MolBiol2C03: Genetics

Molecular techniques
Yusra Tariq, Jason Lee, Kriesha Eyer

Objectives:
 Explain how could a fragment of DNA be amplified
 Design PCR primers
 Be able to differentiate between Sanger sequencing and Next Generation sequencing

Outline: In this week tutorial, you will discuss about PCR and design a set of primers for a given DNA
sequence.

Preparation
To prepare for the tutorial you should:

 Read and bring to the tutorial this Guide

 Read: 7.5 Methods of Molecular Genetic Analysis Make Use of DNA Replication Processes
(pg. 260 – 266) from “Genetics analysis - an integrated approach”

Polymerase Chain Reactions (PCR)

The polymerase chain reaction is a technique which amplifies a fragment of DNA a billion-fold in few
hours. The process consists of denaturing the double stranded DNA at 95 0C and replicating the DNA
using a DNA (Taq) polymerase enzyme.

The ingredients necessary for PCR are:

 Template DNA – low amount of DNA from which we want to amplify a fragment of 100-5000 base
pairs (target sequence).
 Primers – two small specific synthetic oligonucleotides, which exactly match two 15-30 unique base
pair region of the target sequence.
 Taq polymerase – enzyme that catalyze the adding of new nucleotides to the 3’-OH of the primer.
 Deoxynucleotide triphosphate (dNTPs) – equal mixture of dATP, dCTP, dGTP and dTTP. They are the
substrate for Taq polymerase.
 Magnesium – required for Taq polymerase activity.
 Buffer – to maintain the reaction’s pH.

Each PCR cycle has three steps1:

1. Denature. The PCR ingredients are heated at 95 0C for the double stranded DNA to denature into
single strands, by breaking the hydrogen bounds between the strands.
2. Annealing. The primers will bind (anneal) to the appropriate place on the template DNA that
contains the complementary sequence at around 550C. The forward primer will bind to the
bottom strand and the reverse primer will bind to the top strand.
 3. Elongation. The Taq polymerase synthesis new DNA from 5’ to 3’, at 72 0C. DNA polymerase
adds dNTPs to the primers in the same direction as in cellular replication. At the end of the cycle
new two new DNA strands are produced.
The whole cycle is then repeated 25-40 times. With each cycle the amount of template DNA doubles,
which increases exponentially.

Designing primers1
Primers are crucial in the process of specific amplification of DNA. There are some rules you have to
follow when designing primers:
 primers should be specific, each member of a primer pair anneals only to its target sequence in
the template DNA
 primers should complement the template DNA;
 primers should be 17-25 nucleotides in length;  
 the primers’ CG (G+C) content should be 40-60%;  
 primers should end (3') in a G or C, or CG or GC, this increases efficiency of annealing;  
 Melting temperatures (Tm) of hybrids between primers and their target sequence should be 55-
70oC are preferred;  
 3'-ends of primers should not be complementary (i.e. base pair), as otherwise primer dimers will
be synthesized preferentially to any other product;  
 primer self-complementarity (ability to form 2 o structures such as hairpins) should be avoided; 
 runs of four or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich
sequences (because of stability of annealing), and should be avoided.  

Melting temperature (Tm)1 is the temperature at which oligonucleotide primers dissociate from their
template. There are many formulas and computer programs to determine the theoretical melting
temperature. Tm is important for determining the annealing temperature (Ta), which is the optimal
temperature for the primers to anneal to target DNA.
In general Ta is 3-50C lower than the calculated Tm. If the annealing temperature is too high, the
primers anneal poorly to the template and the yield of amplified DNA is very low. If the annealing
temperature is too low, the primers will anneal nonspecific, resulting in the amplification of
unwanted segments of DNA.

1. Adapted from “Molecular Cloning: A Laboratory Manual”, by Joe Sambrook (2001).

 MolBiol2C03: Genetics
Molecular techniques
1. Which of these can DNA polymerase add on to?
A)    5’----------------------------------3'
3’----------------------------------5’
B)    5’-------------------3’
3’----------------------------------5’
C)    5’----------------------------------3’
3’-------------------5’

2. Given a sequence of double stranded DNA, name the primers, both forward and reverse that would
anneal to the sequence (only extend the primers for 6 bases).

5’-AAGTCGTAACC TTGCACGGTAGC-3’

3’-T TCAGCATTGGAACGTGCCATCG-5’

Forward Reverse
                A) 5’-AACCTT-3’     5’-AAGTCG-3’
                B) 5’-TTCAGC-3’     5’-CGGGGC-3’
                C) 5’-AAGTCG-3’     5’-GCTACC-3’
                D) 5’-GGTAGC-3’     5’-GCCCCG-3’
                E) 5’-ATGCGT-3'     5’-TTGGAA-3'

3. You are working for 23andme and you have to determine your clients’ genotype for SNP rs2472297.
This SNP is a point mutation of CYP1A2 gene, involved in coffee metabolism. The T allele of rs2472297 is
consistently linked to a higher coffee intake than the ancestral C allele.
First you want to amplify a ~ 200bp fragment that includes the SNP, and for this you need to design
primers.

5’-TTGCACAAA TGTTTCCCAA GCCAATGAAT TATGAAATAA GCCTTGCAGG GGAATGTTTG AGCTACTGAA

GGGCATGTTC GGCATGATCA GAGGAACACT CTGTTTCCAA GTTAGTA ATG Y* CTCTTTACAT ATAAACACTG
ATGTTTGTTG ATAATGAACA TTCATGTCCT CAATCAAAGC AGAGCCTCTG GGGACACTTC TCTATCAGCC
AAGTGCTCCT AGAAGTGTTC-3’

*where Y represents the SNP and it could be C or T

a) Underline and write your primers in a 5’-3’ orientation.

Forward: 5’ – TTGCACAAATGTTTCCCAAG – 3’

Reverse: 5’ – GAACACTTCTAGGAGCACTT – 3'

b) What is their annealing temperature using the Wallace/Ikatura rule?

Tm forward =2 o (number of A's and T's) + 4 o (number of G's and C's)

= 2 o (12) + 4 o (8)

= 56 o C

Ta forward = Tm-5 o

= 56-5

= 51 o C

Tm reverse = 2 o (number of A's and T's) + 4 o (number of G's and C's)

= 2 o (11) + 4 o (9)

= 58 degrees

Ta reverse = Tm - 5 o

= 58-5

= 53 o C