2015 Molecular Biology of the Cell, 6th Edition Test Bank

2015 Molecular Biology of the Cell, 6th Edition Test

Bank

To download the complete and accurate content document, go to:

https://testbankbell.com/download/2015-molecular-biology-of-the-cell-6th-edition-test-
bank/

Visit TestBankBell.com to get complete for all chapters

MOLECULAR BIOLOGY OF THE CELL, SIXTH EDITION
CHAPTER 6: HOW CELLS READ THE GENOME: FROM
DNA TO PROTEIN
© Garland Science 2015

1. DNA and RNA polymerase differ in all of the following EXCEPT...

A. the nucleotide substrates they incorporate.
B. their requirement for a primer.
C. their error rate.
D. the type of chemical reaction they catalyze.
E. their processivity.

2. What enzyme is depicted in the following schematic drawing?

3'
5'

5'

A. DNA polymerase
B. RNA polymerase
C. Ribosome
D. Reverse transcriptase
E. Topoisomerase

3. The sequence of a region of DNA around the 5′ end of a gene in Escherichia coli is
shown below. The –10 hexamer and the transcription start site are highlighted. What would be
the sequence of the first 10 nucleotides of the mRNA transcribed from this gene? Write down the
sequence from 5′ to 3′, e.g. CGGAUAAACT.

5′…GCGCTTGGTATAATCGCTGGGGGTCAAAGAT…3′
4. Due to their high transcription rate, active ribosomal RNA (rRNA) genes can be easily
distinguished in electron micrographs of chromatin spreads. They have a characteristic
“Christmas tree” appearance, where the DNA template is the “trunk” of the tree and the nascent
RNA transcripts form closely packed “branches.” At the base of each branch is an RNA
polymerase extending that branch, while RNA processing complexes at the tip of the branch
form terminal “ornaments.” The top of the tree represents the ... of the rRNA gene, and the
“ornaments” are at the ... end of the nascent rRNA molecules.
A. end; 3'
B. end; 5'
C. beginning; either 3' or 5'
D. beginning; 3'
E. beginning; 5'

5. Which of the following types of noncoding RNA chiefly functions in the processing and
chemical modification of ribosomal RNAs (rRNAs)?
A. Small nuclear RNAs (snRNAs)
B. Small nucleolar RNAs (snoRNAs)
C. Small interfering RNAs (siRNAs)
D. Transfer RNAs (tRNAs)
E. MicroRNAs (miRNAs)

6. For the bacterial transcription machinery, which of the following mRNA sequences
would you expect to constitute a potent transcriptional termination signal? Note that the two
underlined regions in each sequence are complementary to each other.
A. 5'... UGGCCCAGUCGGAAGACUGGGCCUUUUGUUUU...3'
B. 5'... UGGCCCAGUCGGAAGACUGGGCCCGCGGAGCU...3'
C. 5'... UUUUGUUUUAGGCCCAGUCGGAAGACUGGGCCA...3'
D. 5'... CGCGGAGCUAGGCCCAGUCGGAAGACUGGGCCA...3'

7. The transcript for which of the following noncoding RNA in our cells is expected to
undergo 5' cap addition after transcription?
A. 5S rRNA
B. miR-21 (a microRNA)
C. tRNAPhe
D. 5.8S rRNA
 E. 18S rRNA

8. This large and complex general transcription factor has a DNA helicase activity that
exposes the template for RNA polymerase II transcription. It also has a kinase activity that
phosphorylates the C-terminal domain of the polymerase on Ser5 leading to promoter clearance.
It is...
A. TFIIB
B. TFIID
C. TFIIE
D. TFIIF
E. TFIIH

9. This general transcription factor recognizes the TATA box in RNA polymerase II
promoters. It is...
A. the only single-subunit general transcription factor.
B. able to introduce a rather sharp kink in the double helix upon binding to DNA.
C. responsible for the phosphorylation of the RNA polymerase CTD during transcription
initiation.
D. also responsible for the recognition of the BRE element in the promoter.
E. All of the above.

10. Of the following proteins or protein complexes, which one does NOT typically interact
with an elongating RNA polymerase II?
A. Histone-modifying enzymes
B. Capping enzymes
C. Chromatin remodeling complexes
D. Mediator complex
E. Histone chaperones

11. How does a eukaryotic cell deal with the superhelical tension in its genomic DNA
resulting from the activity of RNA polymerases?
A. DNA gyrase introduces negative supercoils, keeping the DNA under constant tension.
B. The RNA polymerases are allowed to rotate freely around their templates during
transcription, leading to the relaxation of the tension.
C. DNA topoisomerases rapidly remove the superhelical tension caused by transcription.
 D. The nucleosomes adjust the tension by binding to positively supercoiled regions
behind a moving RNA polymerase.
E. All of the above.

12. Comparing mRNA molecules from human and Escherichia coli cells, which of the
following is typically NOT true?
A. A human mRNA has a special 5' cap, while a bacterial mRNA does not.
B. A human mRNA has a poly-A tail, while a bacterial mRNA does not.
C. A human mRNA undergoes alternative splicing, while a bacterial mRNA does not.
D. A human mRNA contains noncoding sequences, while a bacterial mRNA does not.
E. A typical human mRNA encodes one protein, while many bacterial mRNAs encode
several different proteins.

13. Eukaryotic pre-mRNAs undergo a number of modifications such as capping at the 5' end.
A 5' cap...
A. consists of a modified terminal adenine nucleotide.
B. has a 3'-to-5' linkage between the terminal nucleotide and the 5' end of the pre-
mRNA.
C. contains a triphosphate bridge between the terminal base and the 5' end of the pre-
mRNA.
D. carries a negative charge in the terminal base due to methylation.
E. is identical for all mRNAs that are transcribed by RNA polymerase II.

14. After the first and before the second chemical step of RNA splicing, the intron of the pre-
mRNA...
A. is still covalently connected to the 3' exon and has an internal branch in the shape of a
lariat.
B. is still covalently connected to the 3' exon and is linear.
C. is still covalently connected to the 5' exon and has an internal branch in the shape of a
lariat.
D. is still covalently connected to the 5' exon and is linear.
E. is still covalently connected to both of its flanking exons and is linear.

15. In the following qualitative histogram, which two curves better correspond to human
exon and intron length distributions, respectively?
 1

1
3

frequency
Relative
2

0
0 Exon or intron length 500
(nucleotide pairs)

A. Curves 1 and 2
B. Curves 2 and 1
C. Curves 2 and 3
D. Curves 3 and 2
E. Curves 3 and 1

16. To ensure the fidelity of splicing, the spliceosome...

A. hydrolyzes ATP to undergo complex rearrangements.
B. examines the splicing signals on the pre-mRNA several times.
C. assembles on the pre-mRNA co-transcriptionally.
D. takes advantage of “exon definition.”
E. All of the above.

17. A primary mRNA transcript with three exons is depicted below. Which of the following
mature mRNA products of this transcript is a result of exon skipping?

5'

A.
B.
C.
D.
E.
18. The enzyme poly-A polymerase is responsible for adding 3' poly-A tails to eukaryotic
mRNAs. This enzyme...
A. cuts the mRNA after recognition of the cleavage/polyadenylation signal by CstF and
CPSF proteins.
B. polymerizes the tail using an RNA template that is part of the enzyme.
C. is extremely processive.
D. normally adds about 1000 A nucleotides to the mRNA.
E. uses ATP as a substrate.

19. Several mechanisms contribute to the diversity of the mRNAs and proteins encoded by a
single gene in our genome. Which of the following is normally NOT one of them?
A. Alternative choice of polyadenylation sites
B. Alternative choice of translation initiation sites
C. Alternative choice of transcription initiation sites
D. Alternative choice of the reading frames
E. Alternative choice of splice sites

20. Which of the following better describes a typical, actively translated mRNA in its journey
from the nucleus to the cytosol?
A. Initially in a circular conformation, the mRNA linearizes, enters the cytosol (5' end
first), and remains linear.
B. Initially in a circular conformation, the mRNA linearizes, enters the cytosol (3' end
first), and remains linear.
C. Initially linear, the mRNA enters the cytosol (5' end first), and adopts a circular
conformation.
D. Initially linear, the mRNA enters the cytosol (3' end first), and adopts a circular
conformation.
E. Initially linear, the mRNA enters the cytosol (3' end first), and remains linear.

21. As an mRNA molecule is processed in the nucleus, it loses some proteins and binds to
new ones, some of which are used in mRNA surveillance pathways. The presence of which of
the following molecules on an mRNA is a signal that the mRNA is still NOT ready for nuclear
export?
A. Cap-binding complex
B. Exon junction complex
C. snRNPs used in splicing
 D. poly-A-binding proteins
E. SR proteins

22. The nucleolus is a dynamic subcompartment within the nucleus and its size varies
depending on the circumstances. In which of the following cells would you NOT expect to see
the nucleoli?
A. A yeast cell undergoing DNA replication
B. A human neuron in a quiescent (G0) state
C. A human macrophage active in phagocytosis
D. A fruit fly embryonic nucleus in the G2 phase of the cell cycle
E. A mouse embryonic cell in the metaphase stage of mitosis

23. Cajal bodies in the eukaryotic cell nucleus...

A. are stockpiles of fully mature snRNPs and other RNA processing components.
B. can only be observed by electron microscopy.
C. are absolutely required in all cell types.
D. speed up the maturation and assembly of snRNPs and snoRNPs.
E. are the main sites of pre-mRNA splicing.

24. Which of the following processes takes place in the nucleoli within the eukaryotic
nucleus?
A. Ribosome assembly
B. rRNA gene transcription
C. Telomerase assembly
D. tRNA processing
E. All of the above

25. Which of the following is true about the molecule shown in the following drawing?
 A. Its gene is transcribed by RNA polymerase I.
B. There are about 50 genes in our genome encoding this type of molecule.
C. This molecule normally undergoes various covalent modifications.
D. It is normally composed of about 20 monomers.
E. Its gene transcript normally undergoes alternative splicing.

26. How is tRNA splicing different from mRNA splicing in eukaryotic cells?
A. tRNA splicing does not proceed via transesterification reactions.
B. tRNA splicing is carried out by proteins only.
C. tRNA splicing does not create a lariat intermediate.
D. tRNA splicing involves RNA endonuclease and RNA ligase activities.
E. All of the above.

27. The modified nucleotide shown below is normally found in mature...

A. tRNAs.
B. ribosomes.
C. spliceosomes.
D. snoRNAs.
 E. All of the above.

28. Each aminoacyl-tRNA synthetase activates a certain amino acid by attaching it to its
corresponding tRNA(s) through a high-energy linkage...
A. between the amino group of the amino acid and the 3' hydroxyl group of the tRNA.
B. between the amino group of the amino acid and the 5' hydroxyl group of the tRNA.
C. between the carboxyl group of the amino acid and the 3' or 2' hydroxyl group of the
tRNA.
D. between the carboxyl group of the amino acid and the 5' hydroxyl group of the tRNA.
E. between the amino group of the amino acid and the 3' or 2' hydroxyl group of the
tRNA.

29. Activation of an amino acid by an aminoacyl-tRNA synthetase involves the covalent

linkage of...
A. AMP to the amino acid.
B. ADP to the amino acid.
C. AMP to the tRNA.
D. ADP to the tRNA.
E. ADP to the enzyme.

30. On the ribosome, the mRNA is read from ..., and the polypeptide chain is synthesized
from...
A. 5' to 3'; C- to N-terminus.
B. 5' to 3'; N- to C-terminus.
C. 3' to 5'; C- to N-terminus.
D. 3' to 5'; N- to C-terminus.

31. An elongating ribosome is bound to appropriate tRNAs in both the A and the P sites and
is ready for peptidyl transfer. What happens next?
A. The carboxyl end of the polypeptide chain is released from the P-site tRNA and
joined to the free amino group of the amino acid linked to the A-site tRNA.
B. The amino end of the polypeptide chain is released from the P-site tRNA and joined
to the free carboxyl group of the amino acid linked to the A-site tRNA.
C. The carboxyl end of the amino acid is released from the A-site tRNA and joined to
the free amino group of the polypeptide chain linked to the P-site tRNA.
 D. The amino end of the amino acid is released from the A-site tRNA and joined to the
free carboxyl group of the polypeptide chain linked to the P-site tRNA.

32. Which of the following nucleotides is hydrolyzed in both transcription and in translation
elongation?
A. ATP
B. GTP
C. TTP
D. UTP
E. CTP

33. How fast does a bacterial ribosome move on an mRNA?

A. At about 2 nucleotides per second, significantly lower than the speed of the RNA
polymerase.
B. At about 5 nucleotides per second, comparable to the speed of the RNA polymerase.
C. At about 10 nucleotides per second, significantly lower than the speed of the RNA
polymerase.
D. At about 20 nucleotides per second, comparable to the speed of the RNA polymerase.
E. At about 60 nucleotides per second, comparable to the speed of the RNA polymerase.

34. Which of the following features is common between the bacterial and eukaryotic
ribosomes in translation initiation?
A. They both use an initiator tRNA that carries formylmethionine.
B. They both bind to the 5' end of the mRNA and move forward to find the start codon.
C. They both recognize the start codon by interacting with the Shine–Dalgarno
sequence.
D. They both interact with various translation initiation factors.
E. All of the above.

35. The following mRNA sequence is taken from the middle of exon 3 in a mature mRNA
that has 12 exons. Knowing that this mRNA does not undergo nonsense-mediated decay, which
of the reading frames shown is the correct one for this mRNA? Write down 1, 2, or 3 as your
answer.
 5’…AGUGAUUCGAUACAGCUAGCGGACAGCUA…3
1 …’
Reading frames:
2 2…
3
2 3 2…
2
3 32
3 3
36. Polysomes...
A. are large cytoplasmic assemblies made of several ribosomes each translating their
exclusive mRNA.
B. are only found in the eukaryotic cytoplasm.
C. can take advantage of the circularization of eukaryotic mRNA (by interactions
between the 5' and 3' ends of the mRNA) to further speed up the rate of protein
synthesis.
D. are mostly translationally inactive and are normally used by the cell to store the
ribosomes and their associated mRNAs for future use.
E. All of the above.

37. The specific transfer RNA used for the incorporation of selenocysteine in proteins
recognizes the UGA codon, which is normally a translation stop codon. What prevents this tRNA
from reading through all the other “legitimate” UGA stop codons in the cells and causing a
massive, disastrous recoding?
A. The cells that have selenocysteine in their proteins do not normally use the UGA stop
codon and always use the other two stop codons (UAA and UAG) instead.
B. This tRNA is made in such a small amount that its side effects are negligible.
C. This tRNA only interacts with the UGA codon in the P site of the ribosome, and
therefore does not interfere with the normal function of the codon in translation
termination, which takes place in the A site.
D. The mRNAs encoding the selenocysteine-containing proteins also contain additional
sequences required for the recoding event.

38. The structural formulas for a few antibiotics that target the ribosome are shown below.
Which one do you think is that of puromycin? Hint: puromycin mimics the structure of an amino
acid linked to a tRNA molecule.
 B

A
C

Source: Wikipedia.com License: Public domain.

39. In a gene that normally contains three exons, which of the following changes probably
will NOT activate the nonsense-mediated mRNA decay pathway? The sizes of exons 1 to 3 are
100, 150, and 200 nucleotide pairs, respectively.
A. A nonsense mutation in exon 1.
B. A nonsense mutation in exon 2.
C. A mutation in the first intron resulting in the inclusion of a large intronic fragment in
the mature mRNA.
D. A frameshift mutation in exon 1.
E. A mutation in exon 2 leading to its loss through exon skipping.

40. This complex uses ATP and forms an “isolation chamber” for its misfolded protein
substrates, allowing them to fold to their native conformation. It is called...
A. a proteasome.
B. a ribosome.
C. Mediator.
D. a chaperonin.
E. an exosome.

41. What is the function of the 19S cap in the proteasome complex?
A. Recognizing the proteins that will be degraded
 B. Unfolding the proteins that will be degraded and threading them into the central 20S
cylinder for digestion
C. Removing the polyubiquitin chain from the proteins that will be degraded
D. Hydrolyzing ATP to make the digestion process highly efficient
E. All of the above

42. How many ATP molecules must be hydrolyzed by the proteasome for the digestion of a
protein that has been tagged for degradation with a polyubiquitin chain?
A. None; the digestion does not require ATP hydrolysis and is exergonic
B. One
C. Two
D. Ten
E. Many; the number depends on the specific protein

43. In humans, nearly 80% of proteins are acetylated on their N-terminal residue, a
modification known to be recognized by a specific E3 enzyme, which directs the ubiquitylation
of the protein for rapid degradation. Does this mean that all of these proteins are actively
degraded at any given time?
A. Yes; this high turnover rate ensures that their activity is under tight control.
B. Yes; but they are not fully degraded in this way and can still function as protein
fragments.
C. No; the destruction signal can be buried in the interior of the protein or bound to other
proteins.
D. No; the E3 enzyme recognizing this mark is inactive most of the time.

44. In the following representation of a single-stranded RNA molecule, the nucleotide

residues are drawn as gray circles, while base-pairing interactions between them are indicated by
dashed lines. The structure of this RNA molecule has...

5' 3'
 A. one hairpin loop and one pseudoknot.
B. one pseudoknot only.
C. three hairpin loops and a four-stem junction.
D. two hairpin loops and a three-nucleotide bulge.
E. three hairpin loops.

45. In the following diagram showing the overall flow of genetic information in all living
cells, what is the name of the process indicated with a question mark?

46. Sort the following events in the order that they occur during transcription initiation in
Escherichia coli. Your answer would be a four-letter string composed of letters A to D only; e.g.
DCAB.
(A) Abortive initiation trials
(B) σ Factor release from the RNA polymerase holoenzyme
(C) Binding of the holoenzyme to the promoter in the “closed” complex
(D) Formation of the transcription bubble

47. Your friend who is studying the sequence conservation around the branch-point site on a
subset of pre-mRNAs in Macaca mulatto (rhesus macaque) has sent you the following sequence
logo of the region of interest, but has forgotten to indicate the position of the branch-point
nucleotide itself within this region. Where do you think it is? Write down the position number (1
to 8) as your answer.
 2

(bit)
Information
content
0

1 2 3 4 5 6 7 8
Position

48. You have identified an RNA-binding protein that can bind directly (with varying
affinities) to mRNA molecules that bear the following sequences near the 3' splice sites of their
exons. Based on these results, what is the five-nucleotide consensus sequence for the binding site
of this protein? Your answer would be a five-letter string composed of letters A, U, C, or G only;
e.g. UUUAG.

5'...AACGG...3'
5'...AUCGG...3'
5'...GACGC ...3'
5'...AACC C ...3'
5'...AUCGC ...3'
5'...AACAC ...3'
5'...AACC C ...3'

49. In the following schematic drawing, a transcribing RNA polymerase is moving toward
the right on the DNA template as indicated. If the polymerase is allowed to rotate freely while
the DNA is kept from doing so, would the enzyme rotate in a right-handed (R) or left-handed (L)
fashion around the template? Write down R or L as your answer.
 Right-handed rotation of the polymerase

Left-handed rotation of the polymerase

50. Indicate true (T) and false (F) statements below regarding mRNA splicing in human cells.
Your answer would be a four-letter string composed of letters T and F only, e.g. TFFF.
( ) Introns must be removed in the order in which they occur along the pre-mRNA.
( ) Nucleosomes tend to be positioned over exons (on average, about one nucleosome
per exon).
( ) Exon size tends to be much more variable than intron size.
( ) The exon junction complexes mark the sites on the mRNA where splicing has not
been successful.

51. No matter where translation begins, only one polypeptide sequence pattern can be
obtained from the translation of an mRNA chain with the sequence (AC)n; that is, an mRNA
with the sequence 5'...ACACACACAC...3'. In contrast, an mRNA chain with the sequence
(ACG)n can be translated to polypeptide sequences of three distinct patterns, depending on the
choice of the reading frame. Using similar judgment, how many different polypeptide sequence
patterns can be obtained from an mRNA chain with the sequence (ACGU)n? Write down your
answer in digits, e.g. 12.

52. Three consecutive nucleotides in RNA (such as AUC or GUA) constitute a triplet called a
..., which can specify an amino acid or a stop signal for translation.

53. The anticodon sequence of a phenylalanine-specific tRNA is 5'-GAA-3'. Given the

wobble base-pairing rules presented in the following table, how many different codons can be
“read” by this tRNA? Write down your answer in digits, e.g. 12.
Wobble base in the codon Possible anticodon bases
U A, G, or I
C G or I
A U
G C

54. Indicate true (T) and false (F) statements below regarding the accuracy of translation by
the ribosome. Your answer would be a four-letter string composed of letters T and F only, e.g.
TFFF.
( ) The difference in the binding affinity of a codon to a correct versus incorrect
anticodon CANNOT by itself account for the high accuracy of translation.
( ) GTP hydrolysis by EF-Tu both speeds up translation and increases its accuracy.
( ) The ribosome can detect correct Watson–Crick base-pairing between the codon and
anticodon in the A site, and consequently trigger GTP hydrolysis by EF-Tu.
( ) Even after GTP hydrolysis by EF-Tu, the ribosome can prevent wrong amino acid
incorporation by kinetic proofreading.

55. Indicate whether each of the following is located (or takes place) in the large (L) or the
small (S) ribosomal subunit. Your answer would be a four-letter string composed of letters L and
S only, e.g. LLLS.
( ) Peptide bond formation
( ) Codon–anticodon interaction
( ) The path of the mRNA
( ) The polypeptide exit tunnel

56. Indicate true (T) and false (F) statements below regarding the folding of proteins upon
their synthesis. Your answer would be a five-letter string composed of letters T and F only, e.g.
TFFFF.
( ) A globular protein can fold to its native form while still within the ribosome.
( ) A protein can begin to fold and to bind to other proteins while still being synthesized
on the ribosome.
( ) A protein may undergo several cycles of hsp70 binding and release while still being
synthesized on the ribosome.
 ( ) A molten globule can form only after the synthesis of the protein is complete.
( ) A protein typically undergoes hsp60-assisted folding while still being synthesized.

57. Fill in the blank. These RNA molecules can catalyze a wide variety of biochemical
reactions, including peptide bond formation and RNA splicing. They can be found in nature or
selected in vitro for a desired function. Such a molecule is called a(n) ...

58. Indicate true (T) and false (F) statements below regarding the RNA world hypothesis.
Your answer would be a four-letter string composed of letters T and F only, e.g. TFFF.
( ) According to this hypothesis, RNA in primitive cells was responsible for storing
genetic information, while proteins were responsible for the catalysis of chemical
reactions.
( ) The existence of natural ribozymes supports this hypothesis.
( ) In support of this hypothesis, all peptides in present-day cells are made by the
ribosome.
( ) All present-day cells use DNA as their hereditary material.
Answers:
1. Answer: D
Difficulty: 2
Section: From DNA to RNA
Feedback: Despite the lack of homology, the reactions catalyzed by these two
polymerases are analogous, even though the enzymes work on different substrates. DNA
polymerases require a primer and have a much lower error rate compared to RNA
polymerases. They are also not as processive on their own.
2. Answer: B
Difficulty: 2
Section: From DNA to RNA
Feedback: The enzyme synthesizes RNA using one of the DNA strands as template.
3. Answer: GGUCAAAGAU
Difficulty: 3
Section: From DNA to RNA
Feedback: The mRNA sequence starts from the transcription start site and is the same as
the sequence of the coding strand of the DNA (and complementary to the “template
strand”) except that T is replaced with U.
4. Answer: E
Difficulty: 3
Section: From DNA to RNA
Feedback: The shortest rRNA “branches” at the “top” of the tree emanate from the
beginning of the gene since their transcription has just started. All branches extend at
their 3′ end at their base while their 5′ end starts to associate with RNA processing
complexes.
5. Answer: B
Difficulty: 1
Section: From DNA to RNA
Feedback: In the nucleolus, the snoRNAs help process and chemically modify the rRNAs
in various ways.
6. Answer: A
Difficulty: 3
Section: From DNA to RNA
Feedback: Many bacterial transcription terminators consist of a stable hairpin followed
by a string of U nucleotides (that form weak A-U base pairs with the template), which
together help disengage the mRNA transcript from RNA polymerase.
7. Answer: B
Difficulty: 2
Section: From DNA to RNA
 Feedback: MicroRNAs are mainly transcribed by the RNA polymerase II machinery and,
similar to mRNAs, their primary transcripts normally undergo capping and
polyadenylation.
8. Answer: E
Difficulty: 1
Section: From DNA to RNA
Feedback: TFIIH is a large complex with several key functions in transcription initiation.
9. Answer: B
Difficulty: 2
Section: From DNA to RNA
Feedback: It is the multisubunit TFIID, containing a TATA-binding protein, which, upon
binding to the TATA box, creates a sharp kink in the double helix that serves as a
landmark to attract other transcription factors.
10. Answer: D
Difficulty: 2
Section: From DNA to RNA
Feedback: In the initiation phase of transcription, Mediator mediates the interaction of
RNA polymerase with the transcriptional activators and is required for the activation of
transcription by enhancers.
11. Answer: C
Difficulty: 2
Section: From DNA to RNA
Feedback: Unlike bacteria, which maintain a fairly constant level of negative supercoiling
in their circular DNA, eukaryotic topoisomerases rapidly remove the superhelical tension
caused by DNA translocating machines such as the RNA polymerases.
12. Answer: D
Difficulty: 2
Section: From DNA to RNA
Feedback: Noncoding regions are also found in E. coli mRNAs, although these regions
are typically short compared to those in human cells.
13. Answer: C
Difficulty: 1
Section: From DNA to RNA
Feedback: The cap is a 7-methyl G residue linked to the 5' end of the transcript via a 5'-
to-5' triphosphate bridge. Methyl transferase enzymes methylate the terminal guanine
base (giving it a positive charge) and sometimes other nucleotides, creating different 5'
caps.
14. Answer: A
Difficulty: 2
Section: From DNA to RNA
 Feedback: Due to the first transesterification step, the branch point in the intron is
covalently bound to the 5' end of the intron, and the intron is no longer continuous with
the upstream (5') exon.
15. Answer: A
Difficulty: 3
Section: From DNA to RNA
Feedback: Our exons have a narrow distribution of size around the mean value of about
150 nucleotide pairs, whereas introns can vary greatly in size from about 10 to over
100,000 nucleotide pairs.
16. Answer: E
Difficulty: 1
Section: From DNA to RNA
Feedback: The spliceosome uses ATP hydrolysis to produce a series of rearrangements,
allowing the splicing signals to be checked and rechecked to ensure the accuracy of the
process. The fact that splicing is coupled to transcription provides an advantage and helps
the cell keep track of the exons, as does exon definition by SR proteins and other factors
that mark the splice sites around each exon.
17. Answer: B
Difficulty: 2
Section: From DNA to RNA
Feedback: Splicing “mistakes” include exon skipping and intron retention. Additionally,
selection of cryptic splice sites can lead to the partial inclusion of exons or introns.
18. Answer: E
Difficulty: 2
Section: From DNA to RNA
Feedback: After the mRNA is cleaved, this enzyme adds about 200 A nucleotides (from
ATP) one by one without using a template.
19. Answer: D
Difficulty: 2
Section: From DNA to RNA
Feedback: Eukaryotic cells take advantage of various mechanisms such as alternative
splicing and alternative choices of polyadenylation sites, transcription start sites, and
translation start sites to create a highly complex pool of gene products in the cell.
Normally, however, a cellular gene is interpreted in only one of the possible reading
frames.
20. Answer: C
Difficulty: 2
Section: From DNA to RNA
Feedback: Normally, the export of an mRNA to the cytosol occurs with the 5' cap
proceeding first. The mRNA can then circularize through the interaction of the cytosolic
 cap-binding proteins with the cytosolic poly-A-binding proteins to facilitate rapid
translation.
21. Answer: C
Difficulty: 2
Section: From DNA to RNA
Feedback: The snRNPs remain associated with the pre-mRNA until it is fully spliced.
Their presence indicates that the mRNA is still being processed.
22. Answer: E
Difficulty: 2
Section: From DNA to RNA
Feedback: During the M phase, the chromosomes condense and the nucleoli disappear. In
telophase, the chromosomal regions contributing their rRNA genes to the
subcompartment coalesce again and their transcription resumes.
23. Answer: D
Difficulty: 1
Section: From DNA to RNA
Feedback: In Cajal bodies, snRNPs and snoRNPs undergo maturation and assembly at
enhanced rates compared to the rates estimated for cells in which these aggregates are
disrupted. However, this enhancement is not crucial for all cells. Pre-mRNA splicing is
thought to happen in mRNA production “factories” dispersed throughout the nucleus.
24. Answer: E
Difficulty: 1
Section: From DNA to RNA
Feedback: The nucleolus is a factory for the processing of various noncoding RNAs and
their assembly into larger complexes.
25. Answer: C
Difficulty: 2
Section: From RNA to Protein
Feedback: It is a transfer RNA (tRNA) molecule, which is normally composed of nearly
80 nucleotides, is heavily modified, and is transcribed from one of the ~500 tRNA genes
in our genome by RNA polymerase III.
26. Answer: E
Difficulty: 2
Section: From RNA to Protein
Feedback: tRNA splicing appears to be simpler compared to the splicing of pre-mRNAs.
27. Answer: E
Difficulty: 2
Section: From RNA to Protein
Feedback: The modified nucleotide is pseudouridine, one of the most abundant modified
nucleotides in cellular RNA, and it is found in tRNAs, rRNAs, snRNAs, and snoRNAs.
 The “guide” snoRNAs in the nucleolus are themselves involved in the pseudouridylation
of the other RNAs.
28. Answer: C
Difficulty: 2
Section: From RNA to Protein
Feedback: The amino group of the amino acid is free, and will serve as the attacking
group in the formation of the peptide bond on the ribosome. The carboxyl group, on the
other hand, forms a high-energy and susceptible ester bond with the tRNA in preparation
for that same reaction.
29. Answer: A
Difficulty: 1
Section: From RNA to Protein
Feedback: The amino acid is initially activated by an ester linkage, through its carboxyl
group, to an AMP molecule resulting from the hydrolysis of an ATP molecule. The
amino acid is then transferred onto the appropriate tRNA molecule.
30. Answer: B
Difficulty: 2
Section: From RNA to Protein
Feedback: During translation elongation, the ribosome translocates on the mRNA from
the 5′ end to the 3′ end in consecutive sets of three nucleotides. The polypeptide is
concomitantly elongated at its C-terminus by addition of individual amino acids.
31. Answer: A
Difficulty: 2
Section: From RNA to Protein
Feedback: In the fundamental reaction of protein synthesis, a peptide bond is formed
between the carboxyl group at the end of a growing polypeptide chain and a free amino
group on an incoming aminoacyl-tRNA.
32. Answer: B
Difficulty: 1
Section: From RNA to Protein
Feedback: In transcription, GTP is a polymerization substrate along with ATP, UTP, and
CTP. Additionally, GTP is hydrolyzed by several factors involved in translation,
including the eukaryotic elongation factors eEF1 and eEF2.
33. Answer: E
Difficulty: 3
Section: From RNA to Protein
Feedback: The polypeptide chain grows on the ribosome by about 20 amino acids per
second, which is equivalent to an mRNA translocation rate of 60 nucleotides per second.
This is comparable to the rate of transcription by the bacterial RNA polymerase (about 50
nucleotides per second). Indeed, a bacterial ribosome can translate mRNAs co-
 transcriptionally, by closely following an RNA polymerase and translating the same
mRNA molecule that is being produced by the polymerase.
34. Answer: D
Difficulty: 2
Section: From RNA to Protein
Feedback: The initiator tRNA in eukaryotes carries methionine. Unlike the cap-binding
and the 5'-to-3' “scanning” of the mRNA by the eukaryotic translation initiation
machinery, bacterial ribosomes find the start codon by directly interacting with the
ribosome-binding sites in the mRNA. Initiation factors in both systems assist the
ribosomes in initiating with high efficiency and speed.
35. Answer: 1
Difficulty: 3
Section: From DNA to RNA
Feedback: Frames 2 and 3 contain a stop codon (UAG at the sixth codon, UGA at the
first codon, respectively), which is not consistent with the sequence coding for a protein.
36. Answer: C
Difficulty: 2
Section: From RNA to Protein
Feedback: Polysomes form as a result of frequent initiation events leading to several
ribosomes bound to and translating each mRNA simultaneously. If the mRNA is
circularized, the ribosomes that have finished the synthesis of the protein can reinitiate
immediately for another round.
37. Answer: D
Difficulty: 2
Section: From RNA to Protein
Feedback: The presence of the UGA codon is only one of the signals required for the
recoding event. Other sequences (that can form stem-loop structures) in the vicinity of the
UGA codon on the mRNA collaborate with a specific protein factor to incorporate the
amino acid into the growing protein chain only for particular mRNAs and not any mRNA
with a UGA codon.
38. Answer: C
Difficulty: 3
Section: From RNA to Protein
Feedback: Part of the antibiotic puromycin has a striking resemblance to the 3' end of an
aminoacyl-tRNA. As a result, the ribosome mistakes it for an authentic amino acid
substrate and covalently incorporates it into the growing polypeptide chain, thus causing
premature termination.
39. Answer: E
Difficulty: 3
Section: From RNA to Protein
 Feedback: Nonsense mutations in the upstream exons can directly trigger nonsense-
mediated decay (NMD). Frameshift mutations in these exons are likely to introduce
premature termination codons and activate NMD as well. Similarly, retention of intronic
sequences carries a high risk of premature stop codons. In some cases, exon skipping can
lead to NMD if the size of the skipped exon is not a multiple of 3 and therefore its
absence changes the reading frame of the downstream exon.
40. Answer: D
Difficulty: 1
Section: From RNA to Protein
Feedback: The hsp60-like proteins form a large barrel-shaped complex, sometimes called
a chaperonin, that forms an “isolation chamber” for the folding process of a protein after
it has been fully synthesized.
41. Answer: E
Difficulty: 1
Section: From RNA to Protein
Feedback: The 19S cap in the proteasome is a large complex with various functions
including substrate recognition, de-ubiquitylation, unfolding and feeding into the 20S
core, as well as regulatory roles.
42. Answer: E
Difficulty: 1
Section: From RNA to Protein
Feedback: The AAA proteins in the cap hydrolyze tens or hundreds of ATP molecules to
unfold and thread each protein into the central 20S digestive core.
43. Answer: C
Difficulty: 3
Section: From RNA to Protein
Feedback: The modification is not necessarily exposed for the E3 enzymes to recognize.
Exposure of the modification can occur if, for example, the protein becomes misfolded.
44. Answer: D
Difficulty: 3
Section: The RNA World and the Origins of Life
Feedback: The RNA molecule folds into a structure (shown below) with two hairpins;
one with a five-nucleotide loop, and the other with a four-nucleotide loop. The former
hairpin also has a three-nucleotide bulge in its 5' stem. A three-way junction is formed at
the base of the two hairpins.
 5 3
45. Answer: Translation
' '
Difficulty: 1
Section: From DNA to RNA
Feedback: The diagram shows the pathway from DNA to protein.
46. Answer: CDAB
Difficulty: 2
Section: From DNA to RNA
Feedback: In bacterial transcription initiation, binding of the RNA polymerase
holoenzyme to the promoter region in the closed complex is followed by the formation of
the open complex involving the formation of the transcription bubble. After a number of
abortive initiations, RNA polymerase clears the promoter and σ factor is released.
47. Answer: 7
Difficulty: 3
Section: From DNA to RNA
Feedback: The branch-point nucleotide is often an A residue surrounded by other intronic
sequences that are required for splicing.
48. Answer: AACGC
Difficulty: 3
Section: From DNA to RNA
Feedback: The most common nucleotide at each position of the alignment is chosen for
the consensus sequence. Note that none of the examined mRNAs has the consensus
sequence.
49. Answer: R
Difficulty: 3
Section: From DNA to RNA
Feedback: When the polymerase is moving to the right, it induces positive supercoiling
which hinders helix opening. If the enzyme is allowed to rotate freely (which is normally
not the case in vivo), right-handed rotation will eliminate the superhelical tension, as if
the polymerase is twisting to follow along the right-handed double helix.
50. Answer: FTFF
Difficulty: 2
Section: From DNA to RNA
 Feedback: Exon size tends to be much more uniform than intron size and averages at
about 150 nucleotide pairs, close to the length of DNA wrapped by one nucleosome. The
bound nucleosome is suggested to act as a “speed bump” to allow the assembly of
splicing proteins involved in exon definition.
51. Answer: 1
Difficulty: 3
Section: From RNA to Protein
Feedback: Even though the polypeptide sequence pattern for the (ACGU)n RNA polymer
is more complicated than for the other two examples, there is only one such pattern
regardless of the choice of the reading frame: (Thr.Tyr.Val.Arg)n. For the (AC)n RNA,
also only one polypeptide sequence pattern is possible: (Thr.His)n.
52. Answer: codon
Difficulty: 1
Section: From RNA to Protein
Feedback: Three consecutive nucleotides in a protein-coding sequence of mRNA
constitute a codon. Each codon specifies either one amino acid or a stop in the translation
process.
53. Answer: 2
Difficulty: 3
Section: From RNA to Protein
Feedback: The Phe codons UUC and UUU can be recognized by this tRNA, according to
the wobble pairing rules.
54. Answer: TTTT
Difficulty: 2
Section: From RNA to Protein
Feedback: The difference in affinity between correct and incorrect codon–anticodon
matches cannot by itself account for the high accuracy of translation. The ribosome
further assesses the correctness of the match; in the case of a correct match, EF-Tu
hydrolyzes its bound GTP. This contributes to the speed and fidelity of translation. Even
after EF-Tu release, there is a second proofreading opportunity for the ribosome to
prevent an incorrect amino acid from being added to the growing chain.
55. Answer: LSSL
Difficulty: 2
Section: From RNA to Protein
Feedback: The RNA components of the ribosome in the large and small subunit are
responsible for peptide bond formation and the verification of the codon–anticodon
match, respectively. mRNA is threaded through the small subunit, while the nascent
protein emerges from the large subunit.
56. Answer: FTTFF
Difficulty: 2
2015 Molecular Biology of the Cell, 6th Edition Test Bank

Section: From RNA to Protein

Feedback: Proteins can start folding as soon as they emerge from the ribosome (or even
within the exit tunnel of the ribosome, but only for small helical segments) and one
domain can be fully folded and functional before an entire multidomain protein is
completely synthesized. However, folding within the hsp60 chaperonin complex typically
happens only post-translationally.
57. Answer: ribozyme
Difficulty: 1
Section: The RNA World and the Origins of Life
Feedback: Ribozymes are RNAs capable of catalyzing many different biochemical
reactions. The ribosome provides an example in which the rRNA of the large subunit
bears peptidyl transferase activity. Many other functions not found naturally can be
screened for in the laboratory.
58. Answer: FTFT
Difficulty: 2
Section: The RNA World and the Origins of Life
Feedback: The hereditary material in all present-day cells is DNA, but according to the
RNA world hypothesis, RNA preceded DNA (as genetic material) as well as proteins (as
catalysts). Some short peptides are synthesized without the ribosome, an observation that
provides clues as to how the early transition from an RNA world to a protein-dominated
world might have initiated.

Visit TestBankBell.com to get complete for all chapters