Professional Documents
Culture Documents
RESEARCH PROPOSAL
ON
BY
i
Contents Page
Title Page i
Content Page ii
Signature Page iii
Introduction 1
Statement of the Problem 4
Justification of the Study 5
Purpose of the Study 6
Research questions 7
Research hypothesis 7
Contributions and Significance of the Study 8
Proposed Methodology 9
Ethical Consideration 20
Statistical Analysis 21
References 22
Respondent’s Informed Consent Form 25
Study questionnaire 27
ii
Investigators
iii
iv
Introduction
Covid-19 refers to the novel coronavirus disease of 2019 that is caused by Severe Acute Respiratory
Syndrome Coronavirus 2 (SARS-CoV-2). This virus achieved a pandemic spread in the global
community since its first report in the Hubei province, Wuhan, China, in December 2019. The Covid-19
disease affected all age groups but with severe manifestations in the elderly and those with comorbid
conditions. The direct effects of Covid-19 are less of a concern in children, who seem to be largely
asymptomatic or to develop mild illness.
In spite of this, there is evidence that more than 16,000 deaths worldwide occurred among children and
adolescents under 20 years (UNICEF September 2022). Although, this is significantly low when
compared to the mortality in the adult population and may be attributed to the less severe disease
observed among children. Despite the severity of covid-19 disease among the pediatric population,
epidemiological data suggest that the risk of hospitalization or admission to the intensive care unit is
underemphasized (Esposito, Marchetti et al. 2021). The post-covid-19 sequelae reported among children
and adolescents consist of pulmonary fibrosis, myocardial dysfunction, mental health conditions, and
post-viral chronic fatigue syndrome as in myalgic encephalomyelitis (Zimmermann, Pittet et al. 2022).
More recently, there is a focus on multisystem inflammatory syndrome and the development of long
covid in the pediatric population that is yet to be fully understood.
The transition of covid-19 from a virus of pandemic concern to an endemic infection necessitates that we
understand this virus amongst other respiratory viral infections of concern among the pediatric population
since there is usually no clear line of distinction in the symptoms presented by these viral illnesses. Viral
infections like Influenza, Parainfluenza, Rhinovirus, Bocavirus, Adenovirus, Respiratory Syncytial Virus
(RSV), and Human Metapneumovirus are prominent in being associated with clinical manifestations
similar to covid-19 (Burkhardt, Winter et al. 2022).
The understanding of covid-19 in a context different from the prevailing interventions where lockdown
measures and non-pharmaceutical interventions resulted in a reduction in respiratory illness and
hospitalizations is a necessity. Nachega, Sam-Agudu et al. (2022) who assessed the clinical outcome of
covid-19 in children and adolescents in sub-Saharan Africa had a retrospective perspective which
suggests that the conditions of the pandemic might have influenced the observation of increased risk
among children younger than 1 year and with noncommunicable underlying comorbidities. The scenario
may be different as covid-19 gains more endemic prominence because of previous exposure to covid-19
among a pediatric population that are unvaccinated.
In many high-income countries, covid-19 vaccines are being approved for emergency use administration
to children who are older than 6 months. It will be necessary to determine the course of pediatric covid-19
infection alongside other respiratory viral infections in our environment before the childhood vaccination
program is introduced in Africa. Also, several studies have reported the detection of SARS-CoV-2
alongside other respiratory viruses. The clinical significance of past or concurrent SARS-CoV-2 with
other respiratory viruses needs to be investigated. The effect of virus-virus interaction on transmissibility,
disease severity, immunopathology, and vaccine effectiveness of other childhood viral respiratory
infections will need to be further investigated.
In Nigeria, there is paucity of data on SARS-CoV-2 coinfection with other respiratory viruses. Salako,
Odubela et al. (2021) observed the prevalence of SARS-CoV-2 to be 16.3% after reviewing the samples
of 307 children in Lagos. Previously, Akinloye, Rönkkö et al. (2011) reported that viruses contribute
1
more than 75% to the etiology of acute respiratory infection and accounted for viruses like human
rhinoviruses, and parainfluenza viruses, with influenza virus C, human metapneumovirus, human
bocavirus and Adenoviruses. This study will attempt to provide a context to pediatric covid-19 and other
respiratory viral infection taking into consideration the predisposing demographic, social and clinical
factors.
2
The specific objectives of this work will be to:
1. determine the contribution of past or current SARS-CoV-2 infection to severity of infections
caused by other respiratory viruses in children (Influenza A and B, Parainfluenza viruses,
Rhinovirus, Bocavirus, Adenovirus, Respiratory Syncytial Virus, Human Metapneumovirus and
other human coronaviruses HCoV-229E and HCoV-OC43)
2. ascertain if coinfection other respiratory viruses increase the severity of SARS-CoV-2 infection
among children
3. predict if lymphopenia associated with SARS-CoV-2 infection increase vulnerability to other
respiratory viruses of childhood.
4. associate severe respiratory infection among children with demographic, social and clinical
factors
5. ascertain the genetic stability of respiratory viruses detected in this study
Research questions
1. Does past or current SARS-CoV-2 infection increased severity of infections caused by other
respiratory viruses (Influenza A and B, Parainfluenza viruses, Rhinovirus, Bocavirus,
Adenovirus, Respiratory Syncytial Virus, Human Metapneumovirus and other human
coronaviruses HCoV-229E and HCoV-OC43) in children?
2. Does coinfection with other respiratory viruses increase the severity of SARS-CoV-2 infection
among children?
3. Does lymphopenia associated with SARS-CoV-2 infection increase vulnerability to other
respiratory viruses of childhood?
4. Which demographic, social, and clinical factors are associated with severe respiratory infection?
5. Are there changes in the genetic constitution of the respiratory viruses studied?
Research hypothesis
1. Ho: Past or current SARS-CoV-2 infection increase severity of infections caused by other respiratory
viruses in children
Ha: Past or current SARS-CoV-2 infection does not increase severity of infections caused by other
respiratory viruses in children
2. Ho: Coinfection with other respiratory viruses increases the severity of SARS-CoV-2 infection among
children
Ha: Coinfection with other respiratory viruses does not increase the severity of SARS-CoV-2 infection
among children
3. Ho: Lymphopenia associated with SARS-CoV-2 infection increases vulnerability to other respiratory
viruses of childhood
3
Ha: Lymphopenia associated with SARS-CoV-2 infection does not increase vulnerability to other
respiratory viruses of childhood
4. Ho: Demographic, social, and clinical factors are associated with severe respiratory infection
Ha: Demographic, social, and clinical factors are not associated with severe respiratory infection
5. Ho: There are changes in the genetic constitution of viruses detected in this study
Ha: There are no changes in the genetic constitution of viruses detected in this study
1. There is limited data on the long-term effects of SARS-CoV-2 infection on the severity of infections
2. Understanding whether there is an increased risk of severe respiratory infections in children who have
had prior COVID-19 infection will provide valuable insights into the long-term effects of COVID-19 on
pediatric health. This information can be crucial for public health officials and policymakers in planning
3. If a significant association is found between past COVID-19 infection and increased severity of other
respiratory virus infections in children, healthcare providers can be better prepared to manage and treat
such cases. Also, an understanding of the relationship between lymphopenia and susceptibility to other
respiratory viruses in children can aid healthcare providers in managing and treating patients effectively.
This knowledge can aid in early identification and intervention to prevent complications and improve
patient outcomes.
4. Insights into how prior SARS-CoV-2 infection affects the severity of subsequent respiratory infections
can give information on viral interactions and immune responses which can contribute to a deeper
understanding of virology and immunology for the recommendation of vaccination strategies. If there is
evidence that prior COVID-19 infection enhances susceptibility to other viruses, it could underscore the
4
importance of vaccinating children against SARS-CoV-2 to reduce the risk of such interactions and
complications.
5. The results of this research can be used to raise public awareness about the importance of taking
preventive measures and following vaccination guidelines. It can help parents and caregivers make
informed decisions to protect the health of children and the broader community.
Proposed Methodology
Study Area
The study will be conducted at the Lagos University Teaching Hospital (LUTH) Pediatric Unit and
Massey Children's Hospital both located in Lagos, Nigeria. Lagos University Teaching Hospital is a
federal health institution that provides tertiary health services while the Massey Children's Hospital is a
state-owned secondary health facility. Both facilities provides specialist care to children in Lagos,
Nigeria.
Study Design
This study is an hospital-based, cross sectional study which will be carried out among children who give
their assent or their parents or guardians gave their consent. Enzyme-linked immunosorbent assay will be
employed for the detection of antibodies which could be indicative of past or current infection in blood
while polymerase chain reaction will be used to detect the presence of the genes of the viruses to be tested
in respiratory specimen collected with a nasopharyngeal swab. Severe Acute Respiratory Coronavirus-2
and other respiratory viral infections which includes Influenza A and B, Parainfluenza viruses,
Rhinovirus, Bocavirus, Adenovirus, Respiratory Syncytial Virus, Human Metapneumovirus and other
human coronaviruses HCoV-229E and HCoV-OC43 will be assayed for in this study. Relevant open-
ended questionnaire to obtain detailed child history will be taken. This involved age, gender, residence,
history of fever, wet cough, hemoptysis, shortness of breath, exposure to a source of infection,
investigations and treatment given, and any complications.
Patients will be physically examined. This included both general examination (level of consciousness,
presence of cyanosis, temperature, heart rate, respiratory rate and grade of respiratory distress if present)
and local chest examination. Secondary outcome of infection which includes respiratory symptoms of
concern as well as admission and fatality will be obtained from hospital records six weeks after samples
have been collected from participants. Other test results which includes complete blood count, leukocyte
with differential count, C-reactive protein (CRP) and blood culture results will be obtained from the
clinical records of participants
Study Population
5
This study will be carried out on children visiting Lagos University Teaching Hospital (LUTH) Pediatric
Unit and Massey Children's Hospital both located in Lagos who had fever and respiratory tract illness.
The participants will be recruited from the out-patient department (OPD), emergency department (ED),
general wards, and intensive care units (ICUs) of both hospitals.
Children who give assent and or whose parent consent to participate in the study.
Exclusion Criteria
• Participants that are more than 5 years old at the time of recruitment
• Children who do give assent and or whose parent do not consent to participate in the study
• Children who do not have symptoms of respiratory tract illness and or fever
• Children that have congenital heart disease, or immunodeficiency disorders or died within 24 h of
admission
Sampling technique
The method of consecutive sampling, which is a non-probability method, will be used to select consenting
participants.
6
The prevalence of 16.3% among 307 children (≤18 years) according to Salako et al., 2021. The sample
size of this study will be 210 samples. A total of 420 samples will be collected from both Lagos
University Teaching Hospital (LUTH) Pediatric Unit and Massey Children's Hospital respectively.
Ethical Consideration
Ethical approval will be obtained from the health research and ethics committee of the Lagos University
Teaching Hospital and the Hospital Management Board of Lagos State. This research will be carried out
in line with the ethics governing the use of human samples and in accordance with Helsinki declaration.
Ethical practices such as participant consent from parents and or guardians, assents from eligible children
as well as confidentiality and safety laboratory practice will be adhered to during the study.
Laboratory Analysis
Antibody (IgG and IgM) ELISA
Enzyme linked immunosorbent assay will be performed for all the viruses investigated in this study which
includes Severe Acute Respiratory Coronavirus-2, Influenza A and B, Parainfluenza viruses (I, II, III and
IV), Rhinovirus, Bocavirus, Adenovirus, Respiratory Syncytial Virus, Human Metapneumovirus, Human
Coronaviruses HCoV-229E and HCoV-OC43.
Purified viral antigen already coated on the surface of microwells will be purchased. Diluted participants
plasma will be added to the wells with the formation of IgG or IgM- specific antigen -antibody complex
during incubation if the participant has been exposed. After washing the wells to remove unbound
sample, antibody to human IgG and IgM conjugated with horseradish peroxidase (HRP) is added and
incubated at 37°C for 30 minutes. Unbound conjugate is removed by a subsequent washing step.
7
A solution of TMB Reagent is then added to the microwells. The enzyme conjugate catalytic reaction is
stopped at a specific time. The intensity of the color generated is proportional to the amount of IgG or
IgM-specific antibody in the sample. The results are read by a microwell reader compared in a parallel
manner with calibrator and controls according to the manufacturer.
Preparation of reagents for RNA extraction
Viral RNA will be extracted using total RNA purification kit by Jena bioscience (Jena Bioscience GmbH,
Jena, Germany). 260 µl of 2-Mercaptoethanol will be added to 26 ml lysis buffer, 32 ml ethanol will be
added to the washing buffer and second washing buffer into the RNA extraction kit that will used in this
study according to the manufacturer’s instruction.
8
PCR and the details of primers are summarized in Table 1. Briefly, the PCR reaction will be performed
by adding 3 µL RT product of each sample to 22 µL PCR mix. The conditions of amplification will be as
follows: initial denaturation at 95 °C for 10 min; followed by 40 cycles of 95 °C for 1 min, 60 °C for 1
min, and 72 °C for 1 min; a final extension at 72 °C for 10 min. Amplification products w ill be visualized
in 1% agarose gel electrophoresis with sybr safe stain and observed under ultraviolet light. For each PCR
assay, a positive and negative control for each parameter was performed. Internal control will be
performed to detect sample inhibition and avoid false-negative results. External and internal amplification
controls were designed for quality control and validation.
Phylogenetic Analysis
Sequencing will be done for representative isolates of SARS-CoV-2, Influenza A and B, Parainfluenza
viruses, Rhinovirus, Bocavirus, Adenovirus, Respiratory Syncytial Virus, Human Metapneumovirus and
other human coronaviruses HCoV-229E and HCoV-OC43 using ABI 3730 Genetic Analyzer (Applied
Biosystems, USA) employing gene-specific forward and reverse primers of different genes of respiratory
viruses. The most identical nucleotide sequences available in the sequence database will be identified
through NCBI BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Sequences submitted in Nigeria
and from various countries will be retrieved from the GenBank database and aligned; the evolutionary
history will be estimated using the Neighbor-Joining method. Evolutionary analyses will be conducted
using MEGA6. Genbank accession numbers will be assigned to the isolates that will be deposited in the
gene bank
9
Table 2: The Respiratory Index of Severity in Children (RISC) score
Z > -2 0 Point
Total points
Maximum 6 Points
*Weight for age will be categorized based on the WHO z-scores (WHO, 2006)
Statistical analysis
Student’s t-test and chi-square test will be used to analyze and compare th e categorical demographic
characteristics including clinical manifestations and laboratory tests. Kappa statistic will be used
to evaluate the consistency between PCR and ELISA tests (categorical variables) and Cohen’s
kappa coefficient (κ) will be regarded as poor to fair consistency if κ ≤ 0.4; moderate consistency
if 0.41 ≤ κ ≤ 0.60; and good consistency if 0.61 < κ. Logistic regression will be used to predict
SARS-CoV-2 infection and severity of infections caused by other respiratory viruses. A two-sided p <
0.05 will be considered statistically significant. Statistical analyses will be performed using the
SPSS software version 23.0 (SPSS Inc., Chicago, IL, USA).
10
Table 1: Primers and PCR assays for multiplex PCR for Respiratory viruses
Multiplex Primer Amplicon
Direction Sequence (5’–3’) Target Gene Virus
Assay Name (size, bp)
FluA_F sense CCTTCTAACCGAGGTCGAAACG Matrix protein 241 FluA
FluA_R antisense GCATTTTGGACAAAGCGTCTACG
Membrane CoV-
CoV-229E_F sense GGTTTTGACAAGCCTCAGGAAAA 573
glycoprotein 229E
AGA
GTGACTATCAAACAGCATAGCAG
CoV-229E_R antisense
CTGT
Multiplex 4 ADV_F sense CAAAGCTCCCTAGGAAACGACCT Hexon 193 ADV
ADV_R antisense GCGGGTATGGGGTAAAGCATGT
Nonstructural
Boca_F sense GACCTCTGTAAGTACTATTAC 354 Boca
protein-1
Boca_R antisense CTCTGTGTTGACTGAATACAG
SAR
SARS-CoV-2 S-
sense GGTTCACCTCTCTCACTCAA N gene 519
N1-F CoV-
2
SARS-CoV-2 antisense CAAGCAGCAGCAAAAGCAAGA
11
N2-R
References
Krumbein, H, Kümmel, LS, Fragkou, PC, et al. Respiratory viral co-infections in patients with COVID-
19 and associated outcomes: a systematic review and meta-analysis. Rev Med Virol. 2022;e2365.
https://doi.org/10.1002/rmv.2365
______________________
Date (dd/mm/yyyy):______/________/______________
12
d. Other acute lower respiratory tract infection (specify) ______________________________
10. Respiratory rate: ______________breaths per minute (count for full minute)
11. Oxygen saturation _____________%
12. Heart rate ____________________
I Yes, immunized I
Partial I Not immunized
26. Was the child exclusively breastfeed for six months?
Yes/ No
Does the child have wheezing? Wheezing -2 Points
Yes/ No
13
Does the child refuse feeding? Refusal to feed 1 Point
Yes/ No
Growth standards:
Weight for age z-score* Z ≤ -3 2 Points
-2 ≤ Z < -3 1 Point
Z > -2 0 Point
Total points
Maximum 6 Points
FOLLOW UP QUESTIONNAIRE
Part D: Outcome
27. What was the outcome?
I Discharge I
Death
I
Mechanical Ventilation
RESULTS OF INVESTIGATIONS
14
C-reactive protein (CRP)
15