Archives of Oral Biology 142 (2022) 105500

Contents lists available at ScienceDirect

Archives of Oral Biology

journal homepage: www.elsevier.com/locate/archoralbio

Influence of COL2A1-G1405S polymorphism on mandibular skeletal

malocclusions: A genetic association study and in silico analysis
Amin Kalmari a, Valiollah Arash b, Abasalt Hosseinzadeh Colagar a, *
a
Department of Molecular and Cell Biology, Faculty of Basic Science, University of Mazandaran, Babolsar PC:47416-95447, Mazandaran, Iran
b
Department of Orthodontics, Babol University of Medical Sciences, Babol PC: 47176-47745, Mazandaran, Iran

A R T I C L E I N F O A B S T R A C T

Keywords: Objective: The current study aimed to assess the association between collagen type II alpha 1 chain (COL2A1)
COL2A1 single nucleotide polymorphism (SNP: rs2070739; C>T; G1405S) and mandibular skeletal malocclusions in the
Mandibular skeletal malocclusions population of Mazandaran (North Iran).
Rs2070739
Design: During 13 months, 102 control samples, 81 samples with skeletal Class III malocclusion contributed by
Single nucleotide polymorphism
mandibular prognathism and 82 samples with skeletal Class II malocclusion contributed by mandibular retro­
gnathism were screened. Cephalometric analysis was performed to determine the type of abnormalities. COL2A1-
G1405S genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism
(PCR-RFLP) method. The HOPE tool was used to investigate the effect of COL2A1-G1405S on the three-
dimensional structure of protein.
Results: Results showed that there is no significant correlation between genotypes and alleles related to COL2A1-
G1405S and mandibular prognathism (CT genotype: p-value= 0.210; T allele: p-value= 0.222). On the other
hand, an association was observed between COL2A1-G1405S and mandibular retrognathism (CT genotype: p-
value= 0.008; T allele: p-value= 0.011). The outputs of the HOPE tool also showed that COL2A1-G1405S can
disrupt the NC1 domain of the protein.
Conclusions: Here, we provide evidence that COL2A1-G1405S polymorphism may have positive correlation with
the risk of skeletal Class II malocclusion contributed by mandibular retrognathism in the population of
Mazandaran. Given that the COL2A1-G1405S occurs in NC1 domain, it is possible that this domain plays an
important role in signaling pathways related to ossification. So, we suggest that the study of COL2A1 SNPs can
help researchers understand the significant role of this collagen in mandibular skeletal malocclusions.

1. Introduction malocclusions according to the maxillary and mandibular relationships

Mandible is the largest and only mobile bone in the human skull that
holds the lower teeth in place. The horseshoe-shaped part of this bone is
called the body, which ends in two vertical rami (Janfaza, 2011). The
mandibular condyle (most superior part of the mandible) is connected to
the glenoid fossa of the temporal bone by temporomandibular joint. The
articular surface of condyle is covered with secondary cartilage (Kuroda
et al., 2009). This cartilage is an important growth site, contributing to
the elongation of the mandibular ramus. Abnormalities in the growth of
the mandible cause different patterns in the profile of the face. These
patterns are divided into skeletal Class I, Class II and Class III
(Morcos & Patel, 2007). The mandibular base in Class II skeletal pattern
is posterior to the maxillary base, while in Class III it is anterior to the
maxillary base (Chou et al., 2011). Mandibular retrognathism is one of
the reasons that can lead to skeletal Class II malocclusion. On the other
hand, skeletal Class III malocclusion is mainly caused by mandibular
prognathism (Doraczynska-Kowalik et al., 2017). Unpleasant facial
profile, decrease self-confidence, low masticatory efficiency and defi­
ciency in speech articulation are among the obvious effects of this dis­
order (Guan et al., 2015). The mandibular condylar cartilage can be
involved in the development of mandibular retrognathism or mandib­
ular prognathism (Pirttiniemi et al., 2009). This cartilage divides from

Abbreviations: COL2A1, Collagen type II alpha 1 chain; ITGB1, Integrin β1; SMAD1, Mothers against decapentaplegic homolog 1; PCR-RFLP, polymerase chain
reaction-restriction fragment length polymorphism; Runx2, Runt-related transcription factor 2; SNP, single nucleotide polymorphism.
* Corresponding author.
E-mail addresses: a.kalmari@yahoo.com (A. Kalmari), v.arash@mubabol.ac.ir (V. Arash), ahcolagar@umz.ac.ir, acolagar@yahoo.com (A.H. Colagar).

https://doi.org/10.1016/j.archoralbio.2022.105500
Received 16 April 2022; Received in revised form 2 July 2022; Accepted 4 July 2022
Available online 5 July 2022
0003-9969/© 2022 Elsevier Ltd. All rights reserved.
A. Kalmari et al.
the condyle surface inward into superficial, proliferative, flattened and
hypertrophic zones (Robinson et al., 2015). The cells in each of these
four zones have different properties and express specific proteins. One of
the most significant proteins expressed by cells in the proliferative zone
is Sox9, which is important for regulation of chondrogenesis (Bi et al.,
1999). After differentiating of mesenchymal cells into chondrocytes in
the flattened zone, they express collagen type II alpha 1 chain (COL2A1)
as well as Sox9 (Shibukawa et al., 2007). The size of the cells in the
fourth zone increases, and these hypertrophic cells express large
amounts of runt-related transcription factor 2 (Runx2) and collagen type
X (Al-kalaly et al., 2009). Hypertrophic chondrocytes eventually un­
dergo apoptosis, and during a process called endochondral ossification,
bone replaces cartilage (Chen et al., 2021). Runx2 is a necessary factor
for bone formation that regulates chondrocyte hypertrophy, cartilage
matrix calcification, osteoblasts differentiation and osteoclasts function
during endochondral ossification in the rat mandibular condyle (Rabie
et al., 2004). Collagen type II acts as an extracellular signaling molecule
and interacts with integrin β1 (ITGB1) to regulate hypertrophic differ­
entiation of chondrocytes (Lian et al., 2019). It is the most abundant
collagen in the cartilage matrix and also is the marker for cartilage
formation in the condyle (Rabie et al., 2003).
Single nucleotide polymorphisms (SNPs) can be used as genetic
markers to detect an association between a gene and certain disease.
They occur at a specific position in the genome and have a significant
frequency (≥1%) in the human population. A missense mutation is a
type of SNP which changes the coding region of a particular gene to
replace one amino acid with another in a polypeptide chain (Sukhum­
sirichart, 2018).
Due to the role of COL2A1 in chondrocytes differentiation and ulti­
mately endochondral ossification, the aim of this study is to select an
effective missense SNP and investigate its association with mandibular
skeletal malocclusions in the population of Mazandaran (North Iran).
2. Material and methods
2.1. Sample collection and craniofacial measurements
Between January 2021 to February 2022, about 138 patients with
pleasant profile (suspected of skeletal Class I malocclusion), 128 patients
suspected of mandibular prognathism (skeletal Class III malocclusion)
and 114 patients suspected of mandibular retrognathism (skeletal Class
II malocclusion) referred to Arash Orthodontic Clinic (Babol, Mazan­
daran province, Iran). None of these individuals had previously under­
gone any orthodontic treatment and had no history of trauma or surgery
in the dentofacial region. Among these patients, 102 control samples
(mean age: 25.5 ± 13.5; 50 males and 52 females), 81 mandibular
prognathism samples (mean age: 25.5 ± 15.5; 41 males and 40 females)
and 82 mandibular retrognathism samples (mean age: 20.2 ± 9.0; 42
males and 40 females) were screened based on cephalometric analysis
results. Lateral cephalometric radiograph tracing was performed for
Steiner (SNA, SNB and ANB) and "Wits" appraisal to determine the type
of abnormalities in samples. The control group consisted of individuals
with SNA angle values within 82 ± 2 degrees (in patients with skeletal
Class II malocclusion >84◦ and skeletal Class III malocclusion <80◦ );
SNB angle values of 80 ± 2 degrees (in patients with skeletal Class II
malocclusion contributed by mandibular retrognathism <78◦ and skel­
etal Class III malocclusion contributed by mandibular prognathism
>82◦ ); and ANB angle values of 2 ± 2 degrees (in patients with skeletal
Class II malocclusion >4◦ and skeletal Class III malocclusion <0◦ )
(Steiner, 1953). According to the "Wits" appraisal, its normal value is 1
mm in males and 0 in females (Jacobson, 2003). Values higher and
lower than this normal threshold represent patients with skeletal Class II
and Class III malocclusions, respectively. All participants gave informed
written consent and filled out questionnaires about their personal in­
formation. Their gingival blood droplets were transferred to DNA
banking card (Kawsar Biotech Co, Iran) using a pen grasp. This card is
2
Archives of Oral Biology 142 (2022) 105500
suitable for the long-term storage and safe transport of blood samples at
room temperature and does not require freezing for the samples to
remain stable.
2.2. Selection and genotyping of SNP
In a study based on several web-based tools, researchers reported
rs2070739 (C>T; G1405S) as a significant and effective missense SNP in
the structure and function of COL2A1 protein (Kalmari et al., 2022). The
global allelic frequency of COL2A1-G1405S is above 0.1 in the 1000
Genomes project and occurs in exon 53 of COL2A1 (Fig. 1). The effect of
this SNP on the three-dimensional structure of protein was analyzed by
HOPE web-based tool (https://www3.cmbi.umcn.nl/hope/). This tool
collects structural information from several sources and combines this
information to give data about the effect of a certain mutation on the
protein structure.
Genomic DNA of all samples was extracted by commercial kits
(SinaClon Co, Iran). Amplification of COL2A1-G1405S flanking frag­
ments performed by two oligomers. They were designed and checked by
Oligo7 software and Primer-BLAST (NCBI), respectively. Primers were
24 nucleotides in length (COL2A1-F: 5′ TGTCACTCAGCCTATCTT
CTCTAC; COL2A1-R: 5′ GGAGGGAAAGAGGAGGAAAAGTAT). The PCR
reactions were performed by DNA thermal cycler (Master Cycler
Gradient; Eppendorf Co, Germany) in a final volume of 15 µl. This vol­
ume included 2 µl of genomic DNA (~20 ng), 8 µl of Master Mix (1X),
0.3 µl of each primer (~0.2 pmol) and 4.4 µl of ddH2O. All of PCR re­
agents prepared from SinaClon Co, Iran.
COL2A1-G1405S genotyping was performed by polymerase chain
reaction-restriction fragment length polymorphism (PCR-RFLP)
method. Ten microliters of the PCR product digested with 1 U Pvu II
restriction enzyme (5΄-CAG↓CTG; Jena Bioscience Co, Germany) and 1X
buffer at 37 ◦ C incubation for 12 h. The digested fragments were elec­
trophoresed in 1% agarose gel and stained with 1 μg/ml ethidium bro­
mide stock solution to detect of DNA bands with ultraviolet light (Green
& Sambrook, 2012). Direct sequencing of several PCR products (Gen­
Fanavaran Co, Iran) was used to confirm the results of the PCR-RFLP
method.
2.3. Statistical analysis
The odds ratio was calculated with 95% confidence interval (95 %
CI) for different alleles and genotypes in all groups. Hardy Weinberg
equilibrium was also tested in both case and control groups. p-val­
ue< 0.05 was considered statistically significant. Data were analyzed
using SPSS statistical software (ver. 16) and binary logistic regression
method.
3. Results
3.1. Genotyping of samples
The COL2A1-G1405S flanking fragments that amplified by PCR had
616 base pairs/bp. In the presence of C or T nucleotide at the SNP site,
the Pvu II restriction enzyme generates three (76, 184 and 356 bp) or
two (76 and 540 bp) fragments, respectively (Fig. 2A). The 76 bp frag­
ment had no effect on genotyping and was not considered (Fig. 2B). The
PCR-RFLP results were confirmed by direct sequencing of PCR products
(Fig. 2C & D).
3.2. Allelic and genotypic frequencies
The distributions of genotypes in all groups were in accordance with
Hardy-Weinberg equilibrium. The frequencies of homozygous (CC) and
heterozygous (CT) genotypes in the control group were 93.13% and
6.87%, respectively (Table 1). In the mandibular prognathism group,
these frequencies were 87.66% for homozygotes and 12.34% for
A. Kalmari et al. Archives of Oral Biology 142 (2022) 105500

Fig. 1. Human COL2A1 gene is localized to chromosome band 12q13.11. The rs2070739 is located in exon 53 (mRNA/Protein accession number: NM_001844.5/
NP_001835.3 retrieved from NCBI database).

Fig. 2. PCR-RFLP and direct sequencing results. (A) A schematic representation indicating how the Pvu II restriction enzyme digests PCR products. (B) Restriction
digest pattern on the 1% agarose gel electrophoresis, which stained by Ethidium bromide, CC and CT lanes indicate genotypes, L= Marker DNA ladder. (C) Elec­
tropherogram result of PCR product direct sequencing which showed CC genotype. (D) Electropherogram result of PCR product direct sequencing which showed
CT genotype.

heterozygotes. Also, in the mandibular retrognathism group, homozy­
gotes and heterozygotes had 79.27% and 20.73% genotypic frequencies,
respectively. In this study, no samples with TT genotype were observed.
According to the statistical results obtained in Table 1, there is no sig­
nificant association between genotypes and alleles related to COL2A1-
G1405S and mandibular prognathism. On the other hand, a linkage
was observed between the T-allele of COL2A1-G1405S (CT genotype: p-
value=0.008; T allele: p-value= 0.011) and mandibular retrognathism.
3.3. Analysis of protein structure
Analysis of COL2A1 protein sequence in UniProt database (https://
www.uniprot.org/) showed that COL2A1-G1405S SNP leads to the
substitution of Serine residue with Glycine in the fibrillar collagen NC1
domain (Fig. 3A). This replacement according to HPOE tool results, can
disturb NC1 domain and abolish its function (Fig. 3B1-B3).
4. Discussion
Mandible is one of the 28 bones of the human skull that plays an
important role in mastication and normal speech articulation because
some of the facial muscles are attached to it (White et al., 2011).
Overgrowth or undergrowth of this bone can lead to skeletal Class III or
Class II malocclusion, respectively (Morcos & Patel, 2007). Collagen

3
A. Kalmari et al. Archives of Oral Biology 142 (2022) 105500

Table 1 after stimulation of COL2A1. Direct interaction between SMAD1 and

Genotype and allele frequencies of COL2A1-G1405S analyzed in all samples. ITGB1 prevents it from activating (Lian et al., 2019). COL2A1 can also
p- regulate SMAD1 activity via ITGB1-induced extracellular
Genotype/ Allele No. and percentage OR (95 % CI)
value signal-regulated kinase1/2. Thus, by suppressing the activation of
A) Mandibular prognathism samples [Control, n ¼ 102 and Case, n ¼ 81] SMAD1 through these pathways, this protein cannot enter the nucleus
Genotype and modulate gene expression and Runx2 function (van der Kraan et al.,
frequency 2010). Runx2 is considered as a major factor for chondrocyte differen­
CC 95 (93.13%) 71 (87.66%) – – tiation and regulates endochondral ossification (Chen et al., 2014). In
1.911
CT 7 (6.87%) 10 (12.34%)
(0.694–5.267)
0.210 the thirteenth week of embryonic development, the mandibular
TT 0 (0%) 0 (0%) – – condylar cartilage, in collaboration with other parts, forms the condyle
1.911 through endochondral ossification (Guan et al., 2015).
CT+TT 7 (6.87%) 10 (12.34%) 0.210
(0694–5.267) To date, researchers have reported the association of different genes
Allele frequency
with mandibular skeletal malocclusions (caused by mandibular retro­
197 152
C
(96.57%) (93.83%)
– – gnathism or mandibular prognathism). The study of important SNPs of
1.852 these genes has played a critical role in the success of research. For
T 7 (3.43%) 10 (6.17%) 0.222
(0.689–4.977) example, there are reports that some SNPs in MATN1, EPB41 and FGFR2
B) Mandibular retrognathism samples [Control, n ¼ 102 and Case, n ¼ 82] genes may increase the risk of mandibular prognathism (Dor­
Genotype
frequency
aczynska-Kowalik et al., 2017). The same is true of mandibular retro­
CC 95 (93.13%) 65 (79.27%) – – gnathism, for example some SNPs in MYO1H and MATN1 genes are
3.549 positively linked to this abnormality (George et al., 2021). These find­
CT 7 (6.87%) 17 (20.73%) 0.008
(1.393–9.041) ings demonstrate the importance of SNPs in the risk of mandibular
TT 0 (0%) 0 (0%) – –
disorders. In the present study, rs2070739 (C>T; G1405S) was selected
3.549
CT+TT 7 (6.87%) 17 (20.73%)
(1.393–9.041)
0.008 to investigate the role of COL2A1 in mandibular skeletal malocclusions
Allele frequency according to the suggestion of researchers (Kalmari et al., 2022). There
C
197 147
– –
are also reports that rs2070739 alleles are associated with some diseases
(96.57%) (89.64%) such as post-exercise induced muscle damage recovery and ages on set of
3.255
T 7 (3.43%) 17 (10.36%) 0.011 osteonecrosis of the femoral head (Kalmari et al., 2022). Due to the fact
(1.316–8.051)
that the exact nature of COL2A1 binding sites on ITGB1 as well as the
OR, odds ratio; CI, confidence interval; The significant results are bolded. effect of COL2A1-G1405S on the hypertrophic differentiation of chon­
drocytes are not known, two groups with retrognathism and progna­
type II is one of the genetic factors that has been reported to be associ­ thism of the mandible were screened as patients. Thus, the effect of
ated with the risk of mandibular prognathism (Xue et al., 2014). COL2A1-G1405S SNP on the mandibular malocclusions could be
Expression of this collagen by chondrocytes in the mandibular condyle investigated from two aspects. Our results showed that there is no sig­
plays an effective role in cartilage formation (Rabie et al., 2003). nificant association between COL2A1-G1405S and mandibular progna­
COL2A1, as a signaling molecule in the extracellular matrix, can regu­ thism (Table 1). Also, the researchers reported that the A-allele of
late hypertrophic differentiation of chondrocytes (Lian et al., 2019). COL2A1-rs1793953 SNP can significantly decrease the risk of this dis­
ITGB1 receptors compete with other cell membrane receptors for order (Xue et al., 2014). Therefore, it seems that collagen type II cannot
binding to mothers against decapentaplegic homolog 1 (SMAD1) protein

Fig. 3. Schematic structure of COL2A1 sequence and HOPE results. (A) Complete protein sequence of human COL2A1 (accession number: NP_001835.3) which is
composed of 1487 amino acid residues. (B1-B3) Structural analysis in HOPE tool. (B1) Mutated residue is colored magenta and shown as small balls. (B2) Close-up of
the rs2070739 SNP; The protein is colored grey, the side chains of both the wild-type and the mutant residue are shown and colored green and red respectively. (B3)
Close-up of the rs2070739 SNP (seen from a different angle).

4
A. Kalmari et al.
play an effective role in skeletal Class III malocclusion contributed by
mandibular prognathism. On the other hand, the results showed that the
T-allele of COL2A1-G1405S can cause mandibular retrognathism (As
shown in Table 1: CT genotype: p-value= 0.008; T allele: p-value=
0.011). This SNP may enhance the interaction of COL2A1 with ITGB1 by
altering the NC1 domain structure. As a result of this increased inter­
action, more SMAD1 proteins are inactivated by ITGB1 and extracellular
signal-regulated kinase1/2, and eventually Runx2 expression is reduced.
And due to the effect of Runx2 on chondrocyte differentiation, endo­
chondral ossification is impaired and the growth of the mandible de­
creases. Therefore, this disorder in the growth pattern may lead to
different degrees of mandibular retrognathism.
5. Conclusion
To the best of our knowledge, this is the first study to report an as­
sociation between COL2A1 SNP and mandibular skeletal Class II
malocclusion. Here we provide evidence that the T-allele of rs2070739
(C>T; G1405S) can significantly increase the risk of mandibular retro­
gnathism in the population of Mazandaran. Since the COL2A1-G1405S
occurs in NC1 domain, it is possible that this domain plays an impor­
tant role in signaling pathways related to ossification. Due to the
discovered roles of COL2A1 in regulating chondrocyte differentiation in
recent years, we suggest that the linkage between SNPs of this collagen,
especially rs2070739, and mandibular malocclusions be investigated in
different races. It is possible that with further studies on COL2A1 SNPs,
different skeletal patterns of the mandible will be observed in the future.
Funding source declaration
The authors received no financial support for the research, author­
ship, and/or publication of this article.
Ethics approval statement
This research was approved by the human ethics committees of
“University of Mazandaran” at Iran Ministry of Health and Medical
Education (IR.UMZ.REC.1399.032).
CRediT authorship contribution statement
Amin Kalmari: Conceptualization, Methodology, Investigation,
Data curation, Writing – original draft. Valiollah Arash: Conceptuali­
zation, Methodology, Data curation, Writing – review & editing. Abasalt
Hosseinzadeh Colagar: Conceptualization, Methodology, Investiga­
tion, Writing – review & editing, Supervision.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgements
The authors would like to thank Mr Mohammadkazem Heydari (PhD
candidate from University of Mazandaran, Iran) for his assistance in
some data curation and analysis; Dr. Parsa Nouri Delavar (from Babol
University of Medical Sciences, Iran) and Dr. Mohammad Sadeghi (from
Hormozgan University of Medical Sciences, Iran) for their cooperation
in tracing of lateral cephalometric radiograph.
Archives of Oral Biology 142 (2022) 105500
Author agreement
All authors gave final approval and agree to be accountable for all
aspects of the work.
References
Al-kalaly, A. A., Leung, F. Y., Wong, R. W., & Rabie, A. B. M. (2009). The molecular
markers for condylar growth: Experimental and clinical implications. Orthodontic
Waves, 68(2), 51–56. https://doi.org/10.1016/j.odw.2008.11.004
Bi, W., Deng, J. M., Zhang, Z., Behringer, R. R., & De Crombrugghe, B. (1999). Sox9 is
required for cartilage formation. Nature Genetics, 22(1), 85–89. https://doi.org/
10.1038/8792
Chen, H., Ghori-Javed, F. Y., Rashid, H., Adhami, M. D., Serra, R., Gutierrez, S. E., &
Javed, A. (2014). Runx2 regulates endochondral ossification through control of
chondrocyte proliferation and differentiation. Journal of Bone and Mineral Research,
29(12), 2653–2665. https://doi.org/10.1002/jbmr.2287
Chen, H., Tan, X. N., Hu, S., Liu, R. Q., Peng, L. H., Li, Y. M., & Wu, P. (2021). Molecular
mechanisms of chondrocyte proliferation and differentiation. Frontiers in Cell and
Developmental Biology, 9. https://doi.org/10.3389/fcell.2021.664168
Chou, S. T., Tseng, Y. C., Pan, C. Y., Chang, J. Z. C., & Chang, H. P. (2011). Craniofacial
skeletal dysplasia of opposite-sex dizygotic twins. Journal of the Formosan Medical
Association, 110(5), 342–346. https://doi.org/10.1016/S0929-6646(11)60051-X
Doraczynska-Kowalik, A., Nelke, K. H., Pawlak, W., Sasiadek, M. M., & Gerber, H.
(2017). Genetic factors involved in mandibular prognathism. Journal of Craniofacial
Surgery, 28(5), e422–e431. https://doi.org/10.1097/SCS.0000000000003627
George, A. M., Felicita, A. S., Tania, S. M., & Priyadharsini, J. V. (2021). Systematic
review on the genetic factors associated with skeletal Class II malocclusion. Indian
Journal of Dental Research, 32(3), 399. https://doi.org/10.4103/ijdr.IJDR_59_20
Green, M.R., & Sambrook, J. (2012). Molecular cloning. A Laboratory Manual 4th.
Guan, X., Song, Y., Ott, J., Zhang, Y., Li, C., Xin, T., … Zhou, Y. (2015). The ADAMTS1
gene is associated with familial mandibular prognathism. Journal of Dental Research,
94(9), 1196–1201. https://doi.org/10.1177/0022034515589957
Jacobson, A. (2003). The “Wits” appraisal of jaw disharmony. American Journal of
Orthodontics and Dentofacial Orthopedics, 124(5), 470–479. https://doi.org/10.1016/
S0889-5406(03)00540-7
Janfaza, P. (2011). Surgical anatomy of the head and neck. . Harvard University Press.
Kalmari, A., Heydari, M., Hosseinzadeh Colagar, A., & Arash, V. (2022). In silico analysis
of collagens missense SNPs and human abnormalities. Biochemical Genetics, 1–27.
https://doi.org/10.1007/s10528-021-10172-6
Kuroda, S., Tanimoto, K., Izawa, T., Fujihara, S., Koolstra, J. H., & Tanaka, E. (2009).
Biomechanical and biochemical characteristics of the mandibular condylar cartilage.
Osteoarthritis and Cartilage, 17(11), 1408–1415. https://doi.org/10.1016/j.
joca.2009.04.025
Lian, C., Wang, X., Qiu, X., Wu, Z., Gao, B., Liu, L., … Su, P. (2019). Collagen type II
suppresses articular chondrocyte hypertrophy and osteoarthritis progression by
promoting integrin β1− SMAD1 interaction. Bone Research, 7(1), 1–15. https://doi.
org/10.1038/s41413-019-0046-y
Morcos, S. S., & Patel, P. K. (2007). The vocabulary of dentofacial deformities. Clinics in
Plastic Surgery, 34(3), 589–599. https://doi.org/10.1016/j.cps.2007.05.016
Pirttiniemi, P., Peltomäki, T., Müller, L., & Luder, H. U. (2009). Abnormal mandibular
growth and the condylar cartilage. The European Journal of Orthodontics, 31(1), 1–11.
https://doi.org/10.1093/ejo/cjn117
Rabie, A. B. M., She, T. T., & Hägg, U. (2003). Functional appliance therapy accelerates
and enhances condylar growth. American Journal of Orthodontics and Dentofacial
Orthopedics, 123(1), 40–48. https://doi.org/10.1067/mod.2003.45
Rabie, A. B. M., Tang, G. H., & Hägg, U. (2004). Cbfa1 couples chondrocytes maturation
and endochondral ossification in rat mandibular condylar cartilage. Archives of Oral
Biology, 49(2), 109–118. https://doi.org/10.1016/j.archoralbio.2003.09.006
Robinson, J., O’Brien, A., Chen, J., & Wadhwa, S. (2015). Progenitor cells of the
mandibular condylar cartilage. Current Molecular Biology Reports, 1(3), 110–114.
https://doi.org/10.1007/s40610-015-0019-x
Shibukawa, Y., Young, B., Wu, C., Yamada, S., Long, F., Pacifici, M., & Koyama, E.
(2007). Temporomandibular joint formation and condyle growth require Indian
hedgehog signaling. Developmental dynamics: an Official Publication of the American
Association of Anatomists, 236(2), 426–434. https://doi.org/10.1002/dvdy.21036
Steiner, C. C. (1953). Cephalometrics for you and me. American Journal of Orthodontics,
39(10), 729–755. https://doi.org/10.1016/0002-9416(53)90082-7
Sukhumsirichart, W. (2018). Polymorphisms. Genetic diversity and disease susceptibility.
IntechOpen. https://doi.org/10.5772/intechopen.76728
van der Kraan, P. M., Blaney Davidson, E. N., & van den Berg, W. B. (2010). A role for
age-related changes in TGFβ signaling in aberrant chondrocyte differentiation and
osteoarthritis. Arthritis Research & Therapy, 12(1), 1–9. https://doi.org/10.1186/
ar2896
White, T. D., Black, M. T., & Folkens, P. A. (2011). Human osteology. . Academic Press.
Xue, F., Rabie, A. B. M., & Luo, G. (2014). Analysis of the association of COL2A1 and IGF-
1 with mandibular prognathism in a Chinese population. Orthodontics & Craniofacial
Research, 17(3), 144–149. https://doi.org/10.1111/ocr.12038