Polymer 223 (2021) 123694

Contents lists available at ScienceDirect

Polymer
journal homepage: http://www.elsevier.com/locate/polymer

Synthesis of shape memory electroconductive polyurethane with

self-healing capability as an intelligent biomedical scaffold for bone
tissue engineering
Alireza Shaabani, Roya Sedghi *
Department of Polymer and Materials Chemistry, Faculty of Chemistry and Petroleum Sciences, Shahid Beheshti University, GC, 1983969411, Tehran, Iran

A R T I C L E I N F O A B S T R A C T

Keywords: Electrically conductive polymeric materials are known as a special class of intelligent bioactive materials capable
Shape memory of regulating cellular behaviors of human adipose-derived mesenchymal stem cells, especially their differenti­
Self-healing ation to bone tissue. Here the synthesis of electroactive self-healing polyurethane scaffolds (PUAT) with shape
Conductive scaffolds
memory ability based on aniline trimer and disulfide bonds are reported. The prepared scaffolds were charac­
Aniline trimer
Bone tissue engineering
terized by FTIR, tensile test, water contact angle, electrical conductivity, and degradation test. The PUAT5
scaffold (containing 5% aniline trimer) exhibited excellent self-healing (>95%) and shape memory properties
with shape recovery ratio (>95%, ~30 s at 40 ◦ C) and shape fixity ratio (>96%) at a temperature close to the
physiological temperature. The PUAT5 significantly promote the human adipose-derived mesenchymal stem cell
adhesion and proliferation compared to PUAT0 and TCP. Also, the gene expression level of RUNX2, COL1, ALP,
and OCN of PUAT5 were significantly enhanced after 21 days, in line with the increased maturity of extracellular
matrix and mineralization. Furthermore, almost 75% of the bone volume has been recovered at 8 weeks post-
surgery while the control group showed 26% recovery. The In vitro and In Vivo results suggested that these
multifunctional engineered constructs have great potential in repairing various bone defects.

1. Introduction physiochemical characteristics, low cytotoxicity, and easy fabrication

Tissue engineering is an important emerging biomedical technology
and methodology that regenerate, maintain, or improve damaged tissue
function or a whole organ [1]. The main components of engineered
tissues are scaffolds, cells, and growth-stimulating signals [2]. The
biomaterial scaffolds play the most crucial role in determining the
biomechanical characteristics of engineered tissues [3].
Tissue-engineered constructs should mimic the structure and properties
of the native extracellular matrix (ECM). Therefore it acts as a suitable
artificial ECM microenvironment to structural support for cell attach­
ment, migration, proliferation, and differentiation [4]. These engi­
neered tissues have great potential for the generation and
transplantation of several tissues including in the liver, nerve, skin,
vascular, cartilage, especially in bone tissues due to the increased
prevalence of bone diseases and defects in the median age of the pop­
ulation [5,6].
Natural and synthetic biocompatible polymers have been widely
used for bone tissue engineering applications due to controllability on
into different shapes [7]. Among them, polyurethane scaffolds are an
attractive class of biodegradable polymers because of their biocompat­
ibility, non-cytotoxic decomposition products, tunable mechanical
properties, and potential for loading osteogenic materials [8]. PU-based
biomaterials have been introduced in the field of drug delivery mate­
rials, artificial catheters, articular cartilage, shape-memory materials,
and various tissue repair and regeneration [9]. Many researchers re­
ported that PU and its composite scaffolds integrated with protein,
inorganic nanoparticles, and other synthetic and natural copolymers
provided a fertile biological platform for osteogenic differentiation [10].
Due to the response of bone tissue to an external electrical signal,
electrically conducting polymers, as a promising generation bio­
materials have been paid rare attention [11].
Conducting polymers such as polypyrrole, polythiophene, polyani­
line, and their derivatives enhanced adhesion, proliferation, and dif­
ferentiation of mesenchymal stem cells, MC3T3-E1 cells, C2C12 cells,
and osteoblast-like SaOS-2 cells [12,13]. Polyaniline (PANI) is one of the
most studied conductive polymers due to its tunable electrical

* Corresponding author.
E-mail addresses: a.shaabani@mail.sbu.ac.ir (A. Shaabani), r_sedghi@sbu.ac.ir (R. Sedghi).

https://doi.org/10.1016/j.polymer.2021.123694
Received 30 December 2020; Received in revised form 18 March 2021; Accepted 21 March 2021
Available online 26 March 2021
0032-3861/© 2021 Elsevier Ltd. All rights reserved.
A. Shaabani and R. Sedghi
properties, ease in synthesis, low cost, and simple and environmental
stability [14]. However, its non-biodegradability, poor cell compati­
bility, mechanical brittleness, and poor processability restricted their
biomedical applications [15,16]. On the contrary, aniline oligomers like
aniline trimer, tetramer, and pentamer have a similar range of electrical
conductivity with the added advantage of being good processability,
ease of biodegradability, and ease to functionalize with hydrolyzable
end groups [14]. Moreover, they can be easily introduced into other
degradable polymers structure to endow the materials with unique bone
properties [14,15]. Also, the design and performance of the engineered
constructs can be improved by the self-fitting capacity of shape memory
polymers (SMPs). The biocompatible SMP scaffolds can be seeded with
different types of cells and delivered into the damaged tissue by mini­
mally invasive surgical procedures to reduce hospitalization stay and
infection risk [17]. They can be fixed at a temporary shape and restore
their original shape after being implanted into the injured tissue to fill
the bone defect [18]. Also, the electrically conductive scaffolds made
from SMP offer significant promise for future smart biomaterials, espe­
cially in the area of minimally invasive surgery [1,2]. Scaffolds with
shape memory capability can be implanted into the body in a com­
pressed temporary shape through a small incision to be fit after recovery
of the original shape at the damaged area [3,4]. It should be noted that
compressing the scaffolds that are not flexible enough, leads to the
formation of the microcracks in the structure. These microcracks grad­
ually and progressively propagate and grow in number and dimension
and will ultimately cause structural failure if they are not repaired in due
time [19]. Therefore, introduce a self-healing mechanism into the
chemical structure of the implant can maintain the efficiency of the
scaffold by autonomously repairing the damaged areas in the event of
physical and mechanical damages such as microcrack and mechanical
stress [5].
Since the recognition of the damaged area in medical implants and
prostheses is extremely challenging, the production of scaffolds with
inherent crack repair capability, and thus extend the lifespan of
implantable medical devices is very crucial [20] Nowadays, many types
Scheme 1. Schematic represented the synthesis of the AT-contained scaffolds.
2
Polymer 223 (2021) 123694
of self-healing systems based on covalent or noncovalent bonds such as
acylhydrazone bonds, Diels Alder bonding, hydrogen bonding, and etc.,
have been developed [21]. There into, the disulfide bond is one of the
most fascinating dynamic chemical covalent bonds based on thio­
l/disulfide redox dynamic exchange reactions. This system could
self-healing under mild conditions with various stimuli such as heat,
light, and pH through a one-step manner self-healing mechanism [22].
Because the activation of the disulfide self-healing process requires
nucleophilic thiolates at neutral and alkaline pH, performing a
self-healing process in the body is accompanied by challenges. The use
of gold in the engineering scaffold structure by creating a dynamic ex­
change reaction between gold (I)-thiolate (Au–S) species and free thio­
late results in a self-healing process under the physiological conditions
of the body [22]. Also, due to the low mobility of the polymeric chains as
well as the poor chance of the edges of the cracks to approach each other
and perform repair, the shape memory property can be used for faster
repair. In fact, shape memory capacity by eliminating external stimuli
needed for repair accelerated the healing process.
Herein, we design and report a conducting self-healing system based
on gold (I)-thiolate (Au–S) and disulfide bonds having shape memory
effect properties (Scheme 1). Since the application of these conducting
self-healing polymers has not been reported for tissue engineering pur­
poses, studying the biological properties of these polymers seems
attractive. So, in the present study, the prepared scaffolds were inves­
tigated by scanning electron microscopy (SEM), Fourier transform
infrared spectroscopy (FTIR), Atomic force microscopic (AFM), and
water contact angle. Then shape memory effect and self-healing prop­
erties of the prepared scaffolds evaluated. The hADSC cell-seeded scaf­
folds were then analyzed for evaluating their potential application as
bone tissue scaffolds in detail. By combining the self-healing, conduc­
tivity, and shape memory performance, we expected to design and
develop customized bone tissue constructs for use in the minimally
invasive surgical method.
A. Shaabani and R. Sedghi
2. Materials and methods
2.1. Materials
The ethylene glycol (EG, Merck) and ϵ-caprolactone (ϵ-CL, Aldrich)
were dried under calcium hydride (CaH2) for 48 h at room temperature,
filtered, and distilled under reduced pressure before use. The isophorone
diisocyanate (IPDI), tetrahydrofuran (THF), aniline, stannous octoate
(Sn(Oct)2), HAuCl4, cystamine dihydrochloride, dibutyltin dilaurate
(DBTDL), potassium hydroxide (KOH), paraphenylenediamine (PPDA),
glutathione (GSH), dichloromethane (DCM), ethanol (EtOH), HCl,
Hexamethylenediamine (HMDI), and ammonium persulfate (APS) were
supplied by Merck (Merck Millipore, Darmstadt, Germany). Also, Dul­
becco’s Modified Eagle Medium (DMEM), Fetal Bovine Serum (FBS),
and penicillin-streptomycin supplied from Gibco BRL (Life Technolo­
gies, Merelbeke, Belgium).
2.2. Preparation of the scaffolds
2.2.1. Preparation of the cystamine (CYS)
To a solution of cystamine dihydrochloride (10 mmol) in 25 mL
distilled de-ionized (DDI) water was added 2.2 eq potassium hydroxide
and stirred for 10 min at room temperature. The reaction mixture was
extracted with 4 × 50 mL DCM. The combined organic phase was dried
with anhydride MgSO4, filtered and the combined organic layers were
dried with MgSO4, filtered, and the solvent was evaporated under
reduced pressure to yield a slightly yellow oil. The resulted product
should be used immediately after preparation [23].
2.2.2. Synthesis of the amino-terminated aniline trimer (AT)
PPDA (8 mmol) was dissolved in a 100 mL aqueous solution of HCl
(1 M) and 40 mL of EtOH. The flask cooled to about − 5 ◦ C in a NaCl/
crushed-ice bath before APS (8 mmol) was added successively. The re­
action conducted under the air atmosphere for 5 min, and then the an­
iline (16 mmol) rapidly added into the reaction flask. After 45 min the
obtained suspension was collected by vacuum filtration and the pre­
cipitation washed with 30 mL of 1 M HCl, followed by 80 mL of DDI
water. The AT salt was converted to the base form by stirring for 2 h in
40 mL of 1 M NH4OH aqueous solution. The precipitate was collected by
vacuum filtration, washed with DDI water until the pH reached 7, and
then dried at 40 ◦ C for 24 h in a vacuum oven to achieve the yield of
30%. 1H NMR (300 MHz, DMSO‑d6, δ): 5.42 (s, 4 H), 6.60–6.83 (m, 4 H),
6.70–7.10 (m, 4 H). ESI TOF HRMS m/z: found: 289.1442, calculated for
C18H17N+ 4 [MH] : 289.1448 [24].
+
2.2.3. Synthesis of the PCL
The PCL was synthesized by ring-opening polymerization of ϵ-CL
using Sn(Oct)2 as the catalyst and EG as the initiator. First, a calculated
amount of CL, Sn(Oct)2, and EG were placed into the reaction flask
quickly. Then, the trace water was removed by preheating the reaction
flask under a high vacuum for 4 h with continuous stirring. Finally, the
reaction flask was kept at 130 ◦ C for 24 h under a dry nitrogen atmo­
sphere. After the completed reaction, the reaction balloon is cooled to
room temperature, dissolved in the minimum amount of dichloro­
methane, and precipitated in cold water. The precipitate was filtered,
washed with cold water, and dried in a vacuum oven at room temper­
ature (Mn 1H NMR = 2030, Mn GPC = 2110, Mw/Mn = 1.21) [25].
2.2.4. Preparation of the scaffolds
PCL was preheated at 80 ◦ C for 2 h under a high vacuum to remove
trace moisture. Then reaction flask cooled to 70 ◦ C and fresh dried THF
was added. After that, IPDI and DBTDL (0.06 wt% respect to PCL) were
then added to the reaction flask and the mixture was magnetically
stirred for 4 h under N2 protection. The flask temperature was cooled to
room temperature and CYS was added gradually. The mixture was
further stirred at 70 ◦ C for 6 h. The molar ratio of PCL/IPDI/CYS was 1/
3
Polymer 223 (2021) 123694
2.05/1. After completion of the reaction AT at the weight ratio of 1, 3, 5
and 10% (respect to dry polymer weight) added to the reaction mixture
and then some drop of DMSO added to completely dissolved AT. The
HAuCl4 solution added 6-fold excess of the disulfide groups to all scaf­
folds. After the concentrated mixture, the solution was poured into PTFE
mold at 60 ◦ C for 24 h and then 80 ◦ C for 72 h. Samples with different AT
contents were named PUAT1, PUAT3, PUAT5, and PUAT10, which
corresponding to AT content of 1%, 3%, 5%, and 10%, respectively
(Scheme 1). As a control sample, polymer film without AT was prepared
and named PUAT0.
The prepared scaffolds were treated for 10 min in an oxygen plasma
reactor Diener Femto (Diener Electronic, Germany) operated at a fre­
quency of 2.46 GHz. The oxygen flow rate, power input, and pressure
were adjusted at 20 sccm, 50 W, and 40 Pa, respectively. After oxygen
plasma modification the samples were exposed to air for 30 min to settle
any remaining free radicals.
The O2 plasma treatment scaffolds were used in all analyzes except
for the FTIR analysis to confirm the successful reaction between reagents
and the chemical structure of the scaffolds. After completing the reac­
tion, the AT has also been converted to a doped form (using HCl) in all
AT-contained scaffolds and has been evaluated in all analyzes. More­
over, the HAuCl4 was used in all of the scaffolds.
2.3. Characterization and measurements
2.3.1. Fourier transform infrared spectroscopy
Fourier transform infrared spectroscopy (FTIR) of samples was per­
formed with a Thermo Nicolet 5700 FT-IR spectrometer (Waltham, MA,
USA) which is equipped with germanium attenuated total reflection
(ATR) accessory. All measurements were recorded from 600 cm− 1 to
4000 cm− 1 with a resolution of 4 cm− 1 and 100 scans.
2.3.2. Morphology
The morphology and elemental mapping of the scaffold surfaces
were performed using a field emission scanning electron microscopy/
energy dispersive X-Ray spectroscopy (FESEM, TESCAN, Mira 3, Czech
Republic). Also, the surface roughness of the scaffolds was evaluated
using DPN 5000 System AFM (InkCADTM, NanoInk Inc., Skokie, USA) in
the non-contact mode in the air.
2.3.3. Self-healing analysis
The self-healing ability of the prepared samples was assessed using
films with approximate dimensions of 10 × 10 × 1 mm3. The samples
were scratched with a clean razor blade to an approximately 50%
thickness of the sample and healed under heated to 40 ◦ C for 10 h. The
self-healing process of the damaged specimens was evaluated with a
light microscope (Nikon Eclipse E600 microscope, Tokyo, Japan) [26].
2.3.4. Shape memory analysis
The shape memory performance of the fabricated scaffolds was
performed by the U-bending test [17]. The samples were cut into 40 × 6
× 0.2 mm3. The specimens were put into the 40 ◦ C water for 15 s and
deformed into a “U" shape with an angle of (αf). Then, the bended shape
was placed into the 20 ◦ C water for 15 min to fix at the temporary shape
with the storage angle of (αu). Next, the folded samples were placed in
the water bath at a temperature of 40 ◦ C, and then shape recovery (αp)
was measured.
The shape memory cycle was repeated fourth times and evaluated as
the equations below:
αu
Shape fixity (%) = × 100
αf
αf − αp, N
Shape recovery (%) = × 100
αf − αp,N− 1
N denoting the number of each shape memory cycle.
A. Shaabani and R. Sedghi
2.3.5. Dynamic mechanical analysis
Dynamic mechanical analysis (DMA) was performed using TA In­
struments DMA Q800 (USA) to obtain the loss tangent (tan δ) versus
temperature curves. The samples were scanned from − 50 ◦ C to 90 ◦ C, at
a frequency of 10 Hz and a heating rate of 5 ◦ C/min.
The mechanical properties of the neat and healed samples were
enforced using an Instron 3367 universal tester and according to the
ASTM D882 standard. The scaffolds were cut into a dumbbell-shaped
specimen with an affective dimension of 20 × 4 × 2 mm3. Then, the
analysis was performed at ambient temperature at a fixed cross-head
speed of 100 mm min− 1 until the sample ruptured. Finally, the tensile
strength, elongation at break, and Young’s modulus were recorded.
2.3.6. Surface wettability
The water contact angle of the samples was evaluated using the
sessile drop method with a Dataphysics OCA 15 plus goniometer (Data
Physics Instruments GmbH, Filderstadt, Germany). All measurements
were repeated three times and the mean ± standard derivative was
reported.
2.3.7. Electrical conductivity
The electrical conductivity of the samples was measured using the 4-
point probe resistivity measurement tester JANDEL RM2 (Jandel Engi­
neering, Ltd., USA).
2.3.8. In vitro degradation
The In vitro degradation behavior of the scaffolds evaluation was
performed in PBS and GSH-contained PBS solutions. For this purpose,
the pre-weighed scaffolds of each type (1 × 0.5 cm2, wi) placed in 20 mL
of degradation medium solutions (pH = 7.4) under mild agitation (60
rpm) at 37 ◦ C. The degradation rate was monitored at weeks 1–8. At
each time point, the scaffolds were withdrawn and washed with DDI
water to remove residual PBS salts. After drying the samples and
weighing them (wf), the weight loss percentage was achieved as follows
[17,27]:
Wi − Wf
Weight loss(%) = × 100
Wi
2.3.9. Human adipose-derived mesenchymal stem cells (hADSCs)
extraction
The human adipose-derived mesenchymal stem cells (hADSCs) were
isolated from the fat tissues during liposuction of patients in Erfan
Hospital (Tehran, Iran) after obtaining adequate informed consent from
all patients and approval from the hospital ethics committee. The tissues
were washed with HPLC grade water (Sigma-Aldrich) and further
treated with 0.075% collagenase type I (Sigma-Aldrich, St. Louis, MO,
USA) in PBS for 30 min at 37 ◦ C under gentle agitation. The digested
adipose tissue was centrifuged, the supernatant was removed, and the
cell pellet was treated with red blood cell lysis buffer (Sigma-Aldrich) at
room temperature for 5 min. The hADSCs were expanded in a T-75 tissue
culture flask and then further maintain in DMEM and culture medium
supplemented with 10% FBS (Sigma-Aldrich) and 1% penicillin/strep­
tomycin (10,000 U/mL-10,000 μg/mL). They were grown in a humidi­
fied atmosphere at 37 ◦ C and 5% CO2. The growth medium was changed
twice per week, and cells were passaged on approaching 80–90%
confluence by the use of 0.25% trypsin-EDTA solution (Sigma-Aldrich,
USA) [28].
2.3.10. Cell seeding
First, the scaffolds were immersed in ethanol (70%) for 30 min fol­
lowed by three washed with PBS buffer. Then, alcohol sterilized scaf­
folds were put into antibiotic and medium containing penicillin-
streptomycin-amphotericin B to control bacterial contamination and
prevent yeast growth. For promoting cell attachment, the scaffolds were
incubated overnight with the basal medium. The human adipose tissue-
4
Polymer 223 (2021) 123694
derived stem cells which were isolated from human adipose tissue were
cultured in DMEM medium with 4.5 g/L glucose supplemented with
10% FBS and 25 units/mL penicillin-streptomycin (Pen-Strep) and
incubated at 37 ◦ C with 5% CO2 for 24 h. The scaffolds were transferred
to 48-well plate and the osteogenic medium containing DMEM with 10%
FBS, 50 mg per mL ascorbic acid, 10 mM dexamethasone, and 10 mM
beta-glycerophosphate was used to the culture of hADSCs cells at a
density of 2 × 104 cell/cm2. The osteogenic medium was refreshed every
2 days for up to 21 days. The tissue culture plate (TCP) in the absence of
scaffolds used as a control [28].
2.3.11. MTT assay
The proliferation rate of hADSCs on prepared scaffolds was evaluated
using the MTT assay. The sterilized scaffolds were placed in a 48-well
culture plate, seeded with a cell density of 4 × 103, and incubated
under basal medium at 37 ◦ C with 5% CO2. After 1, 3, and 7 days of cell
seeding, 25 μL of MTT solution (5 mg/mL in DMEM) was added to each
well (n = 6). To convert MTT salt to formazan crystals by mitochondrial
dehydrogenase enzyme of living cells, the plate was incubated for 4 h at
37 ◦ C. The supernatant was removed and the formazan crystals were
dissolved in 200 μL DMSO. The optical density (OD) was read at a
wavelength of 570 nm in a microplate reader (BioTek Instruments,
USA). The same procedure was carried out for hADSCs cultured on TCPS
as control [29].
2.3.12. Alizarin red S histochemical staining
Alizarin Red S (ARS) staining was used to evaluate scaffolds miner­
alization on days 7 and 21 after cell seeding. The cell-seeded scaffolds
were rinsed with PBS, fixed with 4% formaldehyde in PBS for 30 min,
and then washed with DDI water. The fixed cells were stained with ARS
solution (0.5% ARS w/v in water, pH = 6.4) for 30 min at 37 ◦ C. Then,
the cells were washed with DDI water three times and visualized under
the light microscope (Primo Star, Carl Zeiss, Germany) [30]. Also, cal­
cium deposits stained with ARS quantified with leaching solution (20%
v/v methanol and 10% v/v acetic acid in DDI water). After 15 min, the
extracted solution was centrifuged and the quantity of ARS was
measured with a spectrophotometer at a wavelength of 450 nm [31].
2.3.13. Alkaline phosphatase (ALP) activity
The level of alkaline phosphatase (ALP) activity, a common index of
bone mineralization, and osteoblast activity measured on days 7, 14,
and 21 days after cell seeding under osteogenic medium. The total
protein of stem cells was extracted using 200 μL radio immune precip­
itation (RIPA) lysis buffer, followed by centrifugation at 4 ◦ C for 15 min
at 15000 RPM. The collected supernatant was used to measure ALP
activity spectrophotometrically using a kit (Pars Azmoon kit, Iran)
following the manufacturer’s protocol at 405 nm. Finally, the ALP ac­
tivity level was normalized to the total amount of protein content [32].
2.3.14. Cell attachment
Cell adhesion morphology and qualitative attachment to the pre­
pared scaffolds were observed with SEM. After 3 days the cell-seeded
scaffolds were washed thrice with 0.15 M PBS and fixed with 2.5%
glutaraldehyde solution for half an hour at room temperature. After
rinsing three times in PBS, the scaffolds were dehydrated using a series
of graded ethanol (30, 50, 70, 90, and 100% ethanol (twice)) for 15 min
exposure at each step. The air-dried scaffolds were sputter-coated with a
thin layer of gold (approximate thickness of 5 nm) and analyzed with
SEM [33].
2.3.15. Gene expression analysis
The relative quantification of osteo-lineage markers expression,
collagen type 1 (Col1), osteocalcin (OCN), alkaline phosphatase (ALP),
runt-related transcription factor 2 (RUNX2), and housekeeping gene
glutaraldehyde phosphate dehydrogenase (GAPDH), was measured on
differentiated cells and normalized to housekeeping gene GAPDH at 7,
A. Shaabani and R. Sedghi Polymer 223 (2021) 123694

14, and 21 days. For the reverse transcription-polymerase chain reaction Inhibitory rate of bacterial growth = [(bacterial concentration of control -
(RT-PCR), the total cellular RNA was extracted and random hexamer bacterial concentration of sample)/(bacterial concentration of control)] × 100.
primed cDNA synthesis was performed using Revert Aid first strand
cDNA synthesis kit (Fermentas Inc., Hanover, MD, USA) according to
manufacturer’s instruction. PCR Amplification was carried out with Taq
2.3.18. Statistical analysis
DNA polymerase (Fermentas Inc., Hanover, MD, USA) according to the
All data were expressed as mean ± SD for at least three independent
manufacturer’s protocols. Denaturation was performed at 94 ◦ C for 10 s,
experiments. Statistical analysis was performed using Student’s t-test.
followed by annealing and elongation for 30 s at 55 ◦ C and 45 s for 72 ◦ C,
respectively. The real-time PCR was carried out using Maxima™ SYBR
Green/ROX qPCR Master Mix (Fermentas, Burlington, ON, Canada) 3. Results and discussion
followed by melting curve analysis [29]. Each reaction was repeated
three times. The primers and product lengths are listed in Table 1. 3.1. FTIR spectroscopy analysis

2.3.16. Micro-CT evaluation
The experimental procedure was performed according to the Stem
Cell Technology Research Center (Tehran, Iran) guidelines. Three
groups of 10-week-old male Wistar male rats (280–310 g, n = 4) were
housed in a temperature- and climate-controlled room (T = 25 ± 1 ◦ C,
50–60% humidity, and 14 h light/10 h dark cycle). The experimental
groups included PUAT0, PUAT5, and empty defect as a control group.
The rats were anesthetized by intraperitoneal injection of xylazine (10
mg/kg, ChemiDaru®, Iran) and ketamine hydrochloride (80 mg/kg,
ChemiDaru®, Iran). The scalp hair was shaved and disinfected with
povidone-iodine (betadine). Under constant irrigation with sterile sa­
line, 6 mm diameter critical-sized defects were produced in the left
parietal bone using a Strong 102L micro bone drilling machine (Saeshin,
Daegu, Korea), and the defects were filled with the circular scaffolds. For
the control group, the defect was left empty. Finally, the scalp incision
was closed in layers with absorbable sutures. The rats were given
cyclosporine A via subcutaneous injection at doses of 5 mg/kg of body
weight per day until sacrificed for histologic Analysis and micro-CT
evaluation (Eight weeks after surgery). The micro-CT measurement
was performed (Siemens, Erlangen, Germany). After finishing the micro-
CT evaluation, the calvaria fragments with the critical bone defects were
immersed in 4% paraformaldehyde, decalcified in 5% EDTA-Tris for 4-
weeks, and neutralized with a 5% sodium sulfate solution. After
embedded in paraffin, the tissue was cut into 5 μm thick sections,
mounted onto individual glass slides, and stained with hematoxylin and
eosin (H&E) and Masson’s Trichrome.
2.3.17. Antibacterial assay
The antimicrobial efficacy assay (time-kill kinetic assay) was tested
against Staphylococcus aureus (S. aureus) as a Gram-positive and
Escherichia coli (E. coli) as Gram-negative bacteria. The overnight culture
of bacterial cells was suspended in 1 mL PBS (pH = 7.4). The number of
cells is estimated by comparing the turbidity of the suspension with 0.5
Mcfarland medium (OD 600 = 0.08–0.13, ~ 108 CFU/mL). The different
sterilized samples (1 × 1 cm2) were put into separated vials and then, 3
mL of tryptic soy broth (TSB) and 100 μL of bacterial suspension were
added to each vial. The vials were incubated at a shaker incubated at
30 ◦ C and 200 rpm. After 1, 4, and 7 days, the aliquots of 100 μL bac­
terial broth were sampled from each vial, and the optical density was
measured at 630 nm by a biophotometer. The inhibitory rate of different
scaffolds was calculated by comparing the amount of optical density
with the control sample (bacterial suspensions without sample) and
using the following equation [34]:
The chemical structure of scaffolds was investigated by FTIR spec­
troscopy analysis and the results are shown in Fig. 1. In the spectrum of
the PCL2K (Fig. 1(a)), several characteristic peaks observed at 2945
cm− 1 and 2865 cm− 1, 1723 cm− 1, and 1178 cm− 1. These peaks are
related to, –CH2- asymmetric, carbonyl group, and C–O–C symmetric
stretching vibrations, respectively [35]. As observed in Fig. 1 (b), the
characteristic peaks of AT that appeared at 3028-3450 cm− 1, 1590
cm− 1, and 1502 cm− 1 were attributed to the stretching vibrations of the
–NH2 groups, quinoid ring, and the benzenoid ring, respectively [36].
Moreover, the bending vibration of the para-substituted benzene ring
was observed at 828 cm− 1. The FT-IR spectrum of PUAT0 (Fig. 1 (c))
exhibits a characteristic band of polyurethane linkage at 3200-3460
cm− 1 and 1568 cm− 1 which relative to stretching vibration of –NH– and
urethane linkage (C–N stretching combined with –NH– out of plane
bending), respectively [37]. The FTIR spectra of PUAT5 (Fig. 1 (d))
exhibit bands at 3200-3460 cm− 1, 1569 cm− 1, and 1505 cm− 1 that
correspond to stretching vibration of –NH, urethane linkage, and ben­
zene ring (of AT), respectively. Also, the sharp peak appears at 829 cm− 1
due to the CH vibration of the para-disubstituted benzene ring (AT). All
the data shows the successful synthesis of PU and its conductive
derivatives.
3.2. SEM analysis
The surface morphologies of the scaffolds at various content of the
AT are shown in Fig. 2 (a).
The SEM micrograph of all scaffolds, except PUAT10, exhibits very
low AT-agglomerates on the prepared films. The PUAT10 scaffold
showed small AT-agglomeration due to the higher percentage loading of
the AT. This fact has a negative effect on mechanical and electrical

Table 1
Primer sequences for RT-PCR analysis.
Gens Forward Primer Reverse Primers

GAPDH GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA

ALP GCACCTGCCTTACTAACTC AGACACCCATCCCATCTC
OCN GCAAAGGTGCAGCCTTTGTG GGCTCCCAGCCATTGATACAG
COL1 GACGAAGACATCCCACCAAT CGTCATCGCACAACACCTT
Fig. 1. FT-IR spectra of the samples: AT (a), PCL2K (b), PUAT0 (c), and
RUNX2 CTCACTGCCTCTCACTTG ATGTATTAACCTGGATTCTGG
PUAT5 (d).

5
A. Shaabani and R. Sedghi
Fig. 2. a) SEM images of the prepared scaffolds, and EDX mapping of the gold element on PUAT5 scaffold, b) AFM images of different scaffolds, and c) Micrograph of
the surface contact angle of the scaffolds.
properties. These results are confirmed by AFM analysis (Fig. 1 (b)). In
Fig. 1 (b), AFM images of the different scaffolds are displayed with the
same scan size and scale. The surface profile exhibited that the PUAT10
samples showed highly roughened surfaces with an average roughness
of 0.52 nm, and PU-AT20 has a relatively smooth surface of 0.10 nm,
while PUAT1, PUAT3, and PUAT5 had roughness values of 0.16, 0.31,
and 0.36 nm, respectively. It must be pointed out that the scaffolds with
the rough surface were favorable for cell behaviors such as cell adhesion,
differentiation, and proliferation [12]. Moreover, the EDX mapping of
the gold element (Fig. 1. (a)) showed a uniform distribution of it within
the PUAT5 scaffold without agglomeration.
6
Polymer 223 (2021) 123694
3.3. Water contact angle (WCA)
The surface wettability of biomaterial is one of the most important
surface characteristics that could regulate the biological response of the
implanted devices, such as cell adhesion, growth, proliferation, and
protein absorption. Several studies reported that hydrophilic surfaces
had a high initial rate of cell adhesion [37,38]. Also, these studies have
been reported that proliferation accelerated when cultured on a sub­
strate with WCA of lower than 70◦ [39,40].
To understand the influence of aniline trimer (AT) on the wetting
ability of the prepared scaffolds, contact angle measurements were
evaluated. The inset of Fig. 1 (c) shows that the incorporation of AT
decreased the WCA of the scaffolds and consequently improve their
hydrophilicity. As can be seen in Fig. 1 (c), the PUT0 scaffold, have an
A. Shaabani and R. Sedghi
average WCA value of 58 ± 3◦ . The AT-containing PU showed a higher
WCA value (the WCAs of PUAT1, PUAT3, PUAT5, and PUAT10 were 55
± 3◦ , 53 ± 2◦ , 49 ± 4◦ , and 45 ± 2◦ , respectively) because the amine
groups of AT was hydrophilic and could form hydrogen bonds with the
water molecule.
With the increasing amount of the AT, and thus increasing the
number of hydrogen bonds, the hydrophilicity of the scaffolds could be
improved. Also, –NH2 groups could increase the exposure of high den­
sity bound receptors such as focal adhesion (cell-matrix adhesion) by
adsorbed fibronectin. On the other hand, the result showed that –NH2
functionalized surfaces up-regulate osteoblast-specific gene expression,
matrix mineralization and differentiation, and ALP enzymatic activity.
This evidence showed that enhancement in wettability can improve cell
adhesion, proliferation, and cell-scaffold interactions.
The convenient hydrophilicity of the material was advantageous to
the adhesion of cells and growth on the surface of the material.
3.4. Mechanical analysis
To develop scaffolds mimicking the native bone tissue, the me­
chanical properties of biomaterials play an important role. PCL-based
polyurethane medical devices have found many applications in recent
years due to their high flexibility, excellent strength, and biocompati­
bility [41]. PCL is one of the most commonly used FDA-approved bio­
polymers in medical applications due to ease of processing and high
flexibility and successfully used as a polyol in the synthesis of medical
polyester urethanes [41]. The PCL-based PU scaffolds with
shape-memory properties can also be achieved by selecting the appro­
priate molecular mass of PCL and controlling its percentage in the
polymer’s structure. The PCL with a molecular weight of 1000–2000 (g.
mol− 1) is generally used to make PU scaffolds with shape memory
properties [42–44]. While the low molecular weight of PCL has a poor
function as a scaffold due to its very low flexibility, strength, and cell
adhesion, synthesis of PU with PCL as a polyol is a very effective way to
improve the physical, mechanical and cellular properties of the PCL.
The mechanical properties of prepared scaffolds with different
amounts of the AT were tested and the result summarized in Table 2 and
Fig. 3 (c). As can be seen in Table 2, the tensile strength and elongation
increased until AT content was up to 5%, while PUAT10 exhibited a drop
in tensile strength and elongation compared to PUAT5. For the tensile
stress-strain curves, the PUAT5 exhibited the highest tensile stress,
Young’s modulus, and elongation at break values among samples. The
improvement of mechanical properties suggested that strong in­
teractions such as hydrogen bonds between AT and polymers might be
formed. Another probable reason is the rigid structure of AT. Moreover,
the drop of the mechanical properties of PUAT10 might be a result of AT
aggregation which reduced the surface area of AT, thus weakened the
interactions. This aggregation is also observed by SEM (Fig. 2 (a)).
Depending on bone density, the tensile and compressive strength of
cancellous bone varied from 10 to 20 MPa and 2–12 MPa, respectively.
Also, these values for cortical bones reach 50–150 MPa and 100–230
MPa, respectively. As can be seen in Table 2, the compressive strength of
the scaffolds varies from 10 ± 0.8 MPa to 28 ± 1.3 MPa. Among the
prepared samples, the mechanical properties of the PUAT5 scaffold fall
within the range of mechanical properties of the cancellous bones.
Table 2
The mechanical properties of the prepared scaffolds.
Samples Tensile Elongation at Young’s Compressive
strength break (%) modulus strength (MPa)
(MPa) (MPa)
PUAT0 5.3 ± 0.3 121 ± 9 38 ± 2.9 28 ± 1.3
PUAT1 6.4 ± 0.6 130 ± 15 29 ± 1.6 23 ± 2.4
PUAT3 9.3 ± 1.1 162 ± 20 24 ± 1.6 18 ± 0.9
PUAT5 11 ± 1.3 193 ± 17 18 ± 2.4 12 ± 1.7
PUAT10 5.6 ± 0.7 112 ± 30 24 ± 1.4 10 ± 0.8
7
Polymer 223 (2021) 123694
Therefore, PUAT5 scaffolds seem to have the potential to be used as a
cancellous bone.
3.5. Self-healing test
The self-healing capability of the scaffolds is firstly investigated in
terms of visual inspection, and then quantified by tensile strength
measurements. The sample films (1 mm thick) were scratched with a
razor blade (1–2 μm in width, 0.5 mm in depth) and heated to 40 ◦ C for
10 h without applying any external force.
As can be seen in Fig. 3 (a), all samples exhibit very good self-healing
ability at 60 ◦ C, and only a trace crack line was observed. This result
suggested that AT had a very destructive effect on self-healing and shape
memory properties. It should be noted that the displacement analysis
indicated that the shape memory property could be weakened upon
heating [43]. The external forces are applied to carry out the displace­
ment analysis which by eliminating this force during the self-healing
process, shape memory force can be easily closed the crack. Also, the
gold in the structure of the scaffold can help to faster repair the damaged
area by creating cross-links bonds with free thiol groups. It is note­
worthy that these free thiol groups are caused by external and internal
stresses and also enzymatic degradation in the body. In comparison with
the PUAT5 scaffold, the PUAT1, PUAT3, and PUAT10 scaffolds needed
higher time to recover the original shape. Moreover, as shown in Fig. 3
(b), after compressing the scaffold for minimally invasive implantation
surgery, cracks appear in the flexion area. These cracks are repaired
after the scaffold is at the temperature required for self-healing.
To further investigate the self-healing property, mechanical analysis
of neat, scratched, and healed scaffolds was performed and the result
illustrated in Fig. 3 (c). After scratching the samples, a significant drop in
elongation at break and tensile stress was observed. But after the healing
test, all of the scaffolds except PUAT10 almost regained the original
mechanical properties. This result confirmed that during the healing
process disulfide bonds reestablished through thiol-disulfide exchange
reaction across the crack surface. Moreover, the shape memory effect
helps to faster scratch approaching and acts as an auxiliary recovery
force.
When the AT content was up to 5% and more, the scaffolds can be the
restoration of 95% and 63% of initial tensile stress, meanwhile, this
amount reached 84% and 88% for PUAT1 and PUAT3 scaffolds,
respectively. Also, the PUAT5 scaffold recovers 95% of its original
elongation at break. It is known that introducing AT in the scaffolds
structure increases hydrogen bond density. These hydrogen bonds
accelerated entanglement and interdiffusion of the dangling chains
across the crack interface. Also, the hydrogen bond helps the disulfide
bonds of the different chains get closer together, increases thiol-
exchange reaction, then increased healing efficiency. The higher
amount of the AT could induce steric effect and decreased chain
mobility, then obstructed the healing process.
To investigate the role of disulfide bonds in the efficiency of the self-
healing process, Hexamethylenediamine (HMDI, non-disulfide bond)
was used instead of CYS (containing disulfide bond) and named as
hPUAT scaffolds. As observed in Fig. S2 (a and b), after the healing
process the crack line was observed in all hPUAT scaffolds and the
samples needed higher time to recover the original shape. Moreover,
after compressing the scaffold for minimally invasive implantation
surgery, cracks appear in the flexion area. These cracks have almost
remained after the scaffold is at the temperature required for self-
healing. Also, the basis on the tensile stress, CYS-free samples,
hPUAT1, hPUAT3, hPUAT5, and hPUAT10 show a maximum healing
efficiency of 67%, 72%, 75%, and 52%, respectively indicated the role of
the disulfide metathesis on the self-healing process (Fig. S2 (c)). More­
over, Fig. S2 (c) shows that the hPUAT scaffolds have lower mechanical
strength and elongation at break than PUAT scaffolds. This is due to
disulfide groups in CYS weakly bonded to each other, therefore cannot
able to sustain the mechanical force, and breaking in the center of the
A. Shaabani and R. Sedghi Polymer 223 (2021) 123694

Fig. 3. Self-healing properties of prepared scaffolds at a) surface and b) folded area, c) Mechanical properties of the neat and healed scaffolds, and d) DMA curves of
the prepared scaffolds.

hard parts leads to the rupture of the structure [45]. However, the me­ separation was increased.
chanical properties of CYS-containing scaffolds are suitable and suffi­
cient for biological applications and have been reported in many studies
3.7. Shape memory analysis
[44,45].

The quantitively and qualitatively shape memory properties of the

3.6. Dynamic mechanical analysis
The dynamic mechanical properties of the scaffolds were investi­
gated by the DMA test as shown in Fig. 3 (d). DMA of polyurethane is
known as a polymer with hard (diisocyanate and chain extender) and
soft (polyol) segments that exhibit a micro-phase separation between
two segments. The amine groups of the AT can form strong interactions
with both hard and soft segments of the PU, therefore affected micro-
phase separation and original interactions. As a result, fluctuation in
Tg could be observed. The temperature dependence of Tan δ was shown
in Fig. 3 (d). All scaffolds displayed a peak around − 49 ◦ C, which is due
to the Tg of the soft segment. When the AT content increased, this peak
shifts to the higher temperature and reached a maximum value when AT
content was 5% (PUAT5). The increase in the Tg can be related to the
strong interactions of the AT with both soft and hard segments of the PU
which enhanced the miscibility of the segments and reduced micro-
phase separation. Moreover, these strong interactions can be distin­
guished from the Tg fluctuation [43]. It noteworthy that further increase
in AT content (PUAT10) causes the aggregation of it and weakened the
interactions. As a result, miscibility was decreased and micro-phase
scaffolds were investigated and the results showed in Fig. S1 and
Table 3. For this purpose, a temporary shape deformation was applied to
all scaffolds, and their ability to retain shape (shape fixity) and recovery
to the original shape (shape recovery) was evaluated. As observed in
Fig. S1, all samples except the PUAT10 scaffold could be fixed
completely in temporary shape at room temperature. In addition, the
shape fixity increased gradually with AT increased up to 5%, and then
decreased at the upper concentration of AT. The shape fixity of the
PUAT0, PUAT1, PUAT3, and PUAT5 were reached 91, 93, 95, and 96%,
while the PUAT10 exhibited shape fixity of 83% in the first cycle. The
recovery process of all scaffolds at 40 ◦ C was finished in 60 s completely,
as shown in Fig. S1, and Video S1. For PUAT1, PUAT3, PUAT5, and
PUAT10 shape recovery of 97, 96, 95, and 81% shape recovery was
observed while the maximum value of shape recovery of 99% appeared
for PUAT0.
Supplementary data related to this article can be found at https://
doi.org/10.1016/j.polymer.2021.123694.
The self-assembled AT aggregates formed hard segments. These hard
segments along with π- π interactions and hydrogen bonds act as phys­
ical crosslinked points determined the permanent shape of the structure

Table 3
Quantitative shape memory properties of the samples.
Shape Fixity Shape Recovery

Sample PU PU PU PU PU PU PU PU PU PU

AT0 AT1 AT3 AT5 AT10 AT0 AT1 AT3 AT5 AT10

N=1 91 93 95 96 83 99 97 96 95 81
N=2 93 95 95 93 86 96 92 92 91 84
N=3 92 94 94 99 85 91 93 91 95 77
N’ = 1 93 94 95 97 81 100 99 99 100 97

N and N′ denoted shape memory properties at 40 ◦ C and 60 ◦ C, respectively.

8
A. Shaabani and R. Sedghi
[46]. These physically crosslinked points decreased chain mobility or
lock chains in the temporary shape [37]. Thus, by increasing the amount
of AT into the chemical structure of the polymer and thereby improve­
ment of inter-intramolecular interactions and micro-phase separation,
the shape fixity is enhanced. Whereas the excessive amount of AT (10%)
decreased micro-phase separation by forming irregular hard segments
and their non-uniformity distribution, therefore decreased shape fixity
[47]. Moreover, during the shape recovery process, the weak hydrogen
bonds are broken, chain mobility and flexibility increase, resulting in
recovering the original shape [48]. At temperatures close to the physi­
ological temperature of the body (37 ◦ C), the shape recovery property
decreases with AT increase, due to insufficient internal energy to acti­
vate the molecular motions. But as the temperature rises to 60 ◦ C, the
higher internal energy causes the switching segments to become more
flexible, resulting in higher efficiency of the shape memory process over
a faster time (Table 3 (N’ cycle)).
These results showed that AT-containing scaffolds have excellent
shape memory properties such as shape fixity at room temperature and
fast shape recovery speed at phycological temperature. We expect that
these scaffolds have the potential to use as degradable implants in
minimally invasive surgery through a small incision in a compressed
temporary shape [49].
3.8. The electrical conductivity of the scaffolds
The electrical conductivities of the synthesized scaffolds with
different AT contents are listed in Table 4. All samples dissolved in
chloroform and doped with the same amount of 1 M HCl, then the
electrical conductivity of the casting films was measured by the standard
4-point probe method.
The conductivities of the scaffold with AT contents from 10 wt % to
1 wt % are between 1.8 × 10− 6 and 3.7 × 10− 7 S/cm, which is lower
than that of AT film (2.5 × 10− 5 S/cm). This is because of the low
content of AT in scaffold and the very week electron mobility of non-
conjugated PU. Moreover, the electrical conductivity increased with
the increasing AT content in the scaffolds. This large variation in elec­
trical conductivity of scaffolds, which can be adjusted by changing AT
content, provided a wide range of specific applications. Due to very low
voltage intensity in vivo (15 mV), these electrical conductivity values
were sufficient to transfer bioelectrical signals in the human body. These
electroactive smart scaffolds could combine with direct electrical stim­
ulation and potentially deliver an electric stimulus applied from skin
electrodes to treat large bone defects. Electrically conductive scaffolds
by providing precise control conditions over the localization, amount,
and duration of the electrical stimulus obviate the need for bone stim­
ulators [44]. While the exact mechanisms by which electrical stimula­
tion improved bone healing remain underexplored, collective findings of
studies proposed direct current electrical stimulation decreased the level
of oxygen and increased the pH; as a result, increased osteoblast cell
proliferation, vasculature development, secretion of several cytokines,
and ECM production [50].
3.9. In vitro degradation
According to the cellular and mechanical analysis results, the PUAT5
Table 4
The electrical conductivity of the prepared samples.
Sample AT content (%) Conductivity (S/cm)
PU 0 1.3 × 10−
AT 100 2.5 × 10−
PUAT1 1 3.7 × 10−
PUAT3 3 7.2 × 10−
PUAT5 5 1.2 × 10−
PUAT10 10 1.8 × 10−
Polymer 223 (2021) 123694
scaffolds are selected as the optimal sample and its degradation rate is
investigated in PBS and GSH medium. It also compares to a non-aniline
trimmer scaffold. Moreover, 1, 6-Hexamethylenediamine (HMDI,
hPUAT scaffolds) instead of cystamine (CYS, cPUAT scaffolds) was used
to investigate the role of disulfide bonds in the self-healing properties of
the scaffolds. The in vitro degradation study was performed on prepared
scaffolds using PBS and GSH solution at 37 ◦ C (pH = 7.4) and the results
are shown in Fig. 4. An increased rate of the degradation of the h &c-
PUAT scaffold was observed in both mediums as increasing in the
amount of the AT into the chemical structure of the scaffolds. The
hPUAT scaffolds demonstrated weight percent over the 8 weeks ranging
from 75 ± 1% for cPUAT0 scaffold to 57 ± 3% for cPUAT10 scaffold in
the PBS medium. These values reach 77 ± 1% for the hPUAT0 scaffold to
60 ± 2% for the hPUAT10 scaffold. In the early stages of degradation (7
days), cPUAT0 and cPUAT5 scaffolds have the lowest rate of loss of
mass, both in GSH- and PBS medium, whereas in hPUAT scaffolds, the
amount of degradation is directly related to the hydrophilicity of the
prepared scaffolds, the hPUAT0 and hPUAT1 scaffolds have the lowest
amount of degradation in both medium. Therefore, it can be concluded
that disulfide bonds play an important role in the self-healing properties
of the prepared scaffolds and prevent the rapid degradation of the
scaffold in the early time of the hydrolysis.
The higher degradability of the scaffolds with increasing the AT
resulted from the different hydrophilicity of them. According to the
water contact angle results, the hydrophilicity of the scaffolds increases
with AT increase. The increase in hydrophilicity accelerates the pene­
tration of water molecules into the structure of the scaffolds, increases
ester linkage hydrolysis rates, therefore led to faster hydrolysis [51].
Moreover, higher hydrophilicity causes faster diffusion of degradation
products and AT content out of the scaffolds.
In GSH solution as a disulfide reductant medium, all cPUAT scaffolds
showed faster degradation than in PBS solution, however, the cPUAT
scaffolds degradation behavior showed similar trends as that of them in
PBS medium. In hPUAT scaffolds, the trend of degradability is different
compared to cPUAT scaffolds and the amount of degradation is pro­
portional to the hydrophilicity of them. Glutathione as a reducing agent,
converts disulfide bonds to thiol groups. Since the degradation rate of
the cPUAT scaffold in the GSH medium faster than the self-healing
process, the use of gold with the ability to form strong bonds with
thiol groups can effectively reduce the rate of degradation [22]. The
lower rate of degradation of gold-containing cPUAT scaffolds than that
of gold-free scaffolds in the GSH-Medium indicates the self-healing
properties of gold-thiol bonds in the cPUAT scaffold, but this differ­
ence is not significant. The difference is probably due to the low mobility
of gold in the rigid chemical structure of the scaffolds as well as the
release of superficial gold from the surface of the cPUAT scaffold, which
increases the rate of degradation in the middle stage.
As the results show, the hPUAT scaffolds have a high self-healing
property, especially in the early stages of degradation. Therefore, the
hPUAT scaffolds can repair possible damages caused during implanta­
tion and after it (mechanical stress on the scaffold by bone and cells).
Also, the degradation profile shows that the hPUAT scaffolds have an
appropriate degradation rate, and as a result, the biodegradability will
overcome the self-healing property. The PCL-based PU scaffolds degrade
by hydrolysis of ester linkages to yield 6-hydroxyhexanoic acid and
soluble urethane fragments, which are naturally metabolized by the
human body. Moreover, the toxicology of PCL-based biomaterials has
been widely studied and reported safe for clinical treatments [52,53].
Also, hemocompatibility and biocompatibility of the aniline oligomer
confirmed by several studies [54–56].
7
Therefore, the self-healing property did not have a negative effect on
5 cellular activity such as cell attachment, proliferation, and differentia­
7 tion, which is confirmed by cellular analysis.
7
6
6
9
A. Shaabani and R. Sedghi Polymer 223 (2021) 123694

Fig. 4. In vitro degradation of the different scaffolds using a) CYS in PBS, b) CYS n PBS/GSH, c) HMDA in PBS, and D) HMDA in PBS/GSH medium in the presence or
absence of the gold element.

Fig. 5. a) MTT assay of prepared scaffolds, b) ALP enzyme activity of hADSC cells, c) quantification and d) qualification ARS staining, and e) cell attachment of
different substrates.

10
A. Shaabani and R. Sedghi
3.10. Cell attachment and proliferation
The in vitro biocompatibility of the samples was evaluated by the
hADSC cells attachment and proliferation on these scaffolds. For this
purpose, hADSC cells were seeded on the scaffolds and cultured for 1, 3,
and 7 days to evaluate the cell viability, attachment, and proliferation.
According to the cell attachment analysis (Fig. 5 (a) and Fig. 5 (e)), the
results of the cell viability exhibited that all of the prepared scaffolds
showed good biocompatibility and no cytotoxicity and inhibitory effect
on cell viability, adhesion, and morphology. As observed in Fig. 5 (e), all
the samples had good cell adhesion, so that cells were attached and
expanded on the entire scaffold surface. By modifying the surface with
plasma and enriching the surface with oxygenated functional groups,
the scaffold surface acts as a very good substrate for cell adhesion and
consequently cell growth and differentiation. After 1 day of culture,
although AT-containing scaffolds show higher cell viability than PUAT0
and TCP, this difference is not significant (Fig. 5 (a)). After 3 days of
culture, cell attachment of the AT-free and AT-containing scaffolds can
be observed in the order of PUAT0 < PUAT10 < PUAT1 < PUAT3 <
PUAT5. Moreover, for the 7 days, the cells cultured on PUAT1 (1.5
times), PUAT3 (1.8 times), PUAT5 (2.3 times), and PUAT10 (1.6 times)
scaffolds showed higher proliferation rates than that on the PUAT0
scaffold. These results indicate that by increasing the percentage of AT
up to 5%, the growth and proliferation of cells significantly increase, but
by increasing the amount of AT to 10%, the proliferation rate decreases.
The earlier research showed that the electroactive surface improved
energy and chemical exchange between cells and surroundings,
enhanced calcium deposition in the ECM, improve the osteogenesis of
differentiated mesenchymal stem cells, and facilitate the protein
adsorption for cell differentiation throughout the cascade of intra-
intercellular reactions induction [57]. Another reason is the higher
number of the amine (-NH2 and –NH–) group in AT-containing scaffolds
than PUAT0 that generated adequate signals for cell recognition and
attachment [58]. Recent studies have shown that protein adsorption and
cell attachment of hADSC cells on the hydrophilic surface much better
than hydrophobic surfaces [59]. Since the electrical conductivity of the
PUAT10 scaffold is higher than the others, therefore, the functional
groups of the scaffold surface can play an important role in cellular
behavior and supplied cytocompatibility with a suitable
micro-environment for cellular activities.
3.11. Alkaline phosphatase
ALP is an early marker of osteogenic differentiation and measuring
its enzyme activity is very important due to the mediating role of it in the
formation of the mineral apatite on ECM [60]. Fig. 5 (b) showed the ALP
activity after 7, 14, and 21 days of induction on different substrates.
The results showed the adding AT into the scaffolds has a positive
influence on osteogenic differentiation. The ALP activity of hADSC cells
on AT-containing scaffolds was higher than that of PUAT0 and tissue
culture polystyrene demonstrated that the AT can promote the ALP ac­
tivity. Also, ALP produced by hADSC cells cultured on all samples
increased with an increase in culture time from 1 day to 14 days, then
decreased. Enhancing the ALP activity with the increase of the AT
indicated the increased interactive signals between the scaffolds and
cells. These findings are thus in full agreement with previous reports that
demonstrated that introduction of AT into the chemical structure of the
scaffolds significantly enhanced cell adhesion and protein adsorption,
thus improved osteogenic differentiation [37,61].
3.12. Alizarin red S staining
To evaluate the in vitro osteogenic bioactivity of the scaffolds,
calcified matrix stained with Alizarin Red S (ARS) on days 7 and 21 of
culture. As can be seen in Fig. 5 (c) ARS absorbance of the cell-seeded
PUAT5 scaffold was higher than other AT-containing scaffolds and
11
Polymer 223 (2021) 123694
TCP. In other words, the formation of mineralized deposits over the
surface is directly related to the amount of AT and increases with
increasing it up to 5%. It was found that calcium deposition on the
scaffolds increased with time of incubation and at day 21, the absor­
bance value of ARS on PUAT1 (1.2 times), PUAT3 (2.2 times), PUAT5
(2.83 times), and PUAT10 (2.1 times) scaffolds showed higher miner­
alization than that on PUAT0 scaffold. Moreover, the digital images of
the scaffolds stained with ARS to identify bone formation are in agree­
ment with the ARS quantification assay and demonstrated that staining
intensity increased with increasing AT content up to 5% (Fig. 5 (d)).
3.13. Quantitative real-time PCR
The reverse transcription-polymerase chain reaction was used to
measure the expression of fourth osteoblast differentiation-associated
gene markers after 7, 14, and 21 days of osteogenic induction. The
mRNA level was evaluated on different scaffolds for individual gen and
the results normalized to GAPDH expression (Fig. 6). As shown in Fig. 6,
the expression of ALP is a marker of osteogenic differentiation increased
from day 1–14 and then decreased. These results are in full agreement
with the behavior of ALP in the osteogenic differentiation process where
the expression level of the ALP gene reaches its maximum value in mid-
differentiation (day 14) [62]. The increased expression of the ALP gene
on 7–14 days, is due to enter into the stage of ECM development and
maturity [63]. On the other hand, the decrease in ALP gene expression
from days 14–21 is due to complete maturation of the ECM and entering
into the mineralization stage [63]. The highest intensity of ALP
expression was recorded with the PUAT5 scaffolds and AT-contained
scaffolds have higher ALP expression than TCP and PUAT0 scaffolds.
During the osteogenic differentiation of hADSCs, RUNX2 plays a
crucial role in the early osteogenic differentiation, maturation of oste­
oblasts, and bone formation [64]. The expression of RUNX2 increases in
immature osteoblasts and reducing during osteoblast maturation. In
other words, mature osteoblasts do not express a high amount of RUNX2
protein [65]. The expression of RUNX2 was highest on day 14 and then
decreased progressively from day 14–21 for all prepared scaffolds. This
behavior indicates that the hADSCs move to the extracellular matrix
maturity stage and bone formation. For RUNX2 protein, the PUAT5
group exhibited a 2.7 times higher expression level at peak levels, while
PUAT1, PUAT3, and PUAT10 showed almost 1.4, 1.9, and 1.7 times
higher than PUAT0 scaffold, respectively. As the induction time
increased, the COL1 expression of all scaffolds dramatically increased on
day 7, then decreased gradually. Since COL1 is an early marker of
osteogenic differentiation, this behavior is quite expected and agrees
with previous studies [66]. According to the results of the ARS analysis,
the amount of calcium deposited on the scaffolds increased sharply on
days 7–21, confirming that the cells had entered the mineralization
phase. The amount of calcium ion deposited on the scaffolds is much
higher than that of the TCP, reaching its maximum in scaffold PUAT5.
More COL1 expression causes more calcium-binding, therefore
improved mineral matrix deposition on the scaffolds [67].
Since the OCN gene is secreted only by mature osteoblast cells at the
end of the mineralization phase, investigation of its secretion can
confirm the osteogenesis of scaffolds [67]. OCN is the most abundant
non-collagen protein of ECM that regulates apatite crystal growth by
coordination with the calcium ion of hydroxyapatite [68]. As can be
seen in Fig. 6, the expression level of OCN on scaffolds increased
continuously over time and peaked on day 21. Moreover, the PUAT5
scaffold upregulated OCN expression 2.81 and 3.9 folds compared to
PUAT0 and TCP at day 21, respectively. Taking together, these results
suggested that loading conductive components into scaffolds signifi­
cantly increased cell signaling and it can be considered as a core factor
for osteogenesis complementation.
A. Shaabani and R. Sedghi Polymer 223 (2021) 123694

Fig. 6. Quantitative analysis of osteogenesis-related gene expression of hADSC cells on the different substrates in differentiation medium after 7, 14, and 21 days of
osteogenic induction.

3.14. In Vivo assessment
The new bone formation in the calvarial defect site was evaluated
using micro-CT analysis and staining analysis (H&E and Masson’s tri­
chrome staining), and the result is shown in Fig. 7. The best bone
regeneration and continuous bone formation were found in the PUAT5
scaffold at weeks 8. Also, the PUAT scaffold groups exhibited notably
greater bone tissue reconstruction than the control group. As observed in
Fig. 7 (j), the newly formed bone grew around and inside the PUAT
scaffolds, effectively repairing the calvarial bone defects, while the
control group displayed the slowest healing rate. The critical-sized cal­
varial defect with PUAT0 and PUAT5 was occupied with newly formed
bone, and bone-like tissue connected the edges, while the control group
exhibited very little bone tissue only on the edges of the defects. The

Fig. 7. a) PUAT0, b) PUAT5 scaffolds were implanted into the calvarial defects of rats, c-e) H&E staining of control (defect-free), PUAT0, and PUAT5 scaffolds,
respectively, f-g) Masson’s Trichrome of control (defect-free), PUAT0, and PUAT5 scaffolds, respectively, i) Bone volume fraction of control group and scaffolds, j) 3D
views of reconstructed images and micro-CT scan assessment of new bone tissue formation after implantation, and k) Antibacterial activity of different scaffolds
against S. aureus and E. coli.

12
A. Shaabani and R. Sedghi
newly formed bone volumes/tissue volume (BV/TV) in the defects after
8 weeks of implantation were calculated and depicted in Fig. 7 (i). The
micro-CT analysis results of the implanted scaffolds and control group
resulted in the BV/TV average ratio of 51% for PUAT0 and 73% for
composite PUAT5 scaffolds, which yielded nearly 2 and 3-fold bone
regeneration compared to the control group (empty defect).
Also, histological analysis was carried out to provide a more detailed
analysis of the bone tissue formation process. The H&E and Masson’s
trichrome staining results of calvarial bone defect sites implanted with
scaffolds and empty defect (control group) for 8 weeks are depicted in
Fig. 7(c–e) and (f-h), respectively. Histological analysis by Masson’s
trichrome and H&E staining revealed more collagen and new bone
formation in the defects filled with PUAT5 scaffolds compared to the
PUAT0 scaffold and control group.
Therefore, the introduction of aniline trimer segment into the PU
scaffold remarkably enhanced osteoconductive and osteoinductive ca­
pacity, cause to the most extensive new bone formation and minerali­
zation at the defect site.
3.15. Antibacterial activity
Microbial infections are the third leading cause of death in developed
countries and the second leading cause of death in the world. For the
treatment of microbial infections broad range of antibiotics are used, but
due to the low rate of new antibiotics development and the resistance of
organisms to common antibiotics, we need to develop new antimicrobial
therapies. One of the most effective ways to overcome these problems is
to develop new inherently antimicrobial biodegradable polymers.
A broad spectrum of bacterial species such as Escherichia coli,
Staphylococcus aureus, Pseudomonas aeruginosa, and Staphylococcus
epidermidis can be found at implant sites and bone infections. Thus, the
susceptibility of the Gram-positive (S. aureus) and Gram-negative
(E. coli) bacterial species against different scaffolds were evaluated
using the Time-Killing method, and the results are shown in Fig. 7 (k).
Antibacterial tests indicated that all prepared scaffolds can inhibit
the growth of S. aureus and E. coli bacteria and the inhibitory rate of
bacterial growth increased with time of incubation. Also, the results
indicate that the PUAT10 scaffold exhibited higher antibacterial activity
than PUAT0 and others, which demonstrated that the incorporation of
AT into the scaffold improves the antibacterial activity for both micro-
organisms. The antibacterial activity assay demonstrated that the ac­
tivity of PUAT10 was more pronounced against E. coli than that against
S. aureus. Moreover, the PUAT10 scaffold displays good antibacterial
activity against E. coli and S. aureus after seven days of incubation with
bacterial inhibition percentages of 65 ± 1% and 60 ± 4%, respectively.
According to reported articles, the antimicrobial properties of aniline
compounds like polyaniline or aniline oligomer are due to the destruc­
tion of the cell wall of the microorganism [69]. Positive charged AT and
acidic dopant of it can electrostatically adhere to the negatively charged
membrane of the bacteria, break of the bacterial cell wall, then bacteria
die. Moreover, the electron transfer between AT and the bacterial wall
can lead to bacterial death. Other potential factors that may indicate
antimicrobial properties include the release of superficial gold from the
surface of the scaffold and the acidic dopant of AT into the bacterial
growth medium.
These self-healing conductive scaffolds with excellent antimicrobial
activity are promising candidates to develop double-edged materials
capable of bonds to bone tissue and show intrinsic antimicrobial
activity.
4. Conclusions
In this study, the intelligent conductive scaffolds with the shape
memory effect and self-healing capability were prepared and their po­
tential for bone tissue regeneration was evaluated. The results indicate
that the addition of aniline trimer by 5% significantly improved cell
13
Polymer 223 (2021) 123694
behavior and physicochemical properties. The simultaneous effect of the
shape memory properties and the rapid formation of disulfide and gold-
thiol bonds on the damaged sites have led to the self-healing operation
being carried out rapidly at relatively low temperatures. The hydrolytic
and GSH-Medium degradation assay also proves that these mechanisms
reduce the rate of degradation of the polymeric scaffold and increases
the lifetime of the scaffolds under physiological conditions at the early
stage of the implantation. Also, the results of cellular analysis show that
self-healing properties do not have a negative effect on cellular prop­
erties such as cell adhesion, proliferation, and differentiation. Moreover,
the PUAT5 scaffold exhibited excellent shape fixity and shape recovery
with ratios of 96% and 95%, respectively. The scaffolds exhibited fast
shape recovery speed at a temperature close to the physiological tem­
perature and suggested these scaffolds have the potential to implant in
the body with the minimally invasive surgical technique. The AT-
contained scaffolds supported outstanding hADSC cell attachment,
proliferation, and differentiation. The ALP and quantitative ARS anal­
ysis showed osteogenic differentiation and bone-forming ability of
prepared scaffolds. Expression of osteogenic genes including RUNX2,
COL1, and ALP exhibited enhanced differentiation, ECM mineralization
and maturation, and osteocalcin deposition. The osteoinductive capa­
bility of these multifunctional engineered scaffolds suggested a prom­
ising approach for repairing cancellous bone defects.
Author contributions
The manuscript was written through the contributions of all authors.
All authors have approved the final version of the manuscript.
Data availability
The raw/processed data required to reproduce these findings cannot
be shared at this time as the data also forms part of an ongoing study.
CRediT authorship contribution statement
Alireza Shaabani: Conceptualization, Methodology, Formal anal­
ysis, Investigation, Data curation, and Writing the original draft.
Roya Sedghi: Writing-review & editing, Supervision, Project
administration.
Declaration of competing interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgments
We appreciate the Shahid Beheshti University Research Council for
their supports.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.polymer.2021.123694.
References
[1] D. Howard, L.D. Buttery, K.M. Shakesheff, S.J. Roberts, Tissue engineering:
strategies, stem cells and scaffolds, J. Anat. 213 (1) (2008) 66–72.
[2] Y. Kang, E. Jabbari, Y. Yang, Integrating top-down and bottom-up scaffolding
tissue engineering approach for bone regeneration, Micro and Nanotechnologies in
Engineering Stem Cells and Tissues (2013) 142–158.
[3] F.T. Moutos, F. Guilak, Composite scaffolds for cartilage tissue engineering,
Biorheology 45 (3-4) (2008) 501–512.
[4] B. Chan, K. Leong, Scaffolding in tissue engineering: general approaches and tissue-
specific considerations, Eur. Spine J. 17 (4) (2008) 467–479.
A. Shaabani and R. Sedghi
[5] S. Dumitriu, V. Popa, Polymeric Biomaterials: Structure and Function, vol. 1, CRC
Press, 2013.
[6] S. Bose, M. Roy, A. Bandyopadhyay, Recent advances in bone tissue engineering
scaffolds, Trends Biotechnol. 30 (10) (2012) 546–554.
[7] T. Ghassemi, A. Shahroodi, M.H. Ebrahimzadeh, A. Mousavian, J. Movaffagh,
A. Moradi, Current concepts in scaffolding for bone tissue engineering, Archives of
Bone and Joint Surgery 6 (2) (2018) 90.
[8] S.L. Cooper, J. Guan, Advances in Polyurethane Biomaterials, Woodhead
Publishing, 2016.
[9] J. Chen, R. Dong, J. Ge, B. Guo, P.X. Ma, Biocompatible, biodegradable, and
electroactive polyurethane-urea elastomers with tunable hydrophilicity for skeletal
muscle tissue engineering, ACS Appl. Mater. Interfaces 7 (51) (2015)
28273–28285.
[10] B.K. Shrestha, S. Shrestha, A.P. Tiwari, J.-I. Kim, S.W. Ko, H.-J. Kim, C.H. Park, C.
S. Kim, Bio-inspired hybrid scaffold of zinc oxide-functionalized multi-wall carbon
nanotubes reinforced polyurethane nanofibers for bone tissue engineering, Mater.
Des. 133 (2017) 69–81.
[11] B. Guo, P.X. Ma, Conducting polymers for tissue engineering, Biomacromolecules
19 (6) (2018) 1764–1782.
[12] B. Guo, L. Glavas, A.-C. Albertsson, Biodegradable and electrically conducting
polymers for biomedical applications, Prog. Polym. Sci. 38 (9) (2013) 1263–1286.
[13] K. Hemmati, R. Alizadeh, M. Ghaemy, Synthesis and characterization of controlled
drug release carriers based on functionalized amphiphilic block copolymers and
super-paramagnetic iron oxide nanoparticles, Polym. Adv. Technol. 27 (4) (2016)
504–514.
[14] T.H. Qazi, R. Rai, A.R. Boccaccini, Tissue engineering of electrically responsive
tissues using polyaniline based polymers: a review, Biomaterials 35 (33) (2014)
9068–9086.
[15] P. Zarrintaj, B. Bakhshandeh, M.R. Saeb, F. Sefat, I. Rezaeian, M.R. Ganjali,
S. Ramakrishna, M. Mozafari, Oligoaniline-based conductive biomaterials for tissue
engineering, Acta Biomater. 72 (2018) 16–34.
[16] A. Khan, M. Jawaid, A.A.P. Khan, A.M. Asiri, Electrically Conductive Polymers and
Polymer Composites: from Synthesis to Biomedical Applications, John Wiley &
Sons, 2018.
[17] Y.-J. Wang, U.-S. Jeng, S.-h Hsu, Biodegradable water-based polyurethane shape
memory elastomers for bone tissue engineering, ACS Biomater. Sci. Eng. 4 (4)
(2018) 1397–1406.
[18] J. Yu, H. Xia, A. Teramoto, Q.Q. Ni, Fabrication and characterization of shape
memory polyurethane porous scaffold for bone tissue engineering, J. Biomed.
Mater. Res. 105 (4) (2017) 1132–1137.
[19] S. Talebian, M. Mehrali, N. Taebnia, C.P. Pennisi, F.B. Kadumudi, J. Foroughi,
M. Hasany, M. Nikkhah, M. Akbari, G. Orive, Self-healing hydrogels: the next
paradigm shift in tissue engineering? Advanced Science (2019), 1801664.
[20] A.B. Brochu, S.L. Craig, W.M. Reichert, Self-healing biomaterials, J. Biomed.
Mater. Res. 96 (2) (2011) 492–506.
[21] Z. Wei, J.H. Yang, J. Zhou, F. Xu, M. Zrínyi, P.H. Dussault, Y. Osada, Y.M. Chen,
Self-healing gels based on constitutional dynamic chemistry and their potential
applications, Chem. Soc. Rev. 43 (23) (2014) 8114–8131.
[22] P. Casuso, I. Odriozola, A.n Pérez-San Vicente, I. Loinaz, G.n Cabañero, H.-J.
r Grande, D. Dupin, Injectable and self-healing dynamic hydrogels based on metal
(I)-thiolate/disulfide exchange as biomaterials with tunable mechanical properties,
Biomacromolecules 16 (11) (2015) 3552–3561.
[23] D.J. Fortman, R.L. Snyder, D.T. Sheppard, W.R. Dichtel, Rapidly reprocessable
cross-linked polyhydroxyurethanes based on disulfide exchange, ACS Macro
Letters 7 (10) (2018) 1226–1231.
[24] K.-Y. Huang, Y.-S. Jhuo, P.-S. Wu, C.-H. Lin, Y.-H. Yu, J.-M. Yeh, Electrochemical
studies for the electroactivity of amine-capped aniline trimer on the anticorrosion
effect of as-prepared polyimide coatings, Eur. Polym. J. 45 (2) (2009) 485–493.
[25] M.R. Nabid, S.J.T. Rezaei, R. Sedghi, H. Niknejad, A.A. Entezami, H.A. Oskooie, M.
M. Heravi, Self-assembled micelles of well-defined pentaerythritol-centered
amphiphilic A4B8 star-block copolymers based on PCL and PEG for hydrophobic
drug delivery, Polymer 52 (13) (2011) 2799–2809.
[26] T. Wan, D. Chen, Mechanical enhancement of self-healing waterborne
polyurethane by graphene oxide, Prog. Org. Coating 121 (2018) 73–79.
[27] E. Díaz, I. Sandonis, M.B. Valle, In vitro degradation of poly (caprolactone)/nHA
composites, J. Nanomater. 2014 (2014) 185.
[28] A. Ardeshirylajimi, M. Soleimani, S. Hosseinkhani, K. Parivar, P. Yaghmaei,
A comparative study of osteogenic differentiation human induced pluripotent stem
cells and adipose tissue derived mesenchymal stem cells, Cell Journal (Yakhteh) 16
(3) (2014) 235.
[29] F. Pournaqi, A. Ghiaee, S. Vakilian, A. Ardeshirylajimi, Improved proliferation and
osteogenic differentiation of mesenchymal stem cells on polyaniline composited by
polyethersulfone nanofibers, Biologicals 45 (2017) 78–84.
[30] A. Zajdel, M. Kałucka, E. Kokoszka-Mikołaj, A. Wilczok, Osteogenic differentiation
of human mesenchymal stem cells from adipose tissue and Wharton’s jelly of the
umbilical cord, Acta Biochim. Pol. 64 (2) (2017) 365–369.
[31] C.-H. Tsai, C.-H. Hung, C.-N. Kuo, C.-Y. Chen, Y.-N. Peng, M.-Y. Shie, Improved
bioactivity of 3D printed porous titanium alloy scaffold with chitosan/magnesium-
calcium silicate composite for orthopaedic applications, Materials 12 (2) (2019)
203.
[32] M. Arjmand, A. Ardeshirylajimi, H. Maghsoudi, E. Azadian, Osteogenic
differentiation potential of mesenchymal stem cells cultured on nanofibrous
scaffold improved in the presence of pulsed electromagnetic field, J. Cell. Physiol.
233 (2) (2018) 1061–1070.
14
Polymer 223 (2021) 123694
[33] R. Sedghi, A. Shaabani, Z. Mohammadi, F.Y. Samadi, E. Isaei, Biocompatible
electrospinning chitosan nanofibers: a novel delivery system with superior local
cancer therapy, Carbohydr. Polym. 159 (2017) 1–10.
[34] R. Sedghi, A. Shaabani, Electrospun biocompatible core/shell polymer-free core
structure nanofibers with superior antimicrobial potency against multi drug
resistance organisms, Polymer 101 (2016) 151–157.
[35] R. Sedghi, A. Shaabani, N. Sayyari, Electrospun triazole-based chitosan nanofibers
as a novel scaffolds for bone tissue repair and regeneration, Carbohydr. Polym. 230
(2020) 115707.
[36] S. Ryu, T. Oh, J. Kim, Surface modification of a BN/ETDS composite with aniline
trimer for high thermal conductivity and excellent mechanical properties, RSC
advances 8 (40) (2018) 22846–22852.
[37] M. Xie, L. Wang, J. Ge, B. Guo, P.X. Ma, Strong electroactive biodegradable shape
memory polymer networks based on star-shaped polylactide and aniline trimer for
bone tissue engineering, ACS Appl. Mater. Interfaces 7 (12) (2015) 6772–6781.
[38] W. Wang, G. Caetano, W.S. Ambler, J.J. Blaker, M.A. Frade, P. Mandal, C. Diver,
P. Bártolo, Enhancing the hydrophilicity and cell attachment of 3D printed PCL/
graphene scaffolds for bone tissue engineering, Materials 9 (12) (2016) 992.
[39] H.H. Ahn, I.W. Lee, H.B. Lee, M.S. Kim, Cellular behavior of human adipose-
derived stem cells on wettable gradient polyethylene surfaces, Int. J. Mol. Sci. 15
(2) (2014) 2075–2086.
[40] S.H. Kim, H.J. Ha, Y.K. Ko, S.J. Yoon, J.M. Rhee, M.S. Kim, H.B. Lee, G. Khang,
Correlation of proliferation, morphology and biological responses of fibroblasts on
LDPE with different surface wettability, J. Biomater. Sci., Polymer Edition 18 (5)
(2007) 609–622.
[41] A. Haryńska, J. Kucinska-Lipka, A. Sulowska, I. Gubanska, M. Kostrzewa, H. Janik,
Medical-grade PCL based polyurethane system for FDM 3D
printing—characterization and fabrication, Materials 12 (6) (2019) 887.
[42] A. Gupta, B.S. Kim, Shape memory polyurethane biocomposites based on
toughened polycaprolactone promoted by nano-chitosan, Nanomaterials 9 (2)
(2019) 225.
[43] Y. Xu, D. Chen, Self-healing polyurethane/attapulgite nanocomposites based on
disulfide bonds and shape memory effect, Mater. Chem. Phys. 195 (2017) 40–48.
[44] A. Shaabani, R. Sedghi, H. Motasadizadeh, R. Dinarvand, Self-healable conductive
polyurethane with the body temperature-responsive shape memory for bone tissue
engineering, Chem. Eng. J. 411 (2021) 128449.
[45] D.-I. Lee, S.-H. Kim, D.-S. Lee, Synthesis and characterization of healable
waterborne polyurethanes with cystamine chain extenders, Molecules 24 (8)
(2019) 1492.
[46] S. Thakur, J. Hu, F. Yilmaz, Polyurethane: a shape memory polymer (SMP), aspects
of polyurethanes, InTechOpen, London, UK, 2017, pp. 53–71.
[47] J. Chen, B. Guo, T.W. Eyster, P.X. Ma, Super stretchable electroactive elastomer
formation driven by aniline trimer self-assembly, Chem. Mater. 27 (16) (2015)
5668–5677.
[48] H.-Y. Lai, H.-Q. Wang, J.-C. Lai, C.-H. Li, A self-healing and shape memory polymer
that functions at body temperature, Molecules 24 (18) (2019) 3224.
[49] A. Lendlein, M. Behl, B. Hiebl, C. Wischke, Shape-memory polymers as a
technology platform for biomedical applications, Expet Rev. Med. Dev. 7 (3)
(2010) 357–379.
[50] B. Ferrigno, R. Bordett, N. Duraisamy, J. Moskow, M.R. Arul, S. Rudraiah, S.
P. Nukavarapu, A.T. Vella, S.G. Kumbar, Bioactive polymeric materials and
electrical stimulation strategies for musculoskeletal tissue repair and regeneration,
Bioactive materials 5 (3) (2020) 468–485.
[51] S. Stewart, J. Domínguez-Robles, R. Donnelly, E. Larrañeta, Implantable polymeric
drug delivery devices: classification, manufacture, materials, and clinical
applications, Polymers 10 (12) (2018) 1379.
[52] D.M. González-García, Á. Marcos-Fernández, L.M. Rodríguez-Lorenzo, R. Jiménez-
Gallegos, N. Vargas-Becerril, L. Téllez-Jurado, Synthesis and in vitro
cytocompatibility of segmented poly (ester-urethane) s and poly (ester-urea-
urethane) s for bone tissue engineering, Polymers 10 (9) (2018) 991.
[53] J.V. Cauich-Rodríguez, L.H. Chan-Chan, F. Hernandez-Sánchez, J.M. Cervantes-Uc,
Degradation of polyurethanes for cardiovascular applications, Advances in
biomaterials science and biomedical applications (2013) 51–82.
[54] H. Qi, M. Liu, L. Xu, L. Feng, L. Tao, Y. Ji, X. Zhang, Y. Wei, Biocompatibility
evaluation of aniline oligomers with different end-functional groups, Toxicology
Research 2 (6) (2013) 427–433.
[55] J. Qu, Y. Liang, M. Shi, B. Guo, Y. Gao, Z. Yin, Biocompatible conductive hydrogels
based on dextran and aniline trimer as electro-responsive drug delivery system for
localized drug release, Int. J. Biol. Macromol. 140 (2019) 255–264.
[56] C. Xu, Y. Huang, G. Yepez, Z. Wei, F. Liu, A. Bugarin, L. Tang, Y. Hong,
Development of dopant-free conductive bioelastomers, Sci. Rep. 6 (1) (2016) 1–13.
[57] C. Li, Y.-T. Hsu, W.-W. Hu, The regulation of osteogenesis using electroactive
polypyrrole films, Polymers 8 (7) (2016) 258.
[58] B.G. Keselowsky, D.M. Collard, A.J. García, Integrin binding specificity regulates
biomaterial surface chemistry effects on cell differentiation, Proc. Natl. Acad. Sci.
U.S.A. 102 (2005) 5953–5957, 17.
[59] W. Song, J.F. Mano, Interactions between cells or proteins and surfaces exhibiting
extreme wettabilities, Soft Matter 9 (11) (2013) 2985–2999.
[60] G. Radha, B. Venkatesan, P. Rajashree, E. Vellaichamy, S. Balakumar, Insights into
the apatite mineralization potential of thermally processed nanocrystalline Ca 10−
x Fe x (PO 4) 6 (OH) 2, New J. Chem. 43 (3) (2019) 1358–1371.
[61] B. Lei, B. Guo, K.J. Rambhia, P.X. Ma, Hybrid polymer biomaterials for bone tissue
regeneration, Front. Med. 13 (2) (2019) 189–201.
[62] Z. Karimi, E. Seyedjafari, F.S. Mahdavi, S.M. Hashemi, A. Khojasteh, B. Kazemi,
S. Mohammadi-Yeganeh, Baghdadite nanoparticle-coated poly l-lactic acid (PLLA)
A. Shaabani and R. Sedghi
ceramics scaffold improved osteogenic differentiation of adipose tissue-derived
mesenchymal stem cells, J. Biomed. Mater. Res. 107 (6) (2019) 1284–1293.
[63] M. Sattary, M.T. Khorasani, M. Rafienia, H.S. Rozve, Incorporation of
nanohydroxyapatite and vitamin D3 into electrospun PCL/Gelatin scaffolds: the
influence on the physical and chemical properties and cell behavior for bone tissue
engineering, Polym. Adv. Technol. 29 (1) (2018) 451–462.
[64] J. Xu, Z. Li, Y. Hou, W. Fang, Potential mechanisms underlying the Runx2 induced
osteogenesis of bone marrow mesenchymal stem cells, Am. J. Tourism Res. 7 (12)
(2015) 2527.
[65] T. Komori, Regulation of proliferation, differentiation and functions of osteoblasts
by Runx2, Int. J. Mol. Sci. 20 (7) (2019) 1694.
15
Polymer 223 (2021) 123694
[66] J.B. Lee, J.E. Kim, D.A. Balikov, M.S. Bae, D.N. Heo, D. Lee, H.J. Rim, D.W. Lee, H.
J. Sung, I.K. Kwon, Poly (l-lactic acid)/gelatin fibrous scaffold loaded with
simvastatin/beta-cyclodextrin-modified hydroxyapatite inclusion complex for
bone tissue regeneration, Macromol. Biosci. 16 (7) (2016) 1027–1038.
[67] S. Mathews, P. Gupta, R. Bhonde, S. Totey, Chitosan enhances mineralization
during osteoblast differentiation of human bone marrow-derived mesenchymal
stem cells, by upregulating the associated genes, Cell Prolif. 44 (6) (2011)
537–549.
[68] B.K. Hall, Bones and Cartilage: Developmental and Evolutionary Skeletal Biology,
Elsevier, 2005.
[69] S. Nanlin, G. Xuemei, J. Hemin, G. Jun, S. Chao, Y. Ke, Antibacterial effect of the
conducting polyaniline, J. Mater. Sci. Technol. 22 (3) (2009) 289–290.