See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/363230648

Enzyme‐Responsive Hydrogel for Delivery of the Anti‐Inflammatory Agent

Zingerone

Article in ChemNanoMat · September 2022

DOI: 10.1002/cnma.202200334

CITATIONS READS

3 102

5 authors, including:

Omprakash Sunnapu Rajamohammed Khader

Institute for Stem Cell Science and Regenerative Medicine Institute for Stem Cell Biology and Regenerative Medicine
22 PUBLICATIONS 790 CITATIONS 8 PUBLICATIONS 79 CITATIONS

SEE PROFILE SEE PROFILE

Mukesh Dhanka Praveen Kumar Vemula

Indian Institute of Technology Bombay Institute for Stem Cell Biology and Regenerative Medicine
15 PUBLICATIONS 195 CITATIONS 124 PUBLICATIONS 5,053 CITATIONS

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Localized thermoresponsive injectable polymeric microparticles-hydrogel composite drug delivery system for treatment of rheumatoid arthritis View project

Biosensors for live cell Imaging and biochemical molecules detection View project

All content following this page was uploaded by Omprakash Sunnapu on 10 March 2023.

The user has requested enhancement of the downloaded file.


doi.org/10.1002/cnma.202200334
Enzyme-Responsive Hydrogel for Delivery of the Anti-Inflammatory
Agent Zingerone
Omprakash Sunnapu,[a] Rajamohammed Khader,[b] Mukesh Dhanka,[b]
Praveen Kumar Vemula,*[b] and Sekar Karuppannan*[a]
Abstract: Inflammation highly fluctuates, and the level of
inflammation varies in patients. Therefore, as opposed to
conventional sustained release systems, delivering drugs in
response to the inflammation and inflammation-associated
enzymes may have a beneficial effect in managing inflamma-
tory diseases such as arthritis. Hence, we have developed an
inflammation-associated enzymes-responsive hydrogel sys-
tem. Zingerone is an active component in ginger and is
known to exhibit a beneficial effect. We have studied the
Introduction
Inflammation is an inherent part of most diseases such as
arthritis, inflammatory bowel disease, lupus, and cardiovascular
diseases.[1–3] At present, nonsteroidal anti-inflammatory drugs
(NSAIDs) and corticosteroids are prescribed to curb the
inflammation. However, these drugs cause plethora of side-
effects, including hepatoxicity, cardiotoxicity, peptic ulcers, and
wound impairment.[4–6] Therefore, the quest for developing or
identifying safe anti-inflammatory molecules continues.[6] A
two-pronged approach is required for efficiently managing
inflammatory diseases, i) identifying novel anti-inflammatory
agents, and ii) efficient delivery of anti-inflammatory agents
using advanced biomaterials. Zingerone, which is known as
vanillyl acetone, is one of the active compounds extracted from
the rhizome of Zingiber officinale.[7] The common name of
Zingiber officinale is ginger which is widely used in culinary. Like
the family of phenolic compounds, Zingerone has shown a
wide range of antioxidant, anti-inflammatory, and antibacterial
properties.[8–10] Despite its versatile, beneficial effects, its poor
aqueous solubility and low bioavailability limit its wide use as a
therapeutic agent. Depending on the disease, such as arthritis,
a local drug delivery system must be needed to deliver the
drug. For example, an injectable hydrogel system could be
administered into the arthritis joint, where gel can be stable
and release the anti-inflammatory agent in response to the
inflammation.
[a] O. Sunnapu, Dr. S. Karuppannan
Department of chemistry
Anna University-University College of Engineering
Dindigul-624622 (India)
E-mail: karuppannansekar@gmail.com
[b] R. Khader, Dr. M. Dhanka, Prof. P. Kumar Vemula
Institute for Stem Cell Science and Regenerative Medicine (inStem)
UAS-GKVK Post, Bellary Road,
Bangalore 560065 (India)
E-mail: praveenv@instem.res.in
ChemNanoMat 2022, 8, e202200334 (1 of 6)
2199692x, 2022, 11, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/cnma.202200334 by National Center For Biological, Wiley Online Library on [01/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Research Article
www.chemnanomat.org
zingerone anti-inflammatory properties using macrophages,
and zingerone-encapsulated self-assembled hydrogels have
been prepared and characterized in detail. Additionally, we
have demonstrated that inflammation-associated enzymes
such as lipase could trigger the release of zingerone in a
responsive manner, in vitro. In vivo efficacy of zingerone-
encapsulated hydrogel will be evaluated in preclinical models
in the future.
Existing injectable biomaterials, including microparticles,
nanoparticles, and hydrogels, are widely used for the sustained
delivery of therapeutic agents.[11–14] Injectable hydrogels are
among most widely used biomaterials due to their several
attractive properties such as non-toxic in nature, biodegrad-
ability, biocompatibility, minimal invasiveness, and easy in-
preparation.[11,15] Several synthetic and natural polymers-based
injectable hydrogels have been developed for localized ther-
apeutics delivery, including alginate, hyaluronic acid, chitosan,
collagen, methylcellulose, poloxamer, poly (N-isopropylacryla-
mide), and polyethylene glycol.[16–18] These localized injectable
polymeric hydrogel systems have been used for preclinical
applications, but their clinical translation has been significantly
slow.[18] As an alternative to polymeric hydrogels, hydrogels
generated through the self-assembly of low-molecular-weight
amphiphiles, known as self-assembled hydrogels, have gained
interest.[19,20] Additionally, multienzyme mimics and nanozymes
were developed for bioapplications.[21,22]
Previously, we have developed a robust amphiphile,
triglycerol monostearate (TGMS), which can self-assemble to
form hydrogel efficiently.[23,24] TGMS consists of polyhydroxy
hydrophilic headgroup and polymethylene hydrocarbon tail;
hence, upon self-assembly it could form robust gels. However,
as self-assembly is a highly sensitive process, the presence of
other molecules could significantly disrupt the process. There-
fore, herein we have optimized gelation conditions to encapsu-
late zingerone in high doses, studied the gelation kinetics, and
characterized the physicochemical properties of hydrogels.
Additionally, inflammation-associated enzymes-responsive zin-
gerone release has been demonstrated, in vitro. Finally, we have
demonstrated that zingerone retains its anti-inflammatory
activity post-release from the hydrogel.
© 2022 Wiley-VCH GmbH

Results and Discussion
Self-assembly of TGMS to prepare zingerone-encapsulated
hydrogels
An amphiphilic TGMS that contains stearic acid and triglycerol
is efficient in undergoing self-assembly in aqueous media to
generate higher-order self-assembled structures to form hydro-
gels and can encapsulate drugs (Figure 1A).[20,23] We have
optimized conditions to encapsulate various amounts of
zingerone. In TGMS hydrogels, 0, 5, 10, and 20 mg/mL
concentration of zingerone has been encapsulated. The gelati-
on behavior has been tested by the ‘inverted vial’ method
(Figure 1B). Upon the formation of the gel, when inverted the
vial, the gel does not flow down, whereas in cases of no
gelation or partial gelation, viscous solid flows down through
vial walls. Interestingly, although high concentration of zinger-
one did not disrupt the gelation behavior of TGMS and formed
hydrogels (Figure 1B), it delayed the self-assembly process. The
presence of zingerone has increased the time to form a gel by
30, 35, and 70% for 5, 10, and 20 mg/ml of zingerone
concentration, respectively (Figure 1C). This result suggests that
a higher concentration of zingerone might interfere with the
self-assembly of TGMS.
After forming stable TGMS hydrogels with and without
zingerone, upon heating to 70 °C, hydrogels turned into the
solution phase. However, upon cooling them to room temper-
ature, all samples formed hydrogels. Hence, zingerone encapsu-
lated TGMS hydrogels have shown thermo-reversible gelation.
Furthermore, we have tested the injectability nature of hydro-
gels by extruding the 1 ml of self-assembled gel through 18, 24,
and 26-Gauge needles. Irrespective of needle gauge, these gels
were smoothly flown through without clogging the needle, and
Figure 1. (A) Schematic presentation of self-assembly of TGMS, and
encapsulation of zingerone drug, its release in response to inflammation-
associated enzymes. (B) Photographs of TGMS hydrogels without or with
zingerone (5, 10, and 20 mg/ml). (C) Time to form hydrogels as function of
zingerone concentration in TGMS hydrogels. Data is represented as
Mean � SD.
ChemNanoMat 2022, 8, e202200334 (2 of 6)
2199692x, 2022, 11, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/cnma.202200334 by National Center For Biological, Wiley Online Library on [01/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Research Article
post-injection, they retain their gel nature. These results suggest
that, in the future, zingerone encapsulated TGMS hydrogels
could be easily injected into the animals to evaluate their
efficacy.
TGMS comprises a polyhydroxyl head group, which can
form an extended hydrogen-bonding network, enabling to
form self-assembled TGMS nanostructures in water. Addition-
ally, a polymethylene hydrophobic hydrocarbon chain enables
to form hydrophobic domains in the self-assembled hydrogel.
These hydrophobic domains are critical for efficient encapsula-
tion of hydrophobic molecules such as zingerone via van der
Waals forces.
Rheology of zingerone encapsulated TGMS hydrogels
In rheology studies, amplitude sweep measurements and shear-
thinning behaviour of the hydrogels were studied in the
absence and presence of encapsulated zingerone. The zinger-
one concentration in TGMS hydrogels was 0, 5, 10, and 20 mg/
ml. In rheology studies, all four hydrogels have shown higher
storage modulus (G’) than loss modulus (G’’), which is typical
visco-elastic solid behaviour of gels (G’ > G’’). Upon applying to
shear stress, after crossover point, G’ values were less than G’’,
which is a typical viscus liquids-like property (G’ < G’’) (Fig-
ure 2A–D). The G’ values for 0, 5, 10, and 20 mg/ml zingerone
encapsulated TGMS hydrogels were 876, 595, 1300, and 803 Pa,
respectively (Figure 2A–D). G’ values did not show any particular
trend while encapsulating variable amounts of zingerone into
the hydrogels.
Additionally, we plotted shear strain at the crossover point
for these four hydrogels. Higher the shear strain value at the
crossover point means the gel is more stable and needs more
strain to deform. For example, shear strain values at the
crossover point for 0, 5, and 10 mg/ml zingerone encapsulated
TGMS hydrogels were the same (γ = 0.025%). However, the
shear strain value at the crossover point for TGMS hydrogel
Figure 2. Amplitude sweep measurements of TGMS hydrogels encapsulated
with (A) 0 mg/ml, (B) 5 mg/ml, (C) 10 mg/ml, and (D) 20 mg/ml zingerone.
The crossover points for these gels were highlighted with gray box.
© 2022 Wiley-VCH GmbH

encapsulating 20 mg/ml zingerone was γ = 0.01% (Figure 3).
This data suggests that up to 10 mg/ml of zingerone encapsu-
lation did not impact the hydrogel strength. However, at higher
concentrations (20 mg/ml), the presence of zingerone slightly
destabilizes the hydrogel, which has weakened the hydrophobi-
cally associated structure of the hydrogel.
To investigate the influence of mechanical forces on the
zingerone encapsulated TGMS hydrogels, we subjected TGMS
hydrogels to a frequency sweep study and measured their
rheological properties using a parallel-plate equipped rheom-
eter (Figure 4A–D). The storage modulus, G’ was independent
of frequency and was higher than the loss modulus, G“ over the
frequency range (0–100 rad/s) examined (Figure 4A–D). This is a
typical response of hydrogels,[24,25] as it suggests that these
hydrogels do not change their properties or ‘‘relax’’ over long
time scales.
Morphology of zingerone encapsulated TGMS hydrogels
The morphology of xerogels of 0, 5, 10, and 20 mg/ml
zingerone encapsulated TGMS hydrogels was examined using
scanning electron microscopy (SEM). The representative images
Figure 3. Shear strain (%) values at crossover point where gel phase
transitioned into viscous liquid phase. Data is represented as Mean � SD.
Figure 4. Storage modulus, G’, and viscous modulus, G’’, over a frequency
range 0–100 rad/s for TGMS hydrogels encapsulated with (A) 0 mg/ml, (B)
5 mg/ml, (C) 10 mg/ml, and (D) 20 mg/ml of zingerone.
ChemNanoMat 2022, 8, e202200334 (3 of 6)
2199692x, 2022, 11, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/cnma.202200334 by National Center For Biological, Wiley Online Library on [01/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Research Article
were given in Figure 5A–D. In the absence of zingerone, TGMS
hydrogels have shown more porous structures, whereas zinger-
one encapsulation has slightly changed the morphology of the
hydrogel into flakes/sheet-like structures. In the field, it is
known that encapsulated molecule does influence the morphol-
ogy of the host gel, which is consistent with the TGMS hydrogel
system.
Enzyme-responsive zingerone release from TGMS hydrogels,
in vitro
The occurrence of inflammation in various autoimmune- or
inflammatory diseases highly fluctuates. Due to the lack of non-
invasive diagnostic methods to identify and measure the
inflammation, it is challenging to deliver anti-inflammatory
drugs when needed. Therefore, an autonomous drug delivery
system that releases the drug in response to inflammation is
ideal. Inflammation causes the production of proteolytic
enzymes such as matrix metalloproteases (MMPs) and lipases.
Since TGMS has an ester bond, it can be cleaved by lipases
(Figure 1A) which results in lipase-mediated degradation of
TGMS hydrogel to release the encapsulated anti-inflammatory
agent, zingerone. Therefore, to test the ability of zingerone
encapsulated TGMS hydrogel to disassemble in the presence of
lipase and release the drug, the hydrogels were placed in a
dialysis bag and incubated in phosphate buffer solution (PBS) at
37 °C with or without lipase enzyme. At various time points, the
amount of zingerone has released from these hydrogels been
quantified using high-performance liquid chromatography
(HPLC). In addition, the drug release was monitored for 21 days,
in vitro. The cumulative release of zingerone is shown in
Figure 6A–C.
Data in Figure 6A–C suggest that in the absence of lipase
enzyme, TGMS hydrogels show a moderate 5–25% of burst
release of zingerone at initial time points, then subsequently
get stabilized and do not release zingerone non-specific
Figure 5. Scanning electron micrographs of TGMS hydrogels encapsulated
with (A) 0 mg/ml, (B) 5 mg/ml, (C) 10 mg/ml, and (D) 20 mg/ml of zingerone.
© 2022 Wiley-VCH GmbH

Figure 6. Sustained release and enzyme-responsive release of zingerone
from TGMS hydrogels encapsulated with (A) 5 mg/ml, (B) 10 mg/ml, and (C)
20 mg/ml of zingerone. Data is represented as Mean � SD. For each panel,
first 2 days release was plotted separately (right side panels).
manner till 21 days. On the contrary, the lipase enzyme could
disassemble the TGMS hydrogel and release zingerone in higher
quantities in an enzyme-responsive manner. Interestingly, the
amount of zingerone encapsulated into the gel significantly
influenced the initial non-specific release. TGMS hydrogel that
contains 5 mg/ml has shown < 10% of zingerone release in a
non-specific manner, whereas 10 and 20 mg/ml of encapsulated
TGMS hydrogel has released ~ 25% of zingerone. It could be
possible that when a lower amount of zingerone is present, it
does not disrupt the self-assembly of TGMS significantly, hence
efficient encapsulation of zingerone in the nanostructures of
TGMS. When zingerone concentration is high, the overall
encapsulation of zingerone could be less. Hence, more burst
release was observed. These results suggest that 5 mg/ml
encapsulated TGMS could be an ideal hydrogel for future in vivo
experiments. Additionally, these results suggest that TGMS
hydrogels could release zingerone in response to the inflamma-
tion-associated hydrolytic enzyme.
Anti-inflammatory activity of zingerone
Since the macrophages play a critical role in colonic inflamma-
tion in inflammatory bowel diseases and joint inflammation in
inflammatory arthritis,[26,27] we determined the zingerone anti-
inflammatory activity using murine macrophage cell line RAW
ChemNanoMat 2022, 8, e202200334 (4 of 6)
2199692x, 2022, 11, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/cnma.202200334 by National Center For Biological, Wiley Online Library on [01/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Research Article
264.7, in vitro. Macrophages were activated by treatment with
lipopolysaccharide (LPS), which is known to activate toll-like
receptors (TLRs),[28] to mimic the inflammation. LPS-induced
production of pro-inflammatory cytokines such as tumor
necrosis factor-alpha (TNF-α) and interferon-gamma (IFN-γ)
from macrophages were quantified by their mRNA levels using
reverse transcription quantitative polymerase chain reaction
(RT-qPCR). Data in Figure 7A&B suggest that upon treatment
with zingerone significantly decreased LPS induced TNF-α and
IFN-γ in macrophages at micromolar concentrations. A dose-
dependent reduction of cytokines has been observed, suggest-
ing the effect of zingerone. Zingerone exhibits its anti-
inflammatory property through suppressing the activity of both
NK-kB and PPAR.[23] Additionally, it is known to downregulate
NF-kB activity and IL1β signalling pathway.[29]
Additionally, we tested the anti-inflammatory efficacy of
zingerone that was released from TGMS hydrogel in response
to the lipase enzyme (Figure 7C). To test this phenomenon,
5 mg/ml zingerone encapsulated TGMS hydrogel was incubated
with lipase enzyme. After 24 hours, the supernatant was
collected, and measured the zingerone. Released zingerone
(100 μM) was added to LPS activated macrophages, and
production of TNF-α and IFN-γ cytokines were measured. Data
in Figure 7D&E suggest that zingerone that was encapsulated
and released from TGMS hydrogels in response to lipase
enzyme retained its activity and reduced the production of
TNF-α and IFN-γ cytokines. Therefore, it is anticipated that
under in vivo inflammatory conditions, zingerone could be
Figure 7. Relative gene expression of pro-inflammatory cytokine genes (A)
TNF-α, and (B) IFN-γ with and without treatment with zingerone. (C)
Schematic of Zingerone encapsulation in TGMS hydrogels, and lipase
mediated drug release. Relative gene expression of pro-inflammatory
cytokine genes (D) TNF-α, and (E) IFN-γ that were treated with zingerone
released from TGMS hydrogel. Data is represented as Mean � SD. * and **
indicate p values < 0.02 and < 0.005, respectively. ns = not significant.
© 2022 Wiley-VCH GmbH

Table 1. Sequences of forward and reverse primers that were used in RT-PCR studies.
Gene Forward Primer
mGAPDH TGACCACAGTCCATGCCATC
mTNF-α TCCCCAAAGGGATGAGAAGT
mIFN-U FGCACTGGGTGGAATGAGACT
released from TGMS hydrogels and exhibit its anti-inflammatory
property.
Conclusion
In conclusion, we have developed an anti-inflammatory agent,
zingerone, encapsulated self-assembled TGMS hydrogels that
are robust, mechanically stable, and injectable for potential
in vivo applications. We have systematically optimized condi-
tions to encapsulate appropriate doses of zingerone in TGMS
hydrogels to minimize the non-specific release. We have
demonstrated that zingerone encapsulated TGMS hydrogels
can release zingerone in response to inflammation-associated
proteolytic enzymes, and released zingerone retains its anti-
inflammatory properties. Self-assembled TGMS hydrogel plat-
form for the delivery of anti-inflammatory agent zingerone. In
future studies, we will investigate the efficacy of zingerone
encapsulated TGMS hydrogels in a preclinical inflammatory
arthritis model, in vivo.
Experimental Section
Materials and Methods: Triglycerol monostearate (TGMS, MF:
C27H45O8, MW: 506.73 g/mol) was procured from AK Scientific (USA).
Zingerone (MF: C11H14O3, MW: 194.22 g/mol) was purchased from
Sigma Aldrich, India. All other chemicals were purchased from
Sigma Aldrich, they were analytical grade, and used without further
purification.
Preparation of zingerone encapsulated TGMS hydrogels: TGMS
(10% W/V) and different concentrations of zingerone (0 or 5 or 10
or 20 mg/ml) were weighed and taken in a 20 ml clean glass vial.
Subsequently, 0.2 ml of DMSO was added to solubilize the mixture.
Subsequently, 0.8 ml of double distilled water was added and
heated to ~ 70 °C using a hot air blower while constant shaking.
Upon gradual cooling of vial to room temperature, hydrogels were
formed. Upon inversion of the vial, gel did not flow down.
Rheology studies: Rheology was carried out using MCR92, Anton
Paar Rheometer. Amplitude sweep measurements were carried out
to confirm gelation in the presence and absence of zingerone. The
shear strain (γ) percentage was varied from 0.0001 to 1% and the
angular frequency(ω) was kept constant at 10 rad/s. Parallel plate
geometry was used with a gap of 5 mm. Frequency sweep
measurements were carried at constant shear strain (γ) was 0.001%
with varied angular frequency from 0.1 to 100 rad/s.
Scanning electron microscopy: The morphology of the hydrogels
was investigated by FESEM (Carl Zeiss MERLIN VP compact).
Hydrogel samples were freeze-dried, and were mounted on carbon
tape and sputter-coated with gold (Pelco® SC-7 Auto sputter
coater). The gold-coated hydrogel samples were imaged at a
voltage of 2 kV.
ChemNanoMat 2022, 8, e202200334 (5 of 6)
2199692x, 2022, 11, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/cnma.202200334 by National Center For Biological, Wiley Online Library on [01/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Research Article
Reverse Primer
GACGGACACATTGGGGGTAG
GGCTACAGGCTTGTCACTGC
AGTGGAGAGAGCAGTTGAGGACA
Zingerone release studies from hydrogel, in vitro: Release kinetics
studies were performed as described earlier.[18] Briefly, for zingerone
release studies, 5, 10, or 20 mg of zingeron was encapsulated in
1 mL of 10% (w/v) hydrogel system and allowed to stand for at
least 24 h before the start of the experiment. 0.4 ml of the gel was
then placed in a dialysis bag of 12 kDa molecular weight cut-off
(Thermo Scientific). The dialysis bag was then tied and suspended
in a 20 ml PBS reservoir with 150 rpm shaking at 37 °C. During each
time point, the complete reservoir was replaced by a fresh PBS
reservoir. 20 mL of each time point was lyophilized and dissolved in
2 ml methanol and run for HPLC for the detection of zingerone. The
method used acetonitrile as the mobile phase with a flow rate of
0.9 ml/min on a C18 reverse-phase HPLC column (4.6 ID × 250 mm
length, Phenomenex).
Cell culture: A murine macrophage RAW 264.7 cells were cultured
in DMEM supplemented with 10% Fetal bovine serum (SIGMA,
Cat.no F2442-100 ML) and 1% antibiotics in a humidified incubator
at 37 °C with 5% CO2. The culture medium was refreshed twice in a
day.
Cytokine assays: RAW 264.7 cells were seeded in 48 well (0.03X106)
plates and pretreated with Zingerone compound in a different
concentration (25, 50, 100,150 and 200 μM) for 2hr prior to adding
100ng LPS (SIGMA, Cat.no L4130-500MG) for 15–18 hrs. Then the
cells were collected using the TRIzol (Thermo Fisher Scientific, Cat
no15596026) reagent to check the levels of TNF-α and IFN-U pro-
inflammatory cytokines.
Reverse transcription quantitative polymerase chain reaction (RT-
qPCR): The total RNA of RAW 264.7 cells samples were extracted
using chloroform and isopropyl alcohol method. Then with this
RNA, DNA’s treatment was done according to the manufacturer
protocol (Thermoscientific, Cat.no EN0521). The RNA quality was
determined by measuring the 260/280 ratio. Samples measuring
> 2 .0 were considered to be of sufficient quality for further
analysis. A total of ~ 1.5 μg total RNA was reverse transcribed to
cDNA synthesis kit (TaKaRa, Cat.no RR037 A). Samples stored at
20 °C until the RT PCR analysis. RT PCR analysis were carried out
by using a RT-PCR thermocycler (QuantStudio 6 Flex, applied
biosystems) using TB Green premix Ex Taq TM II (TaKaRa, Cat.no
RR820 A). The primer sequences are presented in Table 1 below.
Quantification cycle (Cq) values were recorded and the relative
expression level of target genes was calculated using the 2ΔΔCT
method.[30]
Statistical analysis: Data are expressed as mean � SD unless
mentioned. In experiments comparing more than two experimental
groups, statistical differences between groups were determined by
using ordinary one-way ANOVA with Tukey’s post hoc test was
used. The probability value (P) < 0.05 was considered as a statisti-
cally significant difference. Statistical analysis and graphing were
performed with GraphPad PRISM 9.
Acknowledgements
O.S. thanks the Indian Council of Medical Research (ICMR),
Government of India for Senior Research Fellowship. The
© 2022 Wiley-VCH GmbH
 2199692x, 2022, 11, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/cnma.202200334 by National Center For Biological, Wiley Online Library on [01/03/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Research Article
authors acknowledge the Department of Biotechnology (DBT), [11] M. Dhanka, C. Shetty, R. Srivastava, Mater. Sci. Eng. C 2017, 81, 542–550.
[12] F. Rizzo, N. S. Kehr, Adv. Funct. Mater. 2021, 10, 2001341.
India for providing the financial support for the study. We thank
[13] R. Kumar, N. S. Kehr, Nanomaterials 2022, 12, 1304.
Central Imaging & Flow Cytometry facility (CIFF) at inStem and [14] N. M. Jalili, M. K. Jaiswal, C. W. Peak, L. M. Cross, A. K. Gaharwar,
NCBS. Nanoscale 2017, 9, 15379–15389.
[15] M. Dhanka, V. Pawar, D. S. Chauhan, N. K. Jain, R. S. Prabhuraj, C. Shetty,
M. K. Kumawat, R. Prasad, R. Srivastava, Colloids Surf. B 2021, 201,
111597.
Conflict of Interest [16] J. H. Lee, Biomater. Res. 2018, 22, 27.
[17] E. Bellotti, A. L. Schilling, S. R. Little, P. Decuzzi, J. Controlled Release
2021, 329, 16–35.
The authors declare no conflict of interest. [18] A. S. Carlini, R. Gaetani, R. L. Braden, C. Luo, K. L. Christman, N. C.
Gianneschi, Nat. Commun. 2019 10, 1735.
[19] A. Dhayani, P. Srinath, S. E. Prasad, A. Naaz, M. Dhanka, S. Kalita, P. K.
Vemula, Molecular Architectonics and Nanoarchitectonics. Nanostructure
Data Availability Statement Science and Technology, Springer, Singapore 2022, 209–232.
[20] P. K. Vemula, G. A. Cruikshank, J. M. Karp, G. John, Biomaterials 2009, 30,
383–393.
The data that support the findings of this study are available on
[21] Y. Ai, J. You, J. Gao, J. Wang, H.-B. Sun, M. Ding, Q. Liang, Nano Res.
request from the corresponding author. The data are not 2021, 14, 2644–2653.
publicly available due to privacy or ethical restrictions. [22] Y. Ai, Z.-N. Hu, X. Liang, H.-B. Sun, H. Xin, Q. Liang, Adv. Funct. Mater.
2022, 32, 2110432.
[23] T. Gajanayake, R. Olariu, F. M. Leclere, A. Dhayani, Z. Yang, P. K. Vemula,
Keywords: drug delivery · hydrogel · inflammation-responsive · R. Rieben, E. Vogelin, Sci. Transl. Med. 2014, 6, 249ra110.
[24] N. Joshi, J. Yan, S. Levy, S. Bhagchandani, K. V. Slaughter, N. E. Sherman,
self-assembly · zingerone J. Amirault, Y. Wang, L. Riegel, X. He, T. S. Rui, M. Valic, P. K. Vemula,
O. R. Miranda, O. Levy, E. M. Gravallese, A. O. Aliprantis, J. Ermann, J. M.
Karp, Nat. Commun. 2018, 9, 1275.
[1] C. H. Liu, N. D. Abrams, D. M. Carrick, P. Chander, J. Dwyer, M. R. J. [25] A. Dawn, H. Kumari, Chem. Eur. J. 2018, 24, 762–776.
Hamlet, F. Macchiarini, M. PrabhuDas, G. L. Shen, P. Tandon, M. M. [26] P. D. Smith, L. E. Smythies, R. Shen, T. Greenwell-Wild, M. Gliozzi, S. M.
Vedamony, Nat. Immun. 2017, 18, 1175–1180. Wahl, Mucosal Immunol. 2011, 4, 31–42.
[2] D. Furman, J. Campisi, E. Verdin, P. Carrera-Bastos, S. Targ, C. Franceschi, [27] C. C. Bain, A. M. Mowat, Immunol. Rev. 2014, 260, 102–117.
L. Ferrucci, D. W. Gilroy, A. Fasano, G. W. Miller, A. H. Miller, A. [28] S. W. Chung, M. K. Kim, J. H. Chung, D. H. Kim, J. S. Choi, S. Anton, A. Y.
Mantovani, C. M. Weyand, N. Barzilai, J. J. Goronzy, T. A. Rando, R. B. Seo, K.-Y. Park, T. Yokozawa, S. H. Rhee, B. P. Yu, H. Y. Chung, J. Med.
Effros, A. Lucia, N. Kleinstreuer, G. M. Slavich, Nat. Med. 2019, 25, 1822– Food. 2009, 12, 354–350.
1832. [29] C.-Y. Hsiang, H.-Y. Lo, H.-C. Huang, C.-C. Li, S.-L. Wu, T.-Y. Ho, Food Chem.
[3] P. Hunter, EMBO Rep. 2012, 13, 968–970. 2013, 136, 170–177.
[4] S. Harirforoosh, W. Asghar, F. Jamali, J. Pharm. Pharm. Sci. 2013, 16, 821– [30] Z. Wang, Y. Guan, R. Yang, J. Li, J. Wang, A.-Q. Jia, BMC Complement
847. Med. Ther. 2020, 20, 329.
[5] C. T. Deshmukh, Ind. Dermatol. Venereol. Leprol. 2007, 73, 218–221.
[6] J. C. Maroon, J. W. Bost, A. Maroon, Surg. Neurol. Int. 2010, 13, 80.
[7] J. M. Pais, B. Pereira, F. A. Almeida Paz, S. M. Cardoso, S. S. Braga, Biomol.
Eng. 2020, 10, 344.
[8] K. Sharma, P. Nirbhavane, S. Chhibber, K. Harjai, J. Bioact. Compat.
Polym. 2020, 35, 538–553.
[9] S. Mehrzadi, H. Khalili, I. Fatemi, A. Malayeri, A. Siahpoosh, M. Goudarzi, Manuscript received: July 22, 2022
Inflammation 2020, 44, 186–193. Revised manuscript received: September 1, 2022
[10] C.-Y. Hsiang, H.-Y. Lo, H.-C. Huang, C.-C. Li, S.-L. Wu, T.-Y. Ho, Food Chem. Accepted manuscript online: September 2, 2022
2013, 136, 170–177. Version of record online: September 19, 2022

ChemNanoMat 2022, 8, e202200334 (6 of 6) © 2022 Wiley-VCH GmbH

View publication stats