Acta Tropica 103 (2007) 195–200

Development of a real-time PCR assay for Trypanosoma cruzi

detection in blood samples
Maria Piron a,∗ , Roser Fisa b , Natalia Casamitjana a , Paulo López-Chejade b ,
Lluı́s Puig a , Mireia Vergés b , Joaquim Gascón c , Jordi Gómez i Prat d ,
Montserrat Portús b , Sı́lvia Sauleda a
a Transfusion Safety Lab., Banc de Sang i Teixits, Barcelona, Spain
bDepartment of Parasitology, Faculty of Pharmacy, Universitat de Barcelona, Av. Joan XXIII s/n, 08028 Barcelona, Spain
c Department of Tropical Medicine, Hospital Clı́nic i Provincial de Barcelona, C/Rosselló 132, 2-2, 08026 Barcelona, Spain
d Unitat de Medicina Tropical i Salut Internacional Drassanes, Av. Drassanes, 19, 08001 Barcelona, Spain

Received 8 February 2007; received in revised form 4 May 2007; accepted 29 May 2007
Available online 23 June 2007

Abstract
The aim of this study was to develop a real-time PCR technique to detect Trypanosoma cruzi DNA in blood of chagasic patients.
Analytical sensitivity of the real-time PCR was assessed by two-fold serial dilutions of T. cruzi epimastigotes in seronegative blood
(7.8 down to 0.06 epimastigotes/mL). Clinical sensitivity was tested in 38 blood samples from adult chronic chagasic patients and 1
blood sample from a child with an acute congenital infection. Specificity was assessed with 100 seronegative subjects from endemic
areas, 24 seronegative subjects from non-endemic area and 20 patients with Leishmania infantum-visceral leishmaniosis. Real-time
PCR was designed to amplify a fragment of 166 bp in the satellite DNA of T. cruzi. As internal control of amplification human
RNase P gene was coamplified, and uracil-N-glycosylase (UNG) was added to the reaction to avoid false positives due to PCR
contamination. Samples were also analysed by a previously described nested PCR (N-PCR) that amplifies the same DNA region as
the real-time PCR. Sensitivity of the real-time PCR was 0.8 parasites/mL (50% positive hit rate) and 2 parasites/mL (95% positive
hit rate). None of the seronegative samples was positive by real-time PCR, resulting in 100% specificity. Sixteen out of 39 patients
were positive by real-time PCR (41%). Concordance of results with the N-PCR was 90%. In conclusion, real-time PCR provides
an optimal alternative to N-PCR, with similar sensitivity and higher throughput, and could help determine ongoing parasitaemia in
chagasic patients.
© 2007 Elsevier B.V. All rights reserved.

Keywords: Trypanosoma cruzi; Real-time PCR; Chagas disease

1. Introduction and South America and the number of infected people is

Chagas disease is a protozoan infection caused by
Trypanosoma cruzi. The disease is widespread in Central
∗
Corresponding author at: Transfusion Safety Laboratory, Banc
de Sang i Teixits, Passeig Vall d’Hebron 119-129, 08035 Barcelona,
Spain. Tel.: +34 93 2749025; fax: +34 93 2749027.
E-mail address: mpiron@vhebron.net (M. Piron).
estimated at 12–14 million. Transmission of T. cruzi to
humans occurs after the bite of the reduviid bug, when
the excreta containing the parasites contaminate the bite
wound and mucosa, usually after scratching. The par-
asite can also be transmitted from infected mothers to
their children, through blood transfusion or organ trans-
plantation, and in secondary ways, by oral transmission
or laboratory accidents (WHO, 2002). Due to migration

0001-706X/$ – see front matter © 2007 Elsevier B.V. All rights reserved.
doi:10.1016/j.actatropica.2007.05.019
196 M. Piron et al. / Acta Tropica 103 (2007) 195–200
movements from rural to urban areas and from endemic
countries to North America and Europe, chagas disease
is now found in non-endemic areas where, even in the
absence of the vector, the infection can still be trans-
mitted congenitally, by blood transfusion and by organ
transplantation.
Chagas disease passes through two successive stages,
the acute and the chronic phase. After the acute clin-
ical manifestations disappear, the infection rests with
a long period of clinical latency, called the indetermi-
nate form period, which may last throughout life or
evolve to a chronic phase with cardiac or gastrointesti-
nal involvement. The chronic phase is characterised by
high specific IgG antibody production and low, intermit-
tent parasitaemia, which results in the low sensitivity of
the classic parasitological techniques. Diagnosis in this
stage mainly relies on serological techniques, despite
their lack of specificity when crude T. cruzi antigens
are used (Luquetti and Rassi, 2000). Also false–negative
serological results have been reported, which may be
related to the antigen used, the parasite strain involved
in the infection, or poor immune response of the patient
(Luquetti and Rassi, 2000). In addition, serology is not
accurate enough in the evaluation of treatment effi-
cacy, as it remains positive from 6 months to some
years after successful treatment, particularly in adults,
and has low positive predictive value in the diagno-
sis of congenital Chagas disease in the first months
of life due to transfer of antibodies from mother to
child.
Molecular-based assays, in particular amplification
by the polymerase chain reaction (PCR), provide a
more sensitive alternative to traditional parasitological
techniques. Some PCR protocols have been described,
leading to unequal results, probably due to differences
in the volume of blood processed, the DNA extrac-
tion procedure, or the DNA region of T. cruzi amplified
(Junqueira et al., 1996; Virreira et al., 2003).
Nested PCR (N-PCR) provides higher sensitivity than
single-run PCR assay and has already been reported for
supplementary diagnosis of Chagas disease (Marcon et
al., 2002). This technique is highly sensitive, but time
consuming and entails a high risk of false positive results
due to contaminating amplicons.
In contrast, real-time PCR technology uses fluores-
cent labels for continuous monitoring of amplification
throughout the reaction. The main advantages are the
rapid throughput of results (amplification and detection
in one step) and reduced risk of carry-over contamina-
tion (minimal manipulation of samples and use of UNG).
Real-time PCR can be optimised both as a qualitative and
quantitative assay.
The aim of this study was to develop and evaluate the
efficacy of a real-time PCR assay to detect and eventually
quantify T. cruzi in blood of chagasic patients.
2. Patients and methods
2.1. Positive controls
Epimastigotes from T. cruzi (Maracay strain) cultured
in LIT medium with 10% heat-inactivated foetal calf
serum were used to prepare the positive controls. The
number of parasites was assessed by microscopic exam-
ination and was adjusted to 7.8 epimastigotes/mL in
human EDTA whole blood from pooled healthy individ-
uals (Control 1) and frozen at −20 ◦ C. For the sensitivity
analysis (qualitative assay), two-fold serial dilutions of
Control 1 in human EDTA whole blood were performed
down to 0.06 epimastigotes/mL. To assess the dynamic
range of the real-time PCR technique, 10-fold serial
dilutions of blood spiked with T. cruzi epimastigotes
were obtained (106 –10−1 epimastigotes/mL). DNA was
extracted as described below and the real-time PCR reac-
tions were performed as triplicates for each sample.
2.2. Patients and samples
Thirty-eight blood samples from patients with
chronic Chagas disease, who were native to endemic
areas (33 Bolivians, 3 Argentines, 1 Brazilian, 1 Hon-
duran) and living in Barcelona, Spain were included.
One millilitre serum sample and 1 mL of EDTA–blood
were frozen at −20 ◦ C until analysis. All of these patients
arrived at Spain between 2000 and 2004. The patients
included in our study were all adults, diagnosed as chron-
ically infected by T. cruzi, and had not received any prior
specific treatment. All provided signed informed con-
sent for inclusion in the study. Patients were diagnosed
by two serological techniques, the Bioelisa Chagas assay
(Biokit, Barcelona, Spain), which uses recombinant anti-
gens, and a conventional in-house ELISA with whole T.
cruzi antigens. Blood from a newborn with congenital
Chagas disease (Riera et al., 2006) was also included
in the study. Blood samples from 100 healthy individu-
als from endemic areas, and 24 healthy individuals from
non-endemic areas were used as negative controls for
the specificity study. Peripheral blood buffy coat and
bone marrow from 20 patients with Leishmania infantum
visceral leishmaniasis (VL) were also studied.
2.3. DNA extraction
DNA was extracted from 100 !L of 1 mL thawed
EDTA–blood, 200 !L buffy coat and 200 !L bone
 M. Piron et al. / Acta Tropica 103 (2007) 195–200
Table 1
Primers and probe selected for the T. cruzi nested PCR and for the real-time PCR
PCR Primer or probe
Nested TCZ 1 (forward)
TCZ 2 (reverse)
TCZ 3 (forward)
TCZ 4 (reverse)
Real-time Cruzi 1 (forward)
Cruzi 2 (reverse)
Cruzi 3 (probe)
a R, A/G; S, C/G.
b Nucleotide position in the DNA satellite sequence (GenBank accession no. AY520036).
marrow with the High Pure PCR Template Prepara-
tion kit (Roche, Basel, Switzerland), and eluted in
200 !L of elution buffer according to the manufac-
turer’s instructions. Five microliters of extracted DNA
was amplified in triplicate in both the real-time PCR and
N-PCR.
2.4. Nested PCR assay
The N-PCR assay is based on a previously described
procedure (Marcon et al., 2002) using primers TCZ
1 and TCZ 2 for the first reaction and TCZ 3 and
TCZ 4 for the nested amplification, with some mod-
ifications (Table 1). PCR was carried out in 20 !L
reaction mixture containing 1.5 mM MgCl2 and 1 U of
RedTaq polymerase (Sigma), with annealing tempera-
tures of 63 ◦ C (40 cycles) and 57 ◦ C (25 cycles) in the
first and second amplification runs, respectively. The
PCR programs were run on an MJ Research thermo-
cycler (PTC-200), and the 149-nucleotide amplicon was
separated by electrophoresis on 3% agarose gel and visu-
alised by ultraviolet transillumination after staining with
ethidium bromide.
2.5. Real-time PCR assay
Primers and probe were selected from the same repet-
itive sequences of satellite DNA amplified in the N-PCR
protocol and designed according to the Primer Express
Software (Applied Biosystems). The primers Cruzi 1
and Cruzi 2 amplify a 166-bp segment. The probe Cruzi
3 was labelled with 5$ FAM (6-carboxyfluorescein) and
3$ MGB (minor groove binder). Table 1 describes the
position of primers and probe for both the N-PCR and
real-time PCR. The pre-developed reagent for the RNase
P human gene (TaqMan Human RNase P detection
reagent, Applied Biosystems) was included in the PCR
reaction as internal control of amplification. The final
197
Sequencea (5$ –3$ ) Nucleotide positionb
CGAGCTCTTGCCCACACGGG 1–20
CCTCCAAGCAGCGGATAGTTCAGG 165–188
TGCTGCASTCGGCTGATCGTTTTCGA 21–46
CARGSTTGTTTGGTGTCCAGTGTGTGA 142–168
ASTCGGCTGATCGTTTTCGA 27–46
AATTCCTCCAAGCAGCGGATA 172–192
CACACACTGGACACCAA 143–159
conditions in the PCR mixture were 1× Universal Mas-
ter Mix with UNG (Applied Biosystems), 0.1× RNase
P detection reagent, 750 nM each T. cruzi primer and
250 nM for the T. cruzi probe in a 20 !L reaction. The
samples were amplified in a thermocycler ABI Prism
7700 (Applied Biosystems) with the following PCR con-
ditions: first step (2 min at 50 ◦ C), second step (10 min at
95 ◦ C) and 45 cycles (15 s at 95 ◦ C and 1 min at 58 ◦ C). A
sample was considered valid when the internal control
was efficiently amplified, and was considered positive
for T. cruzi when the threshold cycle (Ct) for the T. cruzi
target was <45. The Ct for a given sample is the first
cycle of the PCR reaction where fluorescence is detected
above the baseline. A non-template control was included
in each run as the real-time PCR negative control.
2.5.1. Statistical analysis
The sensitivity of the real-time PCR assay was cal-
culated by PROBIT analysis (SPSS v13, Chicago, IL),
and the 95% and 50% positive hit rates are reported. The
Ct values are expressed as the mean and standard devi-
ation. The coefficient of variation was calculated as the
percentage of the Ct standard deviation divided by its
mean.
3. Results
3.1. Analytical sensitivity and specificity
The sensitivity of the real-time PCR was assessed
by analysing 24 aliquots of each two-fold serial dilu-
tion of parasite-spiked whole blood (Table 2). The 24
PCR results for each dilution were obtained from two
independent runs. After PROBIT analysis, the 95%
detection limit was found at 2.07 parasites/mL (95%
CI 1.68–2.80) and the 50% detection limit at 0.80 par-
asites/mL (95% CI 0.62–1.03). Therefore, a negative
result in the real-time PCR assay should be reported
198 M. Piron et al. / Acta Tropica 103 (2007) 195–200

Table 2 Table 3
Results for the sensitivity assay for the real-time PCR using two-fold Description of the positive and discrepant samples in the real-time PCR
dilutions of blood sample spiked with a known T. cruzi concentration and nested PCR in blood from patients with Chagas disease
Parasites/mL Positive/tested Sample Origin Real-time PCR (mean Ct) N-PCR

7.81 24/24 1 Argentina 34.63 Positive

3.91 24/24 2 Bolivia 28.73 Positive
1.95 21/24 3 Bolivia 32.92 Positive
0.98 17/24 4 Bolivia 35.48 Positive
0.49 10/24 5 Bolivia 36.37 Positive
0.24 6/24 6 Bolivia 39.21 Positive
0.12 4/24 7 Bolivia 35.43 Positive
0.06 2/24 8 Bolivia 39.36 Positive
9 Bolivia 36.33 Positive
10 Bolivia 33.50 Positive
11 Honduras 30.60 Positive
inferior to 2.8 parasites/mL. The sensitivity of the real- 12 Bolivia 39.35 Negative
time PCR was similar to that obtained with the N-PCR 13 Bolivia 39.22 Positive
assay, which in our hands yields a clear band down to 2 14 Bolivia 39.22 Negative
parasites/mL. 15 Bolivia 35.55 Positive
16 Bolivia Negative Positive
As for the quantitative results, the real-time PCR reac- 17 Bolivia Negative Positive
tions performed in triplicate with 10-fold serial dilutions 18 Spaina 14.74b Positive
of DNA from blood spiked with T. cruzi epimastig- a Congenital case, mother from Bolivia.
otes (106 –10−1 epimastigotes/mL) showed a linear curve b From buffy-coat sample.
from 105 down to 10 parasites/mL of blood, with a four-
log dynamic range (Fig. 1).
As for the reproducibility of the assay, single-use samples or 20 samples from VL patients tested positive
aliquots of Control 1 were extracted and amplified in 28 by real-time PCR. In our study, the specificity of the
independent runs. Mean Ct values were 33.73 ± 1.68 for real-time PCR was, therefore, 100%. When the chagasic
the T. cruzi target and 28.91 ± 1.36 for the human RNase patients were analysed, we found that 23 out of 39 sam-
P gene, for a resulting coefficient of variation of 4.97% ples were negative by real-time PCR. All these samples
and 4.87%, respectively. We observed no contamination had an acceptable signal for RNase P gene amplification
of the negative controls or non-template controls of the (mean Ct 28.94 ± 2.65), thus indicating that no false neg-
assay due to carry-over during either the DNA extraction ative results were generated by PCR inhibitors, nor were
or the real-time PCR set-up. there errors in sample dispensing into the PCR reaction.
Conversely, 16 samples out of the 39 chagasic patients
(41%) were positive by the real-time PCR for T. cruzi.
3.2. Clinical sensitivity and specificity The mean Ct value for the T. cruzi target in positive sam-
ples from chronic patients was 35.54 ± 3.29, being all
Negative samples have been tested to determine the
of them near or below the lower limit of the dynamic
specificity of the real-time PCR and the new primers
range (Fig. 1). When compared to the N-PCR, agree-
described here. None of the 124 T. cruzi seronegative
ment between the techniques was 90%. Four samples
had discrepant results, two positives by N-PCR and two
positives by real-time PCR (Table 3).
Finally, the sample from the newborn with congenital
infection was positive with a mean Ct equal to 14.74,
which is over the dynamic range.

4. Discussion

Herein, we describe the development of a new real-

Fig. 1. Dynamic range of the real-time PCR. DNA of 10-fold serial
dilutions of blood spiked with T. cruzi epimastigotes were amplified as
triplicates (106 –10−1 epimastigotes/mL). The linear regression curve
and regression coefficient are indicated.
time PCR method based on TaqMan technology for the
diagnosis of T. cruzi infection in blood samples. Pre-
viously described PCR methods for the diagnosis of
Chagas disease were based on one-step PCR, with or
 M. Piron et al. / Acta Tropica 103 (2007) 195–200
without hybridisation, or N-PCR followed by gel elec-
trophoresis. Consequently, they were time-consuming
and produced false positive results due to contamination
of the samples by carry-over, or false negative results due
to inhibition in the amplification process, when PCRs
were performed in the absence of parallel amplification
of a human gene as a control.
More recently, some works have described real-time
PCR methods using SybrGreen technology which is
based on incorporation of a fluorescent dye into the
double-strand DNA (Cummings and Tarleton, 2003;
Virreira et al., 2006). We chose to use a TaqMan probe
that better guaranties the specificity of the measured sig-
nal.
Our real-time PCR method is based on amplification
of a genomic DNA sequence which had been previously
described as specific for all T. cruzi lineages (Moser et
al., 1989; Virreira et al., 2003). It has been designed
to include a decontamination step and an internal con-
trol for the quality of amplification, and results can be
interpreted both qualitatively and, with the appropriate
standard curve, quantitatively. As is shown in our study,
the real-time PCR has a sensitivity similar to that of the
N-PCR, with a concordance in the clinical samples tested
of 90%. Discrepant results between real-time PCR and
N-PCR can be explained by low parasitaemia, probably
below the limit of detection of both PCR techniques.
Indeed, we noted that both samples with a positive real-
time PCR but negative N-PCR result presented relatively
late Ct for the real-time technique (39.35 and 39.22,
Table 3), which actually correspond to low parasitaemia
according to our standard curve (Fig. 1). Therefore, sen-
sitivity could be further improved if a larger volume of
blood were processed for DNA extraction. The samples
included in this study are representative of the T. cruzi-
infected population in a non-endemic area, that is, young
adults in an indeterminate phase of the disease with low
or absent parasitaemia. We must mention that all the
selected patients were diagnosed on serological findings
and had not received any treatment before enrolment
in the study. All patients with Chagas chronic disease
arrived at Spain between 2000 and 2004 and there was
no significant difference in the time spent outside the
endemic area between patients who presented a posi-
tive result by PCR (real-time or N-PCR) and those who
presented a negative result. Use of the real-time PCR
in this context will be as a qualitative assay to accom-
pany the serological diagnosis. Although the quantitative
assay is of limited value in the indeterminate phase of
the disease, the true potential of the real-time PCR will
eventually be better recognised in other situations for
which PCR-based techniques have been promoted, such
199
as congenital infections (Mora et al., 2005; Schijman et
al., 2003; Virreira et al., 2003), monitoring parasitaemia
during and after treatment (Apt et al., 2005; Britto et al.,
2001; Russomando et al., 1998; Sánchez et al., 2005;
Schijman et al., 2003), early detection of relapses after
heart transplantation (Maldonado et al., 2004), and other
immunosuppressive circumstances. As expected, a low
Ct value (Ct = 14.74), even over the dynamic range of the
technique, was found in the sample from the newborn
with acute congenital infection included in this study.
To be quantifiable, this sample should be diluted before
the extraction step in order to enter the dynamic range
of the technique. However, for more accurate results
in any PCR assay, an international reagent with prop-
erly quantified T. cruzi DNA load would be necessary
for each experiment. International standards for various
infectious agents (human immunodeficiency virus, hep-
atitis C virus) (Saldanha et al., 1999) are available for
molecular biology assays, in order to standardise and
compare methods and laboratory performance. Agen-
cies providing such materials should be encouraged to
make properly characterised T. cruzi reagents available
for this purpose.
In summary, this new real-time PCR system is sim-
pler, faster and more reliable than conventional PCR
techniques. Moreover, the possibility of quantification
and the reduced risk of contamination are added values
to this method.
Acknowledgements
This study has been partially supported by grant
024/13/2004 from the Agència d’Avaluació de Tecnolo-
gies I Recerca Mèdiques (AATRM, Catalunya, Spain).
The T. cruzi Maracay strain was kindly provided by
Prof. A. Osuna (Granada, Spain). We are grateful to
Celine Cavallo for the English revision of the manuscript
and to Marta Espelt for technical assistance.
References
Apt, W., Arribada, A., Zulantay, I., Solari, A., Sánchez, G., Mun-
dana, K., Coronado, X., Rodrı́guez, J., Gil, L.C., Osuna, A., 2005.
Itraconazole or allopurinol in the treatment of chronic American
trypanosomiasis: the results of clinical and parasitological exam-
inations 11 years post-treatment. Ann. Trop. Med. Parasitol. 99,
733–741.
Britto, C., Silveira, C., Cardoso, M.A., Marques, P., Luquetti, A.,
Macedo, V., Fernandes, O., 2001. Parasite persistence in treated
chagasic patients revealed by xenodiagnosis and polymerase chain
reaction. Mem. Inst. Oswaldo Cruz 96, 823–826.
Cummings, K.L., Tarleton, R.L., 2003. Rapid quantitation of Try-
panosoma cruzi in host tissue by real-time PCR. Mol. Biochem.
Parasitol. 129, 53–59.
200 M. Piron et al. / Acta Tropica 103 (2007) 195–200
Junqueira, A.C., Chiari, E., Wincker, P., 1996. Comparison of the
polymerase chain reaction with two classical parasitological meth-
ods for the diagnosis of Chagas disease in an endemic region of
north-eastern Brazil. Trans. R. Soc. Trop. Med. Hyg. 90, 129–132.
Luquetti, A.O., Rassi, A., 2000. Diagnostico Laboratorial da Infeccao
pelo Trypanosoma cruzi. In: Brener, Z., Andrade, A.A., Barral-
Netto, M. (Eds.), Trypanosoma cruzi e Doença de Chagas, second
ed. Guanabara Loogan, Rio de Janeiro, pp. 344–378.
Maldonado, C., Albano, S., Vettorazzi, L., Salomone, O., Zlocowski,
J.C., Abiega, C., Amuchastegui, M., Cordoba, R., Alvarellos, T.,
2004. Using polymerase chain reaction in early diagnosis of re-
activated Trypanosoma cruzi infection after heart transplantation.
J. Heart Lung Transplant. 23, 1345–1348.
Marcon, G.E.B., Andrade, P.D., de Albuquerque, D.M., Wanderley, J.,
da, S., de Almeida, E.A., Guariento, M.E., Costa, S.C.B., 2002.
Use of a nested polymerase chain reaction (N-PCR) to detect Try-
panosoma cruzi in blood samples from chronic chagasic patients
and patients with doubtful serologies. Diagn. Microbiol. Infect.
Dis. 43, 39–43.
Mora, M.C., Sánchez Negrette, O., Marco, D., Barrio, A., Ciaccio,
M., Segura, M.A., Basombrio, M.A., 2005. Early diagnosis of
congenital Trypanosoma cruzi infection using PCR, hemoculture,
and capillary concentration, as compared with delayed serology. J.
Parasitol. 91, 1468–1473.
Moser, D.R., Kirchhoff, L.V., Donelson, J.E., 1989. Detection of Try-
panosoma cruzi by DNA amplification using polymerase chain
reaction. J. Clin. Microbiol. 27, 1477–1482.
Riera, C., Guarro, A., El Kassab, H., Jorba, J., Castro, M., Angrill, R.,
Gállego, M., Fisa, R., Martin, C., Lobato, A., Portús, M., 2006.
Congenital transmission of Trypanosoma cruzi in Europe (Spain):
a case report. Am. J. Trop. Med. Hyg. 75, 1078–1081.
Russomando, G., de Tomassone, M.M.C., de Guillen, I., Acosta, N.,
Vera, N., Almiron, M., Candia, N., Calcena, M.F., Figueredo, A.,
1998. Treatment of congenital Chagas’ disease diagnosed and fol-
lowed up by the polymerase chain reaction. Am. J. Trop. Med.
Hyg. 59, 487–491.
Saldanha, J., Lelie, N., Heath, A., WHO Collaborative Study Group,
1999. Establishment of the first international standard for nucleic
acid amplification technology (NAT) assays for HCV RNA. Vox
Sang 76, 149–158.
Sánchez, G., Coronado, X., Zulantay, I., Apt, W., Gajardo, M., Solar,
S., Venegas, J., 2005. Monitoring the efficacy of specific treatment
in chronic Chagas disease by polymerase chain reaction and flow
cytometry analysis. Parasite 12, 353–357.
Schijman, A.G., Altcheh, J., Buergos, J.M., Biancardi, M., Bisio, M.,
Levin, M.J., Freilij, H., 2003. Aetiological treatment of congenital
Chagas’ disease diagnosed and monitored by the polymerase chain
reaction. J. Antimicrob. Chemother. 52, 441–449.
Virreira, M., Martı́nez, S., Alonso-Vega, C., Torrico, F., Solano, M.,
Torrico, M.C., Parrado, R., Truyens, C., Carlier, Y., Svoboda, M.,
2006. Amniotic fluid is not useful for diagnosis of congenital Try-
panosoma cruzi infection. Am. J. Trop. Med. Hyg. 75, 1082–1084.
Virreira, M., Torrico, F., Truyens, C., Alonso-Vega, C., Solano, M.,
Carlier, Y., Svoboda, M., 2003. Comparison of polymerase chain
reaction methods for reliable and easy detection of congenital Try-
panosoma cruzi infection. Am. J. Trop. Med. Hyg. 68, 574–582.
WHO, 2002. Control of Chagas disease. WHO-Technical Report
Series, 905.