Cryobiology 96 (2020) 30–36

Contents lists available at ScienceDirect

Cryobiology
journal homepage: http://www.elsevier.com/locate/cryo

The combination of basic fibroblast growth factor and kit ligand promotes
the proliferation, activity and steroidogenesis of granulosa cells during
human ovarian cortical culture
Zeinab Ghezelayagh a, b, Naeimeh Sadat Abtahi b, Mojtaba Rezazadeh Valojerdi b, c,
Aboulfazl Mehdizadeh d, Bita Ebrahimi b, *
a
Department of Developmental Biology, University of Science and Culture, ACECR, Tehran, Iran
b
Department of Embryology, Reproductive Biomedicine Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran
c
Department of Anatomy, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran
d
Endometriosis Research Center, Iran University of Medical Sciences, Tehran, Iran

A R T I C L E I N F O A B S T R A C T

Keywords: Different factors, such as basic fibroblast growth factor (bFGF) and kit ligand (KL), are used in ovarian cortical
Human ovarian tissue culture to promote activation of primordial follicles. In the present study, the effects of bFGF and KL, alone and in
Cryopreservation combination, were evaluated on human follicular activation and growth during in-situ cortical culture. Slow
Kit ligand
frozen-thawed human ovarian cortical tissues (n = 6) were cultured in 4 different groups: 1) control (base
Basic fibroblast growth factor
Primordial follicle
medium), 2) KL (base medium; BM + 100 ng/ml KL), 3) bFGF (BM + 100 ng/ml bFGF) and 4) bFGF + KL (BM +
In-vitro culture 100 ng/ml KL + 100 ng/ml bFGF) for a week. The proportion of morphologically normal and degenerated
follicles at different developmental stages, secreted hormonal levels and specific gene expressions were
compared. Although the proportion of growing follicles was higher than primordial counterpart in all cultured
groups, no significant differences were observed among the cultured groups. In all cultured groups, anti-
Müllerian hormone (AMH), progesterone and estradiol hormones levels increased after 7 days of culture;
however, this increase was only significant for estradiol in the bFGF + KL group. The expression of Ki67 gene
indicated an increase in ovarian cell proliferation in the three experimental groups compared to the control
group, however this increment was only significant for the bFGF + KL group. It can be concluded that KL and
bFGF factors individually have no beneficial effects on in-situ follicular growth, but their combination positively
influences steroidogenesis of granulosa cells without significantly increasing the number of growing follicles.

1. Introduction
Ovarian folliculogenesis is a complex and dynamic process, in which,
follicular development starts with primordial follicle recruitment, is
followed by growth and is completed with ovulation or atresia. Pri­
mordial follicle activation is a gonadotropin-independent stage and
occurs under the influence of local regulatory factors secreted by the
oocyte and its surrounding granulosa cells (GCs), in a special temporal
manner. Understanding how these factors perform in this progression
can lead to improvements in to in-vitro follicle culture [12,38].
Since in-vitro culture of isolated human primordial follicles is tech­
nically challenging due to the small sizes of the follicles, dense ovarian
stroma and the long time period needed to reach the preantral stage, in-
situ follicle culture seems to offer promise as an alternate method. In-situ
follicle culture allows normal follicular structure maintenance and fol­
licle–stroma interactions in a three-dimensional manner and overcomes
the technical challenges of in-vitro culture [8,40].
In-vitro culture of cryopreserved ovarian cortical tissue is yet another
alternative technique that initiates primordial follicle activation and
improves follicular development. The ovarian tissue culture system not
only provides an important model to understand the mechanism of
folliculogenesis but is also a potential clinical tool for fertility preser­
vation. This approach can potentially improve fertility potential and
achieve biological parenthood for women with gonadal insufficiency,
such as cancer survivors [7,14,52]. Until date, different substances
including growth factors, transcription factors, cytokines and peptides

* Corresponding author.
E-mail addresses: b.ebrahimi@royaninstitute.org, bitaebrahimi@gmail.com (B. Ebrahimi).

https://doi.org/10.1016/j.cryobiol.2020.08.011
Received 28 May 2020; Received in revised form 4 August 2020; Accepted 26 August 2020
Available online 29 August 2020
0011-2240/© 2020 Elsevier Inc. All rights reserved.
Z. Ghezelayagh et al.
have been used in the culture medium to improve the development and
survival of follicles in ovarian tissue.
Follicle stimulating hormone (FSH) [3,35,36], growth and differen­
tiation factor 9 (GDF-9) [23,34,60], basic fibroblast growth factor
(bFGF) [19,37,42], insulin [26,33], and epidermal growth factor (EGF)
[6,10] are some factors that have been studied for follicular activation
and development in ovarian tissue cultures. However, the role of various
factors during this process and their interaction and coordination with
each other continue to be elucidated. bFGF, also called FGF-2, is
involved in follicle development and is considered to be a primordial
follicle-inducing factor that directly influences female reproductive ef­
ficiency. bFGF is involved in a wide range of ovarian functions,
including steroidogenesis [59], granulosa cell differentiation [4], stro­
mal cell proliferation, theca and granulosa cell mitosis [50], angiogen­
esis and apoptosis [56]. bFGF promotes both activation and survival of
primordial follicles in different species [35,41,45]. Although various
bFGF expression patterns have been shown in different species, this
growth factor is generally expressed by the oocytes of primordial and
primary follicles, the granulosa and theca cells of developing follicles
and also the corpus luteum (bovine [58], rat and pig [21], mouse [61],
and human [63]). bFGF receptors, FGFR1/FGFR2, are located on GCs
[5]. A study conducted on human showed that high doses of bFGF can
stimulate estrogen production and also enhance primordial follicular
development in a serum-free medium [19]. Moreover, it has been shown
that a combination of bFGF with other factors appears to have a syn­
ergistic effect on the activation and growth of primordial follicles in goat
[35] and rat [42] models and when combined with FSH, increased the
survival and further development of primordial follicles during
long-term culture of cattle ovarian tissue [53].
Another important growth factor identified in follicles is the kit
ligand (KL). Similar to the bFGF, KL appears to be a primordial follicle-
inducing factor. KL or steel factor or stem cell factor is a secreted product
of GCs of primordial and primary follicles and affects oocytes, theca, and
stromal cells. It also promotes primordial follicle activation [8,45,57].
Binding of KL to c-Kit, its proto-oncogene receptor tyrosine kinase, ac­
tivates phosphotidylinositide 3-kinase (PI3K) and mitogen-activating
protein kinase (MAPK) signaling pathways that act at different stages
of follicular development and regulate its development and survival [11,
16]. In human ovaries, c-Kit receptor expression is detected in oocytes of
primary and secondary follicles and in GCs of primary, secondary, and
preantral follicles [8,22]. In-vitro KL treatment, being the upstream
signaling of Foxo3 activity, has been found to increase the proportion of
cytoplasmic Foxo3 in primordial follicles in postnatal mouse ovaries
leading to primordial follicle activation [18]. The in-vivo and in-vitro
studies in different species have shown that migration, survival,
growth, and activation of primordial germ cells during embryonic
development [15,20,49], proliferation of GCs [43], recruitment and
differentiation of theca cells [44,46], primordial follicle activation [29,
42,45], cytoplasmic and meiotic competence of oocytes [27,54], antral
cavity formation [28], and androgen production in adult ovaries [39,46]
are related to the KL/c-Kit system. It has also been shown to be an
anti-apoptotic factor for oocyte and follicles during ovarian culture [1].
A study conducted by Carlson et al., demonstrated that KL signaling
controls follicle survival during the in-vitro culture of human ovarian
tissue [8].
In comparison to rodents and non-human primates, little is known
about the effect of growth factors and hormone signals on early in-vitro
human follicular development. As influences of growth factors on fol­
licle development are not completely uniform among different species
and most studies have hitherto been conducted on rodents; the objective
of the current study was to evaluate the effect of bFGF and KL, separately
and in combination, on human follicle activation and growth during in-
vitro culture of human ovarian tissue.
31
Cryobiology 96 (2020) 30–36
2. Materials and methods
2.1. Ovarian tissue collection
Ovarian tissue was obtained from 6 transsexual women with the
mean age of 27 ± 5 years who underwent sex reassignment surgery
(female to male). Informed consent was received from each donor. This
study was approved by the Ethics Committee of Royan Institute (ethics
code: IR. ACECR.ROYAN.REC.1396.212).
2.2. Ovarian tissue manipulation
The ovarian tissues were transferred to the laboratory in medium199
plus HEPES (Gibco, Paisley, UK) supplemented with 4% human serum
albumin (HSA; Alburex 20, CSL Behring, Alemanha) on ice and rinsed
several times with isotonic saline solution (sodium chloride 0.9%,
Tehran, Iran) containing 50 μg/ml penicillin and 60 μg/ml strepto­
mycin. Then, the ovaries were placed in a culture dish (Becton Dick­
inson, Sparks, MD, USA) containing fresh dissecting medium and the
medulla was removed by precise dissection. Thin layers of ovarian
cortex were cut into small strips of 5 × 10 mm with 0.5–1 mm thickness
and were processed for cryopreservation.
2.3. Cryopreservation and thawing of ovarian tissues
Slow-freezing technique was performed for cryopreservation of
ovarian strips [13]. The strips were transferred to cryoprotectant basic
solution, medium199 plus HEPES, supplemented with 2% HSA and 10%
dimethyl sulfoxide (Me2SO; Sigma Aldrich, St. Louis, MO, USA). Then,
the cortical strips were transferred into cryovials (Nunc, Fisher Bio block
Scientific, France), containing 1.5 ml of cryoprotectant basic solution
and cryopreserved slowly in a programmable freezer (Cryologic,
Australia) with the following program: cooling from 0 ◦ C to − 8 ◦ C at
− 2 ◦ C/min followed by manually seeding, and cooling to − 40 at
0.3 ◦ C/min and − 70 ◦ C at 5 ◦ C/min. The program included holding time
for 6 min at the same temperature. Samples were plunged into − 196 ◦ C
liquid nitrogen and stored.
In order to thaw the samples, the cryovials were kept at room tem­
perature for 2min before being immersed in a water bath at 37 ◦ C. The
tissue strips were then transferred to medium199 plus HEPES containing
10% HSA and incubated for 20 min at 37 ◦ C.
2.4. Culturing method
Each cryopreserved-thawed ovarian cortical strip was cut into
smaller fragments (2×1x1 mm3) and placed on a 1.5% agar (Sigma
Aldrich, St. Louis, Missouri, USA) scaffold which was prepared and
soaked overnight in α-minimal essential medium (α-MEM; Gibco) plus
10% HSA. A total number of 80 ovarian fragments were cultured for
histological and real-time assessments. The basic culture medium con­
sisted of αMEM medium, 0.5 IU/ml human recombinant follicle stimu­
lating hormone (FSH; Gonal-F, Merk, Darmstadt, Germany), 10% HSA,
1% ITS (Insulin, Transferrin, Selenium; Gibco), 0.5% Antibiotic Anti­
mycotic solution (Sigma), 2.5 mM 8-Bromoguanosine 3′ , 5′ -cyclic
monophosphate sodium salt (8-br-cGMP; Sigma) and 200 nM GDF9 (Cell
sciences, Canton, MA, USA), 100 ng bFGF (R&D, Minneapolis, MN,
USA), 100 ng KL (SCF; Stem cell factor, Royan, Tehran, Iran) or both
were added to the culture medium according to the experimental
groups: 1) control (base medium), 2) KL (base medium; BM + KL), 3)
bFGF (BM + bFGF) and 4) bFGF + KL (BM + KL + bFGF). Ovarian
cortical strips were cultured in a humidified standard incubator in 5%
CO2 at 37 ◦ C for 7 days. Half of the culture medium was exchanged every
second day. At the end of the culture period, the ovarian cortical tissues
were fixed immediately in Bouin’s fixative for 24 h and then transferred
to 10% formaldehyde (Merk, Darmstadt, Germany) for histological
assessment or in RNA latter for RNA extraction.
Z. Ghezelayagh et al.
2.5. Hormonal evaluation
During the culture period, on days 2 and 7, spent media were
collected and stored at − 20 ◦ C for 17 beta-estradiol, progesterone and
AMH quantification. Hormone levels were evaluated by ELISA (AMH:
Ansh Labs, TX, USA; AccuBind E2 and AccuBind Progesterone: Mono­
Bind Ins. Lake Forest, CA, USA), according to the manufacturer’s
instructions.
2.6. Histological evaluation
Formalin-fixed cortical fragments (n = 48) were processed,
embedded in paraffin and 6 μm thickness serial sections were prepared.
Slides were de-paraffinized, hydrated and stained with hematoxylin and
eosin for histological analysis and follicle counting. Numbers of
morphologically normal and degenerated follicles were evaluated under
a light microscope (Nikon Eclipse E200). The sections were counted 1:5
and in order to avoid double counting, only follicles showing oocytes
were counted. Based on GC shape and number of layers, follicles were
classified as: primordial (with a single layer of flattened GCs), transi­
tional (with a layer of cuboidal and flattened GCs), primary (with a
single layer of cuboidal GCs), and secondary (with at least two layers of
cuboidal GCs and a theca cell layer). The follicular stages beyond pri­
mordial stage were considered as growing follicles. Degenerated follicles
were characterized by pyknotic cells, eosinophilia of the ooplasm, and
clumping of the chromatin material. The follicle density was also
calculated based on formula provided in Schmidt et al., 2003 [51].
2.7. RNA isolation and qRT-PCR
To quantify the follicular development, the oocyte and granulosa cell
development genes (GDF9 and FSHR) were evaluated by Real-Time PCR.
The Ki67 gene expression was also evaluated for examining the prolif­
eration rate in each study group. A total of 32 ovarian fragments were
evaluated for specific genes expression. Total RNA was extracted by
TRIzol reagent (Gibco, Paisley, UK) and reverse transcription (RT) was
performed by cDNA Synthesis Kit (TaKaRa, Tokyo, Japan). Then sam­
ples were amplified with Power SYBR Green PCR Master Mix (Applied
Biosystems, Warrington, UK) and 50 ng cDNA as template using ABI
StepOnePlus PCR system (Applied Biosystems, CA, USA) with the
following thermal profile: 95 ◦ C for 10min followed by 55 cycles at 95 ◦ C
for 10s, and 60 ◦ C for 30s. Samples were obtained from three to five
independent biological replicates and all reactions were performed in
duplicate. PCR products were checked by the melting curve analysis
performed after the amplification cycles. Sample Ct values were
normalized against the expression of GAPDH Ct values and calculated
using a standard curve and comparative ΔCt. The PCR primer sequences
are shown in Table 1.
2.8. Statistical analysis
Statistical analyses were carried out using the Statistical Package for
Social Science (SPSS, version 22.0 for windows SPSS Inc., Chicago. IL).
Continuous variables were expressed as mean ± SD. The normality of
the variables was checked with Kolmogrov-Smirnov test. One-way
ANOVA and Kruskal-Wallis test were used to compare mean values
Table 1
Primer sequences of GDF9, FSHR, Ki67 and GAPDH genes.
Gene Forward primer Reverse primer
name
GDF9 TAGAAGTCACCTCTACAACACTG GGTAGTAATGCGATCCAGGTTA
FSHR TCCTCACCAAGCTTCGAGT GGTTGATGTAGAGCAGGTTGT
GAPDH CTCATTTCCTGGTATGACAAC CTTCCTCTTGTGCTCTTGCT
Ki67 GTGCTCAACAACTTCATTTCCA ACTGAAGAACACATTTCCTCCA
32
Cryobiology 96 (2020) 30–36
across groups for parametric and non-parametric values, followed by
Tukey’s test. Paired t-test was used to analyze hormone secretion be­
tween day 2 and day 7 of culture. A P-value less than 0.05 was consid­
ered statistically significant.
3. Results
3.1. Histological evaluations and follicle distribution by stage of
development
Histological evaluations showed that the human ovarian tissue
integrity was preserved well after slow freezing and in-vitro culture in
all experimental groups. Primordial and growing follicles in different
developmental stages were detected in all groups and stromal cells were
observed between the follicles. Follicles consisted of intact oocytes and
condensed GCs. Primordial, primary, and transitional follicles were
observed as a central oocyte surrounded with one layer of flat, cuboidal
or both kinds of GCs, respectively. Secondary follicles were seen with
two or more layers of GCs surrounding an intact oocyte. Degenerated
follicles were characterized with oocyte shrinkage or dark oocyte and
more than 50% pyknotic GCs (Fig. 1).
Percentages of morphologically normal growing follicles did not
significantly differ from the primordial counterparts in any group. Per­
centage of morphologically normal primordial follicles was lower (P >
0.05) in bFGF and KL groups compared to the control and bFGF + KL
groups. No significant differences were observed between the experi­
mental groups in different developmental stages for the percentage of
morphologically normal follicle. The percentages of degenerated folli­
cles in different developmental stages and also between different
experimental groups did not have any significant difference (Fig. 2).
The follicle density (per mm3) of the ovarian cortical fragments and
the total number of healthy and degenerated follicles in all cultured
groups are shown in Table 2.
3.2. Developmental and proliferation gene expression
For evaluating the development of follicles between different
experimental groups in comparison to the control group, granulosa and
oocyte developmental markers, FSHR and GDF9 genes were studied. The
Q-PCR analysis showed a slight down regulation of GDF9 gene in the
three experimental groups compared to the control group, even though
no significant difference was observed. Except for the bFGF group which
indicated non-significantly higher expression, the expression of FSHR
gene had no difference among the experimental groups.
To study the proliferation of granulosa cells in order to monitor their
growth during culture, the expression of Ki67 gene, a proliferative
marker, was investigated. The expression of Ki67 gene indicated an in­
crease in ovarian cell proliferation in the three experimental groups
compared to the control group, however this increment was only sig­
nificant for the bFGF + KL group (P-value = 0.050) (Fig. 3).
3.3. Hormone concentrations in the spent culture medium
The levels of AMH, progesterone, and estradiol hormones were
evaluated in the spent culture medium on days 2 and 7 of culture to
investigate the development of follicles. The hormonal levels were not
significantly different among the experimental groups on the second day
of culture. On day 7 of culture, there was no significant difference be­
tween the experimental groups for progesterone and AMH hormones.
The estradiol hormone was significantly lower in the bFGF + KL group
compared to KL (P-value = 0.001), bFGF (P-value = 0.000), and control
(P-value = 0.000) groups and for the KL group compared to the control
group on day 7 of culture (P-value = 0.017). The levels of all of the
above mentioned hormones increased in all cultured groups at the end of
day 7 in comparison to day 2 of culture. However, the increase was only
significant for estradiol hormone in the bFGF + KL group (P-value =
Z. Ghezelayagh et al. Cryobiology 96 (2020) 30–36

Fig. 1. Follicular morphology in histological sections of slow frozen-thawed human ovarian tissue after culture. (A–C) Control group: (A) Morphologically normal
transitional (arrowhead) and primary (asteric) follicles and abnormal transitional follicle with collapsed oocyte (arrow), (B) a healthy early secondary follicle with
the oocyte located in the corner of the follicle, and (C) secondary follicle with few degenerated granulosa cells. (D–F) bFGF group: (D) Morphologically normal
transitional follicle with flat (arrow) and cuboidal (arrowhead) granulosa cells, (E) healthy secondary (arrow) and primary follicles (arrowhead), and (F) healthy
secondary (arrow) and transitional follicles (arrowhead). (G–I) KL group: (G) Transitional follicle with twin nucleus, (H) healthy early secondary (arrow) and primary
follicles (arrowhead), and (I) a healthy normal secondary follicle. (J–L) bFGF + KL group: (J) Transitional follicles with missing (arrow) and normal (arrowhead)
granulosa cells, (K) a primary follicle with cuboidal granulosa cells, and (L) a late secondary follicle with a central oocyte but shrinkage ooplasm. Scale bar: 100 μm.

Fig. 2. Distribution of (A) healthy and (B) degenerated follicles by stage of development in 4 different cultured groups. All data were given as mean values ± SD.
Statistical analysis were carried out using one-way analysis of variance (ANOVA) followed by Tukey’s test. No significant difference was observed.

0.010) (Fig. 4). combination on the in-situ development of human primordial follicles.
The achieved results showed that the combination of bFGF and KL
4. Discussion affected the proliferation rate and estradiol production of follicles dur­
ing 7 days of in-vitro culture. However, the addition of KL or bFGF alone
The present study examined the effect of the bFGF and KL or in combination did not have any effect on the primordial follicle

33
Z. Ghezelayagh et al. Cryobiology 96 (2020) 30–36

Table 2 have shown that 100 ng/ml KL or 100 ng/ml bFGF improved in-vitro
The total number of healthy and degenerated follicles and the follicle density development and follicular activation in mouse and ovine ovaries
(per mm3) of the ovarian cortical fragments in the cultured groups. within one week of culture [1,9]. Thus, the observed differences in the
Groups Healthy follicles Degenerated follicles Follicle density effects of these supplements in in-situ ovarian follicle development can
Control 149.8 ± 61.85 54.8 ± 25.44 85.25 ± 38.88
be species-specific.
bFGF 202.7 ± 46.54 107.2 ± 27.32 154.9 ± 27.89 Earlier studies using a combination of both KL and bFGF factors have
KL 188.2 ± 33.46 124.8 ± 28.97 156.5 ± 26.3 also indicated follicular activation in ovine [17] and rat ovarian cultures
bFGF + KL 146.6 ± 45.37 64.2 ± 19.18 87.83 ± 30.64 [41]. Although in the study conducted on ovine ovarian culture, other
48 fragments of ovarian cortex from six patients (Control group n=12, bFGF factors such as GDNF and EGF were also supplemented in the medium,
group n=12, KL group n= 12, bFGF+KL group n=12) were evaluated for and therefore, the results may not be the actual effect of bFGF and KL
follicular distribution. Data were expressed as mean±SEM. Statistical analysis combination [17]. In the culture of rat ovaries, the concentrations of KL
were carried out using one-way analysis of variance (ANOVA) followed by (25 ng/ml) and bFGF (40 ng/ml) was smaller than the concentrations
Tukey’s test. No significant difference was observed. applied in other studies, nevertheless primordial follicle development
was induced in a two-week culture [41], indicating a species-specific
transition and growth. effect of growth factors.
In the present study, the proportion of growing follicles increased According to the histological assessments, the rate of morphologi­
with a decrease in the rate of primordial follicles in all cultured groups cally normal follicles was similar to the control in all developmental
after in-vitro tissue culture. Previous studies have demonstrated that the stages of the three experimental groups. Although Lynch et al., showed
addition of 100 ng/ml KL or 100 ng/ml bFGF promotes primordial fol­ that bFGF could inhibit apoptosis [32], we did not see such an effect in
licle development in long-term cultures of cat [55], macaque [31], rat the bFGF supplemented group.
[45], and cattle ovaries. In addition, studies have shown that the com­ The expression of oocyte and granulosa transition associated
bination of bFGF or KL with FSH promotes primordial follicle activation markers, GDF9 and FSHR, were evaluated after culture to examine the
and improves the survival and growth of follicles in the ovaries of cattle follicular function. The expression of these genes are also essential for
[53] and macaque [31] in long-term culture. Although the used con­ transition of follicles to the next stages of development as they are
centration of bFGF or KL were the same as previous studies, and FSH was expressed in growing follicles. Mofarahe et al. [40] indicated a signifi­
one of our base medium supplements, the primordial follicle activation cant increase in the GDF9 and FSHR genes expression in cultured tissues
rate in KL (100 ng/ml) or/and bFGF (100 ng/ml) groups was similar to in comparison with non-cultured samples. In this study, despite an
the control group. The differences observed may be due to the period of overall increase of GDF9 and FSHR gene expressions, no significant
culture, because a one-week culture may not be sufficient to see the differences were observed in the treated groups, indicating that the
beneficial effects of the supplements in culture. However, other studies growth factors had no positive effects on follicular transition from

Fig. 3. Relative gene expression of granulosa and oocyte developmental and proliferative markers between different experimental groups. Data were presented as
mean values ± SD. Statistical analysis was carried out using one-way analysis of variance (ANOVA) followed by Tukey’s test. A vs. a show a significant difference
(P-value<0.05).

Fig. 4. The secreted levels of (A) AMH, (B) Progesterone, and (C) Estradiol in the spent medium of cultured human slow-frozen thawed ovarian cortical fragments on
day 2 and 7 of culture. Data were given as mean values ± SD. Statistical analysis were carried out using one-way analysis of variance (ANOVA) followed by Tukey’s
test. A vs. a, B vs b, and C vs. c show a significant difference (P-value<0.05).

34
Z. Ghezelayagh et al.
primordial to primary state. In contrast, an increase of GDF9 gene
expression was observed in human ovarian culture after 100 ng/ml
bFGF addition [47] while the same concentration of bFGF or KL had no
difference between the experimental groups for the mentioned gene. In
cat ovarian tissue culture, the addition of 100 ng/ml KL increased Fshr
expression [55] whereas in the present study, the FSHR expression was
only higher in the bFGF group. It seems that the addition of KL inhibits
the FSHR expression as was seen in the bFGF + KL group.
Hormonal assessment was used to evaluate granulosa and theca cell
functions. Non-significant increase of AMH, progesterone, and estradiol
hormones after 7 days of culture presented the increment of steroido­
genic pathways during culture. Earlier studies on cows [59] and rats
[64] have shown an inhibitory effect of bFGF on estradiol production in
early follicular stages of development. Moreover, a sequential medium
with decrement concentrations of bFGF and GDF9 and increment
amounts of EGF and FSH caused estradiol increase but not progesterone
in long-term culture of sheep ovaries [48]. In contrast, Garor et al. [19]
showed estradiol increment in human ovarian culture with bFGF after 2
weeks, despite the endogenous dose used. In a study conducted by Lu
et al. [31], the supplement of bFGF had a higher secretion of estradiol
and progesterone than KL by 18 days, in macaque ovarian culture.
However, our study did not show a significant increase in steroidogenic
hormones after the addition of the same doses for bFGF or KL, which
may be due to our short-term culture. Nevertheless, the synergistic effect
of both bFGF and KL together significantly increased the estradiol hor­
mone. Despite using long-term culture, Lu et al. did not observe an in­
crease in estradiol and progesterone hormones when KL was added to
the culture medium. Although KL has an inhibitory effect on estradiol
production at later follicular developmental stages [24], this factor has
increased the estradiol level secreted from early mouse follicles cultured
in-situ as well as isolated preantral follicles cultured in a
three-dimensional system [1,2].
The expression of Ki67 was also examined to evaluate the prolifer­
ation and growth activity of follicles. The addition of bFGF or KL alone
had no specific effect on the proliferation rate of human ovarian stroma
during in-vitro culture, which is in accordance with the study conducted
by Garor et al., [19]. However, significant increase of Ki67 expression in
comparison to the control group when both KL and bFGF were used,
shows higher proliferation of granulosa cells and results in higher ste­
roid production.
It should also be mentioned that insulin [30], FSH [62], and GDF9
[23,25] were other supplements in the base medium that have been
shown to influence human follicular activation and growth. Although it
is expected that the ultimate human ovarian culture medium requires
multiple growth factors, it seems that the base culture medium used in
this study may be sufficiently effective. Therefore, the addition of KL and
bFGF factors alone or in combination may not be necessary for human
ovarian cortical culture.
5. Conclusion
The presence of KL and bFGF, alone or in combination, in human
ovarian tissue culture medium has no beneficial effects on follicular
activation and growth, but their combination promotes the prolifera­
tion, activity, and steroidogenesis of granulosa cells. Therefore, it seems
that achieving in-vitro human follicular activation and growth requires
more studies on the time of the culture and added supplements.
Declaration of competing interest
The authors have no conflict of interest.
Acknowledgment
This research was financially supported by the Royan Institute. This
research did not receive any specific grant from funding agencies in the
35
Cryobiology 96 (2020) 30–36
public, commercial, or not-for-profit sectors.
References
[1] S. Abdi, M. Salehnia, S. Hosseinkhani, Kit ligand decreases the incidence of
apoptosis in cultured vitrified whole mouse ovaries, J. Reprod. Biomed. Online 30
(2015) 493–503.
[2] S. Abdi, M. Salehnia, S. Hosseinkhani, Quality of oocytes derived from vitrified
ovarian follicles cultured in two-and three-dimensional culture system in the
presence and absence of kit ligand, J. Biopreserv. Biobank. 14 (2016) 279–288.
[3] I. Adriaens, R. Cortvrindt, J. Smitz, Differential FSH exposure in preantral follicle
culture has marked effects on folliculogenesis and oocyte developmental
competence, Hum. Reprod. 19 (2004) 398–408.
[4] E. Anderson, G.Y. Lee, Cell, The participation of growth factors in simulating the
quiescent, proliferate, and differentiate stages of rat granulosa cells grown in a
serum-free medium, J Tissue 25 (1993) 49–72.
[5] A. Ben-Haroush, R. Abir, A. Ao, S. Jin, G. Kessler-Icekson, D. Feldberg, B. Fisch,
Expression of basic fibroblast growth factor and its receptors in human ovarian
follicles from adults and fetuses, J Fertil. Steril. 84 (2005) 1257–1268.
[6] N. Boland, R. Gosden, Effects of epidermal growth factor on the growth and
differentiation of cultured mouse ovarian follicles, J. Reprod. 101 (1994) 369–374.
[7] M. Brännström, M. Milenkovic, Advances in fertility preservation for female cancer
survivors, J. Nat. Med. 14 (2008) 1182.
[8] I.B. Carlsson, M.P. Laitinen, J.E. Scott, H. Louhio, L. Velentzis, T. Tuuri,
J. Aaltonen, O. Ritvos, R.M. Winston, O. Hovatta, Kit ligand and c-Kit are expressed
during early human ovarian follicular development and their interaction is
required for the survival of follicles in long-term culture, Reproduction
(Cambridge, England) 131 (2006) 641–649.
[9] A. Cavalcante, B. Gouveia, R. Barberino, T. Lins, L. Santos, R. Gonçalves,
J. Celestino, M. Matos, Kit ligand promotes the transition from primordial to
primary follicles after in vitro culture of ovine ovarian tissue, J Zygote 24 (2016)
578–582.
[10] J. Celestino, J. Bruno, I. Lima-Verde, M. Matos, M. Saraiva, R. Chaves, F. Martins,
L. Lima, K. Name, C. Campello, Recombinant epidermal growth factor maintains
follicular ultrastructure and promotes the transition to primary follicles in caprine
ovarian tissue cultured in vitro, J. Reprod. Sci. 16 (2009) 239–246.
[11] J. Celestino, M. Matos, M. Saraiva, J. Figueiredo, Regulation of ovarian
folliculogenesis by Kit Ligand and the c-Kit system in mammals, J. Anim. Reprod. 6
(2018) 431–439.
[12] J. Craig, M. Orisaka, H. Wang, S. Orisaka, W. Thompson, C. Zhu, F. Kotsuji, B.
K. Tsang, Gonadotropin and intra-ovarian signals regulating follicle development
and atresia: the delicate balance between life and death, Front. Biosci.: J. Vis.
Literacy 12 (2007) 3628–3639.
[13] A. Dalman, N.S.D.G. Farahani, M. Totonchi, R. Pirjani, B. Ebrahimi, M.R.J.
C. Valojerdi, Slow freezing versus vitrification technique for human ovarian tissue
cryopreservation: an evaluation of histological changes, WNT signaling pathway
and apoptotic genes expression 79 (2017) 29–36.
[14] P. Devine, K. Rajapaksa, P.B. Hoyer, In vitro ovarian tissue and organ culture: a
review, J Front Biosci 7 (2002) d1979–d1989.
[15] S. Dolci, D.E. Williams, M.K. Ernst, J.L. Resnick, C.I. Brannan, L.F. Lock, S.
D. Lyman, H.S. Boswell, P.J. Donovan, Requirement for mast cell growth factor for
primordial germ cell survival in culture, J Nature 352 (1991) 809.
[16] M.-A. Driancourt, K. Reynaud, R. Cortvrindt, J. Smitz, Roles of KIT and KIT
LIGAND in ovarian function, J. Rev. Reprod. 5 (2000) 143–152.
[17] F. Esmaielzadeh, S. Hosseini, Z. Nasiri, M. Hajian, M. Chamani, H. Gourabi,
A. Shahverdi, A. Vosough, M. Nasr-Esfahani, Kit ligand and glial-derived
neurotrophic factor as alternative supplements for activation and development of
ovine preantral follicles in vitro, J. Mol. Reprod. Dev. 80 (2013) 35–47.
[18] M.M. Ezzati, M.D. Baker, H.D. Saatcioglu, G.M. Aloisio, C.G. Pena, Y. Nakada,
I. Cuevas, B.R. Carr, D.H. Castrillon, Regulation of FOXO3 subcellular localization
by Kit ligand in the neonatal mouse ovary, J. Assist. Reprod. Genet. 32 (2015)
1741–1747.
[19] R. Garor, R. Abir, A. Erman, C. Felz, S. Nitke, B. Fisch, Effects of basic fibroblast
growth factor on in vitro development of human ovarian primordial follicles, Fertil.
Steril. 91 (2009) 1967–1975.
[20] I. Godin, R. Deed, J. Cooke, K. Zsebo, M. Dexter, C. Wylie, Effects of the steel gene
product on mouse primordial germ cells in culture, J Nature 352 (1991) 807.
[21] M. Guthridge, J. Schmitt, J. Bertolini, J. Cowling, A. Runting, S. Katsahambas, A.
E. Drummond, M.T. Hearn, Studies on Basic Fibroblast Growth Factor (FGF-β)
Gene Expression in the Rat and Pig Ovary Using in Situ Hybridization and
Quantitative Reverse Transcriptase—Polymerase Chain Reaction Techniques,
Springer, Angiogenesis, 1992, pp. 219–229.
[22] K. Horie, J. Fujita, K. Takakura, H. Kanzaki, H. Suginami, M. Iwai, H. Nakayama,
T. Mori, Pregnancy: the expression of c-kit protein in human adult and fetal tissues,
J. Hum. Reprod. 8 (1993) 1955–1962.
[23] J.G. Hreinsson, J.E. Scott, C. Rasmussen, M.L. Swahn, A.J. Hsueh, O. Hovatta,
Growth differentiation factor-9 promotes the growth, development, and survival of
human ovarian follicles in organ culture, J. Clin. Endocr. Metab. 87 (2002)
316–321.
[24] X. Jin, C.-S. Han, X.-S. Zhang, J.-X. Yuan, Z.-Y. Hu, Y.-X. Liu, Signal transduction of
stem cell factor in promoting early follicle development, J. Mol. Cell. Endocrinol.
229 (2005) 3–10.
[25] A. Kedem, B. Fisch, R. Garor, A. Ben-Zaken, T. Gizunterman, C. Felz, A. Ben-
Haroush, D. Kravarusic, R. Abir, Growth differentiating factor 9 (GDF9) and bone
morphogenetic protein 15 both activate development of human primordial follicles
Z. Ghezelayagh et al.
in vitro, with seemingly more beneficial effects of GDF9, J. Clin. Endocrinol.
Metab. 96 (2011) E1246–E1254.
[26] P.R. Kezele, E.E. Nilsson, M.K. Skinner, Insulin but not insulin-like growth factor-1
promotes the primordial to primary follicle transition, J. Mol. Cell. Endocrinol. 192
(2002) 37–43.
[27] F.G. Klinger, M. De Felici, In vitro development of growing oocytes from fetal
mouse oocytes: stage-specific regulation by stem cell factor and granulosa cells,
J. Dev. Biol. 244 (2002) 85–95.
[28] I. Lima, I. Brito, G. Rodrigues, C. Silva, D. Magalhães-Padilha, L. Lima, J. Celestino,
C. Campello, J. Silva, J. Figueiredo, Presence of c-kit mRNA in goat ovaries and
improvement of in vitro preantral follicle survival and development with kit
ligand, J. Mol. Cell. Endocrinol. 345 (2011) 38–47.
[29] I. Lima, J. Celestino, L. Faustino, D. Magalhães-Padilha, R. Rossetto, I. Brito,
M. Donato, C. Lopes, C. Campello, C. Peixoto, Dynamic medium containing kit
ligand and follicle-stimulating hormone promotes follicular survival, activation,
and growth during long-term in vitro culture of caprine preantral follicles, J. Cell.
Tissue. Org. 195 (2012) 260–271.
[30] H. Louhio, O. Hovatta, J. Sjoberg, T. Tuuri, The effects of insulin, and insulin-like
growth factors I and II on human ovarian follicles in long-term culture, Mol. Hum.
Reprod. 6 (2000) 694–698.
[31] C. Lu, J. Yan, X. Zhi, X. Xia, T. Wang, L. Yan, Y. Yu, T. Ding, J. Gao, R. Li, Basic
fibroblast growth factor promotes macaque follicle development in vitro,
J. Reprod. 149 (2015) 425–433.
[32] K. Lynch, G. Fernandez, A. Pappalardo, J. Peluso, Basic fibroblast growth factor
inhibits apoptosis of spontaneously immortalized granulosa cells by regulating
intracellular free calcium levels through a protein kinase Cδ-dependent pathway,
J. Endocrinol. 141 (2000) 4209–4217.
[33] F. Martins, J. Celestino, M. Saraiva, R. Chaves, R. Rossetto, C. Silva, I. Lima-Verde,
C. Lopes, C. Campello, J. Figueiredo, Interaction between growth differentiation
factor 9, insulin-like growth factor I and growth hormone on the in vitro
development and survival of goat preantral follicles, Braz. J. Med. Biol. Res. 43
(2010) 728–736.
[34] F. Martins, J. Celestino, M. Saraiva, M. Matos, J. Bruno, C. Rocha-Junior, I. Lima-
Verde, C. Lucci, S. Báo, J. Figueiredo, Growth and differentiation factor-9
stimulates activation of goat primordial follicles in vitro and their progression to
secondary follicles, J. Reprod. Fert. Develop. 20 (2008) 916–924.
[35] M. Matos, I. Lima-Verde, J. Bruno, C. Lopes, F. Martins, K. Santos, R. Rocha,
J. Silva, S. Báo, J. Figueiredo, Follicle stimulating hormone and fibroblast growth
factor-2 interact and promote goat primordial follicle development in vitro,
J. Reprod. Fert. Devel. 19 (2007) 677–684.
[36] M. Matos, I. Lima-Verde, M. Luque, J. Maia Jr., J. Silva, J. Celestino, F. Martins,
S. Báo, C. Lucci, J. Figueiredo, Essential role of follicle stimulating hormone in the
maintenance of caprine preantral follicle viability in vitro, J Zygote 15 (2007)
173–182.
[37] M. Matos, R. Van den Hurk, I. Lima-Verde, M. Luque, K. Santos, F. Martins, S. Báo,
C. Lucci, J. Figueiredo, Effects of fibroblast growth factor-2 on the in vitro culture
of caprine preantral follicles, J. Cell. Tissue. Org. 186 (2007) 112–120.
[38] M.M. Matzuk, K.H. Burns, M.M. Viveiros, J.J. Eppig, Intercellular communication
in the mammalian ovary: oocytes carry the conversation, J. Sci. 296 (2002)
2178–2180.
[39] T. Miyoshi, F. Otsuka, E. Nakamura, K. Inagaki, K. Ogura-Ochi, N. Tsukamoto,
M. Takeda, H. Makino, Regulatory role of kit ligand–c-kit interaction and oocyte
factors in steroidogenesis by rat granulosa cells, J. Mol. Cell. Endocrinol. 358
(2012) 18–26.
[40] Z.S. Mofarahe, M. Salehnia, M.G. Novin, N. Ghorbanmehr, M.G. Fesharaki,
Expression of folliculogenesis-related genes in vitrified human ovarian tissue after
two weeks in vitro culture, J Cell Journal 19 (2017) 18.
[41] E. Nilsson, J.A. Parrott, M.K. Skinner, Basic fibroblast growth factor induces
primordial follicle development and initiates folliculogenesis, J. Mol. Cell.
Endocrinol. 175 (2001) 123–130.
[42] E.E. Nilsson, M.K. Skinner, Kit ligand and basic fibroblast growth factor
interactions in the induction of ovarian primordial to primary follicle transition,
J. Mol. Cell. Endocrinol. 214 (2004) 19–25.
[43] F. Otsuka, S. Shimasaki, A negative feedback system between oocyte bone
morphogenetic protein 15 and granulosa cell kit ligand: its role in regulating
granulosa cell mitosis, Proc. Natl. Acad. Sci. 99 (2002) 8060–8065.
36
Cryobiology 96 (2020) 30–36
[44] J.A. Parrott, M.K. Skinner, Direct actions of kit-ligand on theca cell growth and
differentiation during follicle development, J. Endocrinol. 138 (1997) 3819–3827.
[45] J.A. Parrott, M.K. Skinner, Kit-ligand/stem cell factor induces primordial follicle
development and initiates folliculogenesis, Endocrinology 140 (1999) 4262–4271.
[46] J.A. Parrott, M.K. Skinner, Kit ligand actions on ovarian stromal cells: effects on
theca cell recruitment and steroid production, J. Mol. Reprod. Dev. 55 (2000)
55–64.
[47] S. Parte, D. Bhartiya, D.D. Manjramkar, A. Chauhan, A. Joshi, Stimulation of
ovarian stem cells by follicle stimulating hormone and basic fibroblast growth
factor during cortical tissue culture, J. Ovarian Res. 6 (2013) 20.
[48] X. Peng, M. Yang, L. Wang, C. Tong, Z. Guo, In vitro culture of sheep lamb ovarian
cortical tissue in a sequential culture medium, J. Assist. Reprod. Genet. 27 (2010)
247–257.
[49] M. Pesce, M.G. Farrace, M. Piacentini, S. Dolci, M. De Felici, Stem cell factor and
leukemia inhibitory factor promote primordial germ cell survival by suppressing
programmed cell death (apoptosis), J. Devel. 118 (1993) 1089–1094.
[50] R.D. Roberts, R.C. Ellis, Mitogenic effects of fibroblast growth factors on chicken
granulosa and theca cells in vitro, j. Biol. Reprod. 61 (1999) 1387–1392.
[51] Byskov Schmidt, Nyboe Andersen, Muller, Yding Andersen, Density and
distribution of primordial follicles in single pieces of cortex from 21 patients and in
individual pieces of cortex from three entire human ovaries, Hum. Reprod.
(Oxford, England) 18 (2003) 1158–1164.
[52] J. Smitz, M.-M. Dolmans, J. Donnez, J. Fortune, O. Hovatta, K. Jewgenow,
H. Picton, C. Plancha, L. Shea, R. Stouffer, Current achievements and future
research directions in ovarian tissue culture, in vitro follicle development and
transplantation: implications for fertility preservation, J. Hum. Reprod. 16 (2010)
395–414.
[53] K. Tang, W.-C. Yang, X. Li, C.-J. Wu, L. Sang, L.-G. Yang, GDF-9 and bFGF enhance
the effect of FSH on the survival, activation, and growth of cattle primordial
follicles, J. Anim. Reprod. Sci. 131 (2012) 129–134.
[54] F.H. Thomas, R.S. Ismail, J.-Y. Jiang, B.C. Vanderhyden, Kit ligand 2 promotes
murine oocyte growth in vitro, j. Biol. Reprod. 78 (2008) 167–175.
[55] P. Thuwanut, P. Comizzoli, D.E. Wildt, C.L. Keefer, N. Songsasen, Stem cell factor
promotes in vitro ovarian follicle development in the domestic cat by upregulating
c-kit mRNA expression and stimulating the phosphatidylinositol 3-kinase/AKT
pathway, J. Reprod. Fert. Devel. 29 (2017) 1356–1368.
[56] J.L. Tilly, H. Billig, K.I. Kowalski, A. Hsueh, Epidermal growth factor and basic
fibroblast growth factor suppress the spontaneous onset of apoptosis in cultured rat
ovarian granulosa cells and follicles by a tyrosine kinase-dependent mechanism,
J. Mol. Endocrinol. 6 (1992) 1942–1950.
[57] A.R. Tuck, R.L. Robker, R.J. Norman, W.D. Tilley, T.E. Hickey, Expression and
localisation of c-kit and KITL in the adult human ovary, J. Ovarian Res. 8 (2015)
31.
[58] I. Van Wezel, K. Umapathysivam, W. Tilley, R. Rodgers, Immunohistochemical
localization of basic fibroblast growth factor in bovine ovarian follicles, J. Mol.
Cell. Endocrinol. 115 (1995) 133–140.
[59] R. Vernon, L. Spicer, Effects of basic fibroblast growth factor and heparin on
follicle-stimulating hormone-induced steroidogenesis by bovine granulosa cells,
J. Anim. Sci. 72 (1994) 2696–2702.
[60] U.A. Vitt, E.A. McGee, M. Hayashi, A.J. Hsueh, In vivo treatment with GDF-9
stimulates primordial and primary follicle progression and theca cell marker
CYP17 in ovaries of immature rats, J. Endocrinol. 141 (2000) 3814–3820.
[61] R.J. Wordinger, A.-M. Brun-Zinkernagel, I.-F.C. Chang, Immunohistochemical
localization of basic fibroblast growth factor (bFGF) within growing and atretic
mouse ovarian follicles, J Growth Factors 9 (1993) 279–289.
[62] C.S. Wright, O. Hovatta, R. Margara, G. Trew, R.M. Winston, S. Franks, K. Hardy,
Effects of follicle-stimulating hormone and serum substitution on the in-vitro
growth of human ovarian follicles, Hum. Reprod. (Oxford, England) 14 (1999)
1555–1562.
[63] S. Yamamoto, I. Konishi, K. Nanbu, T. Komatsu, M. Mandai, H. Kuroda,
K. Matsushita, T. Mori, Immunohistochemical localization of basic fibroblast
growth factor (bFGF) during folliculogenesis in the human ovary, J. Gynecol.
Endocrinol. 11 (1997) 223–230.
[64] M. Yamoto, T. Shikone, R. Nakano, Opposite effects of basic fibroblast growth
factor on gonadotropin-stimulated steroidogenesis in rat granulosa cells,
J. Endocrinol. 40 (1993) 691–697.