Biomedicine & Pharmacotherapy 144 (2021) 112287

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy

journal homepage: www.elsevier.com/locate/biopha

Hepatorenal protective efficacy of flavonoids from Ocimum basilicum

extract in diabetic albino rats: A focus on hypoglycemic, antioxidant,
anti-inflammatory and anti-apoptotic activities
Mohamed S. Othman a, b, Azza M. Khaled a, c, Amal H. Al-Bagawi d, Mohamed A. Fareid a, e,
Reda A. Ghany a, f, Ola A. Habotta g, Ahmed E. Abdel Moneim h, *
a
Basic Sciences Department, Deanship of Preparatory Year, University of Ha’il, Hail, Saudi Arabia
b
Faculty of Biotechnology, October University for Modern Science and Arts (MSA), Giza, Egypt
c
National Institute of Oceanography and Fisheries, Cairo, Egypt
d
Chemistry Department, Faculty of Science, University of Ha’il, Hail, Saudi Arabia
e
Botany and Microbiology Department, Faculty of Science, Al-Azhar University, Cairo, Egypt
f
Chemistry Department, Faculty of Science, Al-Azhar University, Cairo, Egypt
g
Department of Forensic Medicine and Toxicology, Faculty of Veterinary Medicine, Mansoura University, Mansoura, Egypt
h
Zoology and Entomology Department, Faculty of Science, Helwan University, Cairo, Egypt

A R T I C L E I N F O A B S T R A C T

Keywords: Plant derived phytochemical therapy is a bright candidate for treatment of diabetes and its associated compli­
Hail Ocimum cations. Ocimum baslicum is used as an anti-diabetic traditional medicine. Hence, the present study investigated
Flavonoids the effect of Hail Ocimum extract (HOE) and its total flavonoids (HOETF) against hepatorenal damage in
Diabetes
experimental diabetes induced by high-fat diet (HFD) and injection of streptozotocin (STZ) in rats. Diabetic
High-fat diet
Hepatorenal
animals were co-treated daily with HOE, HOETF or metformin (MET) as a standard anti-diabetic drug for four
Oxidative stress apoptosis weeks. Compared to controls, HFD/STZ-treatment lead to significant increases in fasting blood glucose, insulin
and HOMA-IR levels. Furthermore, diabetic rats had elevated hepatic (ALT and ALP) and kidney functions (urea
and creatinine) biomarkers together with disturbed lipid profile and decreased PPAR-γ gene expression. Higher
levels of hepatic and renal LPO and NO paralleled with lower levels of GSH and activities of antioxidant enzymes
(SOD, CAT, GPx and GR) after HFD/STZ treatment. Additionally, noteworthy inflammatory and apoptotic re­
sponses were evident in both organs of diabetic rats as witnessed by augmented levels of TNF-α, IL-1b and Bax
levels with declined levels of Bcl-2. Moreover, histological examination of hepatic, renal and pancreatic tissues
validated the biochemical findings. On contrary, co-treatment of diabetic animals with HOE or HOETF could
decrease glucose and insulin levels together with improvement of lipid markers and alleviation of hepatorenal
dysfunction, oxidative injury, inflammatory and apoptotic events. Conclusively, HOE or HOETF could be a
promising complementary therapeutic option for the management of diabetic hepatorenal complication owing to
their antioxidant, anti-inflammatory; anti-apoptotic properties.

1. Introduction
Diabetes is a prodigious metabolic disorder associated with distur­
bances in insulin secretion with consequent hyperglycemia as well as
abnormalities in the carbohydrates, lipids, and proteins metabolism
[1–3]. Its prevalence is progressively increasing with regardless of age,
sex, socioeconomical status and ethnicity of the individuals [4]. It is
affecting above four hundreds of millions of people in our entire world
[5]. It is expected that the number of diabetic people will increase to be
over six hundreds of millions by 2040, and the majority of those have
diabetes type 2 [6]. This type of diabetes is characterized by massive
disorders in insulin secretion or insulin signal transduction [5]. It also
accompanied by microvascular and macrovascular problems that
negatively disturb the functions of different organs as nephropathy,
neuropathy, retinopathy, cardiovascular diseases, etc. [2,5,6].
During diabetes, hyperglycemia was reported to encourage the

* Corresponding author.
E-mail addresses: biostar55@yahoo.com (M.S. Othman), ahmed_abdelmoneim@science.helwan.edu.eg (A.E. Abdel Moneim).

https://doi.org/10.1016/j.biopha.2021.112287
Received 11 August 2021; Received in revised form 18 September 2021; Accepted 5 October 2021
Available online 12 October 2021
0753-3322/© 2021 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY license
(http://creativecommons.org/licenses/by/4.0/).
M.S. Othman et al.
production of excess reactive oxygen species (ROS) as a result of high
glucose oxidation rate in mitochondria [3]. High levels of ROS together
with suppression of the antioxidant defense system might result in
progress of insulin resistance, oxidative injury, lipid peroxidation, and
cell damage [2]. Further, hyperglycemia-mediated ROS trigger the
pro-inflammatory mediators by modulating nuclear factor-κB (NFκB)
that induces local and systemic inflammatory reactions [1,3]. Addi­
tionally, the diabetic condition can accelerate the process of lipolysis
that in turn increases the contents of free fatty acids. These free fatty
acids enhance the secretion of cytokines, such as interleukin-6 and
tumor necrosis factor-α [1]. Tumor necrosis factor-α activates the cas­
pase cascade, which strongly incorporated in the induction of apoptotic
cell death [7].
Extensive research has been focused on diabetes as well as devel­
opment of potent anti-diabetic medications. Unfortunately, these med­
ications can not reverse the above-mentioned diabetes associated
complications and their prolonged usage may leads to drug resistance
and adverse effects as acute kidney injury [6,8]. Numerous plant ex­
tracts have been used as traditional therapies in folk medicine to treat
diabetes. One of these plants, is Ocimum basilicum that is mostly called
Basil plant and belongs to the Lamiaceae family [9]. This plant has been
traditionally used for treatment of headache, cough, constipation, skin
warts, parasites and renal malfunctions [10]. Different pharmacological
activities were reported for O. basilicum as hypoglycemic, antioxidant,
anti-inflammatory, anti-microbial, anti-cancer, pain relieving and
immunomodulatory properties [11,12]. These effects are endorsed for
the high content of phenolic compounds and essential oils such as
estragol, linalool, eugenol methylchavikol, methyl cinnamate, linolen,
rosmarinic acid, and geraniol [13,14]. The aqueous extract of
O. basilicum displayed potential hepatoprotection against CCl4 and
diazinon-exposed rats [14,15]. Almalki [12] reported that O. basilicum
could protect the kidney against diabetes induced nephropathy. In
addition, leaves extract of this plant rescued the kidney against acet­
aminophen and thioacetamide-induced kidney injury [16,17].
To assess the pathogenesis of diabetes and its accompanied compli­
cations, different animal models have been established. Feeding on high-
fat diet (HFD) together with injection of low dose of streptozotocin (STZ)
could induce insulin resistance as well as high blood levels of glucose,
insulin, and lipid, which are the features of type 2 diabetes [18]. STZ, a
natural diabetic agent, is used to induce diabetic animal models due to
its detrimental impact on pancreatic β cells; which hinder the insulin
production [1]. Besides, STZ is a potent source of oxidative stress that is
vital in the progress of diabetes and its complications [3].
Despite of this herb has been used in the treatment of diabetes, the
evidence for the role of its polyphenols in lessening the diabetes asso­
ciated liver and kidney complications remains limited. Also, little
available information is known about the therapeutic effects of the fla­
vonoids compounds of HOE. Therefore, this experimental study was
aimed to illustrate the efficacy of HOE and HOETF to improve the gly­
cemic status as well as the oxidative/antioxidant indices, inflammatory
and apoptotic events in livers and kidneys of diabetic rats.
2. Material and methods
2.1. Ethical statement approval
Design of experiment, together with the procedures and techniques
were done in accordance with the guidelines of the Institutional Animal
Care and Use Committee (IACUC) of Helwan University (approval no,
HU2020/Z/AEO0120–01).
2.2. Collection and preparation of HOE
Hail Ocimum plant was purchased from a local market in Hail. The
identification and authentication of plant material were done by a
specialist (Botany Department, Faculty of Science, Helwan University,
2
Biomedicine & Pharmacotherapy 144 (2021) 112287
Egypt). Air-dried plant material was ground by an electric blender. The
plant powder was sequentially extracted with n-hexane and methanol
using a Soxhlet apparatus. Removal of solvents was achieved under
reduced pressure and sticky residues were collected. The crude meth­
anolic extract was further dissolved in ethyl acetate to obtain ethyl ac­
etate fraction. The solvent fraction was concentrated in vacuum to
obtain flavonoids fraction that was reconstituted in distilled water to be
used for the experiment.
2.3. Quantitative phytochemical screenings
Quantitative phytochemical evaluations of the extract and flavo­
noids fractions were carried out to determine the amount of total
phenolic content (TPC) using the Folin–Ciocalteu method and total
flavonoids content (TFC) using the aluminum chloride colorimetric
assay as described in Abdel Moneim [19].
2.4. Experimental animals
Forty-two adult male albino rats (200–220 g body weight) were
purchased from VACSERA (Cairo, Egypt). Before the start of the
experiment, all animals were acclimated for seven days under controlled
housing circumstances i.e., temperature of 25 ± 1 ◦ C, humidity of 50 ±
10% and 12:12 h light and dark cycle condition. They were freely sup­
plied with water and food.
2.5. Experimental induction of diabetes
Twenty-eight rats were fed on a HFD with a total energy of 25.07 KJ/
g consisting of 60% fat, 20% protein and 20% carbohydrate for 28
successive days. They were fasted for 24 h, then injected with a single
dose of STZ (Sigma, St. Louis, MO, USA) intraperitoneally (i.p) at 40 mg/
kg to perform the experimental diabetes according to Srinivasan,et al.
[20]. STZ was prepared by dissolving in freshly prepared citrate buffer
(0.05 M, pH 4.5) immediately before injection. Blood levels of glucose
was monitored every 72 hrs using an Accu-check blood glucose meter
(Roche Diagnostics, Basel, Switzerland). Seven days after STZ injection,
hyperglycemic rats were determined by measuring their blood glucose
levels. Diabetic animals were selected if the fasting blood glucose level
≥ 200 mg/dL and used for subsequent experiment.
2.6. Animals treatment and sampling
After 1 week from diabetes induction, diabetic and non-diabetic rats
were allocated into 6 groups (n = 7):
Control group: non-diabetic rats administered only saline 0.9% NaCl.
HOE group: non-diabetic rats administered HOE (250 mg/kg/day)
for four weeks.
HFD/STZ (diabetic) group: diabetic rats received saline 0.9% NaCl
for four weeks.
HFD/STZ-HOE group: diabetic rats received HOE (250 mg/kg/day)
for four weeks.
HFD/STZ-HOETF group: diabetic rats received HOETF (100 mg/kg/
day) for four weeks.
HFD/STZ-MET group: diabetic rats treated with metformin (MET)
(200 mg/kg/day) for four weeks.
The applied doses of HOE and HOETF were selected based on pre­
liminary experiment using 100, 200, and 250 mg/kg, and 25, 50, and
100 mg/kg, respectively. The higher doses were found to be more
effective in the treatment of hepatotoxicity in CCl4-induced liver
toxicity.
After being anesthetized with pentobarbital (300 mg/kg i.p.), rats
were sacrificed by cervical dislocation after 24 h from the last treatment.
The blood was immediately sampled, incubated at 37 ◦ C for 30 min and
centrifuged at 3000 x g for 10 min. Liver and kidney tissues were
sampled, weighed and divided into two portions; the first portion was
M.S. Othman et al.
stored at − 80 C until performing of biochemical analyses and the sec­
ond one was fixed in 10% buffered formalin for histopathological
examinations.
2.7. Assessment of serum biochemistry
Serum parameters of liver functions (ALT, AST and ALP) and kidney
function (urea, and creatinine) were calorimetrically assessed by stan­
dard kits (Biodiagnostic, Giza, Egypt) following the manufacturer’s in­
formation. Further, total cholesterol (TC), total triglycerides (TG), low
density lipoproteins (LDL-c), and high-density lipoprotein (HDL-c) were
measured by kits (RANDOX Reagents, USA). Atherogenic index of
plasma (AIP) was calculated as logarithmic transformation of the ratio of
TG to HDL-c.
Glucose levels were determined using available enzyme colorimetric
assay according to Trinder [21]. Additionally, serum insulin level was
measured by rat insulin ELISA Millipore kit according to the supplier’s
protocols. The homeostasis model assessment of basal insulin resistance
(HOMA-IR) was calculated based on the fasting blood insulin and
glucose concentrations using the following formula according to the
method of Matthews et al. [22].
HOMA-IR index = fasting glucose (mg/dl) × fasting insulin (mU/
ml)/405.
2.8. Evaluation of hepatorenal oxidative stress biomarkers
Liver and kidney samples were mixed with homogenization medium
(10 mM phosphate puffer (pH 7.4)), centrifuged for ten minutes at 3000
x g at 4 ºC. The resulted supernatant was collected. The level of lipid
peroxidation (LPO) was measured following the described method of
Ohkawa et al. [23]. Nitric oxide (NO) level was measured using the
Griess reagent [24]. The reduced glutathione (GSH) levels were assessed
as stated by Ellman [25].
2.9. Assessment of hepatorenal antioxidant enzymatic activities
Superoxide dismutase (SOD) activities in hepatic and renal tissues
were estimated following the described method of Nishikimi et al. [26].
The described method by Aebi [27] was used for assessment of catalase
(CAT) activities. Furthermore, the activities of glutathione peroxidase
(GPx) and glutathione reductase (GR) were measured according to
Paglia and Valentine [28] and De Vega et al. [29], correspondingly.
2.10. Measurement of hepatic and renal inflammatory markers
ELISA kits were utilized for measurement of the levels of pro-
inflammatory cytokines as nuclear factor kappa B (NF-κB; MyBio­
Source) TNF-α (R&D Systems) and IL-1β (Thermo Fisher Scientific) in
liver and kidney samples based on the manufacturers’ instructions.
2.11. Determination of hepatic and renal apoptotic biomarkers
To evaluate the apoptotic changes in livers and kidneys of diabetic
rats, the levels of Bcl-2 (anti-apoptotic), and Bax (pro-apoptotic) in both
tissues were determined by commercial ELISA kits as mentioned in the
manufacturers’ instructions.
2.12. RNA extraction, cDNA synthesis and quantitative RT- PCR analysis
Extraction of total RNA was performed from freshly isolated hepatic
and renal tissues using TRIzol reagent Qiazol reagent (Qiagen, Ger­
mantown, MD, USA) according to the supplier’s information. RNA
concentrations were measured using nanodrop, and cDNA was synthe­
tized using RevertAid™ H Minus Reverse Transcriptase kit (Fermentas,
Thermo Fisher Scientific Inc., Canada) based on the manufacturer’s
protocol. mRNA levels were determined by SYBR green PCR kit (Qiagen,
3
Biomedicine & Pharmacotherapy 144 (2021) 112287
Germany). Quantitative PCR was done in duplicate on ViiATM 7 PCR
system (Applied Biosystems, USA). The relative levels of mRNA of
peroxisome proliferator-activated receptor gamma (PPAR-ɣ) and insulin
receptor (INSR) were calculated by the 2− ΔΔCt method, which were
normalized to the mRNA level of glyceraldehyde-3-phosphate dehy­
drogenase (GAPDH) as a housekeeping gene. The primer sequences are
listed in Table 1.
2.13. Histopathological examination of hepatic, renal and pancreatic
tissues
Liver, kidney, pancreas, and visceral white adipose tissue samples
were collected and preserved in 10% formalin solution for histological
screening. The specimens from each group were embedded in paraffin
wax and sectioned into 5 µm thick sections and stained with hematox­
ylin and eosin (H &E stain). The stained sections were examined in a
blinded form under light microscopy (Olympus Optical, Japan).
Pancreatic, hepatic, and renal tissues injures severity and fat deposition
were characterized using a semi-quantitative scoring system from ten
fields at least, with four grades assigned according to the severity of
changes, as follows: 1+ , minimal change (<1%); ++, slight change
(1–25%); +++ , moderate change (26–50%); and ++++, severe change
(76–100%).
2.14. Statistical analysis
All data was statistically analyzed using SPSS software and expressed
as the mean ± SD. The one-way ANOVA followed by Duncan’s multiple
comparison test was used to assess the difference between different
groups. The significance level was set at P value less than 0.05.
3. Results
3.1. Phytochemical analysis of the HOE and HOETF
The present results indicated that the TPC (mg GAE/g plant extract)
of HOE and HOETF was 65.4 ± 1.28 and 426.2 ± 7.5, respectively.
While, the TFC (mg QE/g plant extract) was 181.2 ± 7.69 and 661.3 ±
22.8 for HOE and HOETF, respectively.
3.2. Effect of HOE and HOETF on serum glucose, insulin levels, and
insulin resistance in diabetic rats
As displayed in Fig. 1, substantial rises (P < 0.05) were observed in
levels of serum glucose, insulin, and HOMA-IR in the diabetic group as
compared to the control group. Nevertheless, co-treatment of HFD/STZ-
treated rats with HOE or HOETF evoked considerable declines (P <
0.05) in serum glucose, insulin, and HOMA-IR levels in respect to the
model group. In addition, diabetic rats subjected to MET therapy dis­
played low levels (P < 0.05) of the aforementioned parameters in rela­
tion with those in the model group. At the molecular level, mRNA
expression of INSR in liver and kidney of diabetic rats showed note­
worthy downregulations (P < 0.05) when compared with the controls.
Adversely, in comparison with diabetic rats, upregulated levels (P <
0.05) of INSR were observed in rats received HFD/STZ and co-treated
with HOE, HOETF or MET.
Table 1
Primer sequences of genes analyzed in real time polymerase chain reaction.
Name Forward primer (5’–3’) Reverse primer (5’–3’)
GAPDH CTCTCTGCTCCTCCCTGTTC TACGGCCAAATCCGTTCACA
IR CCCTCTGTCTCAGACTCCAC GACAGTCCTGGGAAGAGCAC
PPAR-ɣ GGTGAAACTCTGGGAGATCCT GGTCCACAGAGCTGATTCCG
M.S. Othman et al. Biomedicine & Pharmacotherapy 144 (2021) 112287

Fig. 1. Modulating effect of Hail Ocimum extract (HOE), Hail Ocimum extract total flavonoids (HOETF) or metformin (MET) on blood glucose, insulin and HOMA-IR
in high-fat diet (HFD)-streptozotocin (STZ)-induced diabetes in rats. The obtained results are displayed as the mean ± SD (n = 7). qRT-PCR results of INSR were
normalized with GAPDH and represented as fold change as compared to mRNA levels in the Control rats. aP < 0.05 compared to control group, bP < 0.05 compared
to diabetic group.

3.3. Effect of HOE and HOETF on liver and kidney functions biomarkers 3.4. Effect of HOE and HOETF on lipid metabolism related biomarkers in
in diabetic rats diabetic rats

Table 2 depicts the impact of HOE and HOETF on hepatic and renal
functions biomarkers of diabetic rats. Diabetic rats had higher
(P < 0.05) serum levels of ALT, ALP, urea and creatinine related to
control group. However, there were no significant changes in AST levels
between all groups. Moreover, co-treatment of HFD/STZ group with
HOE, HOETF or MET resulted in significant decreases (P < 0.05) in the
aforementioned parameters when compared with diabetic group, which
reveal their notable protective potential against diabetes-induced hep­
atorenal damage.
The effects of HOE and HOEFT on lipid biomarkers of diabetic rats
were shown in Table 2 Marked increases (P < 0.05) were detected in the
serum levels of TG, TC and LDL-c whereas, the levels of HDL-c displayed
notable decline (P < 0.05) in diabetic rats in respect to control ones. In
contrast, co-administration of HOE or HOETF to diabetic rats evoked
remarkable decreases (P < 0.05) in serum TG, TC, and LDL-c, together
with increases (P < 0.05) in HDL-c comparing with model rats. Further,
diabetic rats treated with MET demonstrated higher levels (P < 0.05) of
TG, TC, and LDL-c than those of control group without any significant
differences with diabetic group. Additionally, compared to controls,

Table 2
Modulating effect of Hail Ocimum extract (HOE), Hail Ocimum extract total flavonoids (HOETF) or metformin (MET) on hepatic and kidney functions markers and lipid
profile in high-fat diet (HFD)-streptozotocin (STZ)-induced diabetes in rats.
Parameters Control HOE HFD/STZ HFD/STZ-HOE HFD/STZ-HOETF HFD/STZ-MET

ALT (U/L) 28.3 ± 5.2 32.1 ± 8.1 65.1 ± 7.0a 45.6 ± 5.9a,b 40.5 ± 5.9a,b 41.2 ± 7.2ab
AST (U/L) 51.0 ± 8.0 51.1 ± 6.8 58.6 ± 7.33 54.9 ± 7.3 53.2 ± 7.7 55.2 ± 5.9
Urea (mg/dL) 39.6 ± 6.8 37.6 ± 5.2 70.9 ± 11.9a 49.7 ± 6.2a,b 47.3 ± 4.8b 53.6 ± 4.6a,b
Creatinine (mg/dL) 0.55 ± 0.10 0.58 ± 0.11 0.99 ± 0.11a 0.70 ± 0.08a,b 0.64 ± 0.07b 0.78 ± 0.09a,b
Triglyceride (mg/dL) 107.6 ± 11.6 112.2 ± 16.5 159.2 ± 15.4a 127.2 ± 16.1a,b 121.9 ± 22.4b 134.8 ± 14.6a
Total cholesterol (mg/dL) 92.4 ± 13.4 97.4 ± 13.2 154.1 ± 11.6a 137.1 ± 13.1a,b 127.3 ± 18.8a,b 140.9 ± 16.9a
HDL-c (mg/dL) 26.9 ± 4.9 30.6 ± 4.4 20.3 ± 4.3a 28.0 ± 4.9b 30.5 ± 4.1b 23.1 ± 3.1
LDL-c (mg/dL) 44.0 ± 15.8 44.4 ± 16.3 101.9 ± 14.4a 83.6 ± 15.9a,b 72.5 ± 21.9a,b 90.9 ± 18.3a
AIP 0.61 ± 0.10 0.56 ± 0.08 0.90 ± 0.10a 0.66 ± 0.08b 0.60 ± 0.09b 0.77 ± 0.09a,b

The obtained results are displayed as the mean ± SD (n = 7).

a
P < 0.05 compared to control group,
b
P < 0.05 compared to diabetic group. Abbreviations: ALT: Alanine aminotransferase; AST: Aspartate aminotransferase; HDL-c: High-density lipoprotein choles­
terol; LDL-c: Low-density lipoprotein cholesterol; AIP: atherogenic index of plasma.

4
M.S. Othman et al.
marked downregulation (P < 0.05) in mRNA expression of PPAR-γ were
noticed in both tissues of diabetic animals (Fig. 2). However, HFD/STZ-
treated rats displayed noticeable upregulation (P < 0.05) in PPAR-γ
expression when co-treated with HOE, HOETF or MET.
3.5. Effect of HOE and HOETF on hepatorenal antioxidant enzymes in
diabetic rats
The antioxidant enzymatic activities of SOD, CAT, GR and GPx in
hepatic and renal tissues were assessed in diabetic rats co-treated with
HOE, HOETF or MET. In hepatic tissue (Fig. 3), notable decreases
(P < 0.05) were observed in SOD, GPx and GR activities in diabetic
group compared to those of the control group. Co-treatment of diabetic
animals with HOE or HOETF restored noticeably (P < 0.05) the activ­
ities of SOD, GR, and GPx in respect to the model group. No significant
differences were detected in the activity of CAT in liver tissue between
all tested groups. Additionally, the administration of MET to diabetic
animals did not evoke any notable differences in the activities of all
examined antioxidant enzymes related to HFD/STZ-treated group.
Concerning the renal antioxidant enzymes (Fig. 3), marked re­
ductions (P < 0.05) were detected in levels of SOD, GR and GPx in the
diabetic group compared to the control one. Co-treatment with HOE
only provoked significant increments (P < 0.05) in the activities of the
abovementioned enzymes in respect to control group. However, diabetic
groups co-treated with HOE or HOETF showed remarkable elevations
(P < 0.05) in the activities of all examined enzymes in respect to group
received HFD/STZ treatment only. Moreover, MET-treated diabetic rats
showed marked elevations (P < 0.05) in the activity of GR only
compared to those in the diabetic group.
3.6. Effect of HOE and HOETF on hepatorenal oxidative stress related
biomarkers in diabetic rats
It is clear from Fig. 4 that the HFD/STZ-treated group unveiled
marked reductions (P < 0.05) in hepatic GSH level accompanied by
marked elevations in levels of NO and LPO when compared with control
group. Nevertheless, noteworthy increases (P < 0.05) in hepatic GSH
levels with declines in NO and LPO levels were detected in groups
received HOE, HOETF or MET treatment in comparison with diabetic
group. In addition, rats administered only HOE had marked elevations
(P < 0.05) in hepatic GSH levels in comparison with those in the control
group.
In renal tissue (Fig. 4), diabetic rats displayed marked declines
(P < 0.05) in renal GSH level accompanied by marked elevations in
levels of NO and LPO compared to control group. Co-treatment of
Fig. 2. Modulating effect of Hail Ocimum extract (HOE), Hail Ocimum extract total flavonoids (HOETF) or metformin (MET) on PPAR-ɣ in high-fat diet (HFD)-
streptozotocin (STZ)-induced diabetes in rats. Results were normalized with GAPDH and represented as fold change as compared to mRNA levels in the Control rats.
a
P < 0.05 compared to control group, bP < 0.05 compared to diabetic group.
5
Biomedicine & Pharmacotherapy 144 (2021) 112287
diabetic rats with HOE or HOETF resulted in notable declines in NO and
LPO together with increases in GSH levels in comparison with HFD/STZ
group. MET-treated diabetic rats displayed low renal LPO levels
(P < 0.05) and high GSH levels compared to those in HFD/STZ group. It
is noteworthy that rats received only HOE showed marked rises
(P < 0.05) in renal GSH levels and declines (P < 0.05) in NO levels in
respect control group.
3.7. Effect of HOE and HOETF on hepatorenal inflammatory biomarkers
in diabetic rats
HFD/STZ-treatment resulted in marked increases (P < 0.05) in he­
patic and renal levels of NF-κB, IL-1β, and TNF-α related to the control
group. Co-treatment of diabetic animals with HOE, HOETF or MET
caused substantial decreases (P < 0.05) in levels of pro-inflammatory
markers compared to diabetic rats. Also, no marked changes were
detected in the levels of tested cytokines between the control and HOE-
treated groups (Fig. 5).
3.8. Effect of HOE and HOETF on apoptotic and anti-apoptotic markers
in livers and kidneys of diabetic rats
Fig. 6 shows that the HFD/STZ group had marked elevated levels
(P < 0.05) of Bax together with notable declines (P < 0.05) in Bcl-2
levels in both tissues in comparison with control group. In contrast,
co-administration of diabetic rats with HOE, HOETF or MET lessened
markedly (P < 0.05) the levels of Bax and increased the levels of
(p < 0.05) Bcl-2 in both tissues compared to the model group. Non-
significant differences were detected in the levels of both tested cyto­
kines between the control and HOE-treated groups.
3.9. Effect of HOE and HOETF on histopathological features of liver,
kidney and pancreas in diabetic rats
3.9.1. Pancreas
Fig. 7 shows normal histology of Langerhans islets and acinus
structure in the control and HOE groups. In the STZ/HFD-treated rats,
there were congestion and inflammation in the interlobular area of
pancreatic tissue with marked vacuolation in cells of Langerhans’s islets
as well as vacuolation of epithelial lining of acini. Treatment of diabetic
rats with HOE or HOETF resulted in noticeable decrease in pancreatic
damage together with normal acinar cell structures (Supplementary
data: Table 1S). In the MET-treated group, mild vascular congestion in
the interlobular area was detected.
M.S. Othman et al. Biomedicine & Pharmacotherapy 144 (2021) 112287

Fig. 3. Modulating effect of Hail Ocimum extract (HOE), Hail Ocimum extract total flavonoids (HOETF) or metformin (MET) on antioxidant enzymatic activities of
SOD, CAT, GPx and GR in high-fat diet (HFD)-streptozotocin (STZ)-induced diabetes in rats. The obtained results are displayed as the mean ± SD (n = 7). aP < 0.05
compared to control group, bP < 0.05 compared to diabetic group.

6
M.S. Othman et al. Biomedicine & Pharmacotherapy 144 (2021) 112287

Fig. 4. Modulating effect of Hail Ocimum extract (HOE), Hail Ocimum extract total flavonoids (HOETF) or metformin (MET) on levels of non-enzymatic biomarkers
(LPO, NO, and GSH) in high-fat diet (HFD)-streptozotocin (STZ)-induced diabetes in rats. The obtained results are displayed as the mean ± SD (n = 7). aP < 0.05
compared to control group, bP < 0.05 compared to diabetic group.

3.9.2. Visceral white adipose tissue
Normal adipocytes distributions with ordinary sizes of cells were
observed in the control and HOE groups (Fig. 7). Whereas in the STZ/
HFD-treated rats, the visceral white adipose tissue displayed larger ad­
ipocytes due to the accumulation of fat in a single large droplet that
expands and overruns most of the cytoplasm. However, rats adminis­
tered HOE or HOETF exhibited smaller sizes adipocytes comparable to
the control group (Supplementary data: Table 1S).
3.9.3. Liver
Fig. 7 depicts the microscopical examination of the liver sections of
examined groups. The control and HOE groups revealed normal hepa­
tocellular structure and normal central vein. However, HFD/STZ-
diabetic rats showed necrotic areas in the liver tissues and, sinusoidal
dilatation in the pericentral area. Remarkably, groups co-treated with
HOE, HOETF showed mild activation of Kupffer cells as well as mild
congestion of central vein (Supplementary data: Table 1S). Further,
MET-treated group showed normal liver cells arranged in hepatic cords
radiating from the central vein.
3.9.4. Kidney
Renal histopathological screening of the control and HOE groups
revealed normal glomeruli and tubules. Adversely, diabetic rats un­
veiled necrotic and degenerated renal tubules and infiltration of in­
flammatory cell in renal glomeruli together with congestion of the
peritubular capillaries. Surprisingly, co-treatment with HOE, or HOETF
improved the renal injury as showed by reduction of renal cortex
damage without inflammatory cell infiltration and less congested

7
M.S. Othman et al. Biomedicine & Pharmacotherapy 144 (2021) 112287

Fig. 5. Modulating effect of Hail Ocimum extract (HOE), Hail Ocimum extract total flavonoids (HOETF) or metformin (MET) on levels of pro-inflammatory bio­
markers NF-κB, TNF-α, and IL-1β in high-fat diet (HFD)-streptozotocin (STZ)-induced diabetes in rats. The obtained results are displayed as the mean ± SD (n = 7).
a
P < 0.05 compared to control group, bP < 0.05 compared to diabetic group.

capillaries (Supplementary data: Table 1S). Besides, the histological
features of renal tubular structures in the MET group were similar to the
control group (Fig. 7).
4. Discussion
Despite of the recent great development in the prevention and
treatment policies of diabetes as well as its associated complications, the
rate of morbidity is growing alarmingly with high rate of mortalities [5,
30]. To assess the impact of using phytochemical products on type 2
diabetes, an animal model treated with low-dose STZ combined with
HFD has been developed. STZ has the ability to produce oxygen free
radicals, that selectively damage pancreatic islet β-cell and induce
hyperglycemia [3,31]. The administration of HFD, along with a low dose
of STZ in rats, evokes a condition that mimics the pathogenesis of type 2
diabetes in humans and in turn render it a suitable model for investi­
gating the anti-diabetic effectiveness of natural products on type 2
diabetes and its complications.
High level of blood glucose is a characteristic feature of diabetic
conditions either in fasting or postprandial states. Therefore, the
monitoring of glucose homeostasis is a key indicator for the diabetes
management. The current study revealed that STZ/HFD-treated diabetic
rats showed noticeable elevations in fasting blood glucose, insulin and
HOMA-IR in comparison with control rats and this in agreement with
former authors [30–32]. Concomitant increases in both fasting insulin
and fasting glucose indicate the incidence of insulin resistance and type

8
M.S. Othman et al. Biomedicine & Pharmacotherapy 144 (2021) 112287

Fig. 6. Modulating effect of Hail Ocimum extract (HOE), Hail Ocimum extract total flavonoids (HOETF) or metformin (MET) on pro-apoptotic biomarker level of Bax
and anti-apoptotic marker level of Bcl-2 in high-fat diet (HFD)-streptozotocin (STZ)-induced diabetes in rats. The obtained results are displayed as the mean ± SD
(n = 7). aP < 0.05 compared to control group, bP < 0.05 compared to diabetic group.

Fig. 7. Histopathological deformations of pancreas, visceral white adipose tissue, liver, and kidney sections of high-fat diet (HFD)-streptozotocin (STZ)-induced
diabetic rats co-treated with Hail Ocimum extract (HOE), Hail Ocimum extract total flavonoids (HOETF) or metformin (MET). Scale bar = 50 µm (400 ×).

9
M.S. Othman et al.
2 diabetes in these animals [32,33]. In support, our molecular results
revealed marked downregulated INSR gene expressions in both tissues
of diabetic group which agrees with former reports [34,35]. The
administration of fat-rich diet was reported to provoke insulin resistance
via glucose-fatty acid interactions. High-fat diet increases the lipid
availability and oxidation, suppress Glut-4 expression with consequent
decrease in glucose uptake in fatty tissues and skeletal muscles [36].
Further, previous studies found that the high-fat diet-induced oxidant
and inflammatory scenarios contribute to impaired insulin sensitivity
[32].
The marked declines in blood levels of glucose, insulin and HOMA-IR
in diabetic animals received HOE or HOETF reflect the antidiabetic
potential of this plant and its flavonoid contents and this is in harmony
with former studies [6,9,37]. Concomitantly, treatment with HOE
reduced the damage of pancreatic islets of diabetic rats. These changes
may result from the improved insulin sensitivity and encouragement of
glucose uptake by tissues as liver where it translates into glycogen
synthesis and storage [9]. Further, this plant extract ant its flavonoids
were reported to enhance the insulin secretion via their positive effects
on pancreatic β cells which is also supported by histopathological
findings [9,13]. In addition, marked inhibition of α-amylase and
α-glucosidase were previously reported after administration of HOE [9,
13]. Inhibition of both enzymes lead to suppression of carbohydrate
metabolism with consequent decrease in glucose release from the lumen
of small intestine to portal vein [37]. Supporting the effectiveness of
flavonoids over the MET, Khaled et al. [38] reported that oral admin­
istration of Ocimum kilimandscharicum L. restored the levels of insulin,
fasting blood glucose, and HOMA index in comparison with MET in rats
with polycystic ovary syndrome.
Moreover, the diabetic group displayed notable rises in serum levels
of ALT, ALP, urea and creatinine; this is consistent with former reports
[1,2]. The leakage of ALT and ALP enzymes from the liver cytosol into
the bloodstream indicate the damage to hepatic cells and liver
dysfunction [39]. As being sensitive markers for kidney injury, the
increased levels of serum urea and creatinine in diabetic rats indicated
the diminished renal function [7]. These changes of deterioration in
hepatorenal functions in STZ/HFD group were in line with the observed
histopathological changes in both organs. In contrast, co-treatment of
diabetic rats with HOE or HOETF caused noteworthy reductions in the
activities of these enzymes together with declines in urea and creatinine,
which indicates the hepatorenal protective effect of HOE and its flavo­
noids in diabetic rats. These findings are in accordance with previous
studies that reported hepatorenal protective effects of O. basilicum
against lead [40] and acetaminophen [16] in experimental animals.
Further, genistein, an isoflavone, lowered significantly blood urea ni­
trogen in alloxan-induced diabetic rats if compared with those
co-treated with MET treatment [41].
Dyslipidemia is a common complication associated with diabetes and
featured in our study by elevated serum TG, TC, and LDL-C and declined
HDL-C in diabetic rats. Similar results were reported previously [4,32].
Excess fat mobilization from the adipose tissues or inhibition of the
hormone sensitive lipase by insulin results in hyperlipidemia [4]. In
accordance with former study of Okoduwa et al. [4], administration of
HOE significantly improved the alterations of blood lipid indices of
diabetic rats. The anti-hyperlipidemic effect of HOE could be attributed
for enhancement of insulin sensitivity and activation of PPAR-γ [42].
This is validated in our study by upregulation in gene expression of
PPAR-γ in both tissues of diabetic group when co-treated with HOE or
HOETF. PPAR-γ plays a vital role lipid, glucose homeostasis and insulin
resistance, when activated, it enhances the β-oxidation of fatty acids
with consequent reductions in TG and TC levels [43]. The hypolipidemic
effect of HOE refers to its flavonoids fraction. For example, a
flavonoid-rich extract from Sophora alopecuroides L. corrected markedly
the lipid profile of HFD/STZ-induced diabetes via regulation of PPARα
and PPARγ expressions in mice [44]. Similar finding were reported with
flavonoids from Rosa rugosa that exhibited PPARα agonist-like effects in
10
Biomedicine & Pharmacotherapy 144 (2021) 112287
an experimental mice model of hypertriglyceridemia [45]. In addition,
the effect of HOE or its flavonoids showed marked anti-hyperlipidemic
effect when compared to MET that further validate their efficacy. In
support, polyphenol extracts of peanut shell lowered effectively the
serum LDL-C levels in comparison with MET therapy [46]. Similar
findings were reported by Khaled et al. [38].
Oxidative stress can be considered as a causative agent in diabetes
progress as well as the diabetes-associated complications [3,31]. In
hyperglycemic conditions, enhanced glucose oxidation process and
release of large amount of superoxide anion result in cellular oxidative
injury that can precede to liver and kidney damage [7,47]. Owing to
their fundamental roles in glucose metabolism, the liver and kidneys are
very sensitive to hyperglycemia-induced injury [48]. Corroborating this
hypothesis, our results revealed marked decreases in antioxidant
enzyme activities of SOD, CAT, GPx, and GR as well as in GSH contents
in the liver and kidney of STZ/HFD-induced diabetic rats. These results
are in accordance with former conclusions [7,47–49]. Further, notable
increases in LPO and NO levels in both tissues of diabetic group reflect
tissue oxidative and nitrosative damage that is similar to previous re­
ports [1,7,31,47,48]. In support, the present histopathological results
showed that the diabetic rats displayed serious damage to the liver and
kidney.
Based on these results, revamping the redox state in liver and kidney
tissues may abolish the oxidative stress resulted from diabetes-induced
excess ROS production. Former authors attributed the hypoglycemic
effect of natural products on diabetic rats is mediated by augmented
total antioxidant capacity [3,9]. Our study unveiled marked elevation in
antioxidant enzymes (SOD, CAT, GPx and GR) and GSH levels which
indicate the antioxidant potency of the polyphenols and flavonoids
found in HOE and in accordance with previous investigations [11,14,
15]. The in vitro hypoglycemic effect of the aqueous extract of Ocimum
basilicum was formerly reported via inhibition of α-glucosidase and
α-amylase activities with resultant improvement of pancreatic β-cell
function [50]. HOE or HOETF also attenuated the increased levels of
MDA and NO in both tissues. These results suggest that this plant or its
flavonoids had the ability to neutralizes hydroxyl (OH− ) and superoxide
(O2− ) radicals and stops the lipid peroxidation [51]. Numerous studies
stated the presence of many phytochemical compounds in O.basilicum
as estragole and eugenol in addition to fatty acids as oleic acid, palmitic
acid and linolenic acid, and aromatic compounds as eucalyptol [14,15,
50]. These detected phytocompounds as estragole and eugenol were
reported to have noticeable antioxidant properties [10]. Additionally,
the chromatogram indicated the presence of volatile terpenoids in HOE
like carvone, carveol, menthone, isoneomenthol and menthol which
have been reported in former studies [10,15]. The hydroxyl groups in
the structure of these compounds can act as hydrogen atom donor that
neutralizes reactive radicals with consequent blockage of the oxidative
chain reaction [39,52]. Supporting former reports [10,53], flavonoids
were also detected in HOE as apigenin O-glucoside, luteolin, quercetin,
quercitrin and rutin. These flavonoids exerted marked antioxidant ac­
tivities that protected liver and kidney tissues against various injuries
[12,15,40,54]. Furthermore, flavonoids commonly activate Nrf2 is a
transcription factor plays a key role in eliminating the excess ROS via
regulation of the expression of many genes encoding antioxidant mol­
ecules [39]. Activation of Nrf2 triggers the detoxifying phase-II enzymes
like NADPH-quinone dehydrogenase-1 and hemeoxygenase-1 enzymes,
thus elevating the cellular antioxidant capacity against oxidative insult
[52,55].
Another important aspect to be discussed is the marked increments
in the hepatic and renal levels of pro-inflammatory cytokines, TNF-α and
IL-1β, in diabetic rats. Similar results were formerly reported in exper­
imentally induced diabetes [1,2,7]. Excess generation of free radicals
contributes to enhancement of nuclear factor-kappa B (NF-κB) which
contributes markedly to the transcription of genes encoding the in­
flammatory proteins [56]. Formerly, NF-κB-mediated inflammation was
reported to be encouraged in STZ-induced diabetes in rats [2].
M.S. Othman et al.
Synergistic activation of the NF-κB signaling and inflammatory cyto­
kines have been reported to be closely related to the patho-physiology of
diabetic nephropathy [57,58]. For example, TNF-α induces over­
production of free radicals, apoptotic damage of renal cell, increases the
permeability of albumin in renal glomeruli in addition to activation of
the secretion of vasoconstrictive mediators in the mesangial cell with
subsequent restriction of renal blood flow [58].
In contrast, HOE supplementation was effective in lowering the
levels of hepatic and renal TNF-α and IL-1β in diabetic rats, this suggests
that HOE supplementation could play a preventive role against inflam­
matory response in diabetic rats. Similar results were detected in former
reports [11,14,51,54]. Rodrigues et al. [59] verified the
anti-inflammatory action of O. basilicum against acute and chronic
inflammation models as paw edema, peritonitis, and vascular perme­
ability and granulomatous inflammation. Notable down regulated ex­
pressions of TNF-α, IL-1β and IL-2 were detected in
lipopolysaccharide-exposed RAW 264.7 macrophages and treated with
O. basilicum extract, in addition to decreasing the levels of inducible
nitric oxide synthase and NO [60]. O. gratissimum extract protected
against carrageenan induced-acute inflammation through suppressing of
neutrophil migration, pro-inflammatory cytokines release, and lipid
peroxidative damage [54]. Further, essential oils of O. basilicum sub­
sided the inflammation via blockage of arachidonic acid metabolism
through acting on cyclooxygenase and lipoxygenase pathways [59,61].
Ability of HOE to alleviation the liver and kidney inflammatory reaction
could be endorsed for the phytoconstituents in HOE monoterpenes and
flavonoids with remarkable anti-inflammatory effects [62,63]. The
relation between oxidative stress and expression of TNF-α results from
the ROS-mediated activation of both NF-κB and p38 mitogen-activated
protein kinase, which trigger extra release of TNF-α [14]. These re­
sults confirmed that HOE restored the balance redox homeostasis in
hepatic and renal cell under diabetic conditions with subsequent sup­
pression of TNF-α expression.
Hyperglycemia mediated-oxidative stress and inflammation could
trigger the apoptotic signaling pathway as a result of mitochondrial
dysfunction [3,7]. Disruption of mitochondrial membrane integrity
leads to cytosolic migration of cytochrome-c and activation of caspase
signaling cascade [2]. In agreement with former authors [64,65], we
found notable increases in Bax levels and declines in Bcl-2 levels in livers
and kidneys of diabetic rats. The balance between Bcl-2 (an anti­
apoptotic marker) and Bax (proapoptotic marker) decides the induction
of the intrinsic pathways of apoptosis [66,67].
In the present study, we found that HOE or HOETF treatment sup­
pressed markedly the cell apoptosis in liver and kidney of diabetic rats.
Anti-apoptotic activity of HOE was reported by former authors [55,
68–69]. As a result of oxidative stress, the mitochondrial membrane
suffers from marked damage, which in turn alters the balance between
proapoptotic (e.g. Bax) and antiapoptotic members (Bcl-2) of the Bcl-2
family. This allows the release of cytochrome c and the consequent
activation of the caspase cascade, which lastly end with DNA damage
[70]. Additionally, overwhelming the cell cycle arrest and apoptosis
could be explained by the stimulation of MAPK and Nrf2 signaling
pathways. Moreover, HOE significantly induced up-regulated Bax levels
and down-regulated Bcl-2 levels in doxorubicin/irradiation-induced
testicular damage [55]. Treatment with the extract of O. gratissimum
reduced the expression of caspase 8 induced by cobalt chloride in renal
tissue which indicates the ability of this plant to modulate the extrinsic
pathway of apoptosis [69].
5. Conclusion
To sum up, the outcomes of this study support the potential value of
HOE and HOETF as an adjunct therapy for management of type 2
diabetes-related hepatic and renal complications. Co-treatment of dia­
betic rats with HOE or HOETF reversed elevated glucose and insulin
levels in addition to restoring the redox status and preventing the
11
Biomedicine & Pharmacotherapy 144 (2021) 112287
oxidative damage in liver and kidney. Besides, administration of HOE or
HOETF could attenuate inflammatory and apoptotic events in both tis­
sues. These findings therefore validate the claims that this herb and its
flavonoid constituents are promising therapeutic interventions to alle­
viate hepatic and renal injuries in diabetic milieu.
CRediT authorship contribution statement
Mohamed S. Othman and Ahmed E. Abdel Moneim: Conceptu­
alization, Methodology. Mohamed S. Othman, Ola A. Habotta, and
Ahmed E. Abdel Moneim: Data curation, Writing – original draft.
Ahmed E. Abdel Moneim: Visualization, Investigation. Mohamed S.
Othman and Ahmed E. Abdel Moneim: Supervision. Mohamed S.
Othman, Azza M. Khaled, Amal H. Al-Bagawi, Mohamed A. Fareid,
and Reda A Ghany: Resources, Validation. Mohamed S. Othman, Ola
A. Habotta, and Ahmed E. Abdel Moneim: Writing – review & editing.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgment
This research has been funded by Scientific Research Deanship at
University of Ha’il- Saudi Arabia through project number: RG-20 153.
Appendix A. Supporting information
Supplementary data associated with this article can be found in the
online version at doi:10.1016/j.biopha.2021.112287.
References
[1] W. Nacer, F.Z.B. Ahmed, H. Merzouk, O. Benyagoub, S. Bouanane, Evaluation of
the anti-inflammatory and antioxidant effects of the microalgae Nannochloropsis
gaditana in streptozotocin-induced diabetic rats, J. Diabetes Metab. Disord. (2020)
1–8.
[2] C. Hacioglu, F. Kar, Y. Kara, E. Yucel, D.B. Donmez, H. Sentürk, G. Kanbak,
Comparative effects of metformin and Cistus laurifolius L. extract in streptozotocin-
induced diabetic rat model: oxidative, inflammatory, apoptotic, and
histopathological analyzes, Environ. Sci. Pollut. Res. (2021) 1–14.
[3] A. Al-Brakati, A.J.A. Albarakati, H.M. Daabo, R.S. Baty, F.E.H. Salem, O.
A. Habotta, E.K. Elmahallawy, D.M. Abdel-Mohsen, H. Taha, A.M. Akabawy,
Neuromodulatory effects of green coffee bean extract against brain damage in male
albino rats with experimentally induced diabetes, Metab. Brain Dis. 35 (7) (2020)
1175–1187.
[4] S.I. Okoduwa, I.A. Umar, D.B. James, H.M. Inuwa, Anti-diabetic potential of
Ocimum gratissimum leaf fractions in fortified diet-fed streptozotocin treated rat
model of type-2 diabetes, Medicines 4 (4) (2017) 73.
[5] R.M. Hassan, M. Elsayed, T.E. Kholief, N.H. Hassanen, J.A. Gafer, Y.A. Attia,
Mitigating effect of single or combined administration of nanoparticles of zinc
oxide, chromium oxide, and selenium on genotoxicity and metabolic insult in
fructose/streptozotocin diabetic rat model, Environ. Sci. Pollut. Res. (2021) 1–18.
[6] S. Chaudhary, A. Semwal, H. Kumar, H.C. Verma, A. Kumar, In-vivo study for anti-
hyperglycemic potential of aqueous extract of Basil seeds (Ocimum basilicum Linn)
and its influence on biochemical parameters, serum electrolytes and
haematological indices, Biomed. Pharmacother. 84 (2016) 2008–2013.
[7] N. Giribabu, K. Karim, E.K. Kilari, N. Salleh, Phyllanthus niruri leaves aqueous
extract improves kidney functions, ameliorates kidney oxidative stress,
inflammation, fibrosis and apoptosis and enhances kidney cell proliferation in
adult male rats with diabetes mellitus, J. Ethnopharmacol. 205 (2017) 123–137.
[8] D. Luo, X. Dong, J. Huang, C. Huang, G. Fang, Y. Huang, Pueraria lobata root
polysaccharide alleviates glucose and lipid metabolic dysfunction in diabetic db/db
mice, Pharm. Biol. 59 (1) (2021) 382–390.
[9] N. Abdelrahman, R. El-Banna, M.M. Arafa, M.M. Hady, Hypoglycemic efficacy of
Rosmarinus officinalis and/or Ocimum basilicum leaves powder as a promising
clinico-nutritional management tool for diabetes mellitus in Rottweiler dogs, Vet.
World 13 (1) (2020) 73.
[10] L. Vlase, D. Benedec, D. Hanganu, G. Damian, I. Csillag, B. Sevastre, A.C. Mot,
R. Silaghi-Dumitrescu, I. Tilea, Evaluation of antioxidant and antimicrobial
activities and phenolic profile for Hyssopus officinalis, Ocimum basilicum and
Teucrium chamaedrys, Molecules 19 (5) (2014) 5490–5507.
M.S. Othman et al.
[11] E.A. Abd El-Ghffar, E. Al-Sayed, S.M. Shehata, O.A. Eldahshan, T. Efferth, The
protective role of Ocimum basilicum L.(Basil) against aspirin-induced gastric ulcer
in mice: impact on oxidative stress, inflammation, motor deficits and anxiety-like
behavior, Food Funct. 9 (8) (2018) 4457–4468.
[12] D.A. Almalki, Renoprotective effect of Ocimum basilicum (basil) against diabetes-
induced renal affection in albino rats, Mater. Socio-Med. 31 (4) (2019) 236.
[13] C. Ezeani, I. Ezenyi, T. Okoye, C. Okoli, Ocimum basilicum extract exhibits
antidiabetic effects via inhibition of hepatic glucose mobilization and carbohydrate
metabolizing enzymes, J. Intercult. Ethnopharmacol. 6 (1) (2017) 22.
[14] S.M. Farouk, F.A.-m Gad, M.A. Emam, Comparative immuno-modulatory effects of
basil and sesame seed oils against diazinon-induced toxicity in rats; a focus on TNF-
α immunolocalization, Environ. Sci. Pollut. Res. 28 (5) (2021) 5332–5346.
[15] H.A. Ogaly, N.A. Eltablawy, A.M. El-Behairy, H. El-Hindi, R.M. Abd-Elsalam,
Hepatocyte growth factor mediates the antifibrogenic action of Ocimum bacilicum
essential oil against CCl4-induced liver fibrosis in rats, Molecules 20 (8) (2015)
13518–13535.
[16] H.F. Karaali, R.R. Fahmi, J.M. Borjac, Effect of Ocimum basilicum leaves extract on
acetaminophen-induced nephrotoxicity in BALB/c mice, J. Complement. Integr.
Med. 16 (2) (2018).
[17] M.Y. Alomar, Physiological and histopathological study on the influence of
Ocimum basilicum leaves extract on thioacetamide-induced nephrotoxicity in male
rats, Saudi J. Biol. Sci. 27 (7) (2020) 1843–1849.
[18] S. Khadke, P. Mandave, A. Kuvalekar, V. Pandit, M. Karandikar, N. Mantri,
Synergistic effect of omega-3 fatty acids and oral-hypoglycemic drug on lipid
normalization through modulation of hepatic gene expression in high fat diet with
low streptozotocin-induced diabetic rats, Nutrients 12 (12) (2020) 3652.
[19] A.E. Abdel Moneim, The neuroprotective effects of purslane (Portulaca oleracea)
on rotenone-induced biochemical changes and apoptosis in brain of rat, CNS
Neurol. Disord. Drug Targets 12 (6) (2013) 830–841.
[20] K. Srinivasan, B. Viswanad, L. Asrat, C. Kaul, P. Ramarao, Combination of high-fat
diet-fed and low-dose streptozotocin-treated rat: a model for type 2 diabetes and
pharmacological screening, Pharmacol. Res. 52 (4) (2005) 313–320.
[21] P. Trinder, Determination of glucose in blood using glucose oxidase with an
alternative oxygen acceptor, Ann. Clin. Biochem. Int. J. Biochem. Med. 6 (1)
(1969) 24–27.
[22] D.R. Matthews, J.P. Hosker, A.S. Rudenski, B.A. Naylor, D.F. Treacher, R.C. Turner,
Homeostasis model assessment: insulin resistance and beta-cell function from
fasting plasma glucose and insulin concentrations in man, Diabetologia 28 (7)
(1985) 412–419.
[23] H. Ohkawa, N. Ohishi, K. Yagi, Assay for lipid peroxides in animal tissues by
thiobarbituric acid reaction, Anal. Biochem. 95 (2) (1979) 351–358.
[24] L.C. Green, D.A. Wagner, J. Glogowski, P.L. Skipper, J.S. Wishnok, S.
R. Tannenbaum, Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids,
Anal. Biochem. 126 (1) (1982) 131–138.
[25] G.L. Ellman, Tissue sulfhydryl groups, Arch. Biochem. Biophys. 82 (1) (1959)
70–77.
[26] M. Nishikimi, N. Appaji, K. Yagi, The occurrence of superoxide anion in the
reaction of reduced phenazine methosulfate and molecular oxygen, Biochem.
Biophys. Res. Commun. 46 (2) (1972) 849–854.
[27] H. Aebi, Catalase in vitro, Methods Enzymol. 105 (1984) 121–126.
[28] D.E. Paglia, W.N. Valentine, Studies on the quantitative and qualitative
characterization of erythrocyte glutathione peroxidase, J. Lab. Clin. Med. 70 (1)
(1967) 158–169.
[29] L. De Vega, R.P. Fernandez, M.C. Mateo, J.B. Bustamante, A.M. Herrero, E.
B. Munguira, Glutathione determination and a study of the activity of glutathione-
peroxidase, glutathione-transferase, and glutathione-reductase in renal transplants,
Ren. Fail 24 (4) (2002) 421–432.
[30] S. Khadke, P. Mandave, A. Kuvalekar, V. Pandit, M. Karandikar, N. Mantri,
Synergistic effect of omega-3 fatty acids and oral-hypoglycemic drug on lipid
normalization through modulation of hepatic gene expression in high fat diet with
low streptozotocin-induced diabetic rats, Nutrients 12 (12) (2020).
[31] Q. Ma, Y. Guo, L. Sun, Y. Zhuang, Anti-diabetic effects of phenolic extract from
rambutan peels (nephelium lappaceum) in high-fat diet and streptozotocin-induced
diabetic mice, Nutrients 9 (8) (2017).
[32] R. Ghiasi, F.G. Soufi, M. hossein Somi, G. Mohaddes, F.M. Bavil, R. Naderi, M.
R. Alipour, Swim training improves HOMA-IR in type 2 diabetes induced by high
fat diet and low dose of streptozotocin in male rats, Adv. Pharm. Bull. 5 (3) (2015)
379.
[33] M.S. Winzell, B. Ahrén, The high-fat diet-fed mouse: a model for studying
mechanisms and treatment of impaired glucose tolerance and type 2 diabetes,
Diabetes 53 (Suppl 3) (2004) S215–S219.
[34] H. Rezazadeh, M.R. Sharifi, M. Sharifi, N. Soltani, Gamma-aminobutyric acid
attenuates insulin resistance in type 2 diabetic patients and reduces the risk of
insulin resistance in their offspring, Biomed. Pharmacother. 138 (2021), 111440.
[35] W. Xu, M. Tang, J. Wang, L. Wang, Anti-inflammatory activities of puerarin in
high-fat diet-fed rats with streptozotocin-induced gestational diabetes mellitus,
Mol. Biol. Rep. 47 (10) (2020) 7537–7546.
[36] V. Ghorbanzadeh, M. Mohammadi, H. Dariushnejad, L. Chodari, G. Mohaddes,
Effects of crocin and voluntary exercise, alone or combined, on heart VEGF-A and
HOMA-IR of HFD/STZ induced type 2 diabetic rats, J. Endocrinol. Investig. 39 (10)
(2016) 1179–1186.
[37] L.M. Casanova, W. Gu, Sn.S. Costa, P.B. Jeppesen, Phenolic substances from
Ocimum species enhance glucose-stimulated insulin secretion and modulate the
expression of key insulin regulatory genes in mice pancreatic islets, J. Nat. Prod. 80
(12) (2017) 3267–3275.
12
Biomedicine & Pharmacotherapy 144 (2021) 112287
[38] N. Khaled, A.A. El-Bahy, R. Radwan, H. Handoussa, S. AbdelMaksoud, Ocimum
kilimandscharicum L. restores ovarian functions in letrozole - induced Polycystic
Ovary Syndrome (PCOS) in rats: comparison with metformin, Life Sci. 232 (2019),
116640.
[39] W.A. Al-Megrin, A.F. Alkhuriji, A.O.S. Yousef, D.M. Metwally, O.A. Habotta, R.
B. Kassab, A.E. Abdel Moneim, M.F. El-Khadragy, Antagonistic efficacy of luteolin
against lead acetate exposure-associated with hepatotoxicity is mediated via
antioxidant, anti-inflammatory, and anti-apoptotic activities, Antioxidants 9 (1)
(2020) 10.
[40] W.M. Yuniarti, N. Krismaharani, P. Ciptaningsih, K. Celia, K.D. Veteriananta,
A. Ma’ruf, B.S. Lukiswanto, The protective effect of Ocimum sanctum leaf extract
against lead acetate-induced nephrotoxicity and hepatotoxicity in mice (Mus
musculus), Vet. World 14 (1) (2021) 250.
[41] K. Rehman, M.B. Ali, M.S.H. Akash, Genistein enhances the secretion of glucagon-
like peptide-1 (GLP-1) via downregulation of inflammatory responses, Biomed.
Pharmacother. Biomed. Pharmacother. 112 (2019), 108670.
[42] C. Gamboa-Gómez, L.M. Salgado, A. González-Gallardo, M. Ramos-Gómez,
G. Loarca-Piña, R. Reynoso-Camacho, Consumption of Ocimum sanctum L. and
Citrus paradisi infusions modulates lipid metabolism and insulin resistance in
obese rats, Food Funct. 5 (5) (2014) 927–935.
[43] S.P. Khadke, A.A. Kuvalekar, A.M. Harsulkar, N. Mantri, High energy intake
induced overexpression of transcription factors and its regulatory genes involved in
acceleration of hepatic lipogenesis: a rat model for type 2 diabetes, Biomedicines 7
(4) (2019).
[44] Y. Lv, P. Zhao, K. Pang, Y. Ma, H. Huang, T. Zhou, X. Yang, Antidiabetic effect of a
flavonoid-rich extract from Sophora alopecuroides L. in HFD- and STZ- induced
diabetic mice through PKC/GLUT4 pathway and regulating PPARα and PPARγ
expression, J. Ethnopharmacol. 268 (2021), 113654.
[45] A. Baiyisaiti, Y. Wang, X. Zhang, W. Chen, R. Qi, Rosa rugosa flavonoids exhibited
PPARα agonist-like effects on genetic severe hypertriglyceridemia of mice,
J. Ethnopharmacol. 240 (2019), 111952.
[46] X.M. Sun, H.Q. Ye, J.B. Liu, L. Wu, D.B. Lin, Y.L. Yu, F. Gao, Assessment of anti-
diabetic activity of peanut shell polyphenol extracts, J. Zhejiang Univ. Sci. B 19
(10) (2018) 764–775.
[47] H. Yaribeygi, M.T. Mohammadi, A. Sahebkar, Crocin potentiates antioxidant
defense system and improves oxidative damage in liver tissue in diabetic rats,
Biomed. Pharmacother. 98 (2018) 333–337.
[48] C. Zhang, J. Li, C. Hu, J. Wang, J. Zhang, Z. Ren, X. Song, L. Jia,
Antihyperglycaemic and organic protective effects on pancreas, liver and kidney by
polysaccharides from Hericium erinaceus SG-02 in streptozotocin-induced diabetic
mice, Sci. Rep. 7 (1) (2017) 1–13.
[49] A.A. Ali, E.A. Essawy, H. Hamed, A.E. Abdel Moneim, F.A. Attaby, The
ameliorative role of Physalis pubescens L. against neurological impairment
associated with streptozotocin induced diabetes in rats, Metab. Brain Dis. 36 (6)
(2021) 1191–1200.
[50] H. El-Beshbishy, S. Bahashwan, Hypoglycemic effect of basil (Ocimum basilicum)
aqueous extract is mediated through inhibition of α-glucosidase and α-amylase
activities: an in vitro study, Toxicol. Ind. Health 28 (1) (2012) 42–50.
[51] Q.K. Alabi, R.O. Akomolafe, J.G. Omole, M.A. Adefisayo, O.L. Ogundipe,
A. Aturamu, J.O. Sanya, Polyphenol-rich extract of Ocimum gratissimum leaves
ameliorates colitis via attenuating colonic mucosa injury and regulating pro-
inflammatory cytokines production and oxidative stress, Biomed. Pharmacother.
103 (2018) 812–822.
[52] A.J.A. Albarakati, R.S. Baty, A.M. Aljoudi, O.A. Habotta, E.K. Elmahallawy, R.
B. Kassab, A.E.A. Moneim, Luteolin protects against lead acetate-induced
nephrotoxicity through antioxidant, anti-inflammatory, anti-apoptotic, and Nrf2/
HO-1 signaling pathways, Mol. Biol. Rep. (2020) 1–13.
[53] R.Y. Ibrahim, S.M. Mansour, W.M. Elkady, Phytochemical profile and protective
effect of Ocimum basilicum aqueous extract in doxorubicin/irradiation-induced
testicular injury, J. Pharm. Pharmacol. 72 (1) (2020) 101–110.
[54] A.M. Ajayi, S. Umukoro, B. Ben-Azu, B. Adzu, O.G. Ademowo, Toxicity and
protective effect of phenolic-enriched ethylacetate fraction of Ocimum
gratissimum (Linn.) leaf against acute inflammation and oxidative stress in rats,
Drug Dev. Res. 78 (3–4) (2017) 135–145.
[55] R.Y.M. Ibrahim, S.M. Mansour, W.M. Elkady, Phytochemical profile and protective
effect of Ocimum basilicum aqueous extract in doxorubicin/irradiation-induced
testicular injury, J. Pharm. Pharmacol. 72 (1) (2020) 101–110.
[56] R.B. Kassab, M.S. Lokman, H.M. Daabo, D.A. Gaber, O.A. Habotta, M.M. Hafez, A.
S. Zhery, A.E.A. Moneim, M.S. Fouda, Ferulic acid influences Nrf2 activation to
restore testicular tissue from cadmium-induced oxidative challenge, inflammation,
and apoptosis in rats, J. Food Biochem. 44 (12) (2020), e13505.
[57] M.U. Rehman, S.M. Rashid, S. Rasool, S. Shakeel, B. Ahmad, S.B. Ahmad,
H. Madkhali, M.A. Ganaie, S. Majid, S.A. Bhat, Zingerone (4-(4-hydroxy-3-
methylphenyl)butan-2-one) ameliorates renal function via controlling oxidative
burst and inflammation in experimental diabetic nephropathy, Arch. Physiol.
Biochem. 125 (3) (2019) 201–209.
[58] Z. Ni, L. Guo, F. Liu, O.J. Olatunji, M. Yin, Allium tuberosum alleviates diabetic
nephropathy by supressing hyperglycemia-induced oxidative stress and
inflammation in high fat diet/streptozotocin treated rats, Biomed. Pharmacother.
Biomed. Pharmacother. 112 (2019), 108678.
[59] L.B. Rodrigues, A. Martins, J. Ribeiro-Filho, F. Cesário, E.C. FF, T.R. de
Albuquerque, M.N.M. Fernandes, B.A.F. da Silva, L.J. Quintans Júnior, A.A.
S. Araújo, P.D.P. Menezes, P.S. Nunes, I.G. Matos, H.D.M. Coutinho, A. Goncalves
Wanderley, I.R.A. de Menezes, Anti-inflammatory activity of the essential oil
obtained from Ocimum basilicum complexed with β-cyclodextrin (β-CD) in mice,
M.S. Othman et al.
Food Chem. Toxicol. Int. J. Publ. Br. Ind. Biol. Res. Assoc. 109 (Pt 2) (2017)
836–846.
[60] C. Selvakkumar, B. Gayathri, K.S. Vinaykumar, B.S. Lakshmi, A. Balakrishnan,
Potential anti-inflammatory properties of crude alcoholic extract of Ocimum
basilicum L. in human peripheral blood mononuclear cells, J. Health Sci. 53 (4)
(2007) 500–505.
[61] L.B. Rodrigues, A. Oliveira Brito Pereira Bezerra Martins, F.R. Cesário, E.C.
F. Ferreira, T.R. de Albuquerque, M.N. Martins Fernandes, B.A. Fernandes da Silva,
L.J. Quintans Júnior, J.G. da Costa, H.D. Melo Coutinho, R. Barbosa, I.R. Alencar,
de Menezes, anti-inflammatory and antiedematogenic activity of the Ocimum
basilicum essential oil and its main compound estragole: In vivo mouse models,
Chem. Biol. Interact. 257 (2016) 14–25.
[62] V. Andrade-Neto, T. Medeiros, Y. Meurer, C. Oliveira, Anti-inflammatory activity
of thymol and estragole, J. Appl. Biopharm. Pharm. 3 (2016).
[63] A.T. Peana, P.S. D’Aquila, F. Panin, G. Serra, P. Pippia, M.D.L. Moretti, Anti-
inflammatory activity of linalool and linalyl acetate constituents of essential oils,
Phytomedicine 9 (8) (2002) 721–726.
[64] M. Lee, H. Zhao, X. Liu, D. Liu, J. Chen, Z. Li, S. Chu, X. Kou, S. Liao, Y. Deng, H. Li,
W. Xie, Protective effect of hydroxysafflor yellow A on nephropathy by attenuating
oxidative stress and inhibiting apoptosis in induced type 2 diabetes in rat, Oxid.
Med. Cell. Longev. 2020 (2020) 7805393.
[65] A.A. Mohamed, S.I. Khater, A. Hamed Arisha, M.M.M. Metwally, G. Mostafa-
Hedeab, E.S. El-Shetry, Chitosan-stabilized selenium nanoparticles alleviate cardio-
13
Biomedicine & Pharmacotherapy 144 (2021) 112287
hepatic damage in type 2 diabetes mellitus model via regulation of caspase, Bax/
Bcl-2, and Fas/FasL-pathway, Gene 768 (2021), 145288.
[66] M.F. El-Khadragy, W.A. Al-Megrin, S. Alomar, A.F. Alkhuriji, D.M. Metwally,
S. Mahgoub, H.K. Amin, O.A. Habotta, A.E.A. Moneim, R.S. Albeltagy, Chlorogenic
acid abates male reproductive dysfunction in arsenic-exposed mice via attenuation
of testicular oxido-inflammatory stress and apoptotic responses, Chem. Biol.
Interact. 333 (2021), 109333.
[67] O.D. AlAmri, R.S. Albeltagy, A.M.A. Akabawy, S. Mahgoub, D.M. Abdel-Mohsen, A.
E. Abdel Moneim, H.K. Amin, Investigation of antioxidant and anti-inflammatory
activities as well as the renal protective potential of green coffee extract in high fat-
diet/streptozotocin-induced diabetes in male albino rats, J. Funct. Foods 71
(2020), 103996.
[68] N.N. Ayuob, M.J. Balgoon, S. Ali, I.S. Alnoury, A.L. HM, A.A. AbdElfattah, Ocimum
basilicum (Basil) modulates apoptosis and neurogenesis in olfactory pulp of mice
exposed to chronic unpredictable mild stress, Front. Psychiatry 11 (2020), 569711.
[69] A.S. Akinrinde, A.A. Oyagbemi, T.O. Omobowale, E.R. Asenuga, T.O. Ajibade,
Alterations in blood pressure, antioxidant status and caspase 8 expression in cobalt
chloride-induced cardio-renal dysfunction are reversed by Ocimum gratissimum
and gallic acid in Wistar rats, J. Trace Elem. Med. Biol. Organ Soc. Miner. Trace
Elem. 36 (2016) 27–37.
[70] Z. Li, Y. Liu, F. Wang, Z. Gao, M.A. Elhefny, O.A. Habotta, A.E.A. Moneim, R.
B. Kassab, Neuroprotective effects of protocatechuic acid on sodium arsenate
induced toxicity in mice: role of oxidative stress, inflammation, and apoptosis,
Chem. Biol. Interact. 337 (2021), 109392.