J Antimicrob Chemother 2010; 65: 853 – 858

doi:10.1093/jac/dkq067 Advance publication 7 March 2010

Impact of the RNA chaperone Hfq on multidrug resistance

in Escherichia coli

Downloaded from https://academic.oup.com/jac/article/65/5/853/824878 by Indian Institute of Technology Kanpur user on 30 October 2023
Junko Yamada 1 – 3†, Seiji Yamasaki 1 – 3†, Hidetada Hirakawa 1 – 3, Mitsuko Hayashi-Nishino 2, Akihito Yamaguchi 2,3
and Kunihiko Nishino 1,3,4*

1
Laboratory of Microbiology and Infectious Diseases, Institute of Scientific and Industrial Research, Osaka University, 8-1 Mihogaoka,
Ibaraki, Osaka 567-0047, Japan; 2Department of Cell Membrane Biology, Institute of Scientific and Industrial Research, Osaka University,
8-1 Mihogaoka, Ibaraki, Osaka 567-0047, Japan; 3Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka,
Suita 565-0871, Japan; 4PRESTO, Japan Science and Technology Agency, 5-3 Yonbancho, Chiyodaku, Tokyo 102-8666, Japan

*Corresponding author. Laboratory of Microbiology and Infectious Diseases, Institute of Scientific and Industrial Research, Osaka University,
8-1 Mihogaoka, Ibaraki, Osaka 567-0047, Japan. Tel: +81-6-6879-8546; Fax: +81-6-6879-8549; E-mail: nishino@sanken.osaka-u.ac.jp
†The first two authors contributed equally to this study.

Received 3 November 2009; returned 3 January 2010; revised 15 February 2010; accepted 15 February 2010

Objectives: Hfq is a bacterial RNA chaperone involved in the post-transcriptional regulation of many stress-
inducible genes via small non-coding RNAs. Although Hfq is related to important phenotypes including virulence
in many bacterial pathogens, its role in drug resistance is unknown. The aim of this study was to investigate the
role of Hfq in bacterial multidrug resistance.
Methods: The hfq gene was inactivated in Escherichia coli by use of pKO3, which is a gene replacement vector.
The drug susceptibility and drug accumulation of the hfq mutant were determined. The level of production of
the AcrB multidrug efflux pump in this mutant was also measured.
Results: The hfq mutant was susceptible to acriflavine, benzalkonium, cefamandole, chloramphenicol, Crystal
Violet, nalidixic acid, novobiocin, oxacillin and rhodamine 6G. E. coli cells were strongly stained with rhodamine
6G compared with the wild-type on deletion of hfq, indicating that Hfq affects the accumulation of the drug in
bacterial cells. The deletion of the drug efflux gene acrB impairs the effect of hfq deletion on E. coli suscepti-
bility. Furthermore, the level of AcrB protein production was reduced in the hfq mutant, whereas hfq deletion
did not affect the promoter activity of the acrAB operon.
Conclusions: These results indicate that Hfq regulates the drug efflux system at the post-transcriptional level
and reveals the previously uncharacterized role of Hfq in bacterial multidrug resistance.

Keywords: AcrB, drug efflux, small RNA

Introduction The AcrAB efflux system, present in most Enterobacteriaceae,

Multidrug efflux pumps cause serious problems in cancer che-
motherapy and the treatment of bacterial infections. Bacterial
drug resistance is often associated with multidrug efflux
pumps, which can decrease drug accumulation within the cell.1
Bacterial multidrug efflux pumps are classified into five families
on the basis of sequence similarity as: major facilitator;
resistance –nodulation –cell division (RND); small multidrug
resistance; multidrug and toxic compound extrusion; and ATP-
binding cassette.2 Of these, the RND family of efflux pumps
plays major roles in both intrinsic and elevated resistance of
Gram-negative bacteria to a wide range of compounds.1 RND
efflux pumps require two other proteins to function, namely a
membrane fusion protein and an outer membrane protein.
belongs to the RND family of efflux pumps and utilizes the
outer membrane protein TolC.1 There are many putative and
proven drug efflux pumps in the Escherichia coli genome.3
Since many such efflux pumps have overlapping substrate
spectra, it is intriguing that bacteria, with their economically
organized genomes, harbour such large sets of multidrug
efflux genes.
The key to understanding how bacteria utilize these multiple
efflux pumps lies in the regulation of pump expression. The cur-
rently available data show that multidrug efflux pumps are often
expressed under precise and elaborate transcriptional control.2
Expression of acrAB, which encodes the major AcrAB efflux
pump, is subject to multiple levels of regulation. It is modulated
locally by the repressors AcrR and AcrS4,5 and on a wider level by

# The Author 2010. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.
For Permissions, please e-mail: journals.permissions@oxfordjournals.org

853
Yamada et al.

stress conditions and global regulators such as MarA, SoxS and
Rob.2 These examples illustrate the complexity and diversity of
the mechanisms regulating bacterial multidrug efflux pumps.
Hfq is a well-conserved RNA-binding protein that was
originally identified in E. coli as a host factor required for the
replication of Qb bacteriophage.6 It functions in a hexameric
MC4100.13 Bacterial strains were grown at 378C in Luria– Bertani (LB)
broth.14
Construction of gene deletion mutants
To construct the hfq and acrAB deletion mutant from E. coli W3104 and

ring-shaped structure as an RNA chaperone7 by mediating the
binding of small RNAs (sRNAs) preferentially to single-stranded
AU-rich regions of mRNA targets.8 sRNAs often bind to the
5′ -untranslated leader region of cognate messengers to modu-
late their stability and/or translation.9,10 Since many transcrip-
tional regulators are subject to post-transcriptional regulation
mediated by sRNAs in conjunction with Hfq, an hfq mutant
shows pleiotropic phenotypes.11 In recent years, Hfq has been
established as an important virulence factor in bacterial patho-
gens.12 Although there is much evidence that Hfq is related
to bacterial virulence, the role of Hfq in bacterial multidrug
resistance is yet to be defined. Here, we demonstrate that Hfq
affects drug susceptibilities and accumulation in E. coli. In
addition, we show that the AcrAB drug efflux system contributes
to the Hfq-mediated drug resistance and that Hfq regulates the
production of AcrB at the post-transcriptional level. Our data
suggest that Hfq plays an important role in controlling the AcrB
level and thereby mediates drug resistance in E. coli.
Materials and methods
Bacterial strains, plasmids and growth conditions
Bacterial strains and plasmids used in this study are listed in Table 1.
E. coli strains were derived from the wild-type strains W31043 and
Downloaded from https://academic.oup.com/jac/article/65/5/853/824878 by Indian Institute of Technology Kanpur user on 30 October 2023
MC4100 cells, the precise in-frame deletions were generated by crossover
PCR. The following oligonucleotide primers were used: hfq-No (CGCGG
ATCCTAAAACTTTAACGGAACTGAC); hfq-Ni (CACGCAATAACCTTCACACTCCAA
ATTTATAACCATTCTCTCTTTTCCTTATATGCTTAT); hfq-Co (CGCGTCGACTGGGTC
CAGCCACGCACCAGG); hfq-Ci (GTTATAAATTTGGAGTGTGAAGGTTATTGCGTGT
AAGGTTTCGGGCTGTTTTTTTACACG); acrA-No (CGCGGATCCATTCGCATTTGTG
GAATATAATCTCCATCA); acrA-Ni (CACGCAATAACCTTCACACTCCAAATTTATA
ACCATATGTAAACCTCGAGTGTCCG), acrB-Co (CGCGGATCCATGGAAAAAAC
TTACTGACCTGGAC); and acrB-Ci (GTTATAAATTTGGAGTGTGAAGGTTATTGC
GTGTGATACAACGTGTAATCACTAAGGCC). The fragment containing the del-
etion was then cloned into the BamHI– SalI (for hfq deletion) or BamHI
sites (for acrAB deletion) (underlined in the primer sequences above) of
the pKO3 vector,15 which is a gene replacement vector that contains a
temperature-sensitive origin of replication and markers for positive and
negative selection for chromosomal integration and excision. The del-
etion was introduced into the chromosome by use of the pKO3 gene
replacement protocol, as described previously.15 The plasmid obtained
was electroporated into W3104 and MC4100. Cells were then recovered
in 1 mL of SOC (2% Bacto tryptone, 0.5% yeast extract, 10 mM NaCl,
2.5 mM KCl, 10 mM MgCl2, 20 mM glucose) for 1 h at 308C. Cells were
plated on chloramphenicol (20 mg/L) -containing LB agar plates and
incubated at 438C overnight. From these plates, five colonies were
picked up and inoculated into 1 mL of LB. Cells were then plated at
308C on 5% (w/v) sucrose plates. The outgrowing bacteria were plated
on LB plates with or without chloramphenicol at 308C. Chloramphenicol-
susceptible mutants were selected. Chromosomal insertions and del-
etions were confirmed by PCR.

Table 1. E. coli strains and plasmids used in this study

Strain or plasmid Characteristics Source or reference

Strains
W3104 Nishino and Yamaguchi3
MC4100 Casadaban13
NKE461 W3104Dhfq this study
NKE19 W3104DacrAB this study
NKE451 W3104DacrABDhfq this study
NKE610 MC4100Dhfq this study
NKE596 MC4100DacrAB this study
NKE602 MC4100DacrABDhfq this study
NKE621 MC4100/pNN387acrAB this study
NKE641 MC4100/pNN387tolC this study
NKE736 MC4100Dhfq/pNN387acrAB this study
NKE1282 MC4100Dhfq/pNN387tolC this study

Plasmids
pKO3 repA(Ts) Cmr sacB + Link et al. 15
pNN387 Cmr; single-copy vector containing promoterless lacZY Miller19
pNN387acrAB pNN387 (acrAB promoter–lacZ) this study
pNN387tolC pNN387 (tolC promoter–lacZ) this study
pACYC177 vector; Apr, Kmr MBI Fermentas
phfq 0.5 kb HincII– PstI fragment containing hfq gene cloned into pACYC177, Kmr this study
pHSG398 vector; derivative of pUC18 containing Cmr in place of Apr Takara Bio Inc.
pacrAB 5.1 kb BamHI– SphI fragment containing acrAB genes cloned into pHSG398, CPr this study

854
Role of Hfq in drug resistance
Plasmid construction
The hfq gene was amplified from W3104 genomic DNA using primers
CGCGTTAACATGTGTACAATTGAGACGTAT and CGCCTGCAGGCGTATAACCCTC
TAAATAGA, which introduced HincII and PstI sites (underlined in the
primer sequences above). The PCR fragment contained a region from
85 bp upstream to 75 bp downstream of the hfq gene. The fragment
was cleaved with HincII and PstI, and then cloned into the corresponding
sites of pACYC177, resulting in phfq (Table 1). To produce pacrAB, the
acrAB genes were amplified by using primers CGCGGATCCATGTTCGT
GAATTTACAGGCG and CGCGCATGCAACGCGTCCCCTTCTTAGC, which intro-
duced BamHI and SphI sites (underlined in the primer sequences
above). This fragment contained a region from 140 bp upstream of
acrA to 545 bp downstream of acrB. The fragment was cleaved with
BamHI and SphI, and then cloned into the corresponding sites of
pHSG398, resulting in pacrAB (Table 1).
Determination of MICs of toxic compounds
The antibacterial activities of various agents were determined on LB agar
(1% tryptone, 0.5% yeast extract, 0.5% NaCl) plates containing chloram-
phenicol, novobiocin, acriflavine, Crystal Violet, rhodamine 6G, benzalko-
nium, oxacillin, cefamandole or nalidixic acid (Sigma, St Louis, MO, USA)
at various concentrations. Agar plates were made by the 2-fold agar
dilution technique, as described previously.16 – 18 To determine the MICs,
bacteria were grown in LB broth at 378C overnight, diluted into the
same medium and then tested at a final inoculum size of 105 cfu/mL
using a multipoint inoculator (Sakuma Seisakusyo, Tokyo, Japan) after
incubation at 378C for 20 h. The MIC was the lowest concentration of
compound that inhibited cell growth.
Observation of drug accumulation in E. coli cells
E. coli cells were spotted onto LB agar plates containing rhodamine 6G
(0.5 or 1 mg/L) at a final inoculum size of 105 cfu/spot, using a multipoint
inoculator (Sakuma Seisakusyo), and were incubated at 378C for 20 h.
Drug accumulation in E. coli cells was observed as the staining of cells
with rhodamine 6G by using a scanner (K100D super; Pentax, Tokyo,
Japan).
Reporter gene assay
To investigate the transcription of acrAB and tolC, the promoter regions of
these genes were cloned in front of the lacZ reporter gene in a single-copy
pNN387 vector.19 The resulting plasmids were transformed into the
MC4100 strain for b-galactosidase activity measurements. Then, transfor-
mants were grown at 378C in LB broth containing 15 mg/L chloramphenicol
until the optical density at 600 nm reached 0.6. b-Galactosidase
activity in cell lysates was assayed using o-nitrophenyl-b-D-galacto-
pyranoside as a substrate, as described by Miller,20 with a slight
modification.
Detection of AcrB
AcrB production was determined as follows. E. coli cells were grown in LB
broth until the optical density at 600 nm reached 0.6. The cells were har-
vested, washed twice with 50 mM potassium phosphate buffer (pH 7.0)
and then disrupted by sonication with a Branson Sonifier 250D
(Branson Ultrasonics Corp., CT, USA) for 1.5 min. After undisrupted cells
were removed by low-speed centrifugation (10 000 g, 10 min), the mem-
brane fraction was collected by ultracentrifugation (200000 g, 30 min).
The membrane fraction was then resuspended in 50 mM potassium
phosphate buffer (pH 7.0). Cell membrane fractions were standardized
to 15 mg of protein and were then separated by SDS–PAGE on an 8%
JAC
polyacrylamide gel, followed by electroblotting onto a polyvinylidene
difluoride membrane. The AcrB protein was detected with polyclonal
anti-AcrB antibodies,4 alkaline phosphatase-conjugated goat anti-rabbit
immunoglobulin G (Bio-Rad Laboratories, CA, USA) and the CDP-Star
reagent (GE Healthcare, Tokyo, Japan), as described previously.4 Pro-
duction of AcrB was scanned using LAS-3000 (Fujifilm, Tokyo, Japan)
and quantified by Science Lab 2001 Image Gauge Ver. 4.0 software (Fuji-
Downloaded from https://academic.oup.com/jac/article/65/5/853/824878 by Indian Institute of Technology Kanpur user on 30 October 2023
film, Tokyo, Japan).
Results
Effect of Hfq on drug susceptibilities of E. coli
To investigate the role of Hfq in drug susceptibilities, the hfq gene
was deleted from E. coli strains W3104 and MC4100, as described
in the Materials and methods section. In both backgrounds, hfq
mutants were susceptible to chloramphenicol (4-fold), novobiocin
(4-fold), acriflavine (8-fold), Crystal Violet (4-fold), rhodamine 6G
(.4-fold), benzalkonium (8-fold), oxacillin (4-fold), cefamandole
(4-fold) and nalidixic acid (4-fold), compared with the
parental strains (Table 2). In both W3104 and MC4100, Dhfq
strains complemented with phfq behaved like the wild-type.
These data indicate that Hfq affects the intrinsic multidrug resist-
ance of E. coli.
Hfq affects drug accumulation in E. coli
One of the major mechanisms of bacterial multidrug resistance is
active drug efflux. Enhanced drug efflux activity reduces intra-
cellular drug accumulation.21 Therefore, we investigated the
effect of Hfq on drug accumulation in E. coli cells. E. coli W3104,
W3104Dhfq and W3104DacrAB cells were spotted onto agar
plates containing 0.5 or 1 mg/L of rhodamine 6G and the plates
were then incubated at 378C for 20 h. Rhodamine 6G did not
inhibit cell growth at these concentrations (Figure 1); however, a
difference in the colour of cells was observed between these
strains. The W3104Dhfq and W3104DacrAB strains appeared red
on plates containing rhodamine 6G, whereas the W3104 strain
was white. This result indicates greater drug accumulation in the
W3104Dhfq and W3104DacrAB strains, suggesting decreased
drug efflux activities in these strains compared with the wild-type
strain (Figure 1). An identical difference in rhodamine 6G accumu-
lation between MC4100 and MC4100Dhfq was also observed (data
not shown).
AcrAB drug efflux system contributes to Hfq-mediated
drug susceptibility
The results described above indicate that the drug efflux activity
of E. coli may be impaired by hfq deletion. In a previous study, we
revealed that at least 20 intrinsic drug efflux systems are
encoded in the E. coli chromosome.3 Among these, the AcrAB
efflux system plays major roles in both intrinsic and elevated
resistance of E. coli to a wide range of noxious compounds.1 In
order to determine whether the AcrAB multidrug efflux system
contributes to the Hfq-regulated drug resistance level of E. coli,
we investigated the effect of hfq deletion on the drug suscepti-
bilities of the acrAB deletion mutant (Table 2). The hfq deletion
did not affect the drug susceptibilities of W3104DacrAB or
MC4100DacrAB against chloramphenicol, acriflavine, Crystal
Violet, rhodamine 6G, benzalkonium, oxacillin, cefamandole or
855
Yamada et al.

Table 2. Susceptibility of E. coli strains to toxic compounds

MIC (mg/L)

Strain CHL NOV ACR CV R6G BENZ OXA FAM NAL

Downloaded from https://academic.oup.com/jac/article/65/5/853/824878 by Indian Institute of Technology Kanpur user on 30 October 2023
W3104 4 128 256 32 .512 64 256 0.5 4
W3104Dhfq 1 32 32 8 128 8 64 0.13 1
W3104Dhfq/pACYC177 1 32 32 8 128 8 ND ND 1
W3104Dhfq/phfq 4 128 256 32 .512 64 ND ND 4
W3104DacrAB 0.5 2 8 1 2 4 1 0.063 1
W3104DacrAB/pHSG398 ND 2 8 1 2 4 1 0.063 1
W3104DacrAB/pacrAB ND 128 256 32 .512 64 256 0.5 4
W3104DacrABDhfq 0.5 1 8 1 2 4 1 0.063 1
W3104DacrABDhfq/pHSG398 +pACYC177 ND 1 8 1 2 4 ND ND 1
W3104DacrABDhfq/pacrAB+phfq ND 128 256 32 .512 64 ND ND 4
MC4100 4 128 256 64 .512 64 256 0.5 4
MC4100Dhfq 1 32 32 8 128 8 64 0.13 1
MC4100Dhfq/pACYC177 1 32 32 8 128 8 ND ND 1
MC4100Dhfq/phfq 4 128 256 64 .512 64 ND ND 4
MC4100DacrAB 0.5 2 8 1 2 4 1 0.063 1
MC4100DacrAB/pHSG398 ND 2 8 1 2 4 1 0.063 1
MC4100DacrAB/pacrAB ND 128 256 64 .512 64 256 0.5 4
MC4100DacrABDhfq 0.5 1 8 1 2 4 1 0.063 1
MC4100DacrABDhfq/pHSG398+pACYC177 ND 1 8 1 2 4 ND ND 1
MC4100DacrABDhfq/pacrAB+phfq ND 128 256 64 .512 64 ND ND 4

CHL, chloramphenicol; NOV, novobiocin; ACR, acriflavine; CV, Crystal Violet; R6G, rhodamine 6G; BENZ, benzalkonium; OXA, oxacillin; FAM, cefamandole;
NAL, nalidixic acid.
Values in bold are smaller than those of the corresponding parental strains.
MIC determinations were repeated at least three times.
ND, not determined, because vectors have a chloramphenicol or ampicillin resistance cassette.

W3104 W3104 Promoter activities of drug efflux systems

W3104
(Wild-type) Dhfq DacrAB The results above suggest the possibility that the AcrAB efflux
system is regulated by Hfq. To determine whether Hfq affects
AcrAB expression at the transcriptional level, the promoter
No drug region of the acrAB operon was cloned in front of the lacZ repor-
ter gene in a single-copy pNN387 vector, and the promoter
Rhodamine 6G activity was determined as b-galactosidase activity. The promo-
0.5 mg/L ter activity of the tolC outer membrane channel was also
measured. As shown in Figure 2, there are no significant
Rhodamine 6G
changes in the promoter activities of acrAB and tolC in
1 mg/L MC4100Dhfq compared with those in MC4100. Thus, Hfq does
not affect acrAB and tolC transcription.
Figure 1. Hfq affects drug accumulation in E. coli. Strains W3104
(wild-type), NKE461 (W3104Dhfq) and NKE19 (W3104DacrAB) were Hfq regulates the production level of the AcrB drug
spotted onto LB agar plates containing 0.5 or 1 mg/L rhodamine 6G.
efflux system
After incubation at 378C for 20 h, E. coli colonies were observed under
visible white light. To test whether Hfq affects AcrB production, we examined the
production level of the AcrB protein in MC4100 and
MC4100Dhfq using western blot analysis. As shown in
nalidixic acid, whereas it results in increased drug susceptibilities Figure 3(a), the production level of AcrB in MC4100Dhfq was
in W3104 and MC4100 (Table 2). When the DacrABDhfq strains lower than that in MC4100. Quantification with Image Gauge
were transformed with pacrAB and phfq, the transformants software (Fujifilm, Tokyo, Japan) identified that the production
behaved like the wild-type (Table 2). These results indicate that of AcrB in the hfq mutant is 53% compared with that in the
the AcrAB efflux system contributes to the Hfq-controlled drug MC4100 strain (Figure 3b). These data indicate that Hfq affects
resistance in E. coli. AcrB expression at the post-transcriptional level.

856
Role of Hfq in drug resistance JAC
MC4100 generating drug resistance and has wide substrate specificity,
40 and the expression of acrAB is subjected to multiple levels of
MC4100Dhfq
regulation. It is regulated by AcrR, MarA, SoxS and Rob.2 Recently,
b-galactosidase activity

we found that acrAB is also regulated by AcrS, which was

30 believed to control the expression of acrEF.4 Furthermore, it
(Miller Units)

was demonstrated that acrAB is positively regulated by SdiA, a

Downloaded from https://academic.oup.com/jac/article/65/5/853/824878 by Indian Institute of Technology Kanpur user on 30 October 2023
protein that regulates cell division genes in a manner dependent
20
upon quorum sensing.22
In this study, we found that Hfq acts as a regulator of drug
10 resistance in E. coli. Hfq positively regulates the production of
the AcrB drug efflux protein; thus, deletion of the hfq gene
resulted in the decreased production of AcrB, and the hfq
0 mutant became more susceptible to multiple drugs compared
acrAB tolC
with the wild-type strain. Hfq affects the protein level of AcrB;
Promoter however, it does not change the promoter activity of the acrAB
operon, indicating that Hfq controls AcrB at the post-
Figure 2. Effect of Hfq on the promoter activity of the AcrAB–TolC drug transcriptional level. The bacterial Sm-like protein Hfq facilitates
efflux system. The effect of hfq deletion on the promoter activities of RNA–RNA interaction involved in post-transcriptional regulation
the acrAB operon and the tolC gene was determined using strains of the stress response. Specifically, Hfq helps pair non-coding
NKE621, NKE736, NKE641 and NKE1282 as described in the Materials RNAs (ncRNAs) with complementary regions of target mRNAs.
and methods section. The data correspond to mean values of three
E. coli Hfq mutants show disrupted signalling in stress response
independent experiments. Error bars correspond to the standard
pathways23 arising from the need for Hfq to mediate base
deviations.
pairing between regulatory ncRNAs and their mRNA targets.
Examples of these partnerships include DsrA –rpoS,23 OxyS –
(a) (b)
fhlA,24 OxyS –rpoS,25 RprA –rpoS,26 RyhB –sodB 27 and Spot42–
galETKM.28
q
hf

We considered the possibility that overproduction of Hfq from

0D

0 100
10 the expression vector may enhance the drug resistance level of
10

C4
C4

M E. coli; however, this was not observed (data not shown). This
M

production level (%)

80 is probably because the Hfq protein is constitutively expressed

Relative AcrB

(55 000 molecules/cell)29 and it is sufficient to maintain the

60 intrinsic drug resistance of E. coli cells. In addition to the roles
of Hfq in bacterial virulence, we found a previously uncharacter-
AcrB 40 ized role for Hfq in multidrug resistance based on regulating the
AcrB drug efflux system. However, the results still leave open the
20 possibility that Hfq may also influence multidrug resistance by
regulation of other systems in addition to AcrAB, such as other
0 efflux systems and/or outer membrane channels, because Hfq
0
q

10 has been shown to affect membrane composition, particularly

hf

C4
0D

M the outer membrane proteins.30 Further investigation of the

10
C4

regulation of the multidrug efflux system in several natural

M

environments is required to elucidate the biological significance

Figure 3. Hfq affects the production level of the AcrB multidrug efflux
protein. (a) Cell membrane fractions were prepared from the strains
MC4100 and NKE610 (MC4100Dhfq) then standardized to 15 mg of
protein. The production of AcrB was detected by western blotting using
polyclonal anti-AcrB antibodies, as described in the Materials and
methods section. (b) The relative amount of AcrB production was
calculated by western blotting analysis using Science Lab 2001 Image
Gauge Ver. 4.0 software. The data correspond to mean values of three
independent experiments. Error bars correspond to the standard
deviations.
Discussion
To survive in natural environments it is important for bacteria to
coordinate gene expression in response to environmental stimuli.
Consequently, several genes are often controlled by complex
regulatory networks that integrate environmental signals. As
described above, the AcrAB–TolC efflux system is effective in
of its regulatory networks. Such an investigation may provide
further insights into the role of multidrug efflux systems in the
physiology of the cell.
Funding
This research was supported by aid from: the Takeda Science Foundation;
the Naito Foundation; the Kanae Foundation for the Promotion of Medical
Science; the Waksman Foundation of Japan Inc.; the Life Science Foun-
dation of Japan; the Program for Promotion of Fundamental Studies in
Health Sciences of the National Institute of Biomedical Innovation; a
Grant-in-Aid for Scientific Research on Priority Areas, Matrix of Infection
Phenomena, from the Ministry of Education, Culture, Sports, Science
and Technology of Japan; a Grant-in-Aid for Young Scientists (S) from
the Japan Society for the Promotion of Science; and PRESTO, Japan
Science and Technology Agency, Japan.

857
Yamada et al.
Transparency declarations
None to declare.
References
1 Nikaido H. Multidrug efflux pumps of Gram-negative bacteria.
J Bacteriol 1996; 178: 5853– 9.
2 Nishino K, Nikaido E, Yamaguchi A. Regulation and physiological
function of multidrug efflux pumps in Escherichia coli and Salmonella.
Biochim Biophys Acta 2009; 1794: 834–43.
3 Nishino K, Yamaguchi A. Analysis of a complete library of putative drug
transporter genes in Escherichia coli. J Bacteriol 2001; 183: 5803 –12.
4 Hirakawa H, Takumi-Kobayashi A, Theisen U et al. AcrS/EnvR represses
expression of the acrAB multidrug efflux genes in Escherichia coli.
J Bacteriol 2008; 190: 6276– 9.
5 Ma D, Alberti M, Lynch C et al. The local repressor AcrR plays a
modulating role in the regulation of acrAB genes of Escherichia coli by
global stress signals. Mol Microbiol 1996; 19: 101– 12.
6 Franze de Fernandez MT, Eoyang L, August JT. Factor fraction required
for the synthesis of bacteriophage Qbeta-RNA. Nature 1968; 219:
588–90.
7 Moller T, Franch T, Hojrup P et al. Hfq: a bacterial Sm-like protein that
mediates RNA– RNA interaction. Mol Cell 2002; 9: 23–30.
8 Zhang A, Wassarman KM, Ortega J et al. The Sm-like Hfq protein
increases OxyS RNA interaction with target mRNAs. Mol Cell 2002; 9:
11– 22.
9 Valentin-Hansen P, Eriksen M, Udesen C. The bacterial Sm-like protein
Hfq: a key player in RNA transactions. Mol Microbiol 2004; 51: 1525– 33.
10 Waters LS, Storz G. Regulatory RNAs in bacteria. Cell 2009; 136:
615–28.
11 Tsui HC, Leung HC, Winkler ME. Characterization of broadly pleiotropic
phenotypes caused by an hfq insertion mutation in Escherichia coli K-12.
Mol Microbiol 1994; 13: 35– 49.
12 Hansen AM, Kaper JB. Hfq affects the expression of the LEE
pathogenicity island in enterohaemorrhagic Escherichia coli. Mol
Microbiol 2009; 73: 446– 65.
13 Casadaban MJ. Transposition and fusion of the lac genes to selected
promoters in Escherichia coli using bacteriophage lambda and Mu. J Mol
Biol 1976; 104: 541–55.
14 Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory
Manual. 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory
Press, 1989.
858
15 Link AJ, Phillips D, Church GM. Methods for generating precise
deletions and insertions in the genome of wild-type Escherichia coli:
application to open reading frame characterization. J Bacteriol 1997;
179: 6228– 37.
16 Nishino K, Nikaido E, Yamaguchi A. Regulation of multidrug efflux
systems involved in multidrug and metal resistance of Salmonella
Downloaded from https://academic.oup.com/jac/article/65/5/853/824878 by Indian Institute of Technology Kanpur user on 30 October 2023
enterica serovar Typhimurium. J Bacteriol 2007; 189: 9066 –75.
17 Nishino K, Senda Y, Yamaguchi A. CRP regulator modulates multidrug
resistance of Escherichia coli by repressing the mdtEF multidrug efflux
genes. J Antibiot 2008; 61: 120–7.
18 Nishino K, Senda Y, Hayashi-Nishino M et al. Role of the AraC-XylS
family regulator YdeO in multi-drug resistance of Escherichia coli.
J Antibiot 2009; 62: 251– 7.
19 Elledge SJ, Davis RW. Position and density effects on repression by
stationary and mobile DNA-binding proteins. Genes Dev 1989; 3: 185–97.
20 Miller JH. Experiments in Molecular Genetics. Cold Spring Harbor, NY:
Cold Spring Harbor Laboratory Press, 1972.
21 Nishino K, Yamaguchi A. Role of histone-like protein H-NS in multidrug
resistance of Escherichia coli. J Bacteriol 2004; 186: 1423– 9.
22 Rahmati S, Yang S, Davidson AL et al. Control of the AcrAB multidrug
efflux pump by quorum-sensing regulator SdiA. Mol Microbiol 2002; 43:
677–85.
23 Sledjeski DD, Whitman C, Zhang A. Hfq is necessary for regulation by
the untranslated RNA DsrA. J Bacteriol 2001; 183: 1997 –2005.
24 Altuvia S, Zhang A, Argaman L et al. The Escherichia coli OxyS
regulatory RNA represses fhlA translation by blocking ribosome binding.
EMBO J 1998; 17: 6069– 75.
25 Zhang A, Altuvia S, Tiwari A et al. The OxyS regulatory RNA represses
rpoS translation and binds the Hfq (HF-I) protein. EMBO J 1998; 17:
6061– 8.
26 Majdalani N, Chen S, Murrow J et al. Regulation of RpoS by a novel
small RNA: the characterization of RprA. Mol Microbiol 2001; 39:
1382– 94.
27 Masse E, Gottesman S. A small RNA regulates the expression of genes
involved in iron metabolism in Escherichia coli. Proc Natl Acad Sci USA
2002; 99: 4620– 5.
28 Moller T, Franch T, Udesen C et al. Spot 42 RNA mediates
discoordinate expression of the E. coli galactose operon. Genes Dev
2002; 16: 1696– 706.
29 Ali Azam T, Iwata A, Nishimura A et al. Growth phase-dependent
variation in protein composition of the Escherichia coli nucleoid.
J Bacteriol 1999; 181: 6361– 70.
30 Valentin-Hansen P, Johansen J, Rasmussen AA. Small RNAs
controlling outer membrane porins. Curr Opin Microbiol 2007; 10: 152– 5.