Biol 226 Lab Manual 2023 Fall

BIOL-226
“GENES TO GENOMICS”
LABORATORY MANUAL
FALL TERM - 2023

Logo artwork © 2023 Andres Posso-Terranova
2
THIS PAGE IS INTENTIONALLY LEFT BLANK

3
TABLE OF CONTENTS
PAGE
GENERAL INTRODUCTION………………………………………………………... 5
LABORATORY 1. INTRODUCTION TO GENETICS AND MONOHYBRID
CROSSES…………………………………………………………………….……… 7
GENETICS NOTATION USED IN Drosophila RESEARCH………………………… 11
ASSIGNMENT NO. 1 ……………………………………………………………… 17
LABORATORY 2. Drosophila BREEDING EXPERIMENT (F1 GENERATION) AND
DIHYBRID CROSSES……………………………………………………………….. 25
ASSIGNMENT NO. 2 ……………………………………………………………... 29
LABORATORY 3. Drosophila BREEDING EXPERIMENT (SEX-LINKED TRAITS) ……. 43
ASSIGNMENT NO. 3 ……………………………………………………………… 47
LABORATORY 4. GENE LINKAGE AND CHROMOSOME MAPPING ………………… 57
ASSIGNMENT NO. 4 ……………………………………………………………… 63
LABORATORY 5. Drosophila EYE COLOR: A COMBINATION OF PROTEIN
PIGMENTS………………………………………………………………………….. 71
ASSIGNMENT NO. 5 ……………………………………………………………… 75
LABORATORY 6. THE CHI-SQUARE (X2) TEST: A STATISTICAL TEST FOR
EXPERIMENTS ……………………………………………………………………… 83
ASSIGNMENT NO. 6 ……………………………………………………………… 87
PRACTICE EXERCISES NO. 1 ……………………………………………………… 95
LABORATORY 7. Drosophila CLASS DATA REVIEW: HYPOTHESES TESTING AND
GENE MAPPING……....……………………………………...................................... 97
ASSIGNMENT NO. 7 ……………………………………………………………… 101
LABORATORY 8. DNA GENOTYPING OF Drosophila MUTANTS: THE WHITE-1
LOCUS (W)………………………………………………………………... 107
ASSIGNMENT NO. 8 ……………………………………………………………… 113
PRACTICE EXERCISES NO. 2 ……………………………………………………… 119
LABORATORY 9. POPULATION GENETICS: GENE POOL AND ALLELE
FREQUENCIES ……………………………………………………………………… 125
ASSIGNMENT NO. 9 ……………………………………………………………… 129
APPENDIX I. THE SEX-LINKED FACTORS IN Drosophila ……………………………….. 139
APPENDIX II. COMMON MUTATIONS IN Drosophila ………………………………….. 140
IMPORTANT REFERENCES ……………………………………………………………... 141
4

5
GENERAL INTRODUCTION frequencies behave through generations. At the
The Biol-226 course “Genes to Genomics” at end of the laboratory, students should be
the University of Saskatchewan, as an versant and able to describe:
introductory course, it is aimed to cover a - The Mendelian principles of segregation
variety of topics that will provide the and independent assortment.
foundations for advanced genetics classes (i.e., - Allelic variation and interaction of genes.
plant breeding, molecular genetics, - Sex-linked inheritance and the three-factor
evolutionary processes, etc.). To briefly chromosome mapping technique.
describe the course, it encompasses two main - The polymerase chain reaction method
components: transmission genetics (PCR) and its use for genotyping.
(Mendelian) and molecular genetics. Although - The allele frequency and gene pool
general concepts related to both are presented concepts.
here, the laboratory practice will focus on the
transmission genetics component. This part of LABORATORY HOURS
the course constitutes the basis for your Regular (in-person) Fall and Winter sessions:
understanding of a wide variety of applications. - Morning session: 8:30 AM to 11:20 AM
The laboratory component of the course is - Afternoon session: 1:30 PM to 4:20 PM
based on the study of a model organism: the - Evening session: 5:20 PM to 8:00 PM
fruit fly Drosophila melanogaster. First, we will
study the mode of inheritance in four different EVALUATION
genes and their interactions through the The weighting of the laboratory component
analysis of phenotypic data collected by of the Biol-226 course is defined in the course
breeding one Drosophila cross over a period of syllabus. Overall, the laboratory includes the
six weeks. Then, students will categorize the following evaluations:
phenotypes of a second-generation progeny (F2)
to map genes on a chromosome and determine Lab assignments (9): To be returned after
the genetic distances. Additionally, the labs will each lab session.
include the use of a genetics cross simulator to Lab quizzes (2): Quiz # 1 includes labs 1-4.
complement the analysis of data and Quiz # 2 includes labs 5-9.
understanding of the concepts.
Secondly, students will study how the
production of several protein pigments in NOTE: The lab quizzes will be performed
Drosophila are responsible for differences in eye- through Canvas. These quizzes are intended to
color phenotypes. Third, students will use assess your understanding of the concepts
molecular tools (PCR and electrophoresis) to rather than the repetition of genetics problems
understand how changes in phenotypic traits or memorization.
are related to variation at the DNA level.
Quizzes may include concepts that are
Finally, the last portion of the laboratory will
reinforced during the lecture component
cover some basic concepts on population
(Mendelian genetics, working with
genetics. Here, students will analyze how allele
probabilities, gene mapping, etc.)
6
ATTENDANCE submitted through the LMS (Canvas) before the
Students are expected to attend all the deadline. Usually, the deadline to return the
scheduled labs sessions. If you miss a lab, you assignments is at the end of each laboratory
must contact the lab coordinator by email session. Late assignment submissions are not
within three working days. Students who accepted unless the student provides a valid
provide a valid reason will receive a time and documented excuse.
extension to perform the lab and submit the
corresponding assignment. 7. If you encounter any question during the
development of your lab practice and
LABORATORY RULES assignment, please contact your TAs as a first
1. During the first week of class, the step. Students should also consult the relevant
instructor will provide a schedule of the chapters in the textbook for additional
laboratory activities. It is important to read the information.
lab instructions before you continue with the
practical component (i.e., crossing living IMPORTANT SAFETY INFORMATION:
organisms or computer simulations). - The laboratory is located in the Thordvaldson
Preparation is essential, and students are building (room G77). Please recognize your
expected to be familiar with the content of each closest exit and evacuation routes.
exercise. - Emergency showers are in the preparation
room and in the hall, by the lateral exit.
2. Be on time. Verbal or video instructions - If any chemical spills, use the kit on the demo
will be presented at the beginning of each lab bench. Contact a TA immediately.
session. - If you hurt yourself in one of the labs, please
inform immediately to one of the teaching staff.
3. Lab benches should remain clean and - In case of an emergency: Dial 5555 from a
always uncluttered. Books, bags, purses, and university phone or 306-966-5555 from any
other supplies should be stored under the phone. If required, please call 911 services.
student workstation and away from the work
surface. CONTACT INFORMATION:
LAB COORDINATOR AND INSTRUCTOR
4. For your safety, no smoking, eating, or Dr. Andrés Posso-Terranova
drinking is allowed in the laboratory. E-mail: andres.posso@usask.ca
Telephone: 306-966-4431
5. Check the assignments and quizzes Office: Thorvaldson Building, Rm. G77
deadlines and important dates posted in
Canvas or provided in the lab schedule. If you require assistance, please do not
hesitate to contact us. Email is the preferred
5. Submit your assignments on time. contact option.
Students should be able to complete the The content of this manual for in-person and remote delivery of the Biol-226 laboratory
assignments during the lab session. Then, at the University of Saskatchewan was drafted by Dr. Andres Posso-Terranova.
November – 2022.
physical, or electronic copies should be
LABORATORY # 1: INTRODUCTION TO GENETICS AND MONOHYBRID CROSSES
LEARNING OUTCOMES genetics analyses in microorganisms, plants,

After completing this lab, students should be amphibians, fishes, birds, and mammals.
able to: An important and widely used model
-Describe the different stages of a model organism is Drosophila melanogaster. It is
organism (Drosophila melanogaster) commonly named “fruit fly” because fermented
-Identify the different phenotypic traits and fruit is its main source of food in. nature
recognize male and female flies. (bananas, oranges, apples, etc.). There are
-Use the Drosophila genetics notation to several aspects that make fruit flies a model
represent different genotypes organism for genetics teaching and research
-Determine de mode of inheritance of a trait Some of those include:
based on the analysis of offspring number.
1) The fly is small and can be easily raised in
INTRODUCTION bottles on a simple culture medium.
One of the main aims of genetics is to
understand how traits are transferred from 2) Drosophila flies breed rapidly. One
parents to offspring (heredity). To do so, many complete life cycle requires about 10 – 12 days
genetics analyses rely on the study of parental at 25 0C (short life cycle).
generations (P1-P2), their offspring (F1), and
their further generations (F2, F3, F4, etc.). If these 3) Only one set of parents can produce several
types of studies are performed in organisms hundred offspring flies.
with relatively long-life cycles (humans, cattle,
elephants, etc.), data collection, analysis and 4) There are only four pairs of chromosomes,
drafting conclusions may require an extensive which facilitates genetic studies.
amount of time (several decades). One way to
overcome this potential issue is to use model 5) Availability of many well-characterized and
organisms with shorter life cycles that are easy easy to score morphological mutants.
to breed under laboratory conditions. Several
model organisms are available to perform
*Please consider performing a web search for Drosophila mutants. There is

plenty of multimedia and graphic content available that illustrates the
morphological variation in fruit flies*
8
THE DIFFERENT STAGES OF Drosophila hatching with each testis containing 36 to 38
melanogaster germ cells. In female larvae of similar age, each
ovary is smaller than the testis, and 8 to 12 germ
THE EGG cells are present. Larvae eat their way through
The egg is fertilized as it passes from the the medium, making tunnels as they go. The
ovary through the uterus prior to being laid. larvae grow very rapidly and pass through
Usually, the mature unfertilized egg is arrested three stages called instars. The first and second
at metaphase I and the rest of the meiotic larval instars occur at about 1-day intervals, but
division continues after the entrance of the the third instar lasts 2 days. At the start of the
sperm. Virgin females may lay unfertilized third instar, the first spermatocytes are found in
eggs, although they are relatively few in the testis and by the end of this stage,
comparison with those laid by an inseminated spermatozoa are present in the tips of the testis,
female. The eggs are white, oval, and about 0.5 with spermatocytes filling the remainder. The
mm in length. ovaries develop; however, they still contain
A pair of stalks extends from the egg and only oogonia. The eye-antenna disc can be seen
prevents it from sinking into the soft medium to be divided into its two parts at the beginning
(attachment to surface). One day after the egg is of the third instar. The cells in the eye portion
laid a small larva hatches out of the egg case (at are arranged in clusters corresponding to the
250C). number of ommatidia in the eye of the adult. By
this time, the segmentation of the antenna
THE LARVAE portion has been completed. The mature third
The larva is white and segmented with black instar larva is the stage used for cytological
mouth parts visible at the anterior end. Testes examination of salivary gland chromosomes.
are already present in male larvae at the time of
Eggs Larvae
9
THE PUPA the testes to the vasa efferentia. The wing
A few hours after the mature third instar becomes fully formed and folded. Only during
larvae crawl out of the soft medium and onto a the last half of the pupal period, the oocyte
dry surface, the cuticle begins to thicken, appears in the ovary for the first time. There are
forming what it is known as pupa. still no mature eggs when the female adult is
The pupa is a stationary brown structure that about to emerge from the pupa.
can be seen on the sides of the culture bottle.
Inside the hard case, tremendous changes are THE ADULT
taking place as the larval tissues undergo About 9 to 11 days after the egg is laid,
histolysis and the new tissues and organs of the metamorphosis is completed, and an adult fly
adult are formed. About halfway through the emerges from the pupa. Within half a day, the
pupal period, pigmentation begins to be adults are sexually mature and able to mate,
deposited in the compound eyes and the testes. thus completing the life cycle.
The ovaries become attached to the oviduct and
Pupa
Adult (yellow body, white eyes,

miniature wing mutant)
Illustration of male (left) and female

(right) Drosophila flies.
10
MORPHOLOGY OF A WILD-TYPE Drosophila comb. Because it is found only in adult males
(not female flies), it is an important feature to
HEAD determine the sex of an adult fly. The
It has a pair of antennae and a pair of eyes. abdominal-terminal part is darker in coloration
The eyes are of two types: simple and in males than in females because the abdominal
compound. The compound eyes are large and rings are very close together in male flies. Wild-
are made up of many small units called the type flies show a brownish body color when
ommatidia. These ommatidia form a compared to other mutants (i.e., yellow (y)).
honeycomb type of arrangement. In wild type
flies, the color of the eye is dull red. This is due WING
to different kind of pigments: a red-type and a The wing contains veins from the base to the
brown one. If only one of them is present, the margin to provide support for flying
eye would either be brown (bw) or bright red movements. Although there are two pairs of
(scarlet (s) red). Genetic mutations that affect wings, only one pair is well developed and is
the distribution of one or both of these pigments used for flying (Order Diptera). The other pair
result in many different possible mutant eye is reduced as a small bulbous structure called
color phenotypes (i.e., sepia (se)), while the the halteres, probably used for balance to
complete absence of pigmentation will produce stabilize flight. Several mutations affect the
white-eyed flies (w). wing size and shape. In wild-type flies, the
wing is elongated, and its length is about twice
THORAX (BODY) the size of the body length. Some mutations,
The thorax is composed of three fused for example the miniature mutation (m),
segments, each of them carrying a pair of produces flies with wings slightly larger than
walking legs. The first pair of legs in male flies the body size but never as long as the wild-type
contain a clump of black bristles called the sex wing size.
Adult male (yellow body, white

eyes, miniature wing mutant) Adult male (wild-type eye color)
11
GENETICS NOTATION USED IN Drosophila type. In most cases, the wild-type allele is
RESEARCH dominant. If that is the case, the mutant
character is represented by a lower-case letter,
You are probably familiar with the symbols usually corresponding to the first letter or letters
of an upper-case letter (e.g., A) to designate a of the mutation (e.g., w = white eye; sn = singed
dominant allele and a lower-case letter (e.g., a) bristles). The corresponding wild-type allele
to indicate the recessive allele of the same gene. would have the same lower-case letter with a
However, several different genetic plus symbol (+) superscript (e.g., w+ and sn+).
nomenclatures exist, and the one used will
depend on the organism you are studying. The If the mutant allele is dominant, the symbol
genetics Drosophila nomenclature that you will would be an upper-case letter without a
use to solve your lab assignments is presented superscript (e.g., B = bar eye) and its recessive
in the following paragraphs. Please make sure wild type allele would be an upper-case letter
that you understand its use. You may lose with a + superscript (e.g., B+).
marks if the correct nomenclature is not used in
your assignments. In summary, upper, or lower case indicates
the dominant or recessive nature of the mutant
When one phenotype is the most common in allele and the + symbol indicates the wild type
a population than its alternative phenotype, the (the most common phenotype).
common phenotype is known as the wild type.
The unusual phenotype is called the mutant
Quick guide for Drosophila notation
Wild Type Mutant
If the mutation is Dominant A+ A
If the mutation is Recessive a+ a
chromosome(s) (autosomal vs. sex-linked) and the

LOCATION OF GENES ON CHROMOSOMES presence of genetic linkage among the genes
(genetically linked vs. not linked). The Drosophila
We have described how to use upper- and notation is very useful because it provides
lower-case letters (dominant vs. recessive alleles) additional information on the location of the genes
and the accompanying + symbol (used to when compared with other genetics notations
represent the wild-type allele). The next step is to (E.g., AaBb). The following symbols are used to
check the location of the gene(s) on the
12
indicate the location of different genes on the represents the “X” chromosome, while a pointy-
chromosomes. ended horizontal line represents the “Y”
chromosome.
a) First, the slash symbol (“/”) represents
each homolog chromosome (autosomes). Each
individual’s genotype should include two (//)
symbols due to their diploid nature. If two genes
(a and b) are on different autosomes: Then, female, and male individuals will
have distinct genotype representations (a and b
a//a b//b genes located both on the X chromosome):
b) If two genes (a and b) are located on the

same autosome:
ab//ab
c) If the genes (a and b) are located only on

the sex chromosomes (i.e., X), a horizontal line
*For additional support, please follow the Drosophila notation flow-chart. Understanding
this notation is a key-aspect for your success. Ask your TAs for clarification*
13
HANDS ON: IN-PERSON PRACTICAL COMPONENT

Drosophila BREEDING EXPERIMENT (MAIN CROSS)
phenotypes and distinguish between male and

IMPORTANT INFORMATION: female individuals.
The objective of the main Drosophila cross (living Before you continue, please check the video
flies) is to unravel the genetics basis of four “how to transfer and sleep the flies” available in
different genes (phenotypes). Canvas or the following link:
https://youtu.be/FwdkV_yccN0
Similar to the work of the genetics’ pioneers
(Gregor Mendel, Thomas Morgan, and many
others), you will collect phenotypic data during
the next couple weeks. Then, you will analyze
this information to determine the genetics basis
of the genes controlling those traits (dominant
vs. recessive alleles; autosomal vs. sex-linked
genes).
MAIN MATERIALS:
TECHNIQUE FOR HANDLING FLIES
• A dissection microscope
It is very important to be an expert on the • A frozen cool-pack and a container with ice
procedure for handling living flies. Before • A couple of paint brushes
starting a Drosophila cross, students must be • A vial containing parental flies (main cross)
familiar with anesthetizing the flies with ice -Females: yellow body, white eyes, miniature
and observing them under the dissecting wings
microscope. Then, as the flies are sleeping, you -Males: sepia eyes
can observe and identify the different
P1 Female: yellow body, white P2 Male: Sepia eyes (wild

eyes, miniature wing type for the other traits)
14
PROCEDURE FOR LABORATORY WORK 5. Score the flies and put them in the morgue.
Keep this information safe, as you need this data
1. Work in pairs of students. Collect one vial to complete your assignment.
containing flies. They are in the cart at the front
of the lab room. We already set up your main 6. Return the tube to the rack. You will need the
cross one week ago. flies that will start emerging next week. These
will be the first generation or F1 flies.
Remember the main cross:
Although this cross involves four (4) genes
P1= virgin females, yellow body, white (mutations) you will not determine the mode of
eyes, miniature wings x P2= males, inheritance of all of them at once. Instead, you
sepia eyes. will consider one or two genes at a time for the
first labs. Then, you will consider the mode of
inheritance of three genes (y w m) to test if they
2. Label your tube as P1 X P2 cross. Add your can be mapped in relation to each other.
names.
PROCEDURE FOR CROSS SIMULATIONS
3. Transfer the flies from the food vial to a clean
vial. Use ice to anesthetize the P1 and P2 flies. 1. Launch the cross simulator. If you still need
Observe them using the dissecting scope. help, please check the posted video on how to
use the CGS platform (available on the Lab’s
If you are not sure how to use the dissecting website on Canvas)
scope, please check the video!
2. Please select the wild Drosophila population:
Lab1:GeneticsModel. Make sure you are using
the right population for your crosses. Click on
the “Start Crossing” button.
3. Sort the flies on the wild population by “all

traits”. You will find the following segregating
traits:
https://youtu.be/ssxfsgI81Zs Wing shape: Vestigial – Wild-type (long)
4. Using a brush, move the flies around and 4. Click on the “Show Details” button. You
observe the phenotypes of wild type and will see a table with the number of flies in your
mutants. Identify male and female flies. Make wild population sorted by traits and sex. Please
sure that you have the right parental flies. write down (or save) this information as you
will need it to complete your assignment.
15
5. Return to the “Organisms” tab. You can now ratios is dividing the higher-class number by
start crossing flies by the lowest class number. Example: If you get
selecting the desired 60 wild-type flies and 19 vestigial flies, the ratio
individuals. The will be 60/19 wild-type: 19/19 vestigial flies.
selected parental That is 3.15 wild-type: 1 vestigial flies.
flies, identification
and phenotypes will 7. The simulator will allow saving a maximum
appear on the right. of 20 vials (crosses). If you need to perform
Click on “Cross more crosses, please trash some vials by clicking
Flies” to perform the on the “Destroy” tab (for example, destroy only
cross. vials 1 to 4). Please DO NOT destroy all vials
as we may need this information to check your
6. Perform the work. Analyze your results and provide the
number of crosses required information in your assignment.
described in your
assignment. Record 8. Complete and submit your assignment by
the number of the deadline. Please carefully read each of the
offspring phenotypes and ratios in the provided questions in your assignment.
templates. An easy way to obtain phenotypic
PRACTICE YOUR PHENOTYPING

Left: A yellow body, white eyes, and miniature wing fly. Right: A wild-type fly for wing size, body,
and eye color. Think about the sex of the flies (male vs. female).
16

17
ASSIGNMENT # 1
DEADLINE: RETURN AT THE END OF THE LABORATORY SESSION
OPTION 1: Deposit a physical copy in the cart (front of the lab)
OPTION 2: Submit an electronic copy (i.e., PDF file) through the LMS platform (Canvas)
NAME: ______________________________________ STUDENT #: ___________ DATE: ____________
Drosophila GENETICS NOTATION
1. Based on the notation used in Drosophila research, please provide the genotypes of the following
hypothetical flies. Please fill the boxes with the corresponding symbols.
Hint: Use the first letter(s) of the mutation’s name as the main symbol for the notation. For
example, if the mutation is called “sepia”, you should use “se” for the mutant type and “se+” for
wild-type flies. Keep in mind the location of the genes on the chromosomes (autosomes vs. sex-
linked) and the nature of the mutation (dominant vs. recessive).
Notation (homozygous or pure

Phenotype Genetic basis
breeding)
Body Wild Mutation Male Male Female Female

Mutation Location
part type Type wild mutant wild mutant
Eye Red Sepia Recessive Autosome
X (sex-
Eye Red White Recessive
linked)
Straight
Wing Curly Dominant Autosome
/long
Straight
Wing Vestigial Recessive Autosome
/long
X (sex-
Body Grey Yellow Recessive
linked)
X (sex-
Abdomen Normal Abnormal Dominant
linked)
18
2. Based on the previous information, please assign the genotypes to the different phenotype
combinations. Assume that all individuals are pure breeding lines (i.e., homozygous).
Hint: Carefully consider the nature of the mutation: Dominant vs. Recessive; Autosomal vs. Sex-
linked.
Genes are genetically linked

Phenotype Sex Genotype
(same chromosome)?
Sepia eyes,
No Male
Curly wings
No (Sepia on autosome,
Sepia eyes,
Yellow on the X Female
yellow body
chromosome)
No (Sepia on autosome,
Sepia eyes,
Yellow on the X Male
yellow body
chromosome)
White eyes,
Yes (both in the X
normal Female
chromosome)
Abdomen
White eyes,
Yes (both in the X
abnormal Male
chromosome)
Abdomen
Vestigial
wings, grey No Female
body
Sepia eyes,
vestigial No Male
wings
19
IDENTIFICATION OF PHENOTYPES
3. A wild-type Drosophila fly has dull-red eyes, brownish body color and long wings (about twice the
length or longer than the abdomen). Please provide the most probable phenotype and sex of the
following flies. Tip: please refer to the “Morphology of a wild-type Drosophila” section in the lab
manual for the possible phenotypes.
Eye: ____________ Eye: ____________ Eye: ____________

Body: ___________ Body: ___________ Body: ___________
Wing: ___________ Wing: ___________ Wing: ___________
Sex: ____________ Sex: ____________ Sex: ____________
Eye: ____________ Eye: ____________ Eye: ____________

Body: ___________ Body: ___________ Body: ___________
Wing: ___________ Wing: ___________ Wing: ___________
Sex: ____________ Sex: ____________ Sex: ____________
20
Eye: ____________ Eye: ____________ Eye: ____________

Body: ___________ Body: ___________ Body: ___________
Wing: ___________ Wing: ___________ Wing: ___________
Sex: ____________ Sex: ____________ Sex: ____________
IN-PERSON LABORATORY WORK AND IDENTIFICATION OF PHENOTYPE

WORTH 20% OF ASSIGNMENT GRADE (Q#4)
4. After observing the P1 and P2 flies under the dissecting scope, please summarize the obtained data
in the table below. WT=Wild-type.
Body: Eye: Wing:

Sex Amount
Yellow/WT White/Sepia/WT Mini/WT
Female
Male
Considering that the main cross that you will analyze during the next labs is:
P1 Female: yellow body, P2 Male: Sepia eyes (wild

white eyes, miniature wing type for the other traits)
Did you get the right parental flies in your vial? YES______ No_____
21
GENETICS-MODEL DETERMINATION
5. In the following question, you need to determine the genetics model of the wing-shape trait in
Drosophila (I.e., Dominant vs. Recessive; Autosomal vs. Sex-linked). Please consider the following
information:
A cross between a P1 wild-type male and a P2 vestigial-wing female fly produced a proportion of ½
wild-type; ½ vestigial-wing flies and no difference between sexes (same number of males – females for
the two phenotypes). Another cross between a P3 wild-type male and a P4 vestigial-wing female fly
produced all wild-type flies. Please fill the templates and blank spaces.
*Please use the Drosophila notation to represent the traits. For example, if you assume that
the vestigial phenotype is recessive, you should use lower-case symbols (vg). Then, the
wild-type phenotype should contain the “+” character (vg+) *
P1 possible genotype(s):_____________ P2 possible genotype(s):_____________
P3 possible genotype(s):_____________ P4 possible genotype(s):_____________
Illustrate the two crosses using the Punnet square templates.
P1 x P2 Cross P3 x P4 Cross
Gametes
Gametes
½ wild-type : ½ vestigial-wing All wild-type flies.
-Based on your analysis, the most probable genetics model for the trait is (fill with an “X”):
Wild-type wing shape is: Dominant: _________ Recessive: ___________
Vestigial wing shape is: Dominant: _________ Recessive: ___________
The wing-shape trait is: Autosomal: _________ Sex-linked: ___________

22
COMPUTER SIMULATIONS (CGS)
*IMPORTANT NOTE: For the next set of questions, you need to use the Classical Genetics Simulator
(CGS) available online (www.cgslab.com). Please watch the videos available on Canvas on how to use
this tool. *All crosses performed at the GCS correspond to hypothetical simulated and randomized data. The
actual genetics basis of the genes/traits in nature may be different*.
An easy way to obtain phenotypic ratios is dividing the higher-class number by the lowest-class
number. Example: If you get 60 wild-type and 19 vestigial flies, the ratio will be 60/19 wild-type: 19/19
vestigial flies. That is 3.15 wild-type: 1 vestigial flies.
6. Perform three independent crosses between a wild-type female and a wild-type male. Record the
data in the scoring tables.
Female#___ Male#:____ Female#___ Male#:____ Female#___ Male#:____
Is there any major difference (i.e. bias) between the phenotype numbers of male vs. female flies? ____
For example: All males vestigial (none wild-type); All females wild-type (none vestigial).
*This may be considered evidence of the presence of sex-linkage*
23
7. Perform three independent crosses between a wild-type female and a vestigial-wing male. Record
the data in the scoring tables.
8. Perform three independent crosses between a vestigial-wing female and a wild-type male. Record
the data in the scoring tables.
24
9. Perform three independent crosses between a vestigial-wing female and a vestigial-wing male.
Record the data in the scoring tables.
10. Based on the phenotypic analysis of the previous twelve crosses, does the results support the
genetics model proposed in question #5? YES: _____ NO: _____
Explain:
_______________________________________________________________________
_______________________________________________________________________
_______________________________________________________________________
_______________________________________________________________________
_______________________________________________________________________
*IMPORTANT NOTE*:
Remember to return your assignment at the END of the lab session or to submit an electronic copy
(i.e., scanned PDF file) through CANVAS
25
LABORATORY # 2: Drosophila BREEDING EXPERIMENT (F1 GENERATION) AND

DIHYBRID CROSSES
LEARNING OUTCOMES a dihybrid cross (AaBb X AaBb) the expected F2

When students complete this lab, they ratio is 9:3:3:1. Please refer to the lecture
should be able to: material or the corresponding chapters on the
- Outline the basic theoretical framework to textbook for further explanation on Mendel’s
perform a Drosophila cross (dihybrid cross) laws.
- Obtain and analyze F1 and F2 data that
illustrate the Mendelian principles of TECHNIQUE FOR HANDLING FLIES
segregation and assortment.
- Propose a genetic model of inheritance for Please make sure that you remember how to
two traits (genes) based on the analysis of manipulate living Drosophila flies for their
simulated Drosophila crosses. observation, phenotyping, and scoring. If you
need to review this procedure, please watch the
INTRODUCTION following video:
Mendel’s studies on contrasting
morphological traits in garden peas clearly “How to transfer and sleep the flies”:
established the basic laws of inheritance. First, https://youtu.be/FwdkV_yccN0
the law of segregation of alleles describes that
parental alleles are separated to the gametes
(each containing only one) and therefore,
offspring inherit one allele from each parent
when gametes merge in fertilization. Then, in
this first hybrid generation (F1), alleles separate
again from each other during the formation of
gametes with equal frequency.
Secondly, the principle of independent

assortment states that alleles from different
genes are sorted independently from one
another and hence, inheritance of one trait is not MAIN MATERIALS
dependent on the inheritance of another. For
example, in a dihybrid individual, the alleles of • A dissection microscope
different genes segregate first and then, they • A frozen cool-pack and a container with ice
assort independently with equal frequency into • A couple of paint brushes
gametes. Thus, the expected F2 phenotypic ratio • Your vial (main cross) containing F1 flies
in a monohybrid cross (Aa x Aa) is 3:1; while in • A new empty food vial
26
For the computer simulations you will need:
6. Get a new food vial available in the cart at the
front of the lab. Select 4 males and 4 females to
• Desk or laptop computer. Small devices as cell
setup a new cross (F1 X F1). If less flies are
phones or tablets are not recommended.
available, set up the cross with all of them.
• Any web browser. The most common choices
are Chrome, Mozilla, or Safari.
7. Label the new vial with your initials, date,
• Access to the virtual cross simulator platform
and cross type (i.e., F1 X F1).
(http://www.cgslab.com )
• Notebook and pen (or pencil)
8. Return the new vial to the rack. You will need
• Calculator
the flies that will start emerging in two weeks.
•A virtual Drosophila population
These will be the second generation or F2 flies.
(Lab2:DihybridCross population)

PROCEDURE FOR LABORATORY WORK
1. Launch the cross simulator
(http://www.cgslab.com ). If you still need
1. Work in pairs of students. Collect your vial
help, please check the posted video on how to
from the previous lab practice. They are located
use the CGS platform (available on the Lab’s
in the cart at the front of the lab room.
website on the LMS)
Remember the main cross:

Lab2:DihybridCross. Make sure you are using
P1= virgin females, yellow body, white
eyes, miniature wings x P2= males,
the “Start Crossing” button.
sepia eyes.

2. Check your tube for the presence of F1 flies.
traits:
3. Transfer the flies to a clean vial and use ice to

Eye color: Sepia – Wild-type (dull red)
anesthetize the F1 generation. Observe them
Wing size: Miniature – Wild-type (long)
using the dissecting scope.
4. Click on the “Show Details” button. You

4. Using a brush, move the flies around and
will see a table with the number of flies in your
observe the phenotypes. Identify male and
wild population sorted by traits and sex. Please
female flies.
write down (or save) this information as you
will need it to complete your assignment.
5. Score the different phenotypes and sexes.
Keep this information safe, as you need this
5. Return to the “Organisms” tab. You can now
data to complete your assignment.
start crossing flies by selecting the desired
27
individuals. The selected parental flies, 7. The simulator will allow saving a maximum
identification and phenotypes will appear on of 20 vials (crosses). If you need to perform
the right. Click on “Cross Flies” to perform the more crosses, please trash some vials by clicking
cross. See an example below: on the “Destroy” tab (for example, destroy only
vials 1 to 4). Please DO NOT destroy all vials
6. Perform the number of crosses described in as we may need this information to check your
your assignment. Record the number of work. Analyze your results and provide the
offspring phenotypes and ratios in the provided required information in your assignment.
templates. An easy way to obtain phenotypic
ratios is dividing the higher-class number by 8. Complete and submit your assignment by
the lowest class number. Example: If you get the deadline. Please carefully read each of the
60 wild-type flies and 19 Sepia flies, the ratio questions in your assignment.
will be 60/19 wild-type: 19/19 sepia flies. That
is 3.15 wild-type: 1 sepia flies.
If you need further assistance, please contact your assigned TA or the lab
coordinator. Their contact information is available in Canvas
28

29
ASSIGNMENT # 2
IN PERSON LABORATORY WORK AND IDENTIFICATION OF PHENOTYPES

WORTH 30% OF ASSIGNMENT GRADE (Q#1-2)
1. After observing the F1 flies under the dissecting scope, please summarize the obtained data in the
table below. Please double check the phenotypes with your TA. y=yellow, w=white, m=miniature,
se=sepia, WT= wild-type. NOTE: To get full marks, please record your observed results in the
electronic file available in the link in the Canvas modules (Lab # 2).
Males Females Total

y-w-m se WT y-w-m se WT
Total
Is there any major difference (i.e., bias) between the phenotype of male vs. female flies?
For example: All males are mutants (none are wild-type); All females are wild-type (none are mutants)
YES: ____ NO: ____
2. Based on your analysis of the obtained F1 data, please propose the mode of inheritance of the different
mutations. HINT: Consider the phenotype of the P1 and P2 flies. Then, carefully analyze the segregation
of the traits in the F1 flies.

F1 males phenotype: ______________________________________________
F1 females phenotype: ______________________________________________

30
-Based on your analysis, please propose the most probable genetics model of inheritance for the traits
(fill with an “X”):
Body color:
The gene is: Autosomal: ____ Sex-linked: ____
The wild-type allele (trait) is: Dominant: ____ Recessive: ____
The yellow allele (trait) is: Dominant: ____ Recessive: ____
Eye color (white vs. wild-type):
The white allele (trait) is: Dominant: ____ Recessive: ____
Wing shape color:
The miniature allele (trait) is: Dominant: ____ Recessive: ____
Eye color (sepia vs. wild-type) HINT: The sepia locus is located on an autosome.
The gene is: Autosomal: __X_ Sex-linked: ____
The sepia allele (trait) is: Dominant: ____ Recessive: ____

31
RAPID TEST: MAKE PREDICTIONS USING A PROPOSED MODEL
3. Assume that the yellow body, white eyes and miniature wings are recessive and sex-linked mutations.
The sepia eye color mutation is an autosomal and recessive mutation. Please provide the genotype of
the P1 yellow body, white eyes, miniature wing females and P2 sepia-eyed males (both are homozygous).
Use the notation for Drosophila research (pages 11-12).
P1 yellow, white, mini females: ___________________________________
P2 sepia-eyed males: ___________________________________
4. Please provide the expected phenotype and genotype of the F1 flies. Show your work.
P1: y-w-m females: __________________ X P2: sepia males: __________________
Gametes
F1 genotype(s): ___________________________________________________
F1 phenotypes(s): ___________________________________________________
32
5. Do these expected results (question # 4) correspond with the observed data (question # 1)?
YES: ____ NO: ____
Please provide a brief explanation:
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
GENETICS PROBLEM: IMPROVE YOUR SOLVING SKILLS
In Drosophila melanogaster, Curly is dominant over normal wings (wild type) and brownish body color
(wild type) is dominant over ebony body color (black). Assume that both genes are located on different
autosomes. The following cross between two pure lines (i.e., homozygous) is performed:
P1: females, Curly wings x P2: males, ebony body color

33
Answer the following questions:
6. Based on the genetics notation used in Drosophila, please provide the genotypes of P1 Curly-wing
females and P2 ebony body males.
Hint: For the notation, please consider the following information: females carry the Curly
mutation (Cy) and the wild type allele for body color (b+). The males carry the ebony mutation
(b) and the wild type allele for wing shape (Cy+)
P1 Curly-wing females: ________________ P1 Gametes: ______________
P2 ebony body males: ________________ P2 Gametes: ______________
7. Based on your answer to the previous question, please provide the expected phenotype and genotype
of the F1 flies.
Make a Punnet square if you need it:
Gametes
Phenotype: _____________________________________________________
Genotype: _____________________________________________________
34
8. What are the F2 phenotypic proportions (Ex. 9/16) expected by crossing the F1 males and females?
Show your work using the Punnet square template.
F1 genotype: ________________ X F1 genotype: ________________
Gametes
Phenotypic proportions:
35
9. In Drosophila melanogaster, Bar-shaped eyes are dominant to normal eyes (the most common
phenotype is normal). Assume that this is an autosomal gene and use the Drosophila genetics notation.
- How would you designate the genotype of a homozygous Bar-eyed fly? _________
- How would you designate the genotype of a normal-eye fly? ___________
- What is the phenotype of a heterozygous fly? ____________
- What is the result of a cross between a heterozygous Bar-eyed fly to a normal-eyed fly?. Show your
work using a Punnet square.
36
Remember: for this assignment, you will use the data collected from the simulated crosses using the
Lab2:DihybridCross wild population. To describe the phenotypes, reduce the ratio to its lowest
terms (Ex., 3.1:1).
*All crosses performed at the GCS correspond to hypothetical simulated and randomized data. The
actual genetics basis of the genes in nature may be different*
Based on the simulation of several crosses (dihybrid), you need to determine the genetics model of two
traits (I.e., Dominant vs. Recessive; Autosomal vs. Sex-linked). Please simulate the following crosses
using the Lab2:DihybridCross population and fill the tables with the required information.
Hint: When you are studying a cross that includes several traits, start your analysis with one
trait at a time. For example, start by crossing two flies with the same wing shape without
considering the body color.
10. Wing shape: perform three independent crosses between a wild-type female and a wild-type male.
Record the data in the scoring tables. The number of obtained flies is available in the “show details” tab
of each corresponding vial.
For example: All males Curly (none wild-type); All females wild-type (none Curly).
37
11. Wing shape: perform three independent crosses between a wild-type female and a Curly-winged
male. Record the data in the scoring tables. Make sure that you use different parental flies each time
you perform a cross.
12. Wing shape: perform three independent crosses between a Curly-winged female and a wild-type
*This may be considered evidence of the presence of sex-linkage**
38
13. Wing shape: perform three independent crosses between a Curly-winged female and a Curly-
winged male. Record the data in the scoring tables. Make sure that you use different parental flies each
time you perform a cross.
14. Based on your analysis of the previous twelve crosses, propose a genetics model of inheritance for
the wing shape trait:
Can you determined the mode of inheritance using the collected data: YES: _____ NO:______
If your answer is “NO”, try performing additional crosses (wild-type x Curly) until you are
completely sure about your conclusions.
Wild-type wing is: Dominant: _________ Recessive: ___________
Curly wing shape is: Dominant: _________ Recessive: ___________
The wing shape gene (trait) is: Autosomal: _________ Sex-linked: ___________
Does the genetics model of the simulation correspond to that of question # 6?. Please explain
_______________________________________________________
_______________________________________________________
_______________________________________________________
39
In the following section, you will focus on the analysis of the second trait (body color).
15. Body color: perform three independent crosses between a wild-type female and a wild-type male.
Record the data in the scoring tables. The number of obtained flies is available in the “show details” tab
of each corresponding vial.
For example: All males ebony (none wild-type); All females wild-type (none ebony).
16. Body color: perform three independent crosses between a wild-type female and an ebony body
40
17. Body color: perform three independent crosses between an ebony body female and a wild-type
18. Body color: perform three independent crosses between an ebony body female and an ebony body
41
19. Based on your analysis of the previous twelve crosses, propose a genetics model of inheritance for
the body color trait:
Can you determine the mode of inheritance using the collected data: YES: _____ NO:______
If your answer is “NO”, try performing additional crosses until you are completely sure.
Wild-type body color is: Dominant: _________ Recessive: ___________
Ebony body color is: Dominant: _________ Recessive: ___________
The body color gene (trait) is: Autosomal: _________ Sex-linked: ___________
Does the genetics model of the simulation correspond to that of question # 6?. Please explain
_______________________________________________________
_______________________________________________________
_______________________________________________________
*IMPORTANT NOTE*:
42

43
LABORATORY 3. Drosophila BREEDING EXPERIMENT (SEX-LINKED TRAITS)
LEARNING OUTCOMES termed X-linked or Y-linked. In Drosophila,

At the end of this lab practice, students Thomas Hunt Morgan provided the first
should be able to: experimental proof to demonstrate that alleles
- Obtained and analyze simulated F1 data of a gene were sex-linked. His investigation of
that illustrate sex-linkage. the inheritance of the white-eyed trait resulted
- Propose a genetic model of inheritance for in assigning the gene for white eyes to the X
two traits based on the analysis of simulated chromosome. In his studies, he also
Drosophila crosses. demonstrated that the white mutation
- Analyze hypothetical crosses that illustrate (recessive form, w) is epistatic over the sepia
a gene-interaction case (i.e., recessive epistasis). (se) mutation. Hence, when the w mutation is
present, the expression of the se allele is
INTRODUCTION repressed. Please consider this information
when solving some of the genetics problems in
Interaction of Genes and Epistasis the lab assignment.
Many dihybrid crosses deviate from the If you would like to explore more
classical 9:3:3:1 ratio. Alleles of independently information about sex-linked genes in
segregating genes interact with one another to Drosophila, please refer to the book “Sex-linked
produce novel phenotypes in further Inheritance in Drosophila” by Thomas H.
generations (F1 and F2). In some cases, alleles of Morgan and Calvin B. Bridges freely available
one gene prevent the expression of alleles of at the following link:
other genes, yielding different ratios such as 9:7, https://www.gutenberg.org/files/34368/3
9:3:4, 15:1. The term epistasis is used to describe 4368-h/34368-h.htm .
when the action of allele(s) of one gene prevent
the expression of the allele(s) of another gene. The “forked-line” method
Crosses involving an epistatic mode of Punnet squares are straightforward when
inheritance have been used to determine the dealing with one or two genes. However, when
particular position of genes in a metabolic using three or more genes, the method becomes
pathway or network. A detailed description of more complicated. For example, if considering
the different epistatic models is available in the three unlinked genes with two alleles, each
“Gene Interaction” chapter on the parent can produce 8 different gametes (2n),
recommended textbook. which will generate 64 possible genotypic
combinations in the Punnet square (8 x 8). In
Sex Linkage this case, it is more effective to use the forked-
The term sex-linkage refers to the genes that line method to determine the possible outcomes
are tied to the sex chromosomes, rather than of the cross (phenotypic and/or genotypic
non-sex chromosomes (autosomes). In humans probabilities).
and many other organisms, these genes are In the forked-line method, each branching
point represents the expected segregation of
44
phenotypes or genotypes for only one Traits:
particular trait based on the parental genotypes.
Then, multiplying the expected fractions across Plant height: T: tall; t: dwarf
the diagram will provide the expected Seed color: Y: yellow; y: green
frequency (or probability) of any phenotypic or Seed texture: R: smooth; r:wrinkled
genotypic combination. Let’s consider the
following example to estimate the phenotypic
frequencies of a tri-hybrid cross.
P1: Tt Yy Rr X P2: Tt Yy Rr
Tip: If you consider only one trait, for example plant height, the cross Tt x Tt will produce ¾ T_ (tall)
and ¼ tt (dwarf) plants. Keep branching the fork with the remaining traits (genes).
MAIN MATERIALS 4. Using a brush, move the flies around and
• A dissection microscope female flies.
• A frozen cool-pack and a container with ice
• A couple of paint brushes 5. Score the flies and put them in the morgue.
• Your vial (F1 X F1 cross) containing F1 parental Keep this information safe, as you need this data
flies. to complete your assignment.
For the computer simulations you will need: 6. Return the tube to the rack. It is extremely
important that you remove the F1 x F1 parentals
from the tube. Then, you will analyze the flies
that will start emerging next week. These will be
the second generation or F2 flies.
• Notebook and pen (or pencil) (http://www.cgslab.com ). If you still need
• Calculator help, please check the posted video on how to
•A virtual Drosophila population use the CGS platform (available on the Lab’s
(Lab3:SexLinkage population) website on the LMS)
PROCEDURE FOR LABORATORY WORK 2. Please select the wild Drosophila population:
Lab3:GeneLinkage. Make sure you are using
1. Work in pairs of students. Collect your vial the “Start Crossing” button.
from the previous lab practice. They are located
in the cart at the front of the lab room. 3. Sort the flies on the wild population by “all
Remember the cross in this vial: traits:
F1 females (WT) x F1 males (yellow, Eye color: Sepia–Wild-type (dull red)

white, miniature) Body color: Yellow–Wild-type (brownish)
2. Check your tube for the presence of F1 4. Click on the “Show Details” button. You
parental flies. will see a table with the number of flies in your
wild population sorted by traits and sex. Please
3. Transfer the flies to a clean vial and use ice to write down (or save) this information as you
anesthetize them. Observe them using the will need it to complete your assignment.
dissecting scope.
46
5. Return to the “Organisms” tab. You can now will be 60/19 wild-type: 19/19 sepia flies. That
start crossing flies by selecting the desired is 3.15 wild-type: 1 sepia flies.
individuals. The selected parental flies,
identification and phenotypes will appear on 7. The simulator will allow saving a maximum
the right. Click on “Cross Flies” to perform the of 20 vials (crosses). If you need to perform
cross. See an example below: more crosses, please trash some vials by clicking
on the “Destroy” tab (for example, destroy only
6. Perform the number of crosses described in vials 1 to 4). Please DO NOT destroy all vials
your assignment. Record the number of as we may need this information to check your
offspring phenotypes and ratios in the provided work. Analyze your results and provide the
templates. An easy way to obtain phenotypic required information in your assignment.
ratios is dividing the higher-class number by
the lowest class number. Example: If you get 8. Complete and submit your assignment by
60 wild-type flies and 19 Sepia flies, the ratio the deadline. Please carefully read each of the
questions in your assignment.
47
ASSIGNMENT # 3
IN-PERSON LABORATORY WORK AND IDENTIFICATION OF PHENOTYPES

1. After observing the F1 parental flies (F1 x F1) under the dissecting scope, please summarize the
obtained data in the table below. Please double check the phenotypes with your TA. y=yellow,
w=white, m=miniature, se=sepia, WT= wild-type
Males Females Total

y-w-m se WT y-w-m se WT
Total
*To get full marks, please record your data in the file available online through the modules tab in
Canvas (Lab # 3)*
PREDICTIONS USING A MODEL: THE SECOND GENERATION (F2)
You already proposed a genetics model of inheritance for the yellow, white, miniature, and sepia
mutations (pages 29-31). Using this information, please answer the following questions.
2. Please provide the genotype and phenotype of the F1 flies.
F1 genotype(s): ___________________________________________________
F1 phenotypes(s): ___________________________________________________
3. Please use the following template to draw a Forked-lined method to estimate the expected
phenotypic frequencies of the F2 offspring.
48
Important information: 1) Please do not consider the sex of the flies, only the phenotypes. 2) When
both, white and sepia mutations are present (w-se), the resulting flies will show white eyes (w). This is
due to an epistatic interaction that will be studied in further labs.
Body color Eye color Wing size Eye color Proportion

(yellow – wt) (white – wt) (miniature – wt) (sepia – wt)
49
Lab3:SexLinkage wild population. To describe the phenotypes, reduce the ratio to its lowest terms
(Ex., 3.1:1).
Based on the simulation of several crosses (dihybrid), you need to determine the genetics model of two
traits (I.e., Dominant vs. Recessive; Autosomal vs. Sex-linked). Please simulate the following crosses
using the Lab3:SexLinkage population and fill the tables with the required information.
Hint: When you are studying a cross that includes several traits, start your analysis with one
trait at a time. For example, start by crossing two flies with the same wing shape without
considering the body color.
4. Eye color: perform three independent crosses between a wild-type female and a wild-type male.
Record the data in the scoring tables. The number of obtained flies is available in the “analysis” tab of
each corresponding vial.
Considering only eye-color, is there any major difference (i.e. bias) between the phenotype numbers
of male vs. female flies? _____
For example: All males sepia (none wild-type); All females wild-type (none sepia)
50
5. Eye color: perform three independent crosses between a wild-type female and a sepia-eyed male.
Record the data in the scoring tables. Make sure that you use different parental flies each time you
perform a cross.
of male vs. female flies? ____
6. Eye color: perform three independent crosses between a sepia-eyed female and a wild-type male.
perform a cross.
51
7. Eye color: perform three independent crosses between a sepia-eyed female and a sepia-eyed male.
perform a cross.
8. Based on your analysis of the previous nine crosses, propose a genetics mode of inheritance for the
eye color trait:
Wild-type eye coloration is: Dominant: _________ Recessive: ___________
Sepia eye coloration is: Dominant: _________ Recessive: ___________
The eye-color trait is: Autosomal: _________ Sex-linked: ___________

52
In the next section, you will focus on the analysis of the second trait (Body color).
9. Body color: perform three independent crosses between a wild-type female and a wild-type male.
Record the data in the scoring tables. The number of obtained flies is available in the “analysis” tab of
each corresponding vial.
For example: All males yellow (none wild-type); All females wild-type (none yellow)
10. Body color: perform three independent crosses between a wild-type female and a yellow-body
53
11. Body color: perform three independent crosses between a yellow-body female and a wild-type
12. Body color: perform three independent crosses between a yellow-body female and a yellow-body
54
13. Based on your analysis of the previous nine crosses, propose a genetics mode of inheritance for
the body color trait:
Wild-type body color is: Dominant: _________ Recessive: ___________
Yellow body color is: Dominant: _________ Recessive: ___________
The Body-color trait is: Autosomal: _________ Sex-linked: ___________
Please consider the following information to solve the next genetics problem
A scientist performed a cross between a P1 The cross produced the following offspring:
yellow-body and brown-eyed female and a P2
wild-type male, both were pure lines (i.e. 100% females: Wild type (body and eyes)
100% males: yellow body, wild-type eyes
homozygous). Also, it is known that both genes
are located on different chromosomes.
14. Based on the F1 results, are the alleles for yellow body and brown eyes dominant or recessive? Are
those genes autosomal or sex-linked? Use the table below to fill the right cell with an “X”.
Mutation Dominant Recessive Autosomal Sex-linked
Yellow
body
Brown
eyes
55
15. Based on the notation used in Drosophila research, please provide the genotype of the P1 yellow body
and brown-eyed female and P2 wild-type male (both are homozygous).
Hint: For the notation, please consider the following information: females carry the yellow body
(y) and the brown (bw) mutations. The males carry the wild-type allele for both genes (y+ and bw+)
P1 yellow body, brown-eyed females: ________________
P2 wild-type males: ________________
16. Please provide the expected phenotype and genotype of the F1 flies. Show your work.
Gametes
F1 genotype(s): ___________________________________________________
F1 phenotypes(s): ___________________________________________________
17. What are the expected F2 phenotypic proportions (Ex. ¾ ; ¼ ) expected by crossing the F1 males and
females? Please provide the F1 genotypes and show your work in the Punnet square template. Reduce
the proportions to the lowest terms (Ex. 2/4 should be expressed as ½)
56
F1 females: ______________ X F1 males: ________________
Gametes
Proportions:
*IMPORTANT NOTE*:
57
LABORATORY 4. GENE LINKAGE AND CHROMOSOME MAPPING
LEARNING OUTCOMES Then, new combinations of alleles and

When students have completed this phenotypes are produced at the end of meiosis
laboratory practice, they should be able to: (recombinant gametes). Since the frequency of
- Obtain and analyze simulated F1 data that crossovers depends on the physical distance
illustrates trihybrid and test-crosses. between two genes, their distance can be
- Describe the difference between determined using the frequency of
independent assortment and gene linkage by recombination.
analyzing progeny numbers. If the relative distance between more than
- To map three sex-linked genes by analyzing two linked genes is determined, a genetic map
real-case data from a Drosophila cross can be constructed showing the relative
- To map three genes on a chromosome based positions of the genes on a chromosome. Such
on simulated data of a trihybrid test cross. maps can be viewed as a one-dimensional
model and can be useful for further genetic
INTRODUCTION analysis.
LINKAGE AND CHROMOSOME MAPPING CHROMOSOME MAPPING

When two genes are located on the same The position of genes on chromosomes is
chromosome at a relatively small distance, usually determined indirectly by calculating
recombination frequencies do not yield the the frequency of recombination between
expected ratios under the assumption of linked genes. The following recombination
independent assortment. Instead, such genes values from three individual 2-point crosses
tend to segregate together and are termed (hypothetical examples of test-crosses) may be
“genetically linked”. Most of the time, this used to illustrate the method for constructing
linkage is not complete due to the occurrence of linkage maps.
crossing over between homologous
chromosomes (recombination) during meiosis.
Cross # Details of cross % Recombination
1 P1= AB//AB X P2 = ab//ab
F1= AB//ab; then, test cross to ab//ab 36.7% between a and b genes
2 P1= BC//BC X P2= bc//bc
F1= BC//bc; then, test cross to bc//bc 10.7% between b and c genes
3 P1= AC//AC X P2 ac//ac
F1= AC//ac; then, test cross to ac//ac 45.0% between a and c genes
58
Based on the recombination values from the outside genes (a-c) does not match the sum of
three test-cross experiments, we can map the the intermediary distances (a-b) + (b-c):
genes a, b, and c as follows:
a-b (36.7 cM) + b-c (10.7 cM) ¹ 45 cM
This discrepancy can be solved by further

experiments. A three-point (trihybrid) test-
cross provides more information regarding the
Thus, the gene order (i.e. a-b-c) and the recombination events that will allow solving the
distance between the genes can be established issue. For example:
on the basis of the percentage of
recombination. In genetics, this percentage of P1= ABC//ABC X P2= abc//abc
recombination is equivalent to centimorgans
(cM) or map units (m.u.) which are the units for Then, a test-cross:
measuring genetic linkage (not true physical
distance). However, the previous example of F1= ABC//abc X P2=abc//abc
individual two-point crosses for mapping three
genes has a problem: the distance between A test-cross progeny example would be:
Class Phenotype Type of gametes Amount %

1 ABC Parental 261 53.8
2 abc Parental 277
3 Abc Single crossover 173 35.5
4 aBC Single crossover 182
5 ABc Single crossover 44 9.5
6 abC Single crossover 51
7 AbC Double crossover 5 1.2
8 aBc Double crossover 7
IMPORTANT TIP: Note that the highest two classes (261 and 277) correspond to the offspring
produced by parental gametes (the ones on each homolog chromosome of the F1 parental,
ABC//abc). The two smallest classes (5 and 7) correspond to the offspring produced by double
crossovers gametes (or double recombinants: AbC and aBc).
When compared to the method based on considered, the phenotype of the double
separate dihybrid test crosses, a three-point test crossover progeny (AbC and aBc) is identical to
cross allows the identification of double the parental classes (ABC and abc) and would
crossovers between flanking markers (A and C go unrecognized as recombinant progeny.
in the example). A dihybrid test-cross, however, While calculating the percentage of
does not detect such double crossover recombination between genes, all of the
individuals. For example, if gene B is not crossovers taking place between any two genes
59
must be added together before dividing by the C= 0.012 / 0.039 = 0.307.
total number of progeny (i.e. single + double
crossovers). If we apply this rule to the test This value (0.307) indicates that there is a
cross progeny results, then we can determine deviation from the expected. vs. observed
the correct order of genes and estimate the number of double crossovers (this ratio should
distances between them. be = 1, if no interaction is present). This
deviation is known as crossing over
Distance between a and b = interference (I).
(173+182+5+7)/total= 0.367 or 36.7% To calculate the interference value (I), we can
use the following formula:
Distance between b and c =
(44+51+5+7)/total = 0.107 or 10.7% I = 1 - coefficient of coincidence (C)
Distance between a and c = I = 1 - 0.307 = 0.692.

(173+182+44+51+2(5+7))/total= 0.474 or 47.4%
A positive interference value indicates that
Thus, a three-point test cross experiment a crossover in one region (a–b) of the
offers us: chromosome decreases the chance of obtaining
- The advantage of being able to detect a crossover in an adjacent region (b–c), or vice
double crossover progeny produced by versa. A coefficient of coincidence C=0
simultaneous crossovers between the a and b, indicates complete interference (I=1), whereas
and b and c genes. a C=1 indicates no interference (I=0). A
- The ability to estimate the level of coefficient of coincidence greater than one will
interaction between those genes by calculating result in a negative interference value, which
the coefficient of coincidence. implies that a crossover in one region increases
the chance of getting a crossover in an adjacent
Coincidence (C) is calculated by comparing region.
the observed and expected number of double
crossovers. The expected number of double Considering this background information,
crossovers is estimated by multiplying the students should be able to analyze the F2 results
probability of single crossovers between a-b from a trihybrid cross performed in the
and b-c. laboratory to determine the mode of
Thus, the expected frequency of double inheritance and map in a chromosome three
crossovers (DC) for the three-point test cross is sex-linked genes: the yellow (y), white (w) and
0.367 X 0.107 = 0.039. The observed frequency of miniature (m) mutations.
double crossovers is 5+7/total= 0.012. By
applying the following formula, we can obtain MAIN MATERIALS
the coefficient of coincidence (C)
C = observed frequency DC/expected • A dissection microscope
frequency DC • A frozen cool-pack and a container with ice
60
• A couple of paint brushes phenotypic variation (see page # 46). Keep this
• Your vial (F1 X F1 cross) containing F2 flies. information safe, as you need this data to
complete your assignment (question # 1).
For the computer simulations you will need: Discard the flies in the morgue.
6. Return the tube to the rack. You will need the

flies for a second round of scoring next week.
Remember that these flies are the second
generation or F2 flies.
• Calculator
(http://www.cgslab.com ). If you still need
•A virtual Drosophila population help, please check the posted video on how to
(Lab4:GeneMapping population) use the CGS platform (available on the Lab’s
website on the LMS)
PROCEDURE FOR LABORATORY WORK
Lab4:GeneMapping. Make sure you are using
1. Work in pairs of students. Collect your vial the right population for your crosses. Click on
from the previous lab practice. They are located the “Start Crossing” button.
in the cart at the front of the lab room.
Remember the cross in this vial: traits”. You will find the following segregating
traits:
F1 females (WT) x F1 males (yellow,
white, miniature) Eye color: White–Wild-type (dull red)
Body color: Yellow–Wild-type (brownish)
2. Check your tube for the presence of F2 flies. Wing size: Miniature–Wild-type (long)
3. Transfer the flies to a clean vial and use ice to 4. Click on the “Show Details” button. You
anesthetize them. Observe them using the will see a table with the number of flies in your
dissecting scope. wild population sorted by traits and sex. Please
write down (or save) this information as you
4. Using a brush, move the flies around and will need it to complete your assignment.
female flies. 5. Return to the “Organisms” tab. You can now
start crossing flies by selecting the desired
5. Score the flies. Remember that in this individuals. The selected parental flies,
generation you are expecting a wide range of identification and phenotypes will appear on
61
the right. Click on “Cross Flies” to perform the 7. The simulator will allow saving a maximum
cross. See an example below: of 20 vials (crosses). If you need to perform
more crosses, please trash some vials by clicking
6. Perform the number of crosses described in on the “Destroy” tab (for example, destroy only
your assignment. Record the number of vials 1 to 4). Please DO NOT destroy all vials
offspring phenotypes and ratios in the provided as we may need this information to check your
templates. An easy way to obtain phenotypic work. Analyze your results and provide the
ratios is dividing the higher-class number by required information in your assignment.
the lowest class number. Example: If you get
60 wild-type flies and 19 Sepia flies, the ratio 8. Complete and submit your assignment by
will be 60/19 wild-type: 19/19 sepia flies. That the deadline. Please carefully read each of the
is 3.15 wild-type: 1 sepia flies. questions in your assignment.
62

63
ASSIGNMENT # 4

se=sepia, WT= wild-type. NOTE: To get full marks, please also record your data in the file available
online through the modules tab in Canvas (Lab # 4).
Phenotype Sex Amount Total
F
WT
M
F
y, w, m
M
F
y
M
F
w, m
M
F
y, w
M
F
m
M
F
w
M
F
y, m
M
F
se
M
F
y, se
M
F
m, se
M
F
y, m, se
M
64
MAPPING BASED ON REAL DATA
During the Fall-2022 term, the biol226 students in your same lab section performed a test-cross between
a wild-type heterozygous female with a yellow body, white eyes, and miniature wing male. As you
already concluded, the three mutations are recessive, and sex (x)-linked. Fill the table with the observed
number of flies.
Your lab section (e.g., Tuesday morning): ______________________________________________________
wild ywm y mw yw m w ym Total
2. Use the table below to summarize the observed data. Then, use this information to map the three
genes (m w y). Calculate the map distances and the C and I value.
Observed Genotype (F1 female *Type of gamete (PR, SR

Phenotype
amount gametes) or DR)
Wild type
Yellow, white, miniature
Yellow
Miniature, white
Yellow, white
Mini
White
Yellow, mini
Total
*PR: Parental; SR: single recombinant; DR: Double recombinant
Hint: First, identify parental (PR) (larger classes) and double recombinant (DR) offspring (smaller
classes). Remember the rule: When you compare PR vs. DR, the gene that has been switched (i.e.
different allele), is the one in the middle.
3. Gene order: ________________

65
Calculate the genetic distances (show your work and units):
4. y-w=
5. w-m=
6. y-m=
Summary distances (include units):

66
To calculate Coincidence and Interference, please review the formulas:
Obs. Freq. DR
𝐶= 𝐼 =1−𝐶
Exp. Freq. DR
7. C: ________________
8. I: ________________
9. Please provide a brief explanation of the Coincidence and Interference values that you calculated. Is
there any “interference”? What does it mean?
_______________________________________________________________________
_______________________________________________________________________
_______________________________________________________________________
_______________________________________________________________________
_______________________________________________________________________
67
Lab4:GeneMapping wild population. To describe the phenotypes, reduce the ratio to its lowest
terms (Ex., 3.1:1).
Based on previous experiments and literature reports, the genes for body color, eye color and wing size
are located on the same chromosome and the genetics model is known (i.e. all three; yellow, white and
miniature are recessive mutations). However, you need to determine: 1) whether there is genetic
linkage between those genes and, 2) the genetic distances between the genetically linked genes.
10. Body color, Eye color and Wing size: Perform a tri-hybrid, test cross between a wild -type fly
(heterozygote) and a yellow body, white eyed, miniature wing fly. You can see the genotype of the
flies, then, make sure that you are using the right flies in the cross (for example, AaBbCc X aabbcc).
ONLY if these genotypes are not available in the wild population, please use the data available in
Canvas. Record the number of offspring in the scoring template.
Female #: ______ Male#: _______
Number of parental offspring:
Wild-type: ____________ Yellow, white, miniature: ___________
Number of double-recombinant offspring:
White: ____________ Yellow, miniature: ___________ Gene order: _______________

68
11. y-w=
12. w-m=
13. y-m=
Summary distances:
69
Obs. Freq. DR
𝐶= 𝐼 =1−𝐶
Exp. Freq. DR
14. C: ________________
15. I: ________________
_______________________________________________________________________
_______________________________________________________________________
_______________________________________________________________________
_______________________________________________________________________
_______________________________________________________________________
70
Please consider the following information to solve the next genetics problem
In Drosophila the genes for body color and wing shape are genetically linked on an autosome (28 map
units). Black body color and vestigial wing shape are both recessive mutations.
A cross between a female Drosophila (bk+ vg+ // bk vg) and a male (bk vg // bk vg) produced a progeny
of 1000 flies. Out of this progeny, how many flies would be:
Hint: Remember that 22 map units is the same as 22% percentage of recombination
17. Grey body and long wings (wild-type)? Show your work.
18. Black body and wild-type wings? Show your work.
*IMPORTANT NOTE*:
71
LABORATORY 5. Drosophila EYE COLOR: A COMBINATION OF PROTEIN PIGMENTS
LEARNING OUTCOMES In Drosophila melanogaster, the brick-red eye

When students have completed this color (wild type) is due to the presence of two
laboratory practice, they should be able to: distinct classes of protein pigments: pteridines
- Describe how the eye color variation in and ommochrome. These two types of pigments
Drosophila is based on protein-pigment are synthesized by two separate biochemical
differences. pathways and wild-type flies contain all of
- Identify some of the genes (enzymes) that them. Their precursor molecules are
are involved in the biosynthesis of protein transported to the compound eyes by
pigments. transporter proteins (ABC proteins) coded by
- Recognize the epistatic interactions the scarlet (st) gene (tryptophan importing), the
between some of the genes responsible for the brown (bw) gene (GTP importing) and the
eye pigment coloration. white (w) gene (common subunit required for
- Implement an experiment to illustrate how importing both precursors). The enzymes that
protein pigments can be separated and are specific to each pathway (# 1 to 9 in the
analyzed by chromatography. figure) are coded by nuclear genes and the two
pathways are under genetic control.
INTRODUCTION
PRECURSOR PTERIDINE PATHWAY

MOLECULE
GTP
Brown gene
White gene
Scarlet gene
Tryptophan
Mutations in one or both pigment pathways Metabolic pathways: investigating the
will produce mutant flies with eye colors biology and chemistry of pigmentation
different to the wild-type brick red. If a https://droso4schools.wordpress.com/l4-
mutation in a gene coding for an enzyme in the enzymes/
ommochrome pathway, the brown pigment
will not be synthesized, and the resulting In today’s laboratory experiment, students
mutant fly will have bright red color (scarlet will be extracting the eye pigments from wild-
red, st). type, sepia, white, scarlet, and brown flies. The
If a mutation occurs in one of the genes extracted pigments will then be used for a Thin
coding for any of the intermediate compounds Layer Chromatography (TLC) experiment to
in the pteridine pathway, the resulting fly may separate seven pteridine compounds. Only
have brown, dark brown or even black eyes. these compounds fluoresce under UV light, not
For example, the absence of drosopterin the ommochrome ones.
pigment (#6) will produce flies with sepia eye Before setting up the experiment, observe the
color. Hence, in this case a mutation at the sepia eye colors of the flies provided in separate vials.
gen (se) will inhibit the synthesis of the Based on the mutant phenotypes and the
drosopterin pigment. If none of the pteridine pteridine pathway, think about a suitable
pigments is produced and only the hypothesis and try predicting the expected
ommochrome is present, the fly will show results for the experiment.
brown eyes (bw).
If both precursor molecules are not Please watch a video describing the practical
transported to the pigment granules by component of the TLC experiment in the
transporter proteins (for example, a mutation in following link:
the white gene), the absence of pigmentation
will cause the mutant fly to have white eyes. TLC Drosophila eye-pigments
This mutation in the white gene (w) is the https://youtu.be/x8bXqC-Au04
famous sex(x)-linked mutation discovered in
1910 by Thomas Hunt Morgan. If you would A diagram representing the different
like to improve your knowledge about the patterns of migration of the pigments in the
biology and chemistry of pigmentation, please TLC plate is presented in the following figure:
visit the following website: .
73
Wild type (+) Brown (bw) White (w) Scarlet (st) Sepia (se)
(Pteridine (Only No pigments (Only (Only

AND ommochrome are present pteridine Drosopterin
ommochrome pigment) pigments are pigment is
pigments) present) absent)
Remember the cross in this vial:

MAIN MATERIALS
F1 females (WT) x F1 males (yellow,
• Your vial containing F2 flies white, miniature)
• Drosophila Flies: Wild, Sepia (se), White (w),
Scarlet (st), and Brown (bw) (5 phenotypes) 2. Check your tube for the presence of F2 flies.
• Fluorescent UV light
• Dissection microscope 3. Transfer the flies to a clean vial and use ice to
• Plastic pestles anesthetize them. Observe them using the
dissecting scope.
• Microtubes (1.5 ml)
• A TLC plate (glass-backed silica gel)
4. Using a brush, move the flies around and
• Paintbrush
• Solvent (1:1 mixture of n-propyl alcohol and
female flies.
28% ammonium hydroxide)
• Marking pens, pencil, ruler
5. Score the flies. Remember that in this
generation you are expecting a wide range of
PROCEDURE FOR LABORATORY WORK phenotypic variation (see page # 46). Keep this
information safe, as you need this data to
complete your assignment (question # 1).
1. Work in pairs of students. Collect your vial
Discard the flies in the morgue.
from the previous lab practice. They are in the
cart at the front of the lab room.
6. Discard the vial in the bin located in the front
of the lab. No further phenotyping is required.
74
THIN LAYER CHROMATOGRAPHY (TLC) - Dispose the tube and the tip into the
EXPERIMENT appropriate container.
- Allow the TLC plates to dry (3 minutes)
1. Work in groups of 5 students. Each student - Use forceps to hold the top end of the TLC -
should collect 2 flies per each of the 5 plate, and gently lower the bottom of the TLC
phenotypes. Deposit the flies in the 1.5 ml tubes. plate into a beaker (do this step in a fume hood
or ask a TA to do it for you).
2. Collect one TLC plate. Draw a light pencil line - Run the experiment for 35 to 50 minutes in the
1-2 centimeters from one end of the plate. This dark as pteridines are light sensitive.
would be the bottom of the plate. Place 5 tick - Check the experiment periodically to make
marks at even intervals on the line. Label the sure that solvent does not go beyond the end of
tick marks with the mutant symbols: +, se, w, the plate.
st, bw. - Allow the TLC plate to air dry.
- Wrap your TLC plate in aluminum foil, label it
3. Each student in the group will extract the eye with your name, and leave it for analysis until
pigments as follows: next week.
- Add 2-3 drops of solvent. Crush/grind the flies Please watch a video describing the practical
with a plastic pestle. component of the TLC experiment in the
- Allow the vial to sit for a 1 minute. following link:
- Use the pipette tip to spot the extracted
pigment onto your TLC plate. TLC Drosophila eye-pigments
- Let the spot dry before applying the next drop https://youtu.be/x8bXqC-Au04
(apply 5-10 drops in total).
75
ASSIGNMENT # 5

se=sepia, WT= wild-type. NOTE: To get full marks, please also record your data in the file available
online through the modules tab in Canvas (Lab # 5).
M
WT
F
M
y, w, m
F
M
y
F
M
m, w
F
M
y, w
F
M
m
F
M
w
F
M
y, m
F
M
se
F
M
y, se
F
M
m, se
F
M
y, m, se
F
76
Did you (with your group) perform the pigment extraction and set up the chromatography
plate?
Yes: _______ No: _________ Reason: _______________________________________
UNDERSTANDING THE CONCEPTS
2. To obtain the wild-type eye color in Drosophila, both pteridine and ommochrome pigments must be
present. Considering the information provided at the introduction of this lab, please fill the table below
(“X”) to indicate the pigment composition of each phenotype.
Pigment (visible under UV Phenotypes

Color
light) (+) brown sepia scarlet white
Isosepiapterin yellow X
Sepiapterin Yellow X
Biopterin blue X
2-amino-4-hydroxipteridine blue X
Xanthopterin green-blue X
Isoxanthopterin violet-blue X
Drosopterin orange X
3. Epistatic relationships between genes may be complex. For the next set of questions, consider whether
a mutation in gene “A” would affect the function/product of gene “B”. Based on the pigment pathways
shown below, please answer the following questions (true/false).
77
A mutation at the sepia gene (se) is epistatic over the brown gene (bw): __________________________
A mutation at the sepia gene (se) is epistatic over the scarlet gene (st): ___________________________
A mutation at the scarlet gene (st) is epistatic over the brown gene (bw): _________________________
A mutation at the brown gene (bw) is epistatic over the sepia gene (se): __________________________
A mutation at the white gene (w) is epistatic over the brown gene (bw): __________________________
A mutation at the scarlet gene (st) is epistatic over the white gene (w): ___________________________
A mutation at the white gene (w) is epistatic over the sepia gene (se): ____________________________
A mutation at the white gene (w) is epistatic over the brown (bw) and scarlet genes: _______________
Please consider the following information to solve the following genetics problem
In Drosophila, the gene for white (w) eyes is on the X chromosome and it is epistatic over brown (bw)
and scarlet (st) (both located on different autosomes). White, brown, and scarlet are recessive
mutations.
White eyes can also result by crossing brown (bw//bw) with scarlet eyed flies (st//st) (that is, when
both mutant alleles are present: bw//bw; st//st).
A cross is made between pure lines of white-eyed females with the genotype otherwise,
homozygous for wild type alleles) and white-eyed males hemizygous for the wild type allele (w+).
4. Using the genetics notation for Drosophila research, please provide the genotypes of the P1 and P2
flies.
P1 white females: _____________________ X P2 white males ________________________

78
5. Using the genetics notation for Drosophila research, please provide the genotype and phenotype of
the F1 flies. Show your work
Gametes
F1 females: Genotype: _______________ Phenotype: _______________
F1 males: Genotype: _______________ Phenotype: _______________
6. Please provide the expected F2 phenotypic proportions (i.e. ¾). Show your work. Hint: It could be
easier to perform the fork-line method when you have a tri-hybrid cross or try drafting individual-gene
Punnet squares and use the probability rules.
F1 females: _________________________ X F1 males: _____________________________

79
Phenotypic proportions (reduce the fractions to lowest terms):
Wild type: ____ /____ Brown: ____ /____
Scarlet: ____ /____ White: ____ /____

80
7. Please estimate the probability of obtaining the following type of flies in the F2 offspring. Show
your work. Please reduce the fractions to lowest terms.
- Only white females
- Only brown males
- Scarlet or brown flies
- Wild type males or scarlet flies
- Scarlet females or wild type males
- White or wild type flies
- Males brown or male scarlet flies

81
HELP: The following diagram represents the expected phenotypes of the F2 generation of question #
6. It may be helpful counting individual flies in this diagram (total=64) and compare with your obtained
proportions (ratios). These phenotypes were described in the introduction section of this lab (wild-type,
brown, scarlet, white).
*IMPORTANT NOTE*:
82

83
LABORATORY 6. THE CHI-SQUARE (X2) TEST: A STATISTICAL TEST FOR EXPERIMENTS
For example, in many of the previous

LEARNING OUTCOMES genetics problems of this lab manual (i.e., sex-
When students have completed this linkage), we predicted the outcome of a
laboratory practice, they should be able to: particular cross without any tangible result. In
- Propose a scientific hypothesis (i.e., null most cases, we based these predictions on the
hypothesis) for a genetic cross. Mendelian principles of segregation and
- Calculate a X2 statistic value based on assortment. Then, after obtaining and
observed and estimated data phenotyping the offspring, we compared the
- Use a calculated X2 value to determine "expected" and "observed" results to validate
whether there is a statistically significant our predictions. In this example, a null
difference between the expected and observed hypothesis (H0) would state that there should
frequencies in a dihybrid cross. be no difference between the observed and the
expected data. In contrast, the alternative
INTRODUCTION hypothesis (H1) would indicate otherwise
Rarely, the observed segregation of a cross (there are significant differences between the
(i.e., number of offspring) matches perfectly expected and observed data). However, the
with those predicted based on Mendel's laws. question is how to statistically determine a
Two main reasons could explain these threshold to decide how well our observed data
variations: first, the differences are due to fits our predictions? The Chi-square (X2)
random chance alone or, secondly, the initial statistical test would allow us to either fail to
assumption to calculate the expected reject or to reject the proposed null hypothesis
frequencies is invalid. If the latter is the case, we (H0).
must formulate a different initial prediction. Imagine that you would like to evaluate the
F2 results for the inheritance of the black body
trait in Drosophila and the following offspring
was produced:
P1= males, grey body X P2= females, black body
F1= All grey body
F1 X F1
F2 progeny:
Grey body 102

Black body 44
84
To contrast the observed F2 results with a 2) THE CHI-SQUARE FORMULA

particular expectation, we should follow these The following simple formula is used to
simple steps: 1) to propose a null hypothesis calculate the X2 statistic
and calculate the expected offspring values; 2)
to calculate a X2 value using the expected and
observed data, and 3) to interpret the X2 value
and its associated probability.
1) THE NULL HYPOTHESIS (H0) The “observed” data represents the number
In our example, if the segregation of alleles of individuals found in a phenotypic class,
responsible for the black body color follows while the “expected” data represents the
Mendel’s first law of segregation (F2 3:1), there number of individuals that the null hypothesis
should be no difference between the observed predicts for that phenotypic class. Notice that
and the expected phenotypic ratios. That is, the the equation is based on the difference between
102 grey: 44 black body should be very close to the observed and the expected data, and
a 3-grey to 1-black body ratio. therefore, the greater the difference, the higher
the value of the statistic. For the calculations,
THE ALTERNATIVE HYPOTHESIS (H1) please consider that it is necessary to calculate
As simple as indicating the opposite of the the X2 from actual numbers (amount) rather
H0, the H1 would state that the F2 progeny (102 than percentages or fractions. A table may
grey: 44 black body) does not fit a ratio of 3-grey facilitate the calculation of the X2 value:
to 1-black body. As mentioned previously, the
X2 statistic will allows us to determine whether
the null hypothesis (H0) is valid or appropriate.
Observed Expected
Phenotype O-E (O-E)2 / E
number number
Grey body (3/4) 102 (146 x ¾)= 109.5 -7.5 0.5137
Black body (1/4) 44 (146 x ¼)= 36.5 7.5 1.5411
Total 146
X 2 value 2.055
3) X2 INTERPRETATION AND CONCLUSION under a certain significance level (a) (the

Once the overall X2 value has been calculated probability of rejecting a H0 when it is true, type
(X2=2.055 in our example), it can be used to I error). Researchers choose relatively low
determine if there is a significant difference significance values (0.01, 0.05 or 0.10), being 0.05
between the observed and expected results, the most used.
85
As the X2 distribution changes depending on hypothesis. Then, the conclusion is that the
the degrees of freedom (df), it is essential to observed data seems to fit the expectation of a
estimate this value before drafting conclusions. 3:1 segregation as proposed by Mendel’s laws.
This value depends on the number of The second method to determine if the
phenotypic classes, and in our example, it is experiment was statistically significant involves
determined as follows: the estimation of a p-value. This value is the
probability that the observed statistic occurred
df = number of phenotypic classes – 1. by chance alone, assuming that the null
hypothesis is true. In other words, the smaller
There are two ways to determine if the the p-value, the more unlikely the observed
outcome of the experiment is statistically results. An easy way to estimate the p-value for
significant. The first method involves the X2 distribution and a given degree of
comparing calculated X2 values vs. distribution freedom is to use online tools, as the one
X2 values. These distribution X2 values presented in the following link:
corresponding to the selected significance
levels and the degrees of freedom are available https://www.socscistatistics.com/pvalues/
from many sources, usually in the form of a chidistribution.aspx
table, like the one presented below:
Here, you can type your calculated X2 value
Df/a 0.1 0.05 0.01 (i.e., 2.055), the significance level (a=0.05) and
1 2.71 3.84 6.64 press the “calculate button”. The results will be
2 4.61 5.99 9.21 presented as in the picture:
3 6.25 7.82 11.35
4 7.78 9.49 13.28
5 9.24 11.07 15.09
6 10.65 12.59 16.81
The numbers on each column are the X2

values that represent the cutoff point to reject or
fail to reject the null hypothesis. To select the X2 Generally, a study is statistically significant if
value from the table (critical value), first, we
the p-value is less than the pre-specified a
must find the appropriate df row and the
value (0.05). A p-value greater than or equal to
significance value column.
a is not a statistically significant result. In our
In our example, the df value is 2-1=1. The X2
case, p=0.1517 is greater than 0.05 and hence, it
cutoff for a=0.05 (critical value) is 3.84.
is not statistically significant. Then, the
conclusion is that the observed data seems to fit
As the calculated X2 value= 2.055 does not
the null hypothesis of a 3:1 segregation as
surpass the critical value from the table
proposed by Mendel’s laws. Although both
(2.055<3.84), we conclude that the difference
methods are still used, we will apply the first
between the observed and expected results is
method for lab purposes. That is, calculated X2
negligible and that we fail to reject the null
86
values will be compared to those presented in 3) Sort the flies on the wild population by “all
the distribution table (no need to estimate p- traits”. You will find the following segregating
values). traits:
MAIN MATERIALS Eye color: White–Wild-type (dull red)
Body color: Yellow–Wild-type (brownish)
• TLC result from last week Wing size: Miniature–Wild-type (long)
• Class results from the F2 generation.
• Calculator 4) Click on the “Analysis” tab. You will see the
• Desk or laptop computer. Small devices as cell number of flies in your wild population sorted
phones or tablets are not recommended. by traits and sex. Please write down (or save)
• Web browser with Flash Player support this information as you will need it to complete
(Chrome, Mozilla, Safari, etc.) your assignment. There is a “Copy to
• Access to the virtual cross simulator platform clipboard” button that you may use to transfer
(http://www.cgslab.com ) that information to a text editor.

5) Return to the “Organisms” tab. You can now
PROCEDURE FOR LABORATORY WORK start crossing flies by dragging the selected
parental to the “Crossing vial” box (purple box,
1) Collect your TLC plate from the previous top right).
week and observe the chromatography results
under UV light. 6) Perform the number of crosses described in
your assignment. Record the number of
2) Analyze your results. You will need this offspring phenotypes and ratios in the provided
information to complete your assignment. Take templates. An easy way to obtain phenotypic
a picture with your mobile device if needed. ratios is dividing the higher-class number by
the lowest class number. Example: If you get
3) Collect the phenotypic information from the 60 wild-type flies and 19 Sepia flies, the ratio
F2 generation (posted in front of the lab). will be 60/19 wild-type : 19/19 sepia flies. That
is 3.15 wild-type: 1 sepia flies.
7) Analyze your results and provide the
1) Launch the cross simulator. If you still need required information in your assignment. DO
help, please check the posted video on how to NOT delete/trash the “vials” of the crosses you
use the CGS platform (available on the Lab’s performed. We may need this information to
website on the LMS) check your work.
2) Please select the wild Drosophila population:
Lab6:Chi-square. Make sure you are using the 8) Complete and submit your assignment by
right population for your crosses. Click on the the deadline. Please carefully read the
“Start Crossing” button. questions in your assignment.
87
ASSIGNMENT # 6
IN-PERSON LABORATORY ANALYSES: THIN LAYER CHROMATOGRAPHY (TLC)

1. Did you (and your group) obtain visible pigments in the chromatography plate?
Yes: _______ No: _________ Potential reason: ________________________________
___________________________________________________________________________________
Based on the observed patterns of pigment migration, can you distinguish between wild-type and
scarlet flies? Explain.
2. Between brown and white-eyed flies? Explain.
3. Between sepia and scarlet flies? Explain.

88
4. The biol226 students (Fall-2021) performed a TLC of Drosophila eye pigments in the lab. Based on the
following picture under UV light, please provide the possible phenotypes of the different flies.
E D C B A
A: ____________________________ B: _________________________________
C: ____________________________ D: _________________________________
E: ____________________________
X2 USING COLLECTED F2 DATA
We have summarized the phenotypic data of your main cross collected over the past 4 weeks in your
lab section. Please use this information to complete the following questions.

89
5. Considering only the white and sepia traits (genes), please provide the following genotypes.
Remember the location of the genes on the chromosomes (autosomal vs. sex-linked) and the genetics
models proposed in assignment # 2.
P1 white-eyed females: ___________________
P2 sepia-eyed males: __________________
F1 wild-type females: ___________________
F1 white-eyed males: __________________
6. Use the space below to perform a forked-line method to determine the expected
frequencies/proportions of the F2 flies. Remember the epistatic interactions among the genes.
Eye color Eye color Proportion

(white – wt) (sepia – wt)
90
7. Please summarize the observed data obtained in your lab section. Then, setup a X2 to test the
hypothesis that the sepia mutation is recessive and assort independently.
F2 Progeny
Wild type White Sepia Total
M F M F M F
Observed Expected
number number
Wild type
White eyes
Sepia eyes
Total
X 2 value
X2 Calculated: ___________________
Degrees of freedom: _____________ X2 from table (critical value, p=0.05): ____________
State your conclusions:

91
8. Your TAs performed a cross between a wild-type fly and a sepia-eyed fly (both parents were
homozygous). Then, two wild-type F1 flies were crossed to produce an F2 generation. Please collect
the offspring data from your TAs and test the hypothesis that the sepia trait is controlled by a recessive
and autosomal mutation. (NOTE: work in pair of students).
Wild-type Sepia Total
M F M F
Observed Expected
number number
Total
X 2 value
X2 Calculated: ___________________

92
X2 BASED ON COMPUTER SIMULATED DATA
Based on previous lab experiments and literature reports, it is known that the genes for body color, eye
color and wing size are located on the same chromosome and the genetics model is known (i.e., all
three; yellow, white, and miniature are recessive mutations). However, you need to 1) propose a
hypothesis regarding the segregation of one gene and, 2) test the hypothesis using the X2 statistic.
Lab6:Chi-square wild population
9. Please use the table below to record the data of the wild population from the cross simulator. Note:
the order of the different phenotypes in your “show details” tab may be different to the order on this
template.
The next group of crosses and questions will help you proposing and testing your hypotheses.
Note: it may be easier considering only two genes at a time.
93
10. Body color and eye color: Perform a dihybrid, test cross between a wild -type fly (heterozygote)
and a yellow body, white eyed fly. You can see the genotype of the flies, then, make sure that you are
using the right flies in the cross (for example, AaBb X aabb). ONLY if these genotypes are not available
in the wild population, please use the data available in Canvas. Record the number of offspring in the
scoring template.
Female #: ______ Male#: _______
11. Please provide the expected (under independent assortment) and observed phenotypic ratios (e.g.,
3:1) resulting from the previous cross. Please reduce the ratios to lowest terms (e.g., 3.2 : 1)
Expected ratio Observed ratio
Body Body
Eye Color Ratio Eye Color Ratio
Color Color
Wild type Wild type Wild type Wild type
Wild type White Wild type White
Yellow Wild type Yellow Wild type
Yellow White Yellow White

94
12. Based on the previous cross, please provide a null hypothesis (H0) assuming independent
assortment of the body and eye color genes. (For example, you may draft your hypothesis like this: “If
the yellow and white mutations are …., then, the expected segregation of a testcross would be….”).
13. Please use the table below to calculate the X2 statistic.
Observed Expected
number number
Wild type
White eyes
Yellow body
Yellow body, white eyes.
Total
X 2 value
X2 Calculated: ___________________
*IMPORTANT NOTE*:
95
PRACTICE EXERCISE # 1
NO NEED TO RETURN. THIS MATERIAL MAY BE INCLUDED IN THE LAB QUIZZES.
In Drosophila, vestigial (partially formed) the X chromosome. Suppose a homozygous
wings (vg) are recessive to normal long wings white-eyed, long-winged female fly is crossed
(vg+), and the gene for this trait is located on an with a homozygous red-eyed, vestigial winged
autosome. The gene for the white-eye trait is on male.
1. What are the expected genotypes, phenotypes, and their ratios in the F1 flies? Use the notation for
Drosophila research.
P1 white, long females: ______________ X P2 red, vestigial males: ___________________
F1 genotypes: _______________________________________________________________
F1 phenotypes: _______________________________________________________________
2. What are the expected genotypes, phenotypes and their ratios in the F2 flies?
F1 females: _____________________ X F1 males: __________________________
Gametes
96
3. What are the expected genotypes and phenotypes, and the ratios of each of the progeny resulting
from a cross between F1 flies back to each parent?
F1 female: _____________________ X P2 red, vestigial male: __________________________
Gametes
F1 male: _____________________ X P1 white, long female: __________________________
Gametes
97
LABORATORY 7. Drosophila CLASS DATA REVIEW: GENE MAPPING AND
HYPOTHESES TESTING
LEARNING OUTCOMES analysis to determine the genetics mode of

At the end of this lab practice, students inheritance of different mutations by using the
should be able to: phenotypic classes and their ratios on the F1 and
- Determine the genetics model of F2 generations. Additionally, students must be
inheritance of four genes based on real cross familiar with the potential epistatic interactions
data. between some genes related with eye color
- Propose a scientific hypothesis (dihybrid variation (lab # 5). Let’s use this previous
cross) and statistically test its validity. knowledge and new skills to answer questions
- Map three genes on a chromosome based regarding your real-case genetics experiment
on real cross data. performed at the University of Saskatchewan.
You have been analyzing a Drosophila cross
INTRODUCTION between P1 yellow body, white eyes, and
miniature wing females with a P2 sepia eyes
The main aim of this lab exercise is to analyze males (both homozygous lines). During a
and discuss the outcome of a particular cross period of four weeks, you collected and
and its further generations (F1 and F2). recorded F1 and F2 data that will allow you to
Additionally, students will get familiar and test some hypotheses about the inheritance and
comfortable at solving genetics problems and to map three genes on a chromosome.
analyzing the different epistatic interactions Please read each paragraph and question
between genes. carefully. Your understanding of the concepts is
Based on the previous labs (#1, 2, 3 and 4), key for your success in your assignments.
students should be familiar on the methods and
P1: Females (yellow body, white

P2: Males (sepia eyes)
eyes, miniature wing mutant)
98
PROCEDURE sex-linked vs. autosomal genes. The F1 results
will provide you hints in this regard.
The tables indicating the outcome (i.e.,
offspring number) of the cross performed in - Due to an epistatic interaction, the F2 results
your lab section are available in front of the lab. of this cross yields 12 phenotypic classes
(instead 16 classes).
Please analyze those results carefully, as they
are the basis to complete the lab assignment. To -For the three-point chromosome mapping of
facilitate your understanding of the concepts yellow, white, and miniature, you should add
and solving your assignment, please consider up some of the F2 phenotypic classes together.
the following key aspects: That is, you should end up with a total of eight
(8) phenotypic classes (instead of 12). Parental
- The cross involves four genes. Two offspring classes (n=2), single recombinant
different genes are responsible for white and classes (n=4) and double recombinant classes
sepia eyes. (n=2).
- Identify the location of genes on the
chromosomes. That is, take into consideration
IMPORTANT: FILL THE TABLES WITH THE DATA PROVIDED BY YOUR TAs
Parental flies (homozygous, pure lines)
P1: Females, yellow body, white eyes, miniature wings.

P2: Males, sepia eyes
F1 results
Males Females Total
Yellow, white, miniature Wild-type
Total
99
F2 results
M
Wild-type
F
M
F
M
Yellow
F
M
Miniature, white
F
M
Yellow, white
F
M
Miniature
F
M
White
F
M
Yellow, miniature
F
M
Sepia
F
M
Yellow, sepia
F
M
Miniature, sepia
F
M
Yellow, miniature, sepia
F
100

101
ASSIGNMENT # 7
X2 BASED ON YOUR COLLECTED DATA
Based on the offspring data (F1 and F2 generations) from the previous pages, please answer the following
questions.
1. Set up a X2 to test the hypothesis that the yellow (y) (body color) and miniature (m) (wing size) are
recessive mutations that assort independently.
Hint: Are you wondering about the classes with the other phenotypes? You must omit those traits
and consider only the y and m genes. For example, the number of flies in the class “sepia” should be
added to the class “wild” (because they are y+ m+ for these genes). Follow the same rule to the
remaining classes.
Expected ratios Observed Expected

Phenotype O-E (O-E)2/E
under Ho number number
Wild type
Grey body,
Miniature wing
Yellow body,
long wing
Yellow body,
miniature wing
Total
X2 Calculated: ______________ Degrees of freedom: _________________
X2 from table (critical value, p=0.05): ___________________
X2 Calculated higher than the critical value? ________ Reject or fail to reject Ho: __________________
102
2. After the X2 test, what is your conclusion regarding the mode of inheritance of the y - m genes? Please
provide a brief explanation.
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
GENE MAPPING BASED ON YOUR COLLECTED DATA
3. Using the class data, construct a linkage map of the yellow (y), white (w) and miniature (m) genes.
Show your work.
Hint: Are you wondering about the classes with the sepia phenotype? You have to omit that trait and
consider only the y, w and m genes. For example, the number of flies in the class “sepia” should be
added to the class “wild” (because they have the wild-type alleles (y+ w+ m+) for these genes). Follow
the same rule to the remaining three classes showing the sepia trait.
Then, identify parental (PR) (larger classes) and double recombinant (DR) offspring (smaller classes).
Remember: When you compare PR vs. DR, the gene that has been switched (allele), is the one in the
middle.
Observed Genotype (F1 *Type of gamete (PR, SR

Phenotype
number female gametes) or DR)
Wild type
Yellow
Miniature, white
Yellow, white
Mini
White
Yellow, mini
Total
103
4. Gene order: ___________________
5. y-w=
6. w-m=
7. y-m=
Summary distances:
104
Obs. Freq. DR
𝐶= 𝐼 =1−𝐶
Exp. Freq. DR
8. C: ________________
9. I: ________________
_______________________________________________________________________
_______________________________________________________________________
_______________________________________________________________________
_______________________________________________________________________
_______________________________________________________________________
105
GENETICS PROBLEM BASED ON COMPUTER SIMULATED DATA
Remember: for the following questions, you will use the data collected from the simulated crosses
using the Lab 7 Gen. Problem wild population
You have grown a population of Arabidopsis thaliana plants in a greenhouse and have noticed that three
different phenotypes are segregating among the individuals. The goal of this exercise is to determine
how these phenotypes might be inherited. Remember that Arabidopsis plants can produce male and
female gametes (i.e., pollen and eggs) within the same individual and hence, they can be self-crossed.
11. Please use the table below to record the data of the wild population from the cross simulator (click
the “Show Details” button). Note: each student will be assigned three randomly different phenotypes
and plant numbers. Please work individually.
Please perform as many crosses as you need to find out the genetics mode of inheritance of the three
traits. Remember to “Destroy” some of the crosses if you reach the simulator’s limit (24).
12. After performing the different crosses and analyzing the offspring number, please provide the most
probable mode of inheritance of the traits (e.g., dominance, co-dominance, incomplete dominance,
epistasis, multiple alleles, which allele(s) is/are dominant and recessive, etc.).
______________________________________________________________
______________________________________________________________
______________________________________________________________
______________________________________________________________
______________________________________________________________
______________________________________________________________
______________________________________________________________
______________________________________________________________
______________________________________________________________
______________________________________________________________
106
13. Please provide experimental evidence to support your proposed model of inheritance. To do so,
please fill the tables with at least six (6) crosses supporting your answer to the previous question (click
the “Show Details” button).
14. Finally, your TAs will review your work in the simulator to get full marks. Please submit your
complete cross data using the link available in the Canvas module (Lab # 7). To do so, please click in
the “View All Data” button and then, copy-paste the information in the submission form.
*IMPORTANT NOTE*:
107
LABORATORY 8. DNA GENOTYPING OF Drosophila MUTANTS: THE WHITE-1 LOCUS
(W)
LEARNING OUTCOMES characterized by 6 exons and 5 introns that

At the end of this lab practice, students encode a 687 aminoacids protein located in the
should be able to: membrane of the eye’s cells. In the white-1
- Recognize the relation between genotype mutation (w), the transcription is disrupted,
and the white-eyes phenotype in Drosophila. and the white protein is not produced. Hence,
- Identify two common molecular genetics because white does not partner with brown and
methods and its components. scarlet, the eye cells are unable to uptake
- Perform a DNA extraction and a PCR to pigment precursors, causing the white-eye
identify Drosophila mutants and wild-type flies. phenotype (absence of pigmentation). Further
molecular studies on the white-1 mutation
INTRODUCTION indicated that an insertion of a Doc-retroposon
(4,700 bp) in the promoter region resulted in its
In some of the previous labs, you have inactivation, and thus, the disruption of
investigated the inheritance of the white-eye transcription.
color in Drosophila. Early in the twentieth
century (1910), Thomas Hunt Morgan Because the gene for white eyes is sex(x)-
discovered that the locus responsible for this linked, male flies are termed hemizygous. That
trait was inherited as sex-linked. Expressly, he is, they carry only one copy of the gene (Xw+Y or
indicated that the locus locates on the X XwY). Instead, female flies have two X
chromosome. Since then, many molecular chromosomes and hence, they carry two copies
studies contributed to revealing the of the white gene. Thus, they can be either
mechanisms by which no pigments are present homozygous or heterozygous (Xw+Xw+, Xw+Xw or
in Drosophila eyes. XwXw).
As you have previously studied, there are The Polymerase Chain Reaction (PCR)
two classes of eye pigments in wild type Back in 1983, Kary Mullis developed a
Drosophila: brownish (ommochrome) and those unique molecular biology technique to make
responsible for bright red coloration multiple copies of a desired piece of double
(pteridines) (Lab # 5). These pigments are stranded DNA in a test tube. This technique is
synthesized from purine and tryptophan known as the Polymerase Chain Reaction and is
precursor molecules (colorless), whose based on the natural process of DNA
transportation into the cells are controlled by replication. All the nucleotide precursors
transporter proteins. To be functional, these (DNTPs), a DNA polymerase (Taq polymerase),
transporters proteins known as the brown and a couple of primers, and the purified target
scarlet genes must partner with a common DNA are added to a tube. Using a thermal
protein subunit coded by the white gene cycler, the PCR reaction is carried out by
(white-1 locus). The wild-type allele (w+) is alternating different cycles of temperature and
108
times. There are mainly three steps in each PCR approximately 30 to 40 PCR cycles, more than
cycle. Each cycle results in the doubling of the one billion copies of the original DNA have
amount of target DNA molecules and hence, the been made. A common setup for genotyping in
exponential reaction results in the production of a PCR machine includes:
millions of copies in 30 to 40 PCR cycles.
1) Initial denaturation: 95-98 °C x 1-5 min.
2) Denaturation: 95-98 °C x 40-60 sec.
PCR steps
3) Annealing: 50-70 °C x 40-60 sec.
Denaturation 4) Extension: 70-72 °C x 40-120 sec.
The tube containing the sample DNA is 5) Repeat steps 2-4 for 25-32 cycles.
heated to more than 90°C, which breaks the 6) Final extension: 70-72 °C x 2-5 min.
hydrogen bonds between the base pairs and
As a complement to the laboratory exercise,
releases two separate single strands.
in this laboratory you will simulate the
amplification of DNA fragments using a virtual
Annealing
environment, known as in-silico PCR. This tool
During this step, short pieces of
is not new, and it is used for many scientists to
commercially prepared single-stranded
perform trial-tests of PCR reactions before the
nucleotide sequences called primers are used to
real experiment is performed. Please watch the
amplify the desired region of the target DNA.
video available in Canvas on how to use the
The primers are complimentary to the desired
In-silico PCR platform.
target DNA sequence and bind to the beginning
of the target sequence, when the temperature is
lowered to a range of 40°C to 60°C.
Extension
During this step, the copying and extension
of single-stranded DNA occurs when the
temperature is raised to approximately 72°C
(ideal for a particular enzyme: Taq DNA
polymerase). After the completion of the
extension step, a new strand of DNA
complimentary to the original strand is made.
Thus, one PCR cycle results in two copies of the
target DNA.
Since the entire PCR process is automated,
White phenotype Wild-type (red-dull eyes
the cycle begins again using the duplicated
DNA resulting in four copies. After
)
.
Click on the link to watch a PCR animation: https://www.youtube.com/watch?v=iQsu3Kz9NYo
Genotyping of the White-1 locus primer 3 are specific to the wild-type and will
By analyzing extracted DNA of wild-type produce a 467 bp DNA fragment (active w+
(red eyed) and mutant flies (white), the allele). The combination of primer 2 and primer
genotypes can be easily determined through 3 will produce a 704 bp fragment specific to the
PCR. This is possible because specific primers doc-retroposon (non-active allele). The
bind to the promoter region on both, wild type following diagrams represents the location of
and mutant flies (see figures below). For primers on the white-1 locus and the expected
instance, the combination of primer 1 and DNA fragments after PCR.
DNA gel electrophoresis polymerase, primer mix (primers I, II, III) and
Electrophoresis is a molecular method based nuclease-free water.
on the principle of separating molecules based - Micropipettes and tips, 5 µL and 20 µL
on their size (Ex., base pairs) and attraction to - Fine-tipped forceps
an electric charge (+ or -). - DNA thermal cycler
After the PCR reaction is performed, the - sharp-point markers for labeling tubes
mixture of DNA fragments can be separated on - DNA Ladder (1kb DNA ladder)
an agarose gel. An electric current (voltage) is
applied to the electrophoresis apparatus and
then, the charged molecules in the sample enter
the gel through the wall of the wells. Since
DNA is negatively (-) charged (due to the
phosphate groups), it moves through the pores
of the agarose gel towards the positive
electrode.
Usually, the first well on the gel is loaded
with a DNA ladder, a solution with standard
molecular weight markers used to estimate the
size of DNA fragments. Larger molecules will
migrate less than smaller molecules because the
latter ones fit easily on the tiny agarose pores
and travel farther in the gel. The current is run
for about 15 to 20 minutes, and then, the gel is
stained with a fluorescent dye (Ex. ethidium
bromide). The end results of the electrophoresis
are visualized under UV light and recorded
using a digital camera.
MAIN MATERIALS (PCR)

- Drosophila flies:
P1 white-eyed females
P2 Red-eyed males Gel electrophoresis of DNA fragments and
F1 red-eyed females genotyping (white-one locus). Line “M”
corresponds to a known DNA ladder (Smith
F1 white –eyed males
and Falkenstein, 2011).
- 1.5 ml tubes
- 0.2 ml PCR tubes
- Solution A: DNA extraction solution (20 µL
dilution Buffer + 1 µL DNA Release Additive).
- Solution B (20 µL): PCR reaction solution
containing: dNTPs, MgCl2, hot start II DNA
111
PROCEDURES 10) Mix the PCR mixture tube by vortex or
tapping, then, perform a quick spin in the
DNA EXTRACTION FROM INDIVIDUAL FLIES centrifuge to collect all the solution at the
bottom of the tube.
1) Work in groups of four people.
11) Ask your TAs to place the tubes in the
2) Each student is required to extract DNA thermocycler and run the PCR program. It will
from only one type of fly: take up to 3 hours to complete.
P1 white-eyed females
P2 Red-eyed males GEL ELECTROPHORESIS
F1 red-eyed females
F1 white –eyed males - After the PCR is completed, the Lab
coordinator will keep your PCR products in the
3) Take a tube containing the extraction freezer.
solution (Solution A). - A gel electrophoresis and further
identification will be performed next week.
4)Add one fly to the tube using forceps or a
brush. Label your tube on the side or the top MATERIALS FOR IN-SILICO PCR
using the fine markers.
5)Crush the fly using a plastic pestle or a phones or tablets are not recommended.
toothpick until a homogeneous mixture is • Web browser with Flash Player support
present. To can mix by vortex or tapping using (Chrome, Mozilla, Safari, etc.)
your fingers. • Access to the in-silico PCR platform
(http://insilico.ehu.eus/user_seqs/PCR/)
6) Incubate your combined solution for 2 • Primers sequences
min. on the bench at room temperature. P1: GTGCAAAGGTGGTCGAATTT
P2: TCTGGGAGTTCATCTGGACA
7) Incubate the solution for 10 min at 98 ̊C in P3: GAGAGGAGTTTTGGCACAGC
the thermalcycler. Please ask your TAs to • Five Drosophila DNA sequences. These files
perform this step. are available at the LMS (lab website) with the
following names:
8) Spin the tube down using a centrifuge. Male_1.txt
Place the tube on ice without disturbing the fly Male_2.txt
at the bottom (1 or 2 minutes). Female_1.txt
Female_2.txt
9) Remove 0.5 µL of the solution and add it Female_3.txt
to the PCR reaction tube (Solution B). Be • Notebook and pen (or pencil)
careful not to suck up any fly parts.
112
PROCEDURE FOR IN-SILICO PCR 4) Upload the five DNA sequences to the
server. Please follow the instructions
1) Open the lab website at the LMS (Canvas provided in the briefing video-lecture.
or Blackboard).
5) Start performing the virtual PCRs required
2) Download the DNA sequence files (n=5) to complete your assignment. Remember to
available in the Module # 8. carefully select the right DNA sequence and
primers for each PCR
3) Store the files in your computer. It may be
easier to find them if you use the folder 6) Analyze the obtained PCR products (i.e.,
“desktop”. sizes) and fill the electrophoresis templates.
3) Launch the in-silico PCR platform at

6) Complete and submit your assignment by
http://insilico.ehu.eus/user_seqs/PCR/.
the deadline. Please carefully read the
questions in your assignment
.
Setting up a PCR reaction and a gel electrophoresis in the lab is a straightforward process.
Please check these videos illustrating the process in our lab at the University of Saskatchewan.
PCR reaction: Gel electrophoresis:

https://youtu.be/tdIidBSv9_s https://youtu.be/FZ19A0RT_tY
113
ASSIGNMENT # 8
IN-PERSON LABORATORY ANALYSES: DNA EXTRACTION AND PCR METHOD

1. After you perform the DNA extraction, please estimate the concentration of your sample. Please
follow the instruction of the TAs
- Sample concentration #: ______________ ng/ul
- 260/280 ______________
- 260/230 ______________
2. Please perform this task before you start the PCR reaction. In groups of four students, find one of the
three available PCR cyclers in the lab. Browse to the “pcr-white” program and answer the following
questions:
- PCR cycler #: ______________
- What is the annealing temperature in the program? ______________
- What is the temperature of the step # 1? ______________
- What is the purpose of step # 1? __________________________________________________
- What is the extension time in the program? ______________
- How many cycles are included in the program? ______________
- What is the annealing time in the program? ______________
- Is there a final extension step included in the program? ______________

114
- Please discuss the different programs with your lab partners (temperatures, time conditions,
cycles, etc.). Which PCR cycler contains the most suitable PCR program to genotype your
samples?
PCR cycler #: ______________
IN-SILICO PCR
First, download the five DNA sequence files available at the Lab’s website (Lab8 folder). Check the
video on how to use the virtual PCR website and remember the genetics mode of inheritance of the
white mutation in Drosophila
3. Using the DNA sequence of individual “Male_1”, please run a virtual PCR using the following primer
combinations:
-PCR # 1: Primers P1 (GTGCAAAGGTGGTCGAATTT) and P3 (GAGAGGAGTTTTGGCACAGC)
PCR amplification fragment present: NO: _______ YES: ________ Length (bp): __________
-PCR # 2: Primers P2 (TCTGGGAGTTCATCTGGACA) and P3 (GAGAGGAGTTTTGGCACAGC)
-Genotype (use the notation for Drosophila research): ____________________
-Phenotype: _____________________
4. Using the DNA sequence of individual “Male_2”, please run a virtual PCR using the following primer
combinations:
-PCR # 4: Primers P2 (TCTGGGAGTTCATCTGGACA)and P3 (GAGAGGAGTTTTGGCACAGC)
-Phenotype: _____________________
115
5. Using the DNA sequence of individual “Female_1”, please run a virtual PCR using the following
primer combinations:
-Phenotype: _____________________
-Phenotype: _____________________
116
-Phenotype: _____________________
8. Based on the PCR fragments obtained in questions 1-5, please fill the following electrophoresis
template. Please consider the DNA ladder (i.e., fragment sizes) loaded on lane 1.
9. Using the following schematic diagram, sketch the DNA fragments expected to be produced by the
PCR method of the white locus in Drosophila. Please refer to the introduction section of this lab for DNA
fragment sizes.
L1: A heterozygous wild-type female L2: A white-eyed male

L3: A white-eyed female L4: A homozygous wild-type female
117
10. A cross between a P1 white-eyed female (wild-type alleles for the brown gene) and a P2 brown-eyed
male (both parents are homozygous) was performed. Based on your knowledge of the white (this lab)
and brown genes (lab # 5), what is the expected phenotypic ratio of crossing F1 males and females?
Show your work.
*IMPORTANT NOTE*:
118

119
PRACTICE EXERCISE # 2
NO NEED TO RETURN. THIS MATERIAL MAY BE INCLUDED IN THE LAB QUIZZES.
Please consider the following information to complete the genetics problem
In the flowers of foxgloves, wild-type peloria, dwarf parent and you observed the
coloration is red while a mutation called white following phenotypes:
(w) produces white flowers. A second mutation,
peloria (p), causes big stems, and yet another Dwarf, peloria 172
mutation, dwarf (d), produces short plants. You White 162
Dwarf, peloria, white 56
crossed a white flowered plant (otherwise
Wild 48
phenotypically wild) to a plant that it is dwarf Dwarf, white 51
and peloria (true breeding both). Peloria 43
All the F1 are tall, and have white, normal Dwarf 6
Peloria, white 5
flowers. Then, you cross an F1 plant back to the
Total 543
1. Which alleles are dominant?
2. What were the genotypes of the parents?
P1: ______________________ P2: ___________________

120
3. Draw a linkage map of the three genes. Is there interference? Use the table below to identify the
different phenotypic classes.
Genotype (F1 female

Phenotype Observed # Type (PR, SR or DR)
gametes)
Dwarf, peloria
White
Dwarf, peloria, white
Wild
Dwarf, white
Peloria
Dwarf
Peloria, white
Total 543
Gene order: ___________________ Distance d-p: ___________________
Distance p-w: ___________________ Distance d-w: ___________________
C: ___________________
I: ___________________
121
4. In Drosophila the genes for black body and vestigial wings are genetically liked on an autosome. The
map distance between these two genes is 34 map units. A cross between a female Drosophila (blk+
vg+//blk vg) and a male blk vg//blk vg produced a progeny of 1000 flies. Out of this progeny, how many
flies would be grey body and long wings (wild-type)? Show your work.
Hint: Remember that 34 map units is the same as 34% percentage of recombination
5. A cross between a wild-type Drosophila female and a wild-type Drosophila male produced the
following progeny. Pink and vestigial are supposed to be autosomal and recessive mutations that assort
independently. Please perform a X2 to test that hypothesis. Note: if you need to calculate the expected
number of offspring, please ROUND to the nearest whole number.
Phenotype Observed Expected O-E (O-E)2/E
Normal Wings,
42
Normal Eyes
Vestigial Wings,
11
Normal Eyes
Normal Wings,
9
Pink Eyes
Vestigial Wings,
38
Pink Eyes
Total
X2 Calculated: ______ X2 from table (critical value, 95%): ________
Is the X2 Calculated higher than the critical value: ______
Reject or fail to reject Ho: _________________

122
6. Based on the picture of a thin layer chromatography (TLC) plate of the eye Drosophila pigments, please
provide the possible phenotypes.
1 2 3 4 5
Lane 1: ____________________________ Lane 2: ________________________________
Lane 3: ____________________________ Lane 4: ________________________________
Lane 5: ____________________________
123
Please consider the following information to complete the following questions
In Drosophila, Dichaete (D) is a chromosome Female flies from a Dichaete stock (pure
3 mutation with a dominant effect on wing lines) were crossed to homozygous ebony, pink
shape. The heterozygote D+//D is viable, but the flies, and the F1 females with a Dichaete
homozygous D//D is lethal. The genes ebony phenotype were test-crossed to the male
(e) and pink (p) are chromosome 3 recessive parental ebony, pink. The test-cross produced
mutations affecting the body and eye color the progeny listed in the table below:
respectively.
ebony, Dichaete, Dichaete, Dichaete, Wild- Total

Test cross Dichaete pink ebony pink pink ebony ebony, type Flies
progeny pink
Total 395 390 85 90 2 3 15 20 1000
7. Please indicate the genotypes of parental, F1 and test-cross flies using the notation for Drosophila
research.
Genotype P1 Dichaete females: ___________________
Genotype P2 ebony, pink males: __________________
Genotype F1 Dichaete females: ___________________
Genotype Test cross ebony, pink males: __________________
8. Please fill the following table and calculate the distances between the genes (show your work).
Observed Genotype (F1 female *Type of gamete (PR, SR

Phenotype
number gametes) or DR)
Dichaete
ebony, pink
Dichaete, ebony
124
pink
Dichaete, pink
ebony
Dichaete, ebony, pink
wild type
Total
Gene order: ___________________ Distance D-p: ___________________
Distance p-e: ___________________ Distance D-e: ___________________
9. Calculate the interference and coincidence values. Show your work. Please provide a brief
explanation of your findings.
C: ___________________
I: ___________________
Explanation:
125
LABORATORY 9. POPULATION GENETICS: GENE POOL AND ALLELE FREQUENCIES
LEARNING OUTCOMES In this example, we can describe the gene

At the end of this lab practice, students pool of the population by simply analyzing the
should be able to: table: the total number of flies (N) is 100, the
- Perform a gel electrophoresis to determine number of homozygous individuals is 74
different DNA fragment sizes. (AA=38 and aa=36) and the number of
- Describe the gene pool concept based on the heterozygous individuals is 26 (Aa). However,
analysis of a hypothetical Drosophila population. instead of using absolute counts of the different
-Estimate genotype and allele frequencies genotypes, a standardized option to describe
based on phenotypic data. the gene pool is to estimate genotype
frequencies. In our case, we can do this by
INTRODUCTION simply dividing each genotype’s number by the
Briefly, the study of the amount and total amount of flies:
distribution of genetic variation in populations
is what we know as population genetics. This Frequency of AA = 16/100 = 0.16
genetics’ field also studies the different F(AA)=0.16
evolutionary forces that drive this variation
(mutation, selection, genetic drift, etc.). Frequency of Aa = 48/100 = 0.48
Imagine, for example, a Drosophila F(Aa)=0.48
population where two alleles (A and a) from one
gene are segregating through the different Frequency of aa = 36/100 = 0.36
generations. It is possible that in an initial wild F(aa)=0.36
population you find three different genotypes
“AA”, “Aa” and “aa”. However, the number of Now, the different genotypes are described
flies per each of these genotypes may change as frequencies and hence, these values should
over time (generations) due several add up to 1 (0.16+0.48+0.36=1). A reduced gene
evolutionary forces. Then, the gene pool pool description of the Drosophila population
concept may be defined as the total amount of can be proposed if we calculate the allele
alleles and their distribution in a population at frequencies.
any time. To estimate these values from count
To better understand the gene pool concept, numbers, first, you must consider the total
let’s assume the following composition of an amount of alleles in the population. In our case
initial Drosophila wild population: the number of flies is N=100. As each individual
is assumed to be diploid, then, the total amount
Genotype Amount of alleles will be 2N, that is, 200 alleles.
AA 16 Now, let’s start by estimating the frequency
Aa 48 of the allele “A”, usually symbolized by the
aa 36 letter “p”. By looking at the table, you can
Total 100 conclude that 16 individuals are “AA”. Hence,
the amount of “A” alleles is 16 X 2 = 32.
126
Similarly, the table indicates that 48 individuals The expected frequency of the homozygous
have only one copy of the allele “A” dominant genotype (AA) would be:
(heterozygous “Aa” individuals). Then, we can F(AA)= F(A) x F(A)
easily calculate the frequency of allele “A” as F(AA)= p x p
follows: F(AA)= p2
(16X2) + 48 Similarly, the expected frequency of the

𝐹(𝐴) = 𝑝 = = 0.4
200 homozygous recessive genotype (aa) would be:
F(aa)= F(a) x F(a)
A formula describing the calculation of F(A) F(aa)= q x q
would be: F(aa)=q2
2𝐴𝐴 + 𝐴𝑎
𝐹(𝐴) = 𝑝 =
2𝑁
The expected frequency of the heterozygous
genotype (Aa) would be:
Similarly, we can estimate the frequency of
F(Aa)=2pq
allele “a” in the population:
And again, as these values are frequencies,

(36X2) + 48
𝐹(𝑎) = 𝑞 = = 0.6 their sum adds up to 1:
200
A formula describing the calculation of F(a) p2 + 2pq + q2 = 1

would be:
2𝑎𝑎 + 𝐴𝑎 The Hardy-Weinberg principle
𝐹(𝑎) = 𝑞 =
2𝑁
Finally, we have a description of the gene This principle states that in the absence of
pool of the observed Drosophila population disturbing factors, if mating is random and the
based in only two numbers: The allele population is large, the genetic variation in a
frequencies p and q. Again, as these values are population will not change. That is, both
frequencies, their sum should add up to 1. genotype and allele frequencies will remain
constant in a state known as Hardy-Weinberg
F(A)=p=0.4 equilibrium. This equilibrium can be disturbed
F(a)=q=0.6 by different evolutionary forces, including
p+q=1 natural selection, mutation, non-random
mating, gene flow, and genetic drift. This lab
Under certain assumptions (i.e., manual only mentions these fascinating topics;
equilibrium), we can make predictions of however, they are reviewed in detailed in
genotype frequencies in further generations, by further advance genetics courses (I.e.,
combining these formulas as follow: Evolutionary Processes, Plant Breeding, etc.).
127
MATERIALS (GEL ELECTROPHORESIS) Observe the gel under UV-light and look at the
different DNA fragments.
• PCR products from previous week.
• A gel chamber and power supply.
MATERIALS (POPULATION GENETICS
• Agarose, SB 1X buffer, SYBR-Safe dye, and SIMULATION)
DNA ladder.
• Pipettes and tips (10 – 20 ul) • Desk or laptop computer. Small devices as cell
PROCEDURE (GEL ELECTROPHORESIS) • Web browser with Flash Player support
(Chrome, Mozilla, Safari, etc.)
1) Set-up the casting trays as illustrated in the • Access to the virtual cross simulator platform
video. (http://www.cgslab.com )
2) Dissolve the agarose in SB buffer (1% • Notebook and pen (or pencil)
Agarose gel) by boiling in the microwave (20-45 • Calculator
seconds). • A virtual Drosophila population (100 flies,
3) Cool down the agarose solution and add Lab9:PopGen population)
1ul of the SYBR-Safe dye. Ask your TAs to
PROCEDURE (POPULATION GENETICS
perform this step. This dye will make your
SIMULATION)
DNA fragments to fluoresce under UV light.
4) Pour the agarose gel on the tray and wait
1) Launch the cross simulator. If you still
until it solidifies (around 10 minutes). Then, put
need help, please check the posted video on
the tray into the electrophoresis chamber.
how to use the CGS platform (available on the
5) Cover the gel with 1X electrophoresis
Lab’s website on the LMS)
buffer (SB). This salt-solution will allow the
separation of the DNA fragments by
2) Please select the wild Drosophila
maintaining a constant electric current through
population: Lab9:PopGen. Make sure you are
the gel.
using the right population for your crosses.
6) Load 8 to 10 ul of the PCR product into the
Click on the “Start Crossing” button.
well. Place the safety cover. Check that the gel is
properly oriented. Remember that DNA
3) Sort the flies in the wild population by
molecules will migrate towards the positive
“all traits”. You will find the following
electrode (red) due the negative charge of the
segregating traits:
DNA (phosphate groups).
7) Connect the chamber cords to the power
Eye shape: Bar (thinner eye)
source. Set the voltage to 140 volts and the time
Wild-type (elongated oval)
to 30 minutes.
8) Run the electrophoresis. Ask one of your
4) Click on the “Show Details” tab. You will
TAs for further instruction.
see the number of flies in your wild population
9) After completion of the electrophoresis,
sorted by traits and sex. Please write down (or
carefully remove the gel and casting tray.
128
save) this information as you will need it to the lowest class number. Example: If you get
complete your assignment. 60 wild-type flies and 19 Sepia flies, the ratio
will be 60/19 wild-type: 19/19 sepia flies. That
5) Return to the “Organisms” tab. You can is 3.15 wild-type: 1 sepia flies.
now start crossing flies by selecting the desired
individuals. The selected parental flies, 7) Analyze your results and provide the
identification and phenotypes will appear on required information in your assignment. DO
the right. Click on “Cross Flies” to perform the NOT delete/trash the “vials” of the crosses you
cross. performed. We may need this information to
check your work.
6) Perform the number of crosses described
in your assignment. Record the number of 8) Complete and submit your assignment
offspring phenotypes and ratios in the provided by the deadline. Please carefully read the
templates. An easy way to obtain phenotypic questions in your assignment.
ratios is dividing the higher-class number by
129
ASSIGNMENT # 9
RETURN AN ELECTRONIC COPY (I.E. SCANNED COPY) THROUGH THE LMS PLATFORM
PLEASE CHECK DEADLINES ON THE LAB’S WEBSITE
IN-PERSON LABORATORY WORK: GEL ELECTROPHORESIS

1. Please provide the running conditions for the gel electrophoresis used by your group:
DNA ladder: ______ ul Sample: _______ ul
Voltage: ______ volts Time: _________ min.
Did you (and your group) obtain visible pattern of DNA fragments in the gel electrophoresis?
Yes: _______ No: _________ Potential reason: ________________________________
___________________________________________________________________________________
Using the following schematic diagram, sketch the DNA fragments produced by the PCR method of
the white locus in Drosophila.
L1: P1 white-eyed female L2: P2 wild type males
L3: F1 red-eyed female L4: F1 white-eyed male

130
CONCEPT UNDERSTANDING
2. Based on the following picture of a gel electrophoresis of the white locus in Drosophila, please provide
the possible phenotypes of each individual.
1 2 3 4
500 bp
Lane 1: ____________________________ Lane 2: ________________________________
Lane 3: ____________________________ Lane 4: ________________________________
POPULATION GENETICS SIMULATIONS
In Drosophila, the wild-type eye is normally an elongated oval whereas the bar eye phenotype is much
thinner, like a line-shape. To complete your assignment, first you should determine the genetics mode
of inheritance of the bar phenotype and then, you should estimate the genotype and allele frequencies
in two populations.
Lab9:PopGen wild population
131
3. Please use the table below to record the data of the wild population from the cross simulator. Note:
the order of the different phenotypes in the “show details” tab may be different to the order on this
template.
Eye shape F M Total
Wild type
Bar
Phenotypic ratio
Wild type Bar
4. Like labs # 2 and 3, you should determine the genetics model of inheritance of the Bar trait. Perform
the following independent crosses and record the data in the scoring tables.
Cross # 1. Wild-type female x Wild-type male
Female#: ___ Male#: ____
Vial#: _____
Eye shape F M Total
Wild type
Bar
Phenotypic ratio
Wild type Bar

132
Cross # 2. Wild-type female x Bar-eye male
Female#___ Male#: ____
Vial#: _____
Eye shape F M Total
Wild type
Bar
Phenotypic ratio
Wild type Bar
Cross # 3. Bar-eye female x Wild-type male
Vial#: _____
Eye shape F M Total
Wild type
Bar
Phenotypic ratio
Wild type Bar

133
Cross # 4. Bar-eye female x Bar-eye male
Vial#: _____
Eye shape F M Total
Wild type
Bar
Phenotypic ratio
Wild type Bar
Is there any major difference (i.e., bias) between the phenotype numbers of male vs. female flies in
any of the crosses? _______
For example: All males bar (non-wild-type); All females wild-type (non-bar).
5. Based on your analysis of the previous crosses, propose a genetics mode of inheritance for the eye
shape trait (Bar):
If your answer is “NO”, try performing additional crosses until you are completely sure about your
conclusions.
Wild-type eye shape is: Dominant: _________ Recessive: ___________
Bar eye shape is: Dominant: _________ Recessive: ___________
The Eye-shape trait is: Autosomal: _________ Sex-linked: ___________

134
6. Now that you determined the genetic basis of the trait and know which allele is dominant and
recessive, please estimate the following frequencies in the wild population (show your work):
-Frequency of the homozygous recessive. Remember, you can estimate this frequency by counting the
number of individuals showing the recessive phenotype and dividing by the total amount of flies. You
already recorded this information in question # 3. Show your work.
F(aa)=
-Frequency of the recessive allele (q). Remember that F(aa)=q2 and you already estimated F(aa) in the
previous question. Show your work.
q=
-Frequency of the dominant allele (p). Remember that p+q=1 and you already estimated q in the
previous question. Show your work.
p=
- Frequency of the homozygous dominant genotype. Remember that F(AA)=p2 and you already
estimated p in the previous question. Show your work.
F(AA)=
-Frequency of the heterozygous genotype. Remember that F(Aa)=2pq and you already estimated p
and q in the previous questions. Show your work.
F(Aa)=
135
7. Perform a cross (# 1) between two homozygous recessive individuals selected from the wild
population. Record the number of flies in the scoring table below.
Vial#: _____
Eye shape F M Total
Wild type
Bar
Phenotypic ratio
Wild type Bar
8. Based on the obtained offspring from cross # 1, please estimate the following frequencies (show your
work):
-Frequency of the homozygous recessive.
F(aa)=
-Frequency of the recessive allele (q). Show your work.
q=
-Frequency of the dominant allele (p). Show your work.
p=
136
-Frequency of the homozygous dominant genotype. Show your work.
F(AA)=
-Frequency of the heterozygous genotype. Show your work.
F(Aa)=
- Please provide a summary of the estimated frequencies.
Wild Population (q#4): F(AA)= ______ F(Aa)= _____ F(aa)= _____ p= _____ q= _____
This cross # 1 (q#8): F(AA)= ______ F(Aa)= _____ F(aa)= _____ p= _____ q= _____
- Did the genotype and allele frequencies changed abruptly? If so, how can you explain these changes?
137
9. Please obtain data from a cross (# 2) between two heterozygous individuals selected from the wild
population. Record the number of flies in the scoring table below.
Vial#: _____
Eye shape F M Total
Wild type
Bar
Phenotypic ratio
Wild type Bar
10. Based on the obtained offspring from the previous cross (# 2), please estimate the following
frequencies (show your work):
-Frequency of the homozygous recessive.
F(aa)=
-Frequency of the recessive allele (q). Show your work.
q=
-Frequency of the dominant allele (p). Show your work.
p=
138
-Frequency of the homozygous dominant genotype. Show your work.
F(AA)=
-Frequency of the heterozygous genotype. Show your work.
F(Aa)=
- Please provide a summary of the estimated frequencies.
Wild Population (q#6): F(AA)= ______ F(Aa)= _____ F(aa)= _____ p= _____ q= _____
This cross # 2 (q#10): F(AA)= ______ F(Aa)= _____ F(aa)= _____ p= _____ q= _____
- Did the genotype and allele frequencies changed abruptly? If so, how could you explain these
changes?
*IMPORTANT NOTE*:
139
APPENDIXES
Appendix I. The sex-linked factors proposed in “Sex-linked Inheritance in Drosophila”, by Thomas
Hunt Morgan and Calvin B. Bridges (1916)
Gen. Part affected. Symbol. Locus. Date found. Found by.

White Eye-color w 1.1 May 1910 Morgan.
Rudimentary Wings r 55.1 June 1910 Morgan.
Miniature Wings m 36.1 Aug. 1910 Morgan.
Vermilion Eye-color v 33 Nov. 1910 Morgan.
Yellow Body-color y 0.0 Jan. 1911 Wallace.
Abnormal Abdomen A′ 2.4 July 1911 Morgan.
Eosin Eye-color we 1.1 Aug. 1911 Morgan.
Bifid Wings bi 6.3 Nov. 1911 Morgan.
Reduplicated Legs 34.7 Nov. 1911 Hoge.
Lethal 1 Life l1 0.7 Feb. 1912 Rawls.
Lethal 1a* Life l1a 3.3 Mar. 1912 Rawls.
Spot* Body-color ys 0.0 April 1912 Cattell.
Sable* Body-color s 43 July 1912 Bridges.
Dot* Thorax 33 ± July 1912 Bridges.
Bow* Wings Aug. 1912 Bridges.
Lemon* Body-color lm 17.5 Aug. 1912 Wallace.
Lethal 2 Life l2 12.5± Sept. 1912 Morgan.
Cherry Eye-color wc 1.1 Oct. 1912 Safir.
Fused* Venation fu 59.5 Nov. 1912 Bridges.
Forked* Bristles f 56.5 Nov. 1912 Bridges.
Shifted* Venation sh 17.8 Jan. 1913 Bridges.
Lethal sa Life lsa 23.7 Jan. 1913 Stark.
Bar Eye-shape B′ 57 Feb. 1913 Tice.
Notch Wing N′ 2.6 Mar. 1913 Dexter.
Depressed* Wing dp 18 April 1913 Bridges.
Lethal sb Life lsb 16.7 April 1913 Stark.
Club* Wings cl 14.6 May 1913 Morgan.
Green* Body-color May 1913 Bridges.
Chrome* Body-color Sept. 1913 Bridges.
Lethal 3 Life l3 26.5 Dec. 1913 Morgan.
Lethal 3a Life l3a 19.5 Jan. 1914 Morgan.
Lethal 1b* Life l1b 1.1- Feb. 1914 Morgan.
Facet* Eye fa 2.2 Feb. 1914 Bridges.
Lethal sc Life lsc 66.2 April 1914 Stark.
Lethal sd Life lsd May 1914 Stark.
Furrowed Eye fw 38 Nov. 1914 Duncan.
140
Appendix II. Common mutations in Drosophila
Black (blk): Body color is black, much darker than that of the wild type.
Brown eye (bw) Brown eyes
Cinnabar (cn): Bright red eyes
Curly (Cy): Wings curled upwards
Bar eye (B): The eye is restricted to a narrow, vertical bar.
Ebony body (e): Body color black
White eyes (w): white color
Rosy eyes (r): Eye brownish in color
Sepia eyes (se): Eye color is a dark brown with the central dark spot, seen in wild flies,
Vestigial wings (vg): The wings are reduced to just a vestige, usually held at right angles to the body.
These flies cannot fly.
Dumpy wings(dp): The wings are shorter and wider than the wild type. They also slope inwards at
the posterior edge.
Miniature wings (m): The wings have normal proportions, but their size is reduced; they barely extend
past the end of the abdomen.
Scarlet eyes (st): Eyes bright red; ocelli colorless
Singed bristles (sn): The bristles on the head and thorax are shortened and twisted.
Yellow body (y): The body is yellow in color.
Cross-veinless (cv): Cross veins are absent.
Forked bristles (f): The tips of bristles on the head and thorax are forked.
Vermilion eyes (v): Eye color bright orange red.

141
IMPORTANT REFERENCES
1. Snustad, Simmons (2009). Mendelism: The basic principles of Inheritance. In Kevin Witt, Merillat
Staat (Eds). Principles of Genetics (pp 43-52). Hoboken. New Jersey 6730. John Willey and Sons.
2. Mertens, Thomas R, Robert L. Hammersmith (2007). Drosophila and Maize experiments in Genetics,
Monohybrid, and dihybrid crosses. In Gary Carlson, Dan Kaveney(Eds). Genetics Laboratory
Investigations. (pp 1-19). Upper Saddle River, New Jersey 07458. Pearson Prentice Hall.
3. Flagg, R.O.(1979). Carolina Drosophila Manual. Burlington. NC: Carolina Biological Supply Co.
4. Klug, W.S. and M.R. Cummings (1991). Linkage, Crossing Over, and Chromosome Mapping. In R.L.
Rogers (Ed). Concepts of Genetics (pp 144-146). New York, New York 10022, Macmillan Company.
5. McMillan, Victoria (2006). Writing Lab Reports and Research Papers. In writing papers in the
Biological Sciences (Eds. Jennifer Blanksteen, Amy Hurd Gershman), Bedford/St. Martin’s, USA (pp
68-113).
6. Ward’s Teacher Guide. Chromatography of Drosophila Eye Pigments. Lab Activity,36 W 1100
7. Smith, O.P. and K.F. Falkenstein. 2011. Linking Genotype to Phenotype in Drosophila melanogaster:
PCR Genotyping the White-one Eye Mutation. Pages 151-170, in Tested Studies for Laboratory Teaching,
Volume 32 (K. McMahon, Editor). Proceedings of the 32nd Conference of the Association for Biology
Laboratory Education (ABLE), 445 pages. http://www.ableweb.org/volumes/vol-
32/v32reprint.php?ch=13

Biol 226 Lab Manual 2023 Fall

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Biol 226 Lab Manual 2023 Fall

Uploaded by

Copyright:

Available Formats

BIOL-226

FALL TERM - 2023

THIS PAGE IS INTENTIONALLY LEFT BLANK

THIS PAGE IS INTENTIONALLY LEFT BLANK

LEARNING OUTCOMES genetics analyses in microorganisms, plants,

*Please consider performing a web search for Drosophila mutants. There is

Adult (yellow body, white eyes,

Illustration of male (left) and female

Adult male (yellow body, white

Quick guide for Drosophila notation

Wild Type Mutant

If the mutation is Dominant A+ A

If the mutation is Recessive a+ a

chromosome(s) (autosomal vs. sex-linked) and the

b) If two genes (a and b) are located on the

c) If the genes (a and b) are located only on

HANDS ON: IN-PERSON PRACTICAL COMPONENT

phenotypes and distinguish between male and

P1 Female: yellow body, white P2 Male: Sepia eyes (wild

3. Sort the flies on the wild population by “all

https://youtu.be/ssxfsgI81Zs Wing shape: Vestigial – Wild-type (long)

PRACTICE YOUR PHENOTYPING

THIS PAGE IS INTENTIONALLY LEFT BLANK

NAME: ______________________________________ STUDENT #: ___________ DATE: ____________

Drosophila GENETICS NOTATION

Notation (homozygous or pure

Body Wild Mutation Male Male Female Female

Eye Red Sepia Recessive Autosome

Genes are genetically linked

Eye: ____________ Eye: ____________ Eye: ____________

Eye: ____________ Eye: ____________ Eye: ____________

Eye: ____________ Eye: ____________ Eye: ____________

IN-PERSON LABORATORY WORK AND IDENTIFICATION OF PHENOTYPE

Body: Eye: Wing:

P1 Female: yellow body, P2 Male: Sepia eyes (wild

P1 possible genotype(s):_____________ P2 possible genotype(s):_____________

P3 possible genotype(s):_____________ P4 possible genotype(s):_____________

Illustrate the two crosses using the Punnet square templates.

½ wild-type : ½ vestigial-wing All wild-type flies.

Wild-type wing shape is: Dominant: _________ Recessive: ___________

Vestigial wing shape is: Dominant: _________ Recessive: ___________

The wing-shape trait is: Autosomal: _________ Sex-linked: ___________

Female#___ Male#:____ Female#___ Male#:____ Female#___ Male#:____

Female#___ Male#:____ Female#___ Male#:____ Female#___ Male#:____

Female#___ Male#:____ Female#___ Male#:____ Female#___ Male#:____

Female#___ Male#:____ Female#___ Male#:____ Female#___ Male#:____

LABORATORY # 2: Drosophila BREEDING EXPERIMENT (F1 GENERATION) AND

LEARNING OUTCOMES a dihybrid cross (AaBb X AaBb) the expected F2

Secondly, the principle of independent

PROCEDURE FOR CROSS SIMULATIONS

Remember the main cross:

3. Sort the flies on the wild population by “all

3. Transfer the flies to a clean vial and use ice to

4. Click on the “Show Details” button. You

THIS PAGE IS INTENTIONALLY LEFT BLANK

NAME: ______________________________________ STUDENT #: ___________ DATE: ____________

IN PERSON LABORATORY WORK AND IDENTIFICATION OF PHENOTYPES

Males Females Total

YES: ____ NO: ____

P1 Female: yellow body, P2 Male: Sepia eyes (wild

F1 males phenotype: ______________________________________________

F1 females phenotype: ______________________________________________

The gene is: Autosomal: ____ Sex-linked: ____

The wild-type allele (trait) is: Dominant: ____ Recessive: ____

NAME: ________________________________ STUDENT #: _ DATE: ________

Eye: Eye: Eye:

Eye: Eye: Eye:

Eye: Eye: Eye:

P1 possible genotype(s):_ P2 possible genotype(s):_

P3 possible genotype(s):_ P4 possible genotype(s):_

Wild-type wing shape is: Dominant: _ Recessive: ___

Vestigial wing shape is: Dominant: _ Recessive: ___

The wing-shape trait is: Autosomal: _ Sex-linked: ___

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

NAME: ________________________________ STUDENT #: _ DATE: ________

YES: NO:

The gene is: Autosomal: Sex-linked:

The wild-type allele (trait) is: Dominant: Recessive:

The yellow allele (trait) is: Dominant: Recessive:

The gene is: Autosomal: Sex-linked:

The wild-type allele (trait) is: Dominant: Recessive:

The white allele (trait) is: Dominant: Recessive:

The gene is: Autosomal: Sex-linked:

The wild-type allele (trait) is: Dominant: Recessive:

The miniature allele (trait) is: Dominant: Recessive:

The wild-type allele (trait) is: Dominant: Recessive:

The sepia allele (trait) is: Dominant: Recessive:

P1: y-w-m females: X P2: sepia males:

YES: NO:

P1 Curly-wing females: __ P1 Gametes:

P2 ebony body males: __ P2 Gametes:

F1 genotype: X F1 genotype:

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Wild-type wing is: Dominant: _ Recessive: ___

Curly wing shape is: Dominant: _ Recessive: ___

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Wild-type body color is: Dominant: _ Recessive: ___

Ebony body color is: Dominant: _ Recessive: ___

NAME: ________________________________ STUDENT #: _ DATE: ________

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Wild-type eye coloration is: Dominant: _ Recessive: ___

Sepia eye coloration is: Dominant: _ Recessive: ___

The eye-color trait is: Autosomal: _ Sex-linked: ___

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Female#_ Male#: Female#_ Male#:__ Female#_ Male#:____

Wild-type body color is: Dominant: _ Recessive: ___

Yellow body color is: Dominant: _ Recessive: ___

The Body-color trait is: Autosomal: _ Sex-linked: ___

F1 females: X F1 males: __