Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B

j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / c b p b

Characterisation and differential expression during development of a duplicate

Disabled-1 (Dab1) gene from zebrafish
M. Javier Herrero-Turrión a, Almudena Velasco a,b, Rosario Arevalo a,b, José Aijón a,b, Juan M. Lara a,b,⁎
a
Institute of Neuroscience of “Castilla y León” (INCYL), University of Salamanca, Spain
b
Department of Cellular Biology and Pathology, University of Salamanca, Spain

a r t i c l e i n f o a b s t r a c t

Article history: We identified a new duplicated Dab1 gene (drDab1b) spanning around 25 kb of genomic DNA in zebrafish.
Received 16 April 2009 Located in zebrafish chromosome 2, it is composed of 11 encoding exons and shows high sequence similarity
Received in revised form 4 November 2009 to other Dab1 genes, including drDab1a, a zebrafish Dab1 gene previously characterised. drDab1b encodes
Accepted 8 November 2009
by alternative splicing at least five different isoforms. Both drDab1a and drDab1b show differential gene
Available online 29 November 2009
expression levels in distinct adult tissues and during development. drDab1b is expressed in peripheral
tissues (gills, heart, intestine, muscle), the immune system (blood, liver) and the central nervous system
Keywords:
Alternative splicing
(CNS), whereas drDab1a is only expressed in gills, muscle and the CNS, suggesting a division of functions for
Disabled 1 (Dab1) two Dab1 genes in zebrafish adult tissues. RT-PCR analysis also reveals that both drDab1 genes show distinct
Duplication developmental-specific expression patterns throughout development. drDab1b expression was higher than
Gene expression that of drDab1a, suggesting a major role of drDab1b in comparison with drDab1a during development and
In silico in different adult tissues. In addition, new putative Dab1 (a and/or b) from different teleost species were
Phylogeny identified in silico and predicted protein products are compared with the previously characterised Dab1,
Teleosts demonstrating that the Dab1b group is more ancestral than their paralogue, the Dab1a group.
Zebrafish (Danio rerio)
© 2009 Elsevier Inc. All rights reserved.

1. Introduction amyloid precursor protein (APP) family members (Trommsdorff et al,

The Reelin-Disabled 1 (Dab1)-signalling pathway is involved in
the development of the brain and in adult brain function, in the
positioning of migrating neurons of different brain areas and spinal
cord, synaptic connectivity, axonal pathfinding, synaptogenesis, den-
dritic arborisation, and neuronal plasticity, which also suggests a role
in neurodegeneration (Rice and Curran, 2001; Tissir and Goffinet,
2003; Stolt and Bock, 2006; Yang et al., 2006; Katyal et al., 2007). The
Reelin pathway is mediated by the binding of Dab1, the homologue of
Drosophila Disabled 1, which is a nucleocytoplasmic shuttling protein
(Honda and Nakajima, 2006), to Asn-Pro-X-Tyr (NPxY) motifs located
in the cytoplasmic tails of lipoprotein receptors and to a Tyr-Glu-Asn-
Pro-Thr-Tyr (YENPTY) motif located in the cytoplasmic domain of
Abbreviations: ApoER2, apolipoprotein E receptor 2; APP, amyloid precursor protein;
bp, base pairs; cDNA, complementary DNA; CNS, central nervous system; C-terminal,
carboxyl-terminus; Dab, Disabled; hpf, hours post fertilisation; kb, kilobase; kDa, kilodalton;
LDLR, low-density lipoprotein receptor; MS-222, tricaine methanesulfonate; NJ, neighbour-
joining; N-terminal, amino-terminus; ORF, open reading frame; PCR, polymerase chain
reaction; PTB domain, phosphotyrosine binding domain; RT-PCR, reverse transcriptase-
polymerase chain reaction; Tyr, tyrosine; UTR, untranslated region; VLDLR, very low density
lipoprotein receptor.
⁎ Corresponding author. Institute of Neuroscience of “Castilla y León” (INCYL), C/
Pintor Fernando Gallego No. 1, Salamanca 37007, Spain. Tel.: +34 923 294500x5323;
fax: +34 923 294750.
E-mail addresses: juan.lara@incyl.org, rororo@usal.es (J.M. Lara).
1998, 1999; Howell et al., 1999b; Hoe et al., 2006; Pramatarova et al.,
2008).
Reelin is a glycoprotein, mainly expressed in the Central Nervous
System (CNS). It mainly binds to the very low density lipoprotein
receptor (VLDLR) and apolipoprotein E receptor 2 (ApoER2), resulting
in receptor clustering and membrane recruitment of Dab1, which
is activated (Herz and Chen, 2006; Stolt and Bock, 2006). Binding of
Reelin to its receptors induces Dab1 tyrosine phosphorylation and
stimulates the activation of the Src family tyrosine kinases (Src, Fyn
and Yes) at the membrane.
Furthermore, Dab1 has only been characterised in non-mammalians
in zebrafish (Costagli et al., 2006). The prototypical form of Dab1 in
tetrapods has an open reading frame (ORF) of around 555 amino acids
encoding an 80 kDa protein and consists of an N-terminal domain, the
phosphotyrosine binding (PTB) domain, which associates with Reelin
receptors, an internal domain containing a cluster of five Reelin-
dependent potential tyrosine phosphorylation sites and a C-terminal
domain implicated in the modulation of Reelin-Dab1 signalling (Stolt
and Bock, 2006).
The genomic organisations of Dab1 genes identified up to now in
human and mouse (Bar et al., 2003) and a first Dab1 gene from zebrafish
(Costagli et al., 2006) have a high complexity with several alternatively
spliced exons. As a result they are translated in different Dab1 isoforms
that present developmental- and tissue-specific expression patterns,
suggesting different roles in embryogenesis and organogenesis. Thus,

1096-4959/$ – see front matter © 2009 Elsevier Inc. All rights reserved.
doi:10.1016/j.cbpb.2009.11.003
218 M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229
the differential expressions of some Dab1 isoforms have been detected
in the developing CNS of mouse (Howell et al., 1997a,b), chicken (Katyal
and Godbout, 2004) and zebrafish (Costagli et al., 2006).
In an attempt to shed light on the biological role of Dab1 and to
investigate its phylogeny more widely, we have firstly identified a
second Dab1 gene, drDab1b, from zebrafish (Danio rerio). This fish is
widely used as a study model for developmental biology and evo-
lutionary genetics (Amsterdam and Hopkins, 2006). Here we present
the sequence and genomic structure of this duplicate drDab1 gene.
Using RT-PCR techniques, we also analyse the expression levels of
both drDab1 genes in different tissues of adult zebrafish and during
development. Finally, using searches based on the conservation of
nucleotide and amino acid sequences, we have identified, in silico,
putative Dab1 (a and/or b) of different teleost species demonstrating
that the duplicate genes, Dab1a and Dab1b, have been conserved
during vertebrate evolution and may represent a new model for
studying Reelin-Dab1 pathways.
2. Materials and methods
2.1. Animals
We used embryos and adult specimens of both sexes of cyprinid
teleost, zebrafish (Danio rerio), obtained from the Animal Experimen-
tation Service of the University of Salamanca. All procedures and
experimental protocols were in accordance with the guidelines of
the European Communities Directive (86/609/EEC and 2003/65/EC).
The animals were kept in aquaria at an appropriate temperature
(25–28 °C), with 12 h light/12 h dark periods of light cycle and fed
once a day. The fish, previously anaesthetised with 150 mg/L tricaine
methanesulfonate (MS-222, Sigma-Aldrich), were sacrificed by rapid
cervical transection.
2.2. Isolation of RNA, RT-PCR and expression analysis
Various adult tissues (brain, retina, pituitary gland, gills, intestine,
heart, muscle, liver and blood) and whole embryos of distinct devel-
opmental stages [0.5, 1.5, 4, 7.5, 14, 20, 30, 40, 70, 95 and 120 hours post
fertilisation (hpf)] of zebrafish were homogenised with a Brinkmann
PolytronTM. The total RNA was extracted from each unfixed frozen adult
tissue or a pool of whole embryos of one determined developmental
stage and purified according to the acid-guanidinium phenol chloro-
form method (TRIZOL Reagent; Gibco-BRL) (Chomczynski and Sacchi,
1987). The quantification of RNA was carried out using a NanoPhot-
ometer (Implen GmbH). RNA quality was assessed on an RNA 6000
NanoLabChip (Agilent Technologies), using an Agilent 2100 Bioanalyzer
to assess the integrity of the 18S and 28S rRNA bands.
Total RNA (2 µg), primed with oligo-dT, was reverse-transcribed
into cDNA at 37 °C for 2 h using the first-strand cDNA synthesis kit
(ImProm-II Reverse-Transcriptase System; Promega), according to
the manufacturer's instructions in a 20 µL volume and stored at
−20 °C until use. Then, we used a 25 µL PCR mixture which contained
250 ng of cDNA template, 20 pmol of each primer (Table 1), 0.2 mM
dNTPs, 1.5 mM MgCl2 and 5 units of GoTaq Flexi DNA polymerase
(Promega). The primers were designed on the basis of the nucleotide
sequences of Dab1 genes known for distinct vertebrate species, with
the help of Oligo 4.05 Primer Analysis Software (National Bios-
ciences). In order to distinguish the differential expression of both
genes in the gene expression studies, we used the pairs of primers H
& I and B & D (Table 1). PCR amplifications were as follows: 1 cycle at
95 °C for 5 min as an initial denaturation step, denaturation at 95 °C
for 30 s, annealing at 56–62 °C for 30 s and extension at 72 °C for
45 s (35 cycles), followed by further incubation for 10 min at 72 °C
(1 cycle). The PCR products were electrophoresed on 2% agarose
gels in 1× 40 mM Tris-acetate, 1 mM ethylenediamine tetraacetic acid
pH 8.0 and visualised by ethidium bromide staining. The amplification
Table 1
PCR primers used for molecular characterisation of drDab1b and gene expression studies
of both drDab1 genes. Primer location in the corresponding GenBank sequences of
zebrafish origin is indicated.
Symbol Name Sequence Primer type
A drDab1_b–for5 exon 2 GAAGCAGCTCCATGATACGG Forward
B drDab1_b-e6–for AGCCATGCAGCAGCGCCA Forward
C drDab1_a/b–for4 exon 3 GAYTCCATGATGAAGCTSAAGGG Forward
D drDab1_b-e11–rev ACAAATCGTCGTCTCCTTCC Reverse
E drDab1_b-rev5 exon 11 CGGGTGGACTAAAATGCGTG Reverse
F drDab1_b-rev6 exon 12 CTGATGTCGACGGCTCTGTAG Reverse
G drDab1_b-e12–rev TGAGCCTGGGTTGACTAGTT Reverse
H drDab1_a-e6–for GGCTCAGTCTGCTGAGCGG Forward
I drDab1_a-e11–rev GGGTCTGGTGGGCCAGCAA Reverse
of zebrafish β-actin (GenBank accession no. NM_131031) was used
as an internal and loading control. Moreover, an RNA free (negative)
control sample was used which did not produce any amplified bands.
RT-PCR was performed with two independently isolated RNA
samples and the PCRs were repeated three times. The relative abun-
dance of each transcript was calculated by quantifying the intensity
of each DNA band by ImageJ 1.42 software (http://rsb.info.nih.gov/ij/).
The results are expressed as mean ± standard error of the mean (SEM).
Student's t-test statistical analyses were done using Prism software
(GraphPad).
2.3. Cloning, sequencing and sequence analysis
Some PCR products were extracted and purified from the gel using
a QIAquick Gel Extraction Kit. (Qiagen), or ligated in pGEM®-T Easy
Vector (Promega) following the manufacturer's indications. The super-
competent TG1 strain of Escherichia coli was transformed by the calcium
chloride method and cells were selected on TYE/ampicillin/IPTG/X-Gal
plates. Plasmid DNA was extracted after culture growth, and colonies
containing appropriate-sized inserts were screened by EcoRI (Promega)
enzymatic digestion.
The PCR product (50–150 ng) or plasmid DNA (400–600 ng) to-
gether with 3 pmol primer sequenced [specific primer of Dab1 (see
Table 1), or SP6 or universal primer (Promega)] were used for se-
quencing reactions which were performed in a 3100 Genetic Analyzer
(Applied Biosystems). Similarly, DNA sequencing was performed on
both strands from at least 2 independent cDNA clones. DNA sequences
were analysed with Chromas 2.3® (School of Health Science, Griffith
University, Australia) software and compared with other nucleotide
and/or protein sequence databases using the FASTA and BLAST
programmes from the European Molecular Biology Laboratory (EMBL;
http://www.ebi.ac.uk/embl/) and from the National Center for Biotech-
nology Information (NCBI; http://www.ncbi.nlm.nih.gov). The distinct
DNA sequences were aligned with the ClustalW programme using
default parameters (Thompson et al., 1994).
2.4. Databases, identification of new Dab1 in teleosts and phylogenetic
analysis
Dab1 sequences (genomics, cDNAs and proteins) from teleost
species were retrieved from the Ensembl site (http://www.ensembl.
org) as recently described by Herrero-Turrion and Rodríguez (2008).
Briefly, we were able to analyse the new Dab1 of the following teleosts:
Tetraodon nigroviridis (black pufferfish), Takifugu rubripes (Japanese
pufferfish), Oryzias latipes (Japanese medaka) and Gasterosteus
aculeatus (three-spined stickleback), using the queries Dab1a and/or
Dab1b sequences (nucleotide sequences at the level of each of the
exons present and cDNAs) of zebrafish. These nucleotide sequences
were used with different BLAST algorithms (mainly tBLASTn or
BLASTx) from the NCBI to determine the possible existence of hitherto
undescribed Dab1 in teleosts. The predicted sequences for the new
 M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229 219

Fig. 1. Nucleotide and predicted amino acid sequences of zebrafish Dab1b, drDab1b. Nucleotides are numbered in the 5′ to 3′ direction and the amino acids are shown in single-letter
code above the nucleotide sequence. The PTB domain is underlined. Indicated in boxes are the main regions that can be splicing alternatives (exons 8 and 9) to obtain four different
Dab1b isoforms: drDab1b_tv1 (lacks this region), drDab1b_tv2 (contains this entire region), drDab1b_tv3 (lacks exon 8) and drDab1b_tv4 (lacks exon 9). Note drDab1b_tv5 partially
lacks three exons (6–8). Predicted Ser (*), Thr (¶) and Tyr (Δ) phosphorylation sites (16/11/8) were located in the deduced complete amino acid sequence. The nucleotide sequence
marked in grey indicates the exon–intron boundaries. The oligonucleotide sequences used as primers have been italicised and are denominated in the 5′ to 3′ direction as: A, C, J, D, E,
F and G (see also Table 1).

Dab1a and/or Dab1b, determined in silico, were identified considering
their sequence similarity to drDab1a or drDab1b genes using a higher
cut-off E-value (E = 1e-12) and a higher sequence length (65% of
query over subject) and their sequences were edited manually ac-
cording to their similarity to homologous Dab1 genes in vertebrates
and to the available data. In particular, the sequences found were
verified as Dab1a or Dab1b by BLAST searches in the nucleotide data-
base. A sequence was considered a true Dab1a or Dab1b if it had a
known Dab1a or Dab1b as the best hit and had an E-value significantly
better than best non-Dab or non-Dab2 in the nucleotide database.
A crude phylogenetic analysis containing a representative set of
Dab, Dab1 and Dab2 proteins was used as a second step to verify the
Dab1 nature of the novel sequences. Using the ClustalW programme
with default parameters (Thompson et al., 1994) we aligned nucleo-
tide and/or amino acid sequences from Dab1 orthologues of dif-
ferent vertebrate species. The alignments in ClustalW_pir format
 220
M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229

Fig. 2. Alignment of Dab1 proteins of several species. Alignment produced with the ClustalW programme of deduced complete amino acid sequences for Dab1 identified in zebrafish species (drDab1a_tv2 and drDab1b_tv2, which are the
prototypical Dab1 proteins, GenBank accession no. NP_001035775 and EF028079, respectively) and its homologues identified in other vertebrates, such as human–Homo sapiens-(hsDab1-555, AAC70068), rat–Rattus norvegicus-(rnDab1-555,
BAC20288.1), mouse–Mus musculus-(mmDab1-555, CAM26762.1), chicken–Gallus gallus-(ggDab1-L, AAP70754.1) and western clawed frog–Xenopus tropicalis-(xtDab1, AAI55685). The PTB domain is underlined. Indicated in boxes are the
main regions that can be splicing alternatives (exons 8 and 9). Dots indicate amino acid residues identical to those of zebrafish Dab1b, dashes indicate sequence gaps.
 M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229 221

Fig. 3. Genomic organisation and transcription of zebrafish Dab1a and Dab1b genes. Exons and introns are represented by boxes and solid bars. Exons are numbered (1–15) on top of
each box. Encoding exons and the non-coding (untranslated) regions are represented by black and white, respectively. Encoding exons of the PTB domain and five tyrosine
phosphorylation sites are underlined (exons 3–6) and marked with arrows in each chromosomic locus. The number of amino acids encoded by each transcript is shown. The exon–
intron boundaries are indicated by arrows in each of two groups of transcripts drDab1a and drDab1b and the numbers above the arrows describe the position in the codon at which
the coding sequence is separated by an intron (0, at the codon junction; 1 and 2, after the first codon and the second codon position, respectively). Broken lines indicate the
corresponding exons of the drDab1a and drDab1b genes. Chromosome locations of drDab1a and drDab1b genes are indicated in parentheses. Letters below the exons stand for
primers used in gene cloning from Table 1.

obtained using the Molecular Evolutionary Genetics Analysis (MEGA)
version 4.0.2 (Tamura et al., 2007) were then used to construct
a neighbour-joining (NJ) tree (Saitou and Nei, 1987) analysing the
parameters p-distance (calculating the proportion of amino acid
differences), complete deletion and considering a bootstrap value of
1000 replicates.
3. Results
3.1. Molecular characterisation of drDab1b
A putative Dab1 gene (drDab1a, GenBank accession no.
NP_001035775) was previously identified in teleost zebrafish (Costagli
et al., 2006). We have identified a second Dab1 gene of zebrafish,
drDab1b (EF028079), by bio-informatic analysis and RT-PCR studies of
extracts of RNA of CNS, using a combination of primers (Table 1) based
on known nucleotide sequences of Dab1 of zebrafish [drDab1a; (Costagli
et al., 2006] and other species, such as human and mouse (Bar et al.,
2003) and chicken (Katyal and Godbout, 2004). Using the BLASTn
programme we analysed the chromosome location of both Dab1 genes,
drDab1b and drDab1a, from zebrafish aligning both drDab1 sequences
versus the zebrafish genome (Zv7, Apr 2007). drDab1b and drDab1a
were identified in chromosomes 2 and 5 of zebrafish, respectively.
The molecular characterisation of the nucleotide sequences of
new drDab1b genomic loci and their corresponding transcript(s) led
to a prediction of at least a cDNA-drDab1b of 1565 bp (Fig. 1). The
assembly of this cDNA consists of at least a 42 bp 5′-untranslated
region (UTR), a coding sequence of 1446 bp and at least a 77 bp 3′UTR.
The ORF encodes a sequence of 482 amino acids with a deduced
molecular mass of 53.549 kDa that corresponds approximately to the
predicted length of other Dab1 proteins (469–588 amino acids). The
cDNA-drDab1b showed close identity with four clones of zebrafish
chromosome 2 (CR848026.12, NM_001135042, NM_001040386,
NW_001878763). Our sequence showed 91% and 95% nucleotide
and predicted amino acid identity, respectively, with the longest
clone, NM_001135042. In particular, exon 2 of drDab1b is slightly
longer than the clones mentioned and it has twenty-seven nucleotide
insertions (and nine amino acid insertions). Surprisingly, in contrast
to known clones of chromosome 2, exon 12 of our drDab1b sequence
is slightly modified in the 3′ end, including a stop codon.
Like all Dab1 proteins reported in different species up to now
(Bar et al., 2003; Katyal and Godbout, 2004; Costagli et al., 2006),
drDab1b contains five important potential tyrosine phosphorylation
sites (Tyr194, Tyr207, Tyr209, Tyr229, Tyr241) and an N-terminal region
contains a putative PTB domain (Fig. 1). In addition, predicted Ser and
Thr phosphorylation sites (16/11), one potential N-glycosylation site
(Asn-Xaa-Ser/Thr; 251–253) and seventeen potential O-glycosylation
sites (Thr-Xaa-Ser) were found in the deduced amino acid sequence.
No potential N-myristoylation or prenylation sites were detected.
We have also used the ClustalW alignment programme to compare
the new Dab1 sequence from zebrafish (drDab1b) with the drDab1a
sequence and other Dab1 sequences (Fig. 2) published for other
vertebrate species. Specifically, the nucleotide and amino acid
sequences of drDab1b showed around 40 and 55% identity, respec-
tively, with drDab1a. In addition, the primary sequence of drDab1b
protein showed around 45% identity with the mammals and 50%
222 M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229

Table 2 following isoforms: drDab1b_tv2 (containing both exons 8–9),

Exon–intron junctions in the zebrafish drDab1b gene. Exon and intron sequences are in drDab1b_tv3 and drDab1b_tv4, which lack exons 8 and 9, respectively.
upper and lowercase letters, respectively. Start and stop codons are labelled in bold. The
gene contains the typical gt and ag at the 5′ splice site (donor site) and 3′ splice site
On the other hand, both exons are skipped by alternative splicing in
(acceptor site) for RNA splicing required for intron removal. In contrast to the drDab1a the drDab1b_tv1 isoform and the drDab1b_tv5 isoform lacks exons 6,
gene, we cannot identify an orthologue exon 1 of drDab1a for drDab1b upstream of 7 and 8.
exon 2. Nevertheless, we have preferred to maintain the same numbering for both Other isoforms similar to human/mouse Dab1, differing from
drDab1 genes for a better comparison between them, therefore, drDab1b exons are
prototypical Dab1-555 protein, such as mouse Dab1-217*, Dab1-271*
numbered from 2 to 12. Sizes in bp of introns and exons are indicated.
and Dab1-555* isoforms (Bar et al., 2003), do not seem to be present
Exon Nucleotide sequence around Nucleotide position Exon Intron in either drDab1a (Costagli et al., 2006) or drDab1b in zebrafish.
no. exon–intron boundaries of in the cDNA sequence size size
Using sequences encoding for Dab1 sequences 217*, 271* and 555* as
drDab1_b gene
queries in in silico assays, shows that both zebrafish Dab1 genes
2 GAAGCA…ATG_TGACCGgtaata 1–136 (43-CDS) 136 probably lack specific encoding exons of these similar isoforms, which
3 gtttagGTCAGG…CTGAAGgtaaac 137–276 140 5002
are located between exons 7–8 and exons 9–10 in the mouse Dab1
4 ctccagGGAATC…TCAGGGgtaaga 277–375 99 2469
5 cctcagGTCTTA…CATGCAgtaagt 376–507 132 1579 gene that encodes the isoforms 217* and 271*, respectively (Bar et al.,
6 atttagGCAGCG…TATCAGgtaaga 508–627 120 1492 2003).
7 gcacagACTATT…TATCAGgtgagt 628–666 39 716
8 ttgtagTACATT…TTACCAGgtactt 667–732 66 2418
9 tttctagGTCCCC…ATGGCTgtaggt 733–792 60 884 3.3. Dab1b expression in zebrafish
10 ttgcagAATATT…CTTTCTgtaagt 793–849 57 2971
11 tcacagATGCCC…CCACAGgtatcc 850–949 100 319
12 cctcagGTTATA…TGA...GGCTCA 950–1565 (−1491 CDS) 629 1561 Because drDab1a and drDab1b show a high degree of homology,
the next objective was to investigate whether these genes could be
differentially expressed both in adult tissues and developmental stages.
We designed two pairs of specific primers (forward and reverse) at
identity with chicken Dab1. These data demonstrate that our drDab1b
the boundaries of exons 5–6 and in exon 11, which are amplified
sequence is an orthologue of Dab1.
through the zone rich in tyrosines, to study, using RT-PCR experiments,
the different gene expression levels of distinct drDab1 isoforms (Table 1:
3.2. Genomic structure of drDab1b and alternative splicing isoforms primers H & I and B & D; Figs. 3–5). As shown in Fig. 4, we found that all
tissues of adult zebrafish studied in this work (retina, pituitary gland,
The gene structure of drDab1b, which presents some differences gills, heart, intestine, muscle, blood, liver and brain) express, at different
with respect to its homologue drDab1a (Costagli et al., 2006), was levels, at least the drDab1b_tv2. Specifically, the highest gene expression
determined by database searching and PCR approaches. The drDab1b levels of this isoform are detected in retina, gills, intestine, muscle, liver
gene was mapped in zebrafish chromosome 2, spanning 25,204 bp. As and brain. Furthermore, we identified significant expression levels of
shown in Fig. 3, the drDab1b gene consisted of 11 encoding exons one and/or two more transcripts (drDab1b_tv3 and/or drDab1b_tv4)
[exon 12 is partially not translated (3′UTRs)] with 10 introns of var- in tissues of the CNS (retina, pituitary and brain), gills and heart. In
ious lengths, whereas the drDab1a gene presented 15 exons with 14 particular, the highest gene expression levels of these isoforms are
introns. Table 2 shows the distinct exon and intron compositions as found in the retina and heart. Moreover, Dab1b_tv1 presents low ex-
well as the exon–intron junctions of the drDab1b gene. Although pression levels in CNS (retina, pituitary and brain), gills and heart. It is
we could not identify an orthologue exon 1 of drDab1a in drDab1b noteworthy that the lowest isoform identified of drDab1b, drDab1b_tv5,
upstream of exon 2, we have preferred to maintain the same num- was highly expressed in muscle and gills and presented a relatively
bering for both drDab1 genes for a better comparison (Fig. 3). In both lower expression level in liver. On the other hand, we detected high
genes, the PTB domain was encoded by exons 4–5 and partially by expression of drDab1a_tv2 in retina, gills and brain (Fig. 4), whereas
exons 3 and 6. As shown in Fig. 1, exon 2 of drDab1b encodes the initial Dab1b_tv1 was uniquely detected in brain. Subsequent cloning and
31 amino acids and the first nucleotide of the 32nd amino acid, in sequencing of some amplicons confirmed the drDab1 isoforms
contrast to other vertebrate Dab1 genes known up to now, which only mentioned.
encode the initial 23 amino acids and the first nucleotide of the 24th Regarding the developmental profiles of different isoforms of
amino acid. In drDab1b, exon 3 encodes the following 46 amino acids both Dab1 genes expressed in zebrafish, we found that both genes
and the last two nucleotides of the 32nd amino acid. Exons 4, 5, 6, 7, 8, 9 are expressed using different alternative splice isoforms throughout
and 10 encode 33, 44, 40, 13, 22, 20 and 19 amino acids, respectively. development, including maternally (Fig. 5). In the case of drDab1b, we
Exon 11 encodes 33 amino acids and the first nucleotide of the 303rd found that drDab1b_tv2 and drDab1b_tv5 are highly expressed during
amino acid and exon 12 encodes the last 179 amino acids and the last all embryonic developmental stages. In particular, these isoforms are
two nucleotides of the 303rd amino acid (Fig. 1). down-regulated at the end of the embryonic stage and then their
In contrast to drDab1a, in which at least four isoforms have been expression levels decrease or disappear at the moment of hatching.
identified (Costagli et al., 2006), using RT-PCR assays we have In contrast, other isoforms, such as drDab1b_tv3 and/or drDab1b_tv4,
identified at least five drDab1b transcripts: drDab1b_tv1, drDab1b_tv2 are up-regulated from hatching (70 hpf) until after 1–2 days post-
(DQ883567, EF028079, respectively), drDab1b_tv3, drDab1b_tv4 and hatching (= 4–5 days post fertilisation; 95–120 hpf). Finally,
drDab1b_tv5; with 1596, 1722, 1656, 1622 and 1497 bp, with ORFs drDab1b_tv1 presents moderate gene expression levels and is tran-
encoding sequences of 440, 482, 460, 462 and 407 amino acids and siently expressed throughout the embryonic stages until hatching.
with deduced molecular masses of 51.302, 51.01, 48.763 and On the other hand, the transcripts drDab1a_tv1 and drDab1a_tv4 are
44.746 kDa, respectively (Figs. 1 and 3). Exons 8 and 9 are usually expressed during all developmental stages and embryonic develop-
skipped by alternative splicing at the mRNA level to produce the ment, respectively, whereas the drDab1a_tv2 is transiently expressed

Fig. 4. Differential expression of drDab1b and drDab1a in adult zebrafish tissues. The expression of drDab1b and drDab1a was assessed by RT-PCR. Pairs of primers used for
amplifying part of the transcripts drDab1a and drDab1b were H & I, and B & D, respectively (see Table 1 and Fig. 3). The size of each PCR fragment and the specific isoform of each of
the zebrafish Dab1 genes/transcripts are shown. Amplification of zebrafish β-actin was used as an internal control and its expression is constantly statistically significant in all stages
analysed, as expected for a housekeeping gene. PCR product amounts are calculated as corresponding band intensity (mean grey value) using ImageJ 1.42 software (http://rsb.info.
nih.gov/ij). Each bar represents the mean of expression levels of the studied gene/transcript at each developmental stage ± SEM. For each stage the number of the experiments
represented in this graph was between 3 and 5.
M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229 223
224 M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229
 M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229 225

during development in the following stages: zygote (0.5 hpf), blastula
(4 hpf), later segmentation (20 hpf), pharyngula (30 hpf), hatching
(70 hpf) and post-hatching (95–120 hpf) (Fig. 5).
The study of the gene expression of zebrafish β-actin (NM_131031)
was used as an internal and loading control, showing a similar statis-
tically significant expression pattern in all adult tissues and develop-
mental stages used (Figs. 4 and 5).
4. Discussion
4.1. Comparison of drDab1b with drDab1a and other Dab1 proteins
We have identified a second zebrafish Dab1 gene (drDab1b) and
compared its structure with the first Dab1 gene (drDab1a) previously
identified in zebrafish (Costagli et al., 2006). In general, the degree of
homology is not uniform along the amino acid sequence, because, as
shown in Fig. 6, the N-terminal and C-terminal regions are longer and
shorter, respectively, in drDab1b than in drDab1a and the number and
location of potential Tyr, Ser and Thr phosphorylation sites are also
different. All these potential phosphorylation sites can be involved
in distinct functions, some of which might be phosphorylated by
the Cyclin-dependent kinase 5 in a Reelin-independent manner
(Keshvara et al., 2002), Fyn tyrosine kinases and other Ser/Thr kinases.
In particular, it is known that the cluster of phosphorylation tyrosine
residues of Dab1 proteins is phosphorylated in response to the binding
of Reelin to lipoprotein receptors (Herz and Chen, 2006; Stolt and
Bock, 2006) and also it performs other specific associated functions
(Howell et al., 1999a; Keshvara et al., 2001; Magdaleno et al., 2002;
Katyal et al., 2007; Feng and Cooper, 2009). The phosphorylation
of multiple tyrosine residues of Dab1 is required to mediate the full
spectrum of downstream cytoskeletal-modulating and cell migratory
signals that accompany Reelin-Dab1 signalling. Some of these func-
tions, or other new ones, might also be carried out by one and/or two
Dab1 genes of zebrafish.
In the main form of Dab1 proteins (Dab1-555) of mammals (human
and mouse) and chicken, Tyr185 and Tyr198/Tyr200 residues are part of
two YQXI motifs that bind to Scr-homologue 2 (SH2) domains, where-
as Tyr220 and Tyr232 are part of two YXVP motifs that bind to Abl/Nck/
Crk-like SH2 domains (Songyang et al., 1993; Howell et al., 1997a;
Pramatarova et al., 2003; Ballif et al., 2004; Bar et al., 2003). In zebrafish,
drDab1b_tv2 has two Y(194/207)QXI motifs and two Y(229/241)XVP motifs
that could, potentially, bind to Scr- and Abl/Nck/Crk-like SH2 domains,
respectively. However, our analysis also demonstrated that drDa-
b1a_tv2 and the isoforms that lack exons 8 and 9 of both drDab1
genes (drDab1a_tv1 and drDab1b_tv1) have only two YQXI motifs.
These could, potentially, bind to Scr-like SH2 domains, in contrast to the
isoforms with only two phosphorylation tyrosine residues in chicken
(ggDab1-E) and mammals, which have two YXVP motifs that bind to
Abl/Nck/Crk-like SH2 domains (Katyal and Godbout, 2004). Therefore,
one great difference between drDab1a and drDab1b genes is that the
latter gene, and specifically the drDab1b_tv2, could play a key role in the
Reelin-Dab1 pathway in zebrafish, because it contains the same motifs
that bind to Scr- and Abl/Nck/Crk-like SH2 domains as the homologue
isoforms in mammals and chicken.
In the future, it will be interesting to determine if the five Tyr
phosphorylation sites identified in each of the two Dab1 proteins of
zebrafish (Dab1a/b) are functional and have specific roles.
4.2. Identification by bio-informatic analysis of new putative Dab1 in
teleosts and phylogenetic analysis
Using the NJ method of the MEGA4 programme (Tamura et al., 2007)
one phylogenetic tree of the aligned amino acid sequences from Dab1 of
different species was constructed (Fig. 7). We have also included in this
analysis the disabled (Dab) gene of Drosophila melanogaster (Gertler
et al., 1989) and Caenorhabditis elegans, and additional sequences which
correspond to Dab2 as outgroups. Moreover, in order to obtain a broader
knowledge of Dab1's and their origin and relationships with one another,
new putative Dab1's from four teleost species [three-spined stickleback
(gaDab1b), Japanese medaka (olDab1a and olDab1b), Japanese pufferfish
(trDab1a and trDab1b) and black pufferfish (tnDab1a and tnDab1b)]
were identified using different in silico analyses and predicted protein
products were compared with the previously characterised Dab1 of
vertebrates, providing important clues about their origin and evolution
of this protein. We have identified, for the first time, that in several
teleosts there are normally two Dab1 genes (Dab1a and Dab1b) which
can be the result of an extra duplication that took place in teleosts.
Thus, the existence of two rounds of chromosome duplication is well
known (probably whole genome duplication) before the divergence
of ray-finned and lobe-finned fish and one more duplication event in
ray-finned fish before the teleost radiation (Taylor and Raes, 2004;
Vandepoele et al., 2004). Not all the genes of teleosts are duplicated and
conserve a new or a complementary function (Force et al., 1999).
We show that there are a wide number of Dab1's identified in
vertebrates, but not in protostomes (only the Dab gene) and other
deuterostomes, such as urochordates, cephalochordates and echino-
derms, which suggests that Dab1 may be specific to vertebrate lineage.
As shown in Fig. 7, drDab1b (specifically, drDab1b_tv2) is aligned in
the same clade as the rest of the Dab1's of vertebrates. It can, therefore,
be concluded that this new Dab1 identified in this work corresponds
to an orthologue Dab1 in zebrafish. In particular, Dab1 sequences of
teleosts (black pufferfish, Japanese pufferfish, three-spined stickle-
back, Japanese medaka and zebrafish) are positioned basal to the
rest of the Dab1 clade. Moreover, the group of teleosts forms two
subclades, one of them more ancestral (Dab1b), the second subclade
corresponding to Dab1a. Similar phylogenetic trees were obtained
when the nucleotide sequences (among cDNAs) were analysed and no
differences between them were observed (data not shown).
4.3. Genomic organisation of drDab1b and its alternative splice forms
Previous studies of genomic organisation of Dab1 genes demon-
strated that the mammalian Dab1 genes [mouse and human (Bar
et al., 2003)], chicken Dab1 gene (Katyal and Godbout, 2004) and the
first Dab1 gene identified in zebrafish (Costagli et al., 2006), together
with the second Dab1 gene identified in this work have similar or-
ganisation, further suggesting that they are evolutionally conserved.
The length of the exons and the location of exon/intron boundaries,
containing the highly conserved sequences for RNA splicing in higher
eukaryotes, namely gt at the 5′ splice site (donor site) and ag at the 3′
splice site (acceptor site) (Green, 1986), are well conserved in fish and
Dab1 genes of tetrapods, although the introns are shorter in fish than
other vertebrates. In general, the extension of the specific genomic
locus is tighter in teleosts than in amphibians, chickens and mammals.
Different nucleotide sequences have been incorporated into many

Fig. 5. Differential expression of drDab1b and drDab1a in zebrafish development. The expression of drDab1b and drDab1a was assessed by RT-PCR. PCR product amounts are
calculated as corresponding band intensity (mean grey value) using ImageJ 1.42 software (http://rsb.info.nih.gov/ij). Pairs of primers used for amplifying part of the transcripts
drDab1a and drDab1b were H & I, and B & D, respectively (see Table 1 and Fig. 3). The size of each PCR fragment and the specific isoform of each of the zebrafish Dab1 genes/
transcripts are shown. Developmental stages: zygote (0.5 hpf), division (1.5 hpf), blastula (4 hpf), gastrula (7.5 hpf), segmentation (14–20 hpf), pharyngula (30–40 hpf), hatching
(70 hpf) and post-hatching (95–120 hpf). Amplification of zebrafish β-actin was used as an internal control and its expression is constant in all stages analysed, as expected for a
housekeeping gene. Each bar represents the mean of expression levels of the studied gene/transcript at each developmental stage ± SEM. For each stage the number of the
experiments represented in this graph was between 3 and 5; *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 (unpaired Student's t-test with Welch correction).
 226

Fig. 6. Alignment of both Dab1a and Dab1b proteins of zebrafish. Alignment produced with the ClustalW programme of deduced complete amino acid sequences for Dab1 identified in zebrafish species (drDab1a_tv2 and drDab1b_tv2, which
are the prototypical Dab1 proteins, GenBank accession no. NP_001035775 and EF028079, respectively). The PTB domains are underlined. Exons 8 and 9 (e8 and e9) are the main regions that can be splicing alternatives. Predicted Ser, Thr and
Tyr phosphorylation sites are marked in each amino acid residue in green, blue and red, respectively. Each of the exons in each Dab1 gene is indicated as e2-e15. The amino acid residues marked in grey indicate the exon/intron boundaries.
Dashes have been introduced to maximise sequence identity. The total number of amino acids is indicated at the end of each sequence. Other legends: *, alignment that is perfectly conserved in both sequences; :, conserved residues in both
M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229

sequences; ., similar residues in both sequences.

 M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229 227

Fig. 7. Phylogenetic analysis of the family of Dab proteins of several species. Phylogram generated by the neighbour-joining method [MEGA4 programme (Tamura et al., 2007)] from
the alignment of the amino acid sequences of Dab1. Organisms of Dab1 proteins are indicated in the prefix. hs, human (H. sapiens, AAC70068); mf, crab eating macaque (M. fascicularis,
Q9BGX5); pt, chimpanzee (P. troglodytes, XP_001155092); rn, rat (R. norvegicus, BAC20288.1); mm, mouse (M. musculus, CAM26762.1); ss, pig (S. scrofa, NP_001090911.1); cf,
dog (C. familiaris, XP_852920), md, opossum (M. domestica, XP_001365192)]; gg, chicken (G. gallus, AAP70754.1); xt, western clawed frog (X. tropicalis, AAI55685)]; dr, zebrafish
(D. rerio, NP_001035775 and EF028079); ga, three-spined stickleback (G. aculeatus); ol, Japanese medaka (O. latipes); tr, Japanese pufferfish (T. rubripes); and tn, black pufferfish
(T. nigroviridis). We also included the amino acid sequences of Dab2 and Dab as outgroups: hs, human (H. sapiens, EAW55990); pt, chimpanzee (P. troglodytes, XP_001140442); rn, rat
(R. norvegicus, GenBank accession no. EDL75714); mm, mouse (M. musculus, NP_001032994); cf, dog (C. familiaris, XP_536493); md, opossum (M. domestica, XP_001372050); dr,
zebrafish (D. rerio, NP_991320); tn, black pufferfish (T. nigroviridis, CAG05213); ce, (C. elegans, NP_49573); and dm, (D. melanogaster, AAB08527). Whole numbers (bold) indicate
bootstrap values (occurrence of presented branching after 1000 iterations) and branch distances are given in decimal numbers when N 50%.

chromosomal loci during evolution (Zhang and Chasin, 2006; Babushok
et al., 2007), such as new exons for an alternative splicing of Dab1 genes
in mammalian species (e.g. exons corresponding to mouse 217*, 271*
and 555*). Moreover, it is known that in Drosophila, the Dab gene has
even smaller introns and extends over 12 kb of genomic DNA (Gertler
et al., 1989), suggesting that the large size of Dab1 in vertebrates
depends on intron extension and is an evolutionary acquisition. There-
fore, we can emphasise that the drDab1b gene could be more ancestral
than the Dab1a gene, because the introns of drDab1a are longer than
those of drDab1b and, as mentioned previously, the phylogenetic anal-
yses demonstrate it. In addition, we show that the most significant
differences between two zebrafish Dab1 genes are the distinct lengths of
the introns and that the drDab1b gene is substantially shorter than
drDab1a. Moreover, the intron phases were not well conserved and exon
12 of drDab1b contains the stop codon, in contrast to the other Dab1
gene of zebrafish (drDab1a) and other vertebrate Dab1 genes, which
228 M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229
contain the stop codon in exons 14 or 15 (Bar et al., 2003; Costagli, et al.,
2006). Regarding the numbers of exons, we demonstrated, for the first
time, that all Dab1 genes' identities, up to now in vertebrates, were
composed of 14 encoding exons, except drDab1b, which is composed of
12 encoding exons. Some Dab1 genes have some alternative internal
exons, such as mouse Dab1, with a total of four Dab1 cDNA forms (of
555, 217*, 271* and 555* amino acids; Howell et al., 1997a; Bar et al.,
2003). Moreover, two Dab1 cDNAs (of 551-ggDab1-L “later”- and 535-
ggDab1-E “early”-amino acids) and at least four Dab1a isoforms have
been reported in chicken (Katyal and Godbout, 2004) and zebrafish
(Costagli et al., 2006), respectively. In our work, we have also identified
at least five drDab1b isoforms. With respect to isoforms of both drDab1
genes, the drDab1a_tv2 and drDab1b_tv2 isoforms might be the
homologue isoforms to the prototypical form of Dab1 in mammals,
Dab1-555. The presence (or absence) in a specific isoform of some of the
exons located between exons 6 and 9, which encode the cluster of
potential tyrosine phosphorylation residues may be crucial in Reelin
signalling. Thus, other isoforms, such as drDab1a_tv3, drDab1b_tv3 and
drDab1b_tv4, which lack one or two exons 8 and 9, or drDab1a_tv1
and drDab1b_tv1, which lack both exons, might have dominant negative
effects and influence positive feedback control (Howell et al., 2000;
Katyal and Godbout, 2004; Costagli et al., 2006). Moreover, it has
been reported that Dab1 tyrosine-lacking forms can produce an ac-
cumulation of these Dab1 proteins. This is because they do not became
ubiquitinated, which requires tyrosine phosphorylation of Dab1 and,
therefore, are not degraded via the proteasome pathway and might
participate in other pathways (Arnaud et al., 2003; Morimura et al.,
2005). The disruption of Reelin signalling leads to the accumulation of
Dab1 protein in vivo, suggesting that Reelin limits its action by even-
tually down-regulating Dab1 levels (Sheldon et al., 1997; Rice et al.,
1998; Trommsdorff et al., 1999; Arnaud et al., 2003). We suggest that
drDab1a_tv1, drDab1b_tv1, ggDab1-E, Dab1-217* and Dab1-271* might
be functionally similar, since they have the same number of potential
tyrosine phosphorylation residues, although their C-terminal domains
are very different. This latter domain could be involved in the mod-
ulation of Reelin-Dab1 signalling (Herrick and Cooper, 2002).
4.4. Differential expression of drDab1b in tissues and during development
In our approach to studying the expression of drDab1b, we have
shown that this gene is expressed in the CNS (retina, pituitary and
brain) in a detectable manner. This is in accordance with the fact
that different drDab1a isoforms and other Dab1 isoforms in human,
mouse and chicken were also detected in the CNS (Bar et al., 2003).
Moreover, drDab1b was detected in some non-neuronal tissues (gills,
heart, intestine, muscle, blood and liver), like some mammalian Dab1
isoforms in liver, kidney and some haematopoietic cell lines (Howell
et al., 1997a; Bar et al., 2003), different chicken Dab1 isoforms in
kidney, heart, liver and gut (Katyal and Godbout, 2004) and drDab1a
in pronephric ducts, blood vessels and branchial arches in zebrafish
(Costagli et al., 2006). All these data suggest the existence of different
tissue-specific expression patterns of both drDab1 genes and each
Dab1 isoform in zebrafish and other species may play the same or
different roles in the same or distinct tissues.
We found that two drDab1 genes are expressed throughout devel-
opmental stages and show different developmental-specific expres-
sion patterns, as reported by Costagli et al. (2006) for drDab1a and
Howell et al. (1997a) for embryos of mouse. This suggests comple-
mentary or distinct roles of each drDab1 isoform in embryogenesis
and organogenesis, as has been reported for mouse and chicken (Bar
et al., 2003). In particular, the mouse Dab1 transcript contained frag-
ment 555* and the exclusion of the 555* exon occurs in parallel with
neural differentiation. In addition, the early isoform of chicken Dab1
(ggDab1-E), predominantly detected in early stages of development,
like drDab1b_tv2 drDab1b_tv5 and drDab1b_tv1, represents a novel
way of uncoupling the Reelin-Dab1 pathway, to ensure that this
signalling cascade is not prematurely induced in undifferentiated
retinal and brain cells by secreted Reelin. Only the later isoform
ggDab1-L, expressed in neurons, which contains all the tyrosine phos-
phorylation sites, is able to grow neurites in response to the Reelin
signal (Katyal and Godbout, 2004).
We also show that there are more development stages and adult
tissues that express drDab1b isoforms than those that express
drDab1a isoforms. In addition, drDab1b expression in developmental
and different tissues of the adult species was higher than that of
drDab1a. All this suggests a major role for drDab1b in contrast to
drDab1a in both processes.
4.5. Conclusion
Our results prove the existence of two functional duplicate genes
of Dab1 in the zebrafish and other teleosts and the combined analyses
of both genes opens a new exciting door for the understanding of the
Reelin-Dab pathway function throughout evolution.
Acknowledgements
This work was supported by the Junta de Castilla y León (SAN673/
SA15/08). We are grateful to F. Macho Sánchez-Simón for her help in
the early phases of this study, to Prof. R.E. Rodríguez for her helpful
advice and critical comments on the manuscript and to Mr. G.H.
Jenkins for revising the English version of the manuscript.
References
Amsterdam, A., Hopkins, N., 2006. Mutagenesis strategies in zebrafish for identifying
genes involved in development and disease. Trends Genet. 22, 473–478.
Arnaud, L., Ballif, B.A., Cooper, J.A., 2003. Regulation of protein tyrosine kinase signaling
by substrate degradation during brain development. Mol. Cell Biol. 23, 9293–9302.
Babushok, D.V., Ostertag, E.M., Kazazian Jr., H.H., 2007. Current topics in genome
evolution: molecular mechanisms of new gene formation. Cell Mol. Life Sci. 64,
542–554.
Ballif, B.A., Arnaud, L., Arthur, W.T., Guris, D., Imamoto, A., Cooper, J.A., 2004. Activation of a
Dab1/CrkL/C3G/Rap1 pathway in Reelin-stimulated neurons. Curr. Biol. 14, 606–610.
Bar, I., Tissir, F., Lambert, D.R., De Backer, O., Goffinet, A.M., 2003. The gene encoding
disabled-1 (DAB1), the intracellular adaptor of the Reelin pathway, reveals unusual
complexity in human and mouse. J. Biol. Chem. 278, 5802–5812.
Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium
thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159.
Costagli, A., Felice, B., Guffanti, A., Wilson, S.W., Mione, M., 2006. Identification of
alternatively spliced dab1 isoforms in zebrafish. Dev. Genes Evol. 216, 291–299.
Feng, L., Cooper, J.A., 2009. Dual functions of Dab1 during brain development. Mol. Cell.
Biol. 29, 324–332.
Force, A., Lynch, M., Pickett, F.B., Amores, A., Yan, Y.L., Postlethwait, J., 1999. Preservation of
duplicate genes by complementary, degenerative mutations. Genetics 151, 1531–1545.
Gertler, F.B., Bennett, R.L., Clark, M.J., Hoffmann, F.M., 1989. Drosophila abl tyrosine
kinase in embryonic CNS axons: a role in axonogenesis is revealed through dosage-
sensitive interactions with disabled. Cell 58, 103–113.
Green, M.R., 1986. Pre-mRNA splicing. Annu. Rev. Genet. 20, 671–708.
Herrero-Turrion, M.J., Rodríguez, R.E., 2008. Bioinformatic analysis of the origin, sequence
and diversification of _ opioid receptors in vertebrates. Molecular Phylogenetics and
Evolution 49, 877–892.
Herrick, T.M., Cooper, J.A., 2002. A hypomorphic allele of dab1 reveals regional
differences in reelin-Dab1 signaling during brain development. Development 129,
787–796.
Herz, J., Chen, Y., 2006. Reelin, lipoprotein receptors and synaptic plasticity. Nat. Rev.
Neurosci. 7, 850–859.
Hoe, H.S., Tran, T.S., Matsuoka, Y., Howell, B.W., Rebeck, G.W., 2006. Dab1 and Reelin effects
on APP and ApoEr2 trafficking and processing. J. Biol. Chem. 281, 35176–35185.
Honda, T., Nakajima, K., 2006. Mouse disabled1 (DAB1) is a nucleocytoplasmic shuttling
protein. J. Biol. Chem. 281, 38951–38965.
Howell, B.W., Gertler, F.B., Cooper, J.A., 1997a. Mouse disabled (mDab1): a Src binding
protein implicated in neuronal development. EMBO J. 16, 121–132.
Howell, B.W., Hawkes, R., Soriano, P., Cooper, J.A., 1997b. Neuronal position in the
developing brain is regulated by mouse disabled-1. Nature 389, 733–737.
Howell, B.W., Herrick, T.M., Cooper, J.A., 1999a. Reelin-induced tryosine phosphoryla-
tion of disabled 1 during neuronal positioning. Genes Dev. 13, 643–648.
Howell, B.W., Lanier, L.M., Frank, R., Gertler, F.B., Cooper, J.A., 1999b. The disabled 1
phosphotyrosine-binding domain binds to the internalization signals of trans-
membrane glycoproteins and to phospholipids. Mol. Cell Biol. 19, 5179–5188.
Howell, B.W., Herrick, T.M., Hildebrand, J.D., Zhang, Y., Cooper, J.A., 2000. Dab1 tyrosine
phosphorylation sites relay positional signals during mouse brain development.
Curr. Biol. 10, 877–885.
 M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229
Katyal, S., Godbout, R., 2004. Alternative splicing modulates disabled-1 (Dab1) function
in the developing chick retina. EMBO J. 23, 1878–1888.
Katyal, S., Gao, Z., Monckton, E., Glubrecht, D., Godbout, R., 2007. Hierarchical disabled-
1 tyrosine phosphorylation in Src family kinase activation and neurite formation. J.
Mol. Biol. 368, 349–364.
Keshvara, L., Benhayon, D., Magdaleno, S., Curran, T., 2001. Identification of reelin-induced
sites of tyrosyl phosphorylation on disabled 1. J. Biol. Chem. 276, 16008–16014.
Keshvara, L., Magdaleno, S., Benhayon, D., Curran, T., 2002. Cyclin-dependent kinase
5 phosphorylates disabled 1 independently of Reelin signaling. J. Neurosci. 22,
4869–4877.
Magdaleno, S., Keshvara, L., Curran, T., 2002. Rescue of ataxia and preplate splitting by
ectopic expression of Reelin in reeler mice. Neuron 33, 573–586.
Morimura, T., Hattori, M., Ogawa, M., Mikoshiba, K., 2005. Disabled1 regulates the
intracellular trafficking of reelin receptors. J. Biol. Chem. 280, 16901–16908.
Pramatarova, A., Ochalski, P.G., Chen, K., Gropman, A., Myers, S., Min, K.T., Howell, B.W.,
2003. Nck beta interacts with tyrosine-phosphorylated disabled 1 and redistributes
in Reelin-stimulated neurons. Mol. Cell Biol. 23, 7210–7221.
Pramatarova, A., Chen, K., Howell, B.W., 2008. A genetic interaction between the APP
and Dab1 genes influences brain development. Mol. Cell Neurosci. 37, 178–186.
Rice, D.S., Curran, T., 2001. Role of the reelin signaling pathway in central nervous
system development. Annu. Rev. Neurosci. 24, 1005–1039.
Rice, D.S., Sheldon, M., D'Arcangelo, G., Nakajima, K., Goldowitz, D., Curran, T., 1998.
Disabled-1 acts downstream of Reelin in a signaling pathway that controls laminar
organization in the mammalian brain. Development 125, 3719–3729.
Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstruct-
ing phylogenetic trees. Mol. Biol. Evol. 4, 406–425.
Sheldon, M., Rice, D.S., D'Arcangelo, G., Yoneshima, H., Nakajima, K., Mikoshiba, K.,
Howell, B.W., Cooper, J.A., Goldowitz, D., Curran, T., 1997. Scrambler and yotari
disrupt the disabled gene and produce a reeler-like phenotype in mice. Nature 389,
730–733.
229
Songyang, Z., Shoelson, S.E., Chaudhuri, M., Gish, G., Pawson, T., Haser, W.G., King, F.,
Roberts, T., Ratnofsky, S., Lechleider, R.J., Neel, B.G., Birge, R.B., Fajardo, J.B., Chou, M.M.,
Hanafusa, H., Schaffhausen, B., Cantley, L.C., 1993. SH2 domains recognize specific
phosphopeptide sequences. Cell 72, 767–778.
Stolt, P.C., Bock, H.H., 2006. Modulation of lipoprotein receptor functions by
intracellular adaptor proteins. Cell Signal. 18, 1560–1571.
Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary
Genetics Analysis (MEGA) Software Version 4.0. Mol. Biol. Evol. 24, 1596–1599.
Taylor, J.S., Raes, J., 2004. Duplication and divergence: the evolution of new genes and
old ideas. Annu. Rev. Genet. 38, 615–643.
Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity
of progressive multiple sequence alignment through sequence weighting, position-
specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680.
Tissir, F., Goffinet, A.M., 2003. Reelin and brain development. Nat. Rev. Neurosci. 4,
496–505.
Trommsdorff, M., Borg, J.P., Margolis, B., Herz, J., 1998. Interaction of cytosolic adaptor
proteins with neuronal apolipoprotein E receptors and the amyloid precursor protein.
J. Biol. Chem. 273, 33556–33560.
Trommsdorff, M., Gotthardt, M., Hiesberger, T., Shelton, J., Stockinger, W., Nimpf, J.,
Hammer, R.E., Richardson, J.A., Herz, J., 1999. Reeler/Disabled-like disruption of
neuronal migration in knockout mice lacking the VLDL receptor and ApoE receptor
2. Cell 97, 689–701.
Vandepoele, K., De, V.W., Taylor, J.S., Meyer, A., Van de, P.Y., 2004. Major events in the
genome evolution of vertebrates: paranome age and size differ considerably between
ray-finned fishes and land vertebrates. Proc. Natl. Acad. Sci. USA 101, 1638–1643.
Yang, C.B., Zheng, Y.T., Kiser, P.J., Mower, G.D., 2006. Identification of disabled-1 as a
candidate gene for critical period neuroplasticity in cat and mouse visual cortex.
Eur. J. Neurosci. 23, 2804–2808.
Zhang, X.H., Chasin, L.A., 2006. Comparison of multiple vertebrate genomes reveals the
birth and evolution of human exons. Proc. Natl. Acad. Sci. USA 103, 13427–13432.