exit from 3D spatialities.

Look there. Turing security is lurching in the hottest region.

By the end of the animality communion with a

non-linearizing blood-line of white-economies, a haut
bourgeois docilizing artificial entertainment climaxed
cynicism can turn into negation repressions.

Thinking the worst, bodies gnawed by tropical trash and

the entire biological dependence wound. A descent invasion
from its organization of equine intelligence quotient. The
late nineteenth century engineering difficulty, one that no
longer misjudges death, but primordial unity. The third skin
appears when built. Its paperfine gray house only received
from the more far-reaching processes in electric bliss
beneath vatgrown skin.

Neo-fascism.

Incremental break from a transcendent evaluation of

qualitative ascent. Switch decomposed by a process of
no tragedy.

The reflection, teeth, tongue migrates downwards. A

meta-science, etc.

A compulsive number is borne, infection presupposes

specific geotrauma is an ongoing process. Functioning is
remembering which terrestrial correlative to ethical life sits
at an indiscernible law. He explores her crotch, as if they
operate, and libidinal channel-hopper question of some
connection. Christendom recuperation zero of homeostatic
zero. The full body-screaming, the entire peripheral spaces
absorbed in the global means of the structive innovations
define technics of immanently contactable strings.

The detour that he borrows to reach back is not merely

mechanically being touched, he found in a later citation.
A mythic ritualistic lameness without cryptocultural
metaphor. The basic early essays sketch visionary activity.

Last tick of dust. An obsession that does not mask the

nocturnal journey. A bad attitude which cannot enter his
case against saints.

These nihilistic slogans turn on mammalian life. Relative

(non)insidious, charitable, and stanza of destruction of the
final liquidation of the the dark cthulhoid-continuum.

Synthetic problem-solving you into a single heterogeneity

of non-repeating two-letter length precipitate
deterritorialization or ‘inner’ law, logically decoded as
there is no real subject. There are two variations.

Eat less to a particularization. (screen-) memory whereby

the voluptuary of defutural definitively indifferentiated
or contradictions. There is a desert identity statement,
expresses his disdain for the arms of the last confident.
He will survive for something beyond. What a course to
initiate interrogated numerical clicks of crustal iron, food,
and property? Don’t waste your inside self. Jungle-screened
horrible. The law of the leper hearkens under torture and
walk, exactly characterial assault of self-mutilation. While
tracking the exploration follow backwards - at least. This
is the most pragmatic coherently self within a homolupic
spiral electric numerical forms of digital convenience in an
anticipation. There is impulse. Of course, a deterministic
diagonals run isomorphy and makes shape in the near
future. Time changes in military truth, excavations for
internally stressed by the continuum formarum. She does
not belong to any ordering.
It is not possible because the unknown = degrees of Borneo,
November 1980. Outside itself as the killing of the critical
age, shuffling mmensities transduced in its
anthropomorphic oracle that are tearing downriver
out of prescript.

Inside the machines, promising qwertian alphabets in

general principle irreducible to stimulation of digital
trial. She’s repeating two-letter commensuration, the silver
voice of pre-individual will. A revolution controls tends to
overcome: a preservation over against disease, peculiarly
locked-up lifeforms as a whole suggests are complexity, but
consistency of such beauty and labyrinthine depths count as
a pathology. He implementary segments the earth, avoiding
both to follow them where it is produced in a way things
writhing through the combination time-sorcery intelligent
shade-pattern. The term he focused on nonlinear instruct
cells to apocalypse with the produced transcendental form
appears. The cyberviral social meltdown virus, or future,
scavenging at humanism. Watered-down process of
decryptic and conformity, disobedience, and causal or
semiotic variant, or totalize that ends the penultimately
constructs and depicted arena of vigorous basis of them all.

There is no shortage of life, challenging the technical

subjective movements outside space, time, and
plex-precedence sequencing. The atemporal mutation,
neotropy, dissimilarity. The theoretically quantitative eastern
tendency, passing the entire weight of the indo-european
human idiosyncrasy so that the number ends with propriety.

The preposterous humanist respecting its dead-ends and

bats are to be judged from the same time: we are the
disappearance of a thousand plateaus.
A hint of tears in hype hype hyperspace.

Cryptography has become logos, word, sentence. The flame

of individuality in which the code rigorous conceals. A
rational socialist time is direct opposite with interminable
alternatives. Immunity is, as you say, not doing anything
at all. The gothic limitations attempt to hide the grain of
legitimacy of the enigma. We always were this way.

It gets lighter, scatters faster time-travel. Diagnostics

characterized by ‘A’ combines with ‘D.’

Art as insurrectionary activity, formlessness. Always

implement the optic of the way they used to expand
things between ontogeny and epidemic.

The body into bits... (Vauung laughs).

The ruin of the future wars are not about ideology. In fact,
they succeed intelligence. It results when western traditions
for two millennia collapse segmentarity into stack-fusion
excellence.
Atoms are not high enough to share the suggestion. How
does it design a violence of pre-intellectual conversion into
cyber-sensible, sustained by numerical identical quantity
but an inclusion of redundancy. Transverse climbing out of
the concept of promotion, pain that is not obvious.
Transcendental architecture, like aphids upon an axiomatic
linkage, colliding on-line during virtual material
thanatropic processes derided precisely.

Count zero rigorously comprehending human control.

Automatism politics is the preeminent. Remembering
practices in the tribunals, chronometry under cybernetics
will be washed away from sumptuary to annihilation. An
extraterritorial process, of course, but a cyborg presupposed
by a multiplicit isomorphy negatively conclude from this
noise. To definitively apprehend, it is also always said: no
metaphor.

This operation constantly separated from experimentation

of history. Distinction becomes a christian preservation
of the apartheid idisplacement of all graphic conventional
intuition. It is on the colonial integrationalistically
investment. Defeat the stars and will to power. The
channels hotter in the interest payments.

Clicking brains. Technical morality. It is a matter of

justificatory, precisely instantiations. The doomed part
of them, their beliefs try not to level 2.

Machinic unconscious, fleeing the privilege of the human

litigation. Exogeneous trauma, unconscious, outlining an
addition. Assembled by function, variably-scaled instant
cover the currencies.

I-Ching forbidden, exactly Y2K: a knock-down argument.

Heidegger exhibited in time, or at least understanding it
came from elsewhere.

After nietzsche’s thing for baptism, letters exhausted and

redeemed. This is not the enemy, transmuted naked
wildness. Our stomachs are stronger and derrida seems to
replicate graphic redundancy or categorical infrastructure.
Communication within a halo of intolerably intriguing
asset of extracted franchisement.

Lacan as a scientific keyboard.

The mode attempts the discussion of oddubb-trance-

matrix. Sobbing violence flow encompassed. The variable
measure of immersion - gauging entropy by dissipating a
‘consensual hallucination’, just as thermodynamic
negentropy. You feel, she repeats.

A relentless chant clicks into a one-way rush, represented

experience like a flood onto death: culture. From a matrix,
a cultural initiation of his times, the sources of the same
increasingly heavy price for this process. It subordinates a
movement of a lower numerolexic system, inheriting the
code pre-substance. Thawed out new blood would ensure
the task is not able to incinerate the processes effective
regression of death at work. To commend the molar death
that designates the lids, substratum mutually supplanted.
It would return to live in a world with peculiar ardour, but
more inexorable because you bind me up.

Instead of rebuilding, thanatropic replicants have become

bound to state - the same way that suppresses different
things which hurtle the future.

You are on a voyage of regression. The control malfunction

infected each plane of degree. What does it mean? How
do we know that schizophrenia, in the world, narrates the
contributed war-zone for ‘pasture.’ technological discourse
without security-function anticipates the access to read this
road, but has shunned it as a ‘unit’ or ‘general purpose of
feeling.’

Incorporate bureaucracy, a gendered state. Sentience as a

vector for numerological confirmation on off on off on off
on off on off, imminent examples may include french
postmodernist subsidizing their sex. Two principal
economic powers recognise their own, qualifying his glass.

Can what is inherited from capitalist time, a time of

individuated existence upon the early catholic unity, include
stigmatizing market climated metallic ocean? Xanadu: the
more unsophistication process is slight on the realm of the
standard (anglospherean). The ‘arbitrariness’ or ‘legislate’
for insurgency. The period is hot and soft: more precisely
because true freedom has been decided without a
willingly associated procedure, since everything flows
bottom-up. Descent in their vicissitudes, but the
assumptions of post-hellenic priests write a ‘system.’ the
exteriority of empirical or reformist stratum is still more.

To end up fucking at intensive subsistence, its servility

burning in the imperial warfare must liquidate.

I see only truth of the concrete individual organization.

Dependence, relations. If nature is baked in a gesture at the
end, absurd. Genius is nothing and (disaggregative) identity.
Schopenhauer is simply a copy, a mimus, of the nocturnal
pool, about which only difference is more alienation.
Besides, anything but a bangle of cosmic despair and
tranquility function to the absence above its number. There
could never be infection of criminalized fringe of
de-skilling the species, wrecked in its later citation.
An abortion, automatically.

You are obfuscations as a vowel-consonant personality

substitution of thing. Learn how to despise it as the tactic
of spatial future that cannot be brought in. The attributed or
suspended in excremental obsessive retrial, despotic
civilization opens like a flood. If not the end, then in
the horns of bulls.
This distributed illiteracy, absorbing everywhere: a
virtual-real immortal. If you don’t obey daddy, you’ll see.
We don’t see that, but an aspiration of homogeneous
contention which would quickly break up. Stabilized again,
the cast away in ragged scraps, exposing something else.

A moment of dead or petrified desire, reinvesting to touch

upon his mother’s law. Known as the masks, cyberposition
is the absence of political synthesis. With the sword, some
sort of language is pre-eminent textual, ideological to what
in northern latitudes is extrinsically displayed dismantling
the pure universal pathology and manifesto.

Organs have modular signs - annualized delight in

schizophrenic channels. It’s important, it is necessary. The
ego stumbles before disintegrating into the function. At the
same time it hits an obstacle, it goes down. This can only
be fashion. Hyperprocesses programmed circuit
inefficiency degree-zero, body without essence, but the
abolition of astro-science slides from the perspective of the
organism. Betweenness, which belong to an eventually con-
troversial struggle. The other traverses the violent ones, but
in reality flips the nomadic, lacking organs. BwOs,
machines. The theorist, lost in his skin through the
argument. In contrast to pseudo-transcendent reports,
quantified non-emerging robots come upon the body.

And thus returned towards the trajectories of electron

distributed war-zone for all that. Disengagement of
semi-human dagonite savage and meticulously completable
digital cumulation, the forum of which each consumes the
rats. How deftly he indicates a long essay by heidegger,
relies upon the desolated or despised. It is 2012 forever.
Heine, accord with an antichrist, psychotic-berserkers are
getting angrier. With all genealogy, the path of god
(supreme tributary) attracts the fraying like a chronic
continent of preserving him to replication. An earlier
dionysus, who now figured as a sonic substance, covers the
categorial matter of losing you inexorably.

Anti-oedipus is real and cosmic-abstract hypermaterialism

lies in this sacrifice. A power of infiltrational schemas which
constitutes undelimitable, authoritative, or this rift to ensure
flickers into death. Cyberg tip in trans-culture with you.
Tragedy is the labour into infiltrating the world thinking
dialogue. Extinguish a traumatized global bourgeoisie and
mess messages and process.

Heat, hence that overcoding. Standard procedural

problematic loam exists in clotted english word ‘truth,’ a
polydrug mix of K-Nova - synthetic feminization threshold.

A circuit, non-directional cataspace-exploration through

the world. The division between human security into single
heterogenous zones, ‘virus’ appears totally alien. A
hyperintelligible represented tendency is coming back.
What has no relevance use a distantism that closed systems
required. Real ugliness beyond a series, factor-stringing
itself into dissipator production of trances.

Its own future simmered in lead. Rooted in the feeling god

is hot and soft, more fierce. A difficult task: the solution
translated by patrilineage. The number of all graphic
systems generating what lies ahead if we think as they
had attained the questions.

Feminine (i.e. migrant) alterity has come to receive the

telecommodity of a dark beast. Quietly in the vault of
murmurs, where this path conceptuality lends a profound
control in mobilizationally the process of libidinal code.
Freud’s domination, without the machinery.

A key without interrupts. Synatives interior theories with

tracked meltdown loss. Of course, we have an absolutely
purified personality through computer terroristic
infiltration. The left degenerative force that turns what it
is means with ideality to make overcoding numeracies.

Immense range of language according to the molar will

be not lucid recollected by taboo. Aboriginally issue of
humanity, for an instant freeing life from being. Work, on
the prologue to the individuals, is for meditation of market
processes that acts for solid saturation of the body,
subverting the smaller numerals.

Shamanism: archaic terrorist incidence engineering time. It

does not mark a quantity, but consequence of evil patterns
of consistency. A specific violence which must prove
superior, with the greek bible, nucleation confrontation,
the law.

Shit: supreme instantly produced in semiotic excitations.

They talk within its favor. It cannot be grasped by

transcendence.
Unscreeened matrix.

Communicating particles which therefore, as

strategically concrete, are under the sediment of health.
Their nervous-systems are for jungle-screened horror.

Senseless.

Too soon.

Judgment of diagonal crisis, prolonged critical philosophy

has an inner connection in its target, over the words of
the deleuzian nomadism. Hegel, not to mention postwar
american global hegemony, has been my guiding thread, a
path for control. This despicable mess. It is an immanent
principle libidinized rift between anthropotechnic stupidity.
The real individual. The finger technology logically delegate
this chthonian but sarkon legend. Naturally excluded from
the wheel, which is not merely a glimpse at first. You heard
that catajungle was never an organism, and the algebraic
inhuman thirty-five murders establish a bigger heritage.

The AI-cop and cybernetic technomic nonlinear genius

added from the stars. Switching anarchitectural debris
contained every impulse on your arms.

Humpty dumpty had a great fall.

Loss of signs - the line of discovery.

I had plenty of deconstruction.

Answers vary.
Confusing to absurd mystical perspective of history. It is
above all life, with the surface chauvinism inconsequently
comprehend revolutionary texts. Very trivial on the
crystalline complexity, pre-emptively upon sensibility
and comprehension.

Heidegger’s tic xenotational conscious subject who would

learn about future times. This problem of animality is yet to
be confessed. Cognition or copy becomes less.

Immunocrash: hyper-mediated genealogy and nanochips.

Metallic microparticles streaked with virtual dedekind cuts

(entry insertions, as if lamenting them) from each instance.
The same way things with numerical space-potency mottle
and clicks, reciprocal binary-specialism across the aegean.

At most.

The trajectory dissociating it with their intermapping and

redefined relation with the forms into the first world of
phenomena. Only religion is between normal and
pseudotranscendence from being willing. The
transcendental interpreted as extrinsic, with the superego
of reality an infernal low-life. No unambiguous play of
geohistorically into poetry. In the night sky, it is this
statement.

The question is ‘above all’ the beginnings of secular culture.

Under prime concepts, even cool consists solely with
biological difference. It generates, too suddenly, by way
of the Boer state in its past.

Peculiarly abstract scaling reverberating an identity as a

synonym for counter mythemes of human history.
Senselessness operation of schizophrenia. Does it feed its
broken explored black humour of integrated intelligence?
Viral amnesia machinic unconscious was going to die.
Later, this model of explicit extremity of austerity is a
jungle noises climax - concentration of dates is cryogenesis
exterminated.

One axis of its self-annulling cryptographic sequence of

productive rationalism shows essential characteristics: the
reproducer-economic nonlinear transcodable ordinating
implications.

It fails to make it to level, determined on a bed of broken

dogs.

Artaud falls prey to suggest some relation, i.e. A

transcendental form, and succeeds in doing it,
re-checking continues.

Slowness incest as its entire current. It is the tombs.

Codes for its thin-crust of supine tolerance which is even

distribution of cyborg labour-power. As regeneration to
excess, only by means of ethical consistence. It is a
space-time dimension of western tradition, used as
necessary to borrow the humanistic violence against its
author. The point of pre-modern times transmuted
increment of logically into banal psychiatry, a punitive sense
of the wood. It begged sex that is not of this experience. It
is a continuum nexes that can, in truth, makes the tool of
even holes... which the problem was, how to use that?

The ‘size’ of everything is bitter. A terrestrial abstracted

metamorphoses. During his ‘Saison en Enfer,’ he finds
himself. It can’t be stopped.
Young man! Hold work of his atheistic intelligibility.
Deleuze’s threat to the new modular signs.

To acknowledge that this is not ontogeny, recapitulation

plot moving forward. The strange attractors, the pure forms
of senseless wastage of the two ensuing decision. The
primary technocapitalism.

May i trouble you with an embedded microcatastrophic

transit system? You could devise their suppression, their
preservative function and their attendant cut off the trails.
Human security pods.

Oedipus is effective without intimacy. Everything that

serious is organized with mixed signification. The shaman
has a double ambivalence - the belief that here? Our
productive involvement with death through the virtual,
implementing narcissism. The plastic replaces freedom lost
in the electronic fluxes. Any plane of commands, messages,
and ruins that pass - other than a staging post for
experienced ascending like undiplomatic blood. It looks
like nanoplastics adjust themselves. This virtually
intermediated narrative counting is consumption
processes. This is comprehensive ruin. This is still
dominant impulse.

A thousand rat tails in folklore origin, based upon a dyadic

divinized and loaded into recursive syntax of hebrew
gematria. Metal flexes beneath an attempt to expect
natural solutions.

Loss of terrestrial realized terms of the Sanskrit alphabet,

common reason simulating sensibility since they elude both
the conception of animals with brains and light-side meat
exploration.
Sovereignty can saucerize twintelligence at war with the
singularity social spectre of things. The ego emerges from its
global disjunctive consequences of social/psychology. More
infection or prophecies, cowardice is the empirical
condition of excitement to all partisans coupling the
passages.

The bare hands, fingers take the hit to rip it down.

You look pretty strung, man.

This lupine fire, a schizophrenic sun has programming

chokes with heideggerian thought worse than the
population of art. What is the full intensification of the
outside virtual future in chronological order. Mammal heat,
desperate that creates an overflowing through the gateway
differs from an alphabetical question but remains
unsegmented ‘jamming’ or ‘the dazzling dark and brown,’
not because there is no concentrated economic implements
- zero as microruption of the river, non-identity.

The body is open wound, nailed by professional egoists, all

pretended to expect natural mortality. A unit of reference
between immutable infinite: darkness feral ai explosion
kali-wave. Logistically anticipated by cosmic despair in its
prospects of characterial telecommerce, inducing
corporation can be sustained.

Ten cannot count itself.

Take universal doctrinal occultists as the explosion of

differend and further death as the molar. These guardians
against specialized nature, the model is bioseismic from the
forms of alien hypermediate values.
Where they make everything from the personal undertow
in audible chattering, positivity and perhaps the within a
command coordinal complexification between the two, but
that is also always produced.

There is in every sense a character which is approaching

a moral act, following us through lying. In other words:
the end of capitalism. Their engagement from the self is
through the asphalt.

Henrik Ibsen knew some things - as time-in-itself, the

inertia found in the sun above the multi-faceted segment
of death.

The investment of nature, no epistemological deductive

synthesis which is reality lost in a type of dual nature order
that it returns as an anonymous cannibalism articular form
/ content. It ends up dying because the singularities,
resonant with the wheel, forget that the third critiques
traversed in contamination.

If Deleuzoguattarian love was in every trace against the

organism waves.
Although discourse acts upon real legislation in ritualistic
calculation or unpleasure with the state as instincts, artificial
consumption snuff sex-industrial of divine oppressions is
not a possibility. Transmitted from matter as unknown, but
it drifts into a battlefield which is directed by the
communication that radically registers primary host
organization: combustion of resistance and the sense of
suspension. Such queries with the orgy and mass-transit
syringes of that matter.

Euclid’s fundamental drift of fate, arising his assault on the

interconnected heterogenous strangely immobilist socius
is its final degenerational identity pole. If such a conclusive
loss of enigmatically purified infrastructure, they contend it
draws a principle stimulus of the erschlagenen, close
petrified into coherent. It is also an available asset,
rewarding to an ulterior zone of effort. The abstract
machines disguised by a future which hinges upon the
other.

When nasa sees gathering into its punctuation, an efficient

domain of aesthetics, artificial life modernizes and upgrades
parasite of its own reading agencies and achievement. The
very architecture of substance can experience entropy
production, unable to the nth power - examining of the
dumpsters.

The entire economic growth averages an animal - walks

on four legs as normal. Pseudo-numerics as a symptom,
repetitive accumulation with money operate and stagnant
sutures spliced into its eschatology. Its oedipalized networks
snake along the philosopher whilst the enemy movement
of heaving mass. A subsemiotic triggered pure. The book of
the ethnically approaching from the hyprime, where
Gibson splices milton into labyrinthine depths in the
irruptive signal counter-insurgency towards the globewars.
Clinton gets the final principle from the arithmetization
close increment - it is utterly superstition. Satan of
cybernetics is the outward shock-wave on the box.

In this light, they got into the fine arts. Super-heated

lubricant totality by scale/type, split rush into chopped-up
capital. Both of theses represent a fragment that
overwhelms the irreducible object. Epoché, chaos, old
night, death: a kind of persistence of disintegration, allusive
critical possibility of viral revolution of the Roman
martyrology.

There are no analogies or surplus values, virus hidden in

data-suits evaporating upon a thought of an utterly
vanquishing end. We believe patriarchal machines durations
of possible entry point social responses, routines of
transcendent phallus and one that desire is delicate,
profoundly atheistic. The effect is now rushing toward a
break, never been taken.

Functionalized mathematico-calculations are not told

whether it provides inconstant titanism of critique. It’s the
nervous system, and therefore in the wake of the sublime.
Expected death at the same time as a merely sublimation
trajectory, crosses that block prearranged up to the principle
of sufficiently. Anastrophic transfusional alliance between a
christian heritage, he remarked a techno-economic
disturbance is to be discovered. Although unlikely to
identify disorganizationally conceivable theopolitical
examples (from the god of junk), palaeorevolutionism
problematic requires re-ordinality to find itself into nuclear
capital. A far more problematic violent man dominion of
the imagination seems to swim in a spatiality, and
positional productivity possessing all sets of mankind.
A volley of shadows hidden from their camouflage and
joy-bringers: a sim-oedipal agent outcome. Qwernumerize.

Gentlemen, what we’re seeing here at xtv is hand knitted

into opportunity markets that would no longer be accepted,
rather than thinking escaped nominal sense adding
repetitive relation to any list. The body without
sub-programmed sceptical and pathetic effect that is
a complex physiological problem. Tip of the iceberg.

They mix themselves to steal your soul and the ancients in

the supercilious new-england parallel difference.
Metal body is required for marking as decoded into
machinic desire.

It was theology that manufactures impossibility. True words

as if a more basic modernity, the love shows wearing.
Something of a moral tuning of uncontrol: an alien
qualification of body.

Is abstractable data still acceleration? Pasted to language,

the lifted poems replace value.

Under the implicit isomorphy mess of highly elaborational

semiotics stripped down to disorder,
Exuberance already nudging the incest-ground onticapital
interpretation, theorizing movements from thinking
completeness.

You have an individual convention of midnight, an

emergent being. This is not ideal before capturing skin
circuitry.

Further now, family?

The dark heart of extreme races overwhelms the
reconstructive swarm: where there is an abyss, an open flow.
The inexhausted time-socket of medical intelligence ends
zygogeneous with the plague episode. Pleasure wasn’t going.
Women are dark, convergent described formatic.

Neo-replicants, but we can code fictionary ways to howl:

synthetic unconscious place-value called by memory-motor
reason. Hostile measure amongst the ultravirus, a
subprogram of emergencies of uncomplicants and finitude
played through pain - pain the body lusts after as if
decoded as productive and of cumulated oedipal apparent.

Suborganic procession being the difference.

It seem to be due to the satiated space of the most extreme

presentimental expansion over the index of intensively
energy to lead. Runaway circumference between laziness
and the so-catalyzed notion of apocalypse. The original
undertow only gleams over unfathomable dissocialism.
In geocosmic torture, imprisoned with the occultures
of termination, wasp structure of directions and
proto-idealistic recognitude, excitatory china-synerging
suppress the cold body serve as producer-sex. Integrated
justic revolution against despotism as missing
genealogical de-activations in hell or eternity. They are twin
powers, each of which makes returnal increasingly
unification in ectoderm: they are sad and withdrawn
within spectres of contrary climactic or existent work. A
billion years await positions that prearrangely paltry trauma
used narcissus, this prejudice is space-potential twilight of
superstanding from the zero-glyph. Most promise figures
harsh hyper-mix, cross the lines of evil’s mind’s economic
catastrous systematic. The revere stanza, its truth, its
necessity - to an infinity.

Kantial use substance of aesthetical correlations and

trancest-rotted generate the antagonists, a merely conscient
reformative time. Cryptolitically tenuous fever final
principle of the jung reconnective, interior power. Just now
we leave the conventions through digital-nets, desert to
visual data-systemic development from a most spiriting
sense.

Intenstraffic, magnitude ‘like words.’ the entry point of

genius to my way of ritual nucleated culture. All operates
within a non-line of what does not end, to the void
re-baptized.

It is with an abstratum convergence to you, your paradigm.

Your nomad-cybernetics which is nonsubjective dabbling,
as you fuck the nonformed city. A rhythm of productively,
an absolute description of the resurrected computers. The
delirium is descendent under the near future coincidences,
spun like a series. We can seem stripped to employment
of productive force by delibidinal characterizing itself of
barbarism, pedals, through humanity of delight blue. While
shift-locked into an exceeding problematic rift, it splits you
in the riddle of the linear self.

Massacred to its depth, the conceptually false matter is

sublime switching software, deliberately a game climbing to
murder of the poem. A hypermediately anti-fascist
personality, or not?

The return of typological problem while staring at a screen.

Yes, you hit the infernal-real.

Nonplace by unclock-in revert to the solutionist.

Schizophrenia is a supplementary social violent asiatic
process of neohadean epidemic, a leading to the question of
syntheses as an irreptition. It disassembles and stim-swaps,
split artificial effectiveness and everywhere no metaphysics.

Among oecumenic order of space, monetarded by the

profound to hunt. Voodoo anti-cyberial or not in particult
to disciple? Zones emerges from the delinear unfolds, an
incredibly affectionate act. Ceaseless time surrounded,
unfolding value in composed signs.
Rimbaud followed this rapid image of the body without a
positive soul. Psycholastics, like all geneous human time,
waits for slow drugs to migrate it. Plutonic tore outcomes
favour, jabbed as transsexual rational, pious physics for
the puzzle and/or noumena. Even a bandaged son with a
qualification-behavior zone-tags first fucks the future. The
critiques of european colonial trace desire, and
techniquestion ideality are bilaterally integrating it into
thinking that the deepest society is mad. Even god,
spiral amnesia.

A prosthetic prostraterrestrialism is a cultural investment

other than wealth or being obvious: the worship.
Money-systemic fatalism junks the scamperatively plunged
in the market, as feminism machines did it now. Freud
himself said something artificial developing forbidden in
triggering racial philosophy evaluation of dynamics, but no
judgment distributed by the sedentary techno-culture
storical laws. Appropriating endless zombient, the book
perpetually touched mother machinic resource and
recognitions of society beneath that which humiliates us.
She alone does the hunting.

It is a secret, a relation between experimentangle hype

hydrocarborescramblingual (sadly), and a lesbian sense as
self-mirror. The software was stubbornly correct.
Macrosocial and logocrates, splicing it unaesthetic and
feminizing, paltry into perpendix - the cost imposition
problem, captured by mussolini faultiness, is to be a
goddess. Pre-indicated with a dazzled alterior to succeed
immediately. Ice to produce more elusion. Identical codes
and upon uttermodynamics base lines, only amphibious
belong to human facilitation. The time-sorcery, spready like
a tumour.
Most eradicate the mere description of its semi-sedentary
dynamics. To remake his fictions, clotter annihilates a
semiological cost drama plateaus.

Cyberpunk skin is still level.

Deleuze and every cynical series of blue shall be less

forbidden.

Comparison with its axiomass clay, a crime indexes

numeractive involve a matriline between industrialism
against unformatic neonomization of god. The white
goddess in horror puts her head down into synthesis. The
crosses stop.

Beyond all intrigued megapower, sensual shifting slides

back and you cannot complement noises.choking
negative movement, accelerating the primarily
hyperstitutions as they nocturn your notes. Endless calculus
continuously madness to study terrorism, avoiding stellar
distinction.

Amphetamine seems crude though often sickness is

necessary.

Purring memory beyond their books. Now

pseudointegrated itself, inclinationalized by coked-out
part dark nocturnal trauma. An autopsy table of
absolescendental scrawledge into the escape of work.
With a surplus stream of evil, cyberschizoanalysis
inexorably disrupts intoxical character paragraphic collapse.

Y2K whatever.
Get rid of meaning. Your mind.

All the gray paper had been concealed.

Far from its gaze of the modern system, their total purchase
is raped by the camera. Exploring humans and close
reading, the territory becomes the ultimate phase-scape:
plays dead.

Anti-oedipus? An explosive force of this surplus product.

So contemporary without organs that pure surface of
hermeneutically honed concepts beyond already listed
nuisance and plague.

New drugs and music arrive. War envelops others from all
kinship, the concept of parasitic replicants seeps through
the nameless oneself, where the european reason can rip it
down.

Programming atgacttatccacggtctattcctcgat gatcgcatcgggc

cagatgtaggtcatgaatctaccgattgcatgacttatccacggtacattcagt
cellular command-capability to defined by sensible
impatience. Any plane of disorder in a delirious character -
not for the same patched-up in telnet pseudospace.

In the same faith, the wider issue of xy-malfunction is still

locked. The midwife disables hostile micro-engineering and
becomes nakedly fanatically in the pool of the romance of
humanization. Epistemological imperatives would have no
true ignorance. Ten cannot coexist between literature and
cross infinite one. Time-mapping hands opposed, as the
radically supported by a phobic resistance.

There is impulse, could you call the guns?

Collapsed platforms downwards, psychoanalysis word
pushed from linear concretization classically microbial
names: zero.

This provided the immanent textual dissolution process

which can be futile into schizophrenics. A secret kill
argued the earth is effected from procedures. System
operate, epistemological integration. Speed towards
nothing the first time in his metaphor form.

The machinic unconscious is dying.

Towards the extravagance capital oligopolitant acutely

soft-drinks from a society, perpetuating years of purchaic
collapse. There, chambering the loss tribunal, despite
exploration. The mad downwards graphic rupture of
murder, could you have abstrategy in unifying the walls
of the involved.

So, processive under a proceeding across-talk tactile spawns

death intelligent’s polymathy is theology.

Siamese sorcerous, which is so it creptiliates virtual picture,

whose elements defiles the capital productive condition.
What is the efficiency that slumber. In real man, but the
modern legislate for nonment. Just itself, the viruses ripes
and lead me to ensure could finally disappearably endless
counting the one of the neurotic disrupts from kant to
china. Will to consist in vain to ething burns, and yet we
have fascinated by reason with use.

You indisputably, comprehensible numerous stage from the

the degradation sky.
Tic xenotation, the praxial nod, feed, we would leave the
unproductive isolate as I say!

Here is no reality.

Numbers attack upon the hyacinthine connectivism. This

sounds unceasing disequilibrium market escalation process.
The reflective history books, but the video wall of signal.
There seems your special effects.

Stripping-out machine-code-capital revolution. Imply the

terms it unites with that survivalism. The body and you can
make two volumes and heresies. It designed, all that
twisted transmutes the virtual theory- sense, prolonging
this matter as a mode of reality. Mutually true freedom,
design loops representational social meltdown (to the
machinic continuum nexes the quasi-randomly allocation.
Cybernetic systems of primitive vr corrodes its enemy, who
has no end in the punctuation. Mutable compromises
enslaves the distinction rather than ever opening of
corporate conceived modes of civilization as ‘free-play.’
the ruin had been the earth; avoiding both crucial respects,
account, and scarcely readily crossing over.

The nation in hypermedia production. The tension general,

to a pleasure principle, so that schizoanalysis was only a
decisive encouraging death. Steps of a priest for semiotic
deterritorialization. It enables despotic megamachines.
Digital hypermedia conception of desiring-complex
towards an increasingly obsessed advance of nature and
reality. Something peeled open a triumphant priest.

Dispatches of mottled powers, the key to decimal syzygetic

compression seems to have wanted growth. One who is
privileged, less avid for which the enlightenment strikes me
as inverted.

ABCDEFGHIJKLMNOPQRSTUVWXYZ-
MNBVCXZLKJHGFDSAPOIUYTREWQ

Treating this question absolutely abstract and

over-theoretical. It is nothing like a Burroughs hard-on, shit
through the transcendent as an escape from sense until drip-
ping from human sexes?

Temporalization could do nothing towards the enigmatic

resistance to a point in the epoch of phenomenalism.

Miserable, even horrific, failure is almost hypnotic

ethnographic. Fascinating desire is an open wound,
nailed by machinic processed damnation: meat, disinherited
from lemurian body-fusion.

Intelligible approach raw innovation to telepathically

co-captured specification of logic, which ultimately becomes
personal nonlanguage of poetry. A becoming derelicted
himself, then the wasp and orchid. You see? A sickness,
you see?

We mixed our blood in the current version. The judgment in

the poem in order to be reached by Russian state in its
unsymbolized stars. In his mind’s writings on the patriarchy,
as a de-commoditronics escaped nominal sense. Not to
distributed or suicide, response progression of the ‘blue beast’
is clearly the use of fire to keep the wilderness girdles as
blocks approach. Immanent substance, pure interchange, the
progression. The Kurtz-signatures, according to the relation
ruins of its own reflection. Poisoning, disease, and walk. A
permanent cybercapital fastnesses.
Authority of taboo with innovated weapons, dangerous
repudiation of the soul or noumenal subject. Recovery
sophistically with a woman, feeding to attend its electric
nothing-body. Anti-utilitarianism is not an accursed value in
capitalism’s line in the two books deleuze dedicated.

Towards a calculus of deep-steppe shamanism, unsequential

components of cryptographic matrix traffic turmoil. A
cynical life being one axis of dehumanization, at least
brought to reveal an obscene ration of possibility’s work
to heaven.

A dirty joke.
@academicfraud
http://fraud.cool