BIOLOGY Educart Sample Papers Term 2 C-12 - Watermark-Compressed

@Cbsebookshub - Join Us on Telegram
I
Book Name Educart CBSE Class 12 Term-2 Biology Sample Papers
Editor Name I Pradeep Gulati
Edition I Latest
Published by I Agrawal.
Group Of Publications (AGP)
I
© All Rights reserved.
ADDRESS 28h15 Jyoti Block, Sanjay Place, Agra, U.P. 282002
I
(Head office)
guickreply@agpgroup.in
CONTACT
I
We reply super fast
www.educart.co
BUY BOOK Cash on delivery available
WHATSAPP 18937099777
(Head office)
Pugc,i�� I Agrawal Group Of Publications (AGP)
I
ISBN 978-93-5561-238-0
I
© COPYRIGHT Agrawal Group Of Publications {AGP)
Disclaimer: This teaching material has been published pursuant to an undertaking given by
the publisher that the content does not in any way whatsoever violate any existing copyright
or intellectual property right. Extreme care is put into validating the veracity of the content in
this book. However, if there is any error found, please do report to us on the below email and
we will re-check; and if needed rectify the error immediately for the next print.
ATTENTION
No part of this publication may be re-produced, sold or distributed in any form or
medium (electronic, printed, pdf, photocopying, web or otherwise) on Amazon,
Flipkart, Snapdeal without the explicit contractual agreement with the publisher.
Anyone caught doing so will be punishable by Indian law.
� Wf5T�R cf5"T � '1ft f6�Hfcl5f�fcl> � tlll!f � �FclGlcJ-lcf5 � � f.t-rr �1, f4'&IYcf51t, � � � '1ft
�'llflTTl!llll ($<'1�1f.lcf5, �. �. Y512lct,'1cft, �'llf JF<Tl!ff) �ftITT"��. �'l!Tfctnfur��Jff�
i,:5il"�'lftUtTT�§3TT�JlT(!Jlf.��mm,
AGP contributes Rupee One on every book purchased by you to

the Friends of Tribals Society Organization for better education
of tribal children.
Contents
Time Management 5
Topper Tips 7
Chapter-wise 9
Special Concept Maps
Topper’s Solutions
(Question-type based)
Solved Sample Papers

Sample Paper 1 (CBSE Term 2 Sample Paper, 14 Jan ‘22) 35
Sample Paper 2 43
Sample Paper 3 49
Sample Paper 4 55
Sample Paper 5 61
Sample Paper 6 67
Sample Paper 7 73
Sample Paper 8 78
Sample Paper 9 83
Self Assessment (with Self-evaluation)

Sample Paper 10 87
Self-evaluation Chart 90
Sample Paper 11 92
Sample Paper 12 97
Note : Self Assessment Papers solution are available on our website (www.educart.co).
Question Paper Design
SA I SA II Case-based
Section
(2 marks) (3 marks) (5 marks)
6Q
A – –
(2 internal choice)
(4)
6Q
B – –
(1 internal choice)
1Q
C – –
(1 internal choice)
TOTAL 12m 18m 5m
Note: The paper contains some Diagram, Statement and Graph-based questions as well.
Time
Management
No. of Total Time
Section Question Type Time to be Spent
Questions (maximum)
Reading Time (Mandatory): 15 min
Short Answer I 4-5 minutes

A 6Q 30 minutes
(SA I) (per Question)
Short Answer II 8-10 minutes

B 6Q 60 minutes
(SA II) (per Question)
Case-based 13-15 minutes

C 1Q 15 minutes
(CBQ) (per Question)
Revision Time 15 minutes
TOTAL TIME: 120 minutes
NOTE: The mandatory Reading Time before the 2 hour paper is not yet mentioned by
CBSE. It is assumed as per usual 15 minutes.
(5)
TOPPER TIPS
for Term 2 Subjective Paper
Reading Time Hack!

• You will get a good 10-15 minutes in the beginning to read the question paper.
• Use this time to mark the answers you are more confident in attempting first.
• Make a draft in your mind of where you will add a diagram. This helps in saving time
as much as possible.
Follow CBSE Marking Scheme*

As Lakshya Sharma, CBSE 12th Topper of 2020 says, the CBSE Marking Scheme Solutions
provide a lot of help in forming answers that would impress the paper checkers. Solving
sample papers as per the marking scheme helped him scoring 95+ marks in Boards. So
do refer to that marking scheme (given in Sample Paper 1).
Focus on Avoiding Silly Mistakes

Be extra careful with definitions, complex terminologies, flowcharts, and diagrams,
especially their labellings. Mistakes in spellings and diagrams are considered silly whereas
catching them at the right time can help scoring maximum marks.
Structure your Answers Correctly

Writing subjective answers (SAs & LAs) in bullet points (preferably with headings) is a
great practice. This leaves a good impression on the paper checker and helps you stick to
the point. For instance, provide 3 detailed points for SA II and add a diagram/ flowchart
wherever possible.
Always Leave Time for Revisio

There are 13 questions to attempt within 2 hours. So, make sure you leave at least 15
minutes at the end for revision. Use this time to check things like sub-parts of a question,
diagrams and labellings, and doubtful/incomplete answers.
* Refer to our Self Evaluation charts to increase your understanding of how to score step-wise
marks in relation to our self assessment papers.
(7)
SELF
EVALUATION
CHART*
Learn techniques to score full marks like a
Topper, using our Self-assessment papers.
Score Full Marks

Questions
Questions
(Breakdown)
Score Full Marks
(Breakdown)
Marks Breakdown
Diagram (1 mark)
• Check if you covered all steps Q8 Diagram (1 mark)
Q8 Labeling
Labeling (1(1mark)
mark)
required to get full marks. Processes of
Must include: Foreign and vector
ProcessesRecombinant
ofTechnologyDna DNA, ligases, recombinant DNA
• Such checklist is normally given
Recombinant(Biotechnology)
Dna DNA,
and ligases,
cloning hostrecombinant
(1 mark) DNA
Technology
to CBSE paper-checkers. (Biotechnology)
and cloning host (1 mark)
Q9
Q9
Score Full Marks Your

(Breakdown) Score Full Marks Performance
Your (m)
(Breakdown) Performance (m)
Diagram (1 mark) Diagram (1 mark)

Labeling (1 mark)
Labeling (1 mark) 2
23 Calculate your Score
Must include: Foreign
DNA,and vector
ligases, recombinant DNA
and cloning host (1 mark) • Identity which subjective Q’s
DNA, ligases, recombinant DNA 3
and cloning host (1Name
mark)
you scored less marks in.
of disease (1 mark)
Mode of transmission (1 mark) 2
• Know your shortcomings.
Mention 1 symptom (2 marks) 4
Name of disease (1 mark) TOTAL Marks 37/40
Mode of transmission (1 mark) 2

Mention 1 symptom (2 marks) 4
TOTAL Marks 37/40

*This concept is applied to our 3 final self-assessment (unsolved) papers. The criteria used
is based on the understanding of CBSE Marking Scheme of Semester 2, along with inputs
from Educart Subject matter experts. Difference in opinion is highly possible.
(8)
SPECIAL
CONCEPT MAPS
(CHAPTER-WISE)
HUMAN HEALTH Typhoid Common Cold
AND DISEASES • Caused by Salmonella typhi

• Symptoms includes high
fever, stomach pain,
• Caused by Rhino viruses.
• Majorly affects the nose
& the respiratory
constipation, diagnosis is passage (not lungs).
by widal test. • Symptoms can be sore
throat, headache, nasal
Pneumonia block age & discharge etc.
HEALTH • It is the most common
• Caused by Streptococcus viral infection found in
pneumoniae and humans.
State of mental, physical and social well being. Haemophilus influenzae.
Mainly affected by: genetic disorders, infection E.g. Diptheria, plague,
in lifestyle. Dysentery are other Ascariasis
bacterial diseases.
Allergies • Caused by Ascaris.
• Exaggerated response of immune Malaria • Spread through eggs in
system to certain antigens present in contaminated water,
environment. • Caused by Plasmodium food, etc.
(P. vivax, P. malaria and P.
• IgE responsible for this. falciparum)
• Histamine and serotonin are chemicals Filariasis
Cancer • Transmitted by Female
secreted by mast cell which triggers Anopheles mosquito.
allergy. • Caused by Wuchereria,
• Normal cells loose contact the filarial worm (W.
inhibition and divide Amoebic Dysentery Bancrofti and W. Malayi),
uncontrollably. First forms
Drugs benign tumor (doesn’t Autoimmune Caused by Entamoeba
• Transmitted through
spread) or malignant tumor vector mosquito.
• Heroin also called as smack is obtained Disorder histolytica, housefly is
(spreads from one part to mechanical carrier of this
from Papaver somniferum. other also called as Because of genetic AIDS
disease.
• Cannabinoids (marijuana, hashish, metastasis). and some unknown
charas and ganja) are obtained from • Cancer is caused by virus reasons immune • Caused by retrovirus
Cannabis sativa. system starts Ringworm Disease Human Immuno
called as oncogenic viruses.
• Cocaine is obtained from Erythroxylum coca. Cellular oncogenes or proto attacking its own Deficiency virus. Targets
• Caused by Microsporum TH and replicate inside by
• Adolescence is associated with highest oncogenes are genes when body cells.
Trichophyton and help of reverse transcriptase
risk for drug use. activated makes normal cell E.g: Rheumatioid Epidermophyton.
• Proper education & guidance will help into cancerous. arthritis. enzyme.
• Transmitted by soil, used • Diagnosed by Enzyme
youth to safeguard self from such towels, clothes of
exposure to drugs. linked Immunosorbent
infected individual. Assay (ELISA).
Infectious Disease
Vaccination and Immunization Common Diseases in Human
Prevents • Caused by pathogens and can be
Activation of immune system by injecting Lack of ease (comfort) is called as disease. transferred from diseased to healthy person.
dead or weakened antigen (active • Various types of pathogens are bacteria,
immunization). fungi, virus, protozoans etc.
• They can harm organism by either living in or
on them.
Page
1. Human Health and Diseases 10
Topper’s Solution 12
2. Microbes in Human Welfare 14
3. Biotechnology Principles and Processes 20
4. Biotechnology and its Applications 24
5. Organisms and Polulations 28
6. Biodiversity and Conservation 33
9
Human Health and Disease
Ch 1:
10
NCERT BOOK Ch 8
Special Concept MAPS
HUMAN HEALTH Typhoid Common Cold

• Caused by Salmonella typhi • Caused by Rhino viruses.
AND DISEASES • Symptoms includes high • Majorly affects the nose
fever, stomach pain, & the respiratory
constipation, diagnosis is passage (not lungs).
by widal test. • Symptoms can be sore
throat, headache, nasal
Pneumonia block age & discharge etc.
HEALTH • It is the most common
• Caused by Streptococcus viral infection found in
pneumoniae and humans.
State of mental, physical and social well being. Haemophilus influenzae.
Mainly affected by: genetic disorders, infection E.g. Diptheria, plague,
in lifestyle. Dysentery are other Ascariasis
bacterial diseases.
Allergies • Caused by Ascaris.
• Exaggerated response of immune Malaria • Spread through eggs in
system to certain antigens present in contaminated water,
environment. • Caused by Plasmodium food, etc.
(P. vivax, P. malaria and P.
• IgE responsible for this. falciparum)
• Histamine and serotonin are chemicals Filariasis
Cancer • Transmitted by Female
secreted by mast cell which triggers Anopheles mosquito.
allergy. • Caused by Wuchereria,
• Normal cells loose contact the filarial worm (W.
inhibition and divide Amoebic Dysentery Bancrofti and W. Malayi),
uncontrollably. First forms
Drugs benign tumor (doesn’t Autoimmune • Transmitted through
Caused by Entamoeba
spread) or malignant tumor vector mosquito.
• Heroin also called as smack is obtained Disorder histolytica, housefly is
(spreads from one part to mechanical carrier of this
from Papaver somniferum. other also called as Because of genetic AIDS
disease.
• Cannabinoids (marijuana, hashish, metastasis). and some unknown
charas and ganja) are obtained from • Cancer is caused by virus reasons immune • Caused by retrovirus
Cannabis sativa. system starts Ringworm Disease Human Immuno
called as oncogenic viruses.
• Cocaine is obtained from Erythroxylum coca. Cellular oncogenes or proto attacking its own Deficiency virus. Targets
• Caused by Microsporum
• Adolescence is associated with highest oncogenes are genes when body cells. TH and replicate inside by
Trichophyton and
risk for drug use. activated makes normal cell E.g: Rheumatioid help of reverse transcriptase
Epidermophyton. enzyme.
• Proper education & guidance will help into cancerous. arthritis.
• Transmitted by soil, used • Diagnosed by Enzyme
youth to safeguard self from such towels, clothes of
exposure to drugs. linked Immunosorbent
infected individual. Assay (ELISA).
Infectious Disease
Vaccination and Immunization Common Diseases in Human
Prevents • Caused by pathogens and can be
Activation of immune system by injecting Lack of ease (comfort) is called as disease. transferred from diseased to healthy person.
dead or weakened antigen (active • Various types of pathogens are bacteria,
immunization). fungi, virus, protozoans etc.
• They can harm organism by either living in or
on them.
Immunity
Ability to fight against diseases.
Active Immunity Passive Immunity

When body itself makes antibodies When pre made antibodies are
against antigen. It takes time and injected in body. It have immediate
is long lasting. action but temporary.
E.g: IgA in colostrum.
Immune System
Innate Immunity Acquired Immunity
Consists of lymph, lymph nodes, primary
Immunity by birth and non specific lymphoid organs (bone marrow, thymus), Immunity learned in a life time, pathogen
in nature. It’s 4 barriers are: and secondary lymphoid organs like spleen, specific.
tonsils and MALT (Mucosa Associated • Slow and delayed 1st response against
Lymphoid Tissue). pathogen is primary response.
Physical Barrier • Subsequent exposure to same pathogen
leads to secondary response.
Skin and mucus coating. Prevents
• These are carried by B and T lymphocytes.
entry of microbes & helps Enanthem.
• Antibodies are secreted by B cell namely
IgA, IgG, IgM and IgE.
Physiological Barrier • Structure of Antibody is H2L2 type i.e 2
heavy chains and 2 light chains connected
Acid in stomach, saliva in mouth, tears by disulphide bonds. Each antibody is
from eyes. Prevents growth of microbes. antigen specific.
Cellular Barrier Humoral Immune

Response
Polymorpho nuclear leukocyte (PMNL),

monocytes, natural killer cells in blood Antibody mediated immune
kills disease causing agents. response.
Cell Mediated
Cytokine Barrier
Response
Interferons secreted by virus
Carried out by T lymphocytes
infected cell to protect other
and natural killer cell against
cells.
virus infection.
11
TOPPER’S SOLUTION
SUBJECTIVE Type Questions

Very Short Answer Type Questions [1 mark ]
1. Name two diseases whose spread can be controlled by the eradication of Aedes mosquitoes.
Ans.
[CBSE Topper 2018]
2. How do cytokine barriers provide innate immunity in humans ?

Ans.
[CBSE Topper 2018]
3. State the function of interferons.

Ans.
[CBSE Topper 2019]
Short Answer Type Questions (SA) [2 marks ]
4. List the symptoms of Ascariasis. How does a healthy person acquire this infection?
Ans.
[CBSE Topper 2014]
5. Name the type of immunity the colostrum provides to a newborn baby. Write giving an example where
this type of immunity should be provided to a person.
Ans.
[CBSE Topper 2017]
12 Biology Class XII

6. (A) Name the source plant of heroin drug. How is it obtained from the plant ?
(B) Write the effects of heroin on the human body.

Ans.
[CBSE Topper 2018]
7. List any four common approaches for treatment of cancer.

Ans.
[CBSE Topper 2019]
Human Health and Diseases 13

Microbes in Human Welfare
MICROBES IN Ch 2: Special Concept MAPS
14
BIOFERTILISERS NCERT BOOK Ch 10
• Rhizobium bacteria fix atmospheric nitrogen into MICROBES IN

nitrates in symbiotic association with legumes. INDUSTRIAL PRODUCTS
• Azospirillum and Azotopacter are free living
nitrogen fixing bacteria.
Lorem ipsum • Fermented beverages- Sacchromyces cerevisiae
• Mycorrhiza is symbiotic association of fungi • Antibiotics- Penicillium notatum
from genus Glomus and plants. • Citric acid- Aspergillus niger
• Mycorrhiza absorbs phosphorus from soil and • Acetic acid- Acetobacter aceti
provides it to plants. • Butyric acid- Clostridium butylicum
• Anabaena, Nostoc, Oscillatoria, blue green algae • Lactic acid- Lactobacillus bacteria
also helps in fixing nitrogen and adding • Streptokinase- Streptococcus bacteria,
nutrients to soil. streptokinase is clot bluster.
• Cyclosporin A- Trichoderma polysporum,
Head cyclosporin is used as immunosuppressive agent
• Statins- yeast, statins are blood cholesterol
Collar
Tail
lowering agent. Pectinase and proteases
Plate enzymes are also produced by microbes, these
are used for removing fibers from fruit juice.
Pins
Prongs
(a) (b)
Viruses: A bacteriophage Adenovirus which
cause respiratory infections Flagella
(a)
Rod shaped bacteria (magnified 1500x)
Rod-shaped
bacterium
Compact
Rod-shaped (b) (c)
viruses Spherical shaped bacteria A rod shaped bacterium showing
(c) (magnified 1500x) flagella (magnified 5000x)
Rod-shaped Tobacco Mosaic Virus (TMV).
Magnified about 1,00,000 - 1,50,000×
MICROBES IN
MICROBES IN HOUSEHOLD PRODUCTS
BIOCONTROL AGENTS
• Curd- Lactic acid bacteria

• Bacillus thuringiensis produces Bt toxin which • Bakery- baker’s yeast (Saccharomyces cerevisiae)
heltp in killing caterpillars. • Swiss cheese - Propionibacterium sharmanii.
• Trichoderma are free living fungi which are found
in root ecosystem acts as a very good biocontrol
agent.
• Baculoviruses (genus Nucleopolyhedrovirus)
attacks insects and other arthropods, these can
be used as narrow spectrum insecticidal.
MICROBES IN HUMAN
WELFARE
MICROBES IN SEWAGE TREATMENT MICROBES IN PRODUCTION OF BIOGAS
Process of sewage treatment in Sewage Treatment Plants (STPs) • Biogas is a mixture of gases (mainly methane) produced by the microbial
activity & which may be used as fuel.
• Bacteria which grows anaerobically on cellulosic material produces large
amounts of methane along with CO₂ and H₂ are called as methanogens.
Primary treatment Secondary treatment • Biogas plant:
(Physical) (biological) Gas: to
Combustion
or other uses
Filtration & sedimentation Filtration & sedimentation

used to remove suspended
solids from sewage
Agitation & rapid growth of
aerobic microbes (flocs) Gas Holder
Dung Water (CH4 + CO2 + ....)
Feed
Flocs consumes organic matter, releasing Slurry
minerals & reducing Biochemical Oxygen Demand (BOD)
Sludge
Effluent passed to settling tank

Flocs sediments to form – activated sludge

Digester
Pumped into Anaerobic Sludge Digester
Forms Biogas Effluent released into

(used as source rivers and streams
of energy)
15
TOPPER’S SOLUTION


1. Explain the significant role of the genus Nucleopolyhedrovirus in an ecologicalsensitive area.
Ans.
[CBSE Topper 2014]
2. Name a genus of baculovirus. Why are they considered good biocontrol agents?
Ans.
[CBSE Topper 2016]
3. Your advice is sought to improve the nitrogen content of the soil to be used for cultivation of a non-
leguminous terrestrial crop.
(A) Recommend two microbes that can enrich the soil with nitrogen.

(B) Why do leguminous crops not require such enrichment of the soil ?

Ans.
[CBSE Topper 2018]
4. Write the binomials of two fungi and mention the products/bioactive molecules they help to produce.
Ans.
[CBSE Topper 2017]

5. Mention a product of human welfare obtained with the help of each one of the following microbes:
(A) LAB

(B) Saccharomyces cerevisiae

(C) Propionibacterium sharmanii

(D) Aspergillus niger

Ans.
[CBSE Topper 2015]

6. “Determination of Biological Oxygen Demand (BOD) can help in suggesting the quality of a water
body.” Explain.
Ans.
[CBSE Topper 2015]
Microbes in Human Welfare 17

7. Choose any three microbes, from the following which are suited for organic farming which is in great
demand these days for various reasons. Mention one application of each one chosen.

Mycorrhiza; Monascus; Anabaena; Rhizobium; Methanobacterium; Trichoderma.
Ans.
[CBSE Topper 2015]
8. (A) How do organic farmers control pests ? Give two examples.

(B) State the difference in their approach from that of conventional pest Control Methods.

Ans.
[CBSE Topper 2019]

Long Answer Type-II Questions (LA-II) [5 marks ]

9. Explain the process of sewage water treatment before it can be discharge into natural water bodies.
Why is this treatment essential?
Ans.
[CBSE Topper 2014]
Microbes in Human Welfare 19

Biotechnology: Principles
Ch 3: and Processes
20
NCERT BOOK Ch 11 Special Concept MAPS
BIOTECHNOLOGY :
PRINCIPLES AND PROCESSES
Biotechnology as defined by European Federation of Biotechnology (EFB):
“The integration of natural science and organisms.”
Step 1: Isolation of
Genetic Material
RECOMBINANT DNA
DNA is isolated from plant cell by help of cellulase TECHNOLOGY
enzyme, from fungi by chitinase enzyme and by
lysozyme from bacterial cell. Then treated with Combining DNA of one organism with another
protease (to digest histone protein) and in order to obtain useful features. Process of which
ribonuclease (to digest RNA). Other molecules are is as follows:
separated by other enzymes and centrifuged.
Finally DNA is precipitated by chilled ethanol.
Step 3: Separation and Step 4: Amplification of gene
Isolation of DNA fragments of Interest by using PCR
Step 2: Cutting of DNA After cutting DNA by restriction endonucleases In polymerase chain reaction DNA is First denatured
DNA fragments are separated by agarose gel at high temperature, then annealed with RNA
at Specific Location electrophoresis. Fragments are separated by their primers and then extended by help of Taq
It is done by help of nucleases enzymes. These are size and dyed by ethidium bromide. polymerase (obtained from Thermus aquaticus).
The enzyme cuts both DNA EcoRI cuts the DNA between bases
of 2 types exonucleases (cuts at ends of DNA G and A when the sequence Nucleotide 5’ 3’
strands at the same site 3’ 5’
GAATTC is present in the DNA 5’ 3’
fragment 5’ or 3’) and endonucleases (cuts at Vector DNA Foreign DNA 5’ 3’
specific site within DNA sequence). Endonucleases
(Restriction enzymes) cuts at their palindromic 5’ 3’ Denaturation Annealing Extension
3’ 5’
nucleotide sequence and forms sticky ends which

3’ 5’
are later joined by DNA ligase enzyme. Eco RI
DNA primer 3’ 5’
Eg: EcoRI cuts only at GAATTC 5’-3’ direction. Sticky end Original DNA 5’ 3’
3’ 5’
Sticky end
DNA fragments join sticky ends
Recombinant DNA
Steps in formation of recombinant DNA by the action of restriction
endonuclease enzyme-Eco RI
Step 7: Obtaining Foreign Product Step 6: Transformation Step 5: Selecting Cloning Vector
of Recombinant DNA
Proteins which are formed by this gene of interest Plasmid DNA, bacteriophage DNA, Ti plasmid of
by host cells having recombinant DNA is called as Inserting rDNA (vector+gene of interest) in host cell Agrobacterium tumifaciens (for plants) are used as
recombinant protein. These are formed at large is done by various methods like heat shock method cloning vectors. Features of vector are:
scale by using bioreactors (have internal control of (cells kept in ice then at 42 degrees for 30-45 sec - Origin of replication(ori): It is a sequence from
temp. pH, oxygen etc.).These are of two types: and again in ice), micro-injection (recombinant where DNA replication starts.
(a) Simple Stirred Tank Bioreactor: Mixture is DNA directly injected in animal cell), biolistics or - Selectable Marker: Antibiotic resistance gene or
mixed with help of flat bladed impeller gene gun (high velocity gold or tungsten particle insertional inactivation (β galactosidase gene is
(b) Sparged Stirred Tank Bioreactor: Bubbles are coated with recombinant DNA are bombarded in damaged when DNA is inserted in it and gives
used for mixing as well as for better supply of plant cells). colorless colonies otherwise gives blue colonies).
oxygen. - Cloning Sites: Single recognition site of restriction
Foreign DNA
Vector DNA enzymes like BamHI, EcoRI should be present. DNA
(plasmid)
Same restriction enzyme cutting both foreign is inserted by cutting at one recognition site
DNA and vector DNA at specific point
making it sensitive to one antibiotic but this
recombinant can still survive in medium with other
antibiotic. Non recombinants can survive both the
antibiotics as they don’t have DNA inserted in
Ligases join foreign them.
DNA to plasmid EcoR I Cla I Hind III
Pvu I
Step 8: Downstream Processing BamH I
Pst I
ampR tetR
Separation, purification and quality control of
products obtained from above process comes pBR322
Transformation Sal I
under downstream processing.
Increased surface E.coli ori
Acid/base for Motor area for
pH control oxygen transfer Gas Cells divide rop
Foam entrainment
Steam for braker
sterilization
Flat bladed
impeller
Culture Pvu II
broth E.coli cloning vector pBR322 showing restrictions sites (Hind III, EcoRI, BamHI,
Bubbles SalI, PvuII, PstI, ClaI), ori and antibiotic resistance genes (ampR and tetR).
dramatically Rop codes for the protiens involved in the replication of the plasmid.
Sterile increase the oxygen
air transfer area
,
21
TOPPER’S SOLUTION

1. Why is it not possible for an alien DNA to become part of a chromosome anywhere along its length
and replicate normally?
Ans.
[CBSE Topper 2014]
2. Name the enzymes that are used for the isolation of DNA from bacterial and fungal cells for
recombinant DNA technology.
Ans.
[CBSE Topper 2014]

3. Name and describe the technique that helps in separating the DNA fragments formed by the use of
restriction endonuclease.
Ans.
[CBSE Topper 2014]

4. Describe the roles of heat, primers and the bacterium Thermus aquaticus in the process of PCR.
Ans.
[CBSE Topper 2017]
5. Describe the roles of (A) high temperature, (B) primers, and (C) bacterium Thermus aquaticus in
carrying the process of polymerase chain reaction.
Ans.
[CBSE Topper 2019]
Biotechnology: Principles and Processes 23

Biotechnology and
its Applications
Ch 4:
24
TRANSGENIC ANIMALS NCERT BOOK Ch 12 Special Concept MAPS
Animals that have had their DNA manipulated to

possess and express an extra (foreign) gene. They
Molecular Diagnosis are produced for following reasons:
i. To study normal physiology and development.
PCR (polymerase chain reaction) is used for ii. To obtain biological products:
detection of HIV in suspected individual. Single E.g. α -1 - antitrypsin for treatment of emphysema,
stranded radioactive DNA or RNA is used to detect Transgenic cow Rosie had human alpha-lactalbumin
genetic mutation present in person affected from in its milk.
genetic disorder. The labeled DNA or RNA will not iii. To test vaccine safety: Transgenic mice and
bind with mutated gene. ELISA (Enzyme Linked monkey are used for this. RNA Interference (RNAi)
Immunosorbent Assay) detects antibody present in iv. Study of disease: Transgenic animals are
blood against specific antigen. available for cancer, cystic fibrosis, cancer, etc. This method involves silencing of specific mRNA
v. Chemical Safety Testing: Transgenic animals due to complimentary dsRNA molecules that binds
carry genes which makes them sensitive towards to and prevents its translation. Agrobacterium
Gene Therapy certain chemicals and the effects are then studied. vectors are used to introduce DNA which produces
both sense and antisense RNA in host cell. These
Adding/replacing non functional gene (disease two RNA being complimentary to each other
causing) with functional gene. initiates process of silencing of specific mRNA in
E.g. In ADA (adenosine deaminase) deficiency nematodes.
patient WBC is taken out and ADA cDNA inserted in
these cell (temporary solution). For permanent
treatment this cDNA is inserted in cells of bone marrow. Bt Cotton
In some enzyme replacement treatment is done in
which functional enzyme is inserted in blood. ADA which Bacillus thuringiensis produces a protein which kills
is essential for functionality of immune system. lepidopterans (tobacco budworm, armyworm),
BIOTECHNOLOGY AND coleopterans (beetles) and dipterans (flies,
Genetically mosquitoes). Insecticidal protein is secreted as
inactive protoxin but it becomes active inside
Engineered Insulin IT’S APPLICATIONS alkaline pH of intestine of insects and creates hole
Human pro-hormone insulin (inactive insulin in their intestine. This toxin is coded by cry gene.
hormone) consists of three polypeptide chains A, B E.g. cryIAc and cryIIAb, control cotton bollworms
and C. However, mature insulin have only A and B and cryIAb controls corn borers.
chain joined by disulphide bond. Both these chains
are synthesized by recombinant DNA technology in
bacteria separately, then joined by disulphide bond
later. IN AGRICULTURE
E.g. Humulin - Human insulin prepared by Eli lilly, in

1983.
ETHICAL ISSUES Synthesis of GMO (Genetically Modified
Organism) for better disease resistance, better
• GEAC (Genetic Engineering Approval nutrition quality, increased efficiency of mineral
Committee) makes decision regarding validity absorption, enhanced nutritional value of food, etc.
of GM research and introduction of GM E.g. “Golden rice” modified to be enrich in Vitamin A.
organism in public domain.
IN MEDICINE • Biopiracy: The use of bio resources by
multinational companies and other
organizations without proper authorization from
the countries and people concerned without
compensatory payments.
TOPPER’S SOLUTION
1. State the role of C peptide in human insulin.

Ans.
[CBSE Topper 2014]
2. What is Biopiracy ?
Ans.
[CBSE Topper 2015]
3. Mention two objectives of setting up GEAC by our Government.

Ans.
[CBSE Topper 2016]
4. Name the specific type of gene that is incorporated in a cotton plant to protect the plant against
cotton boll worm infestation.
Ans.
[CBSE Topper 2017]
5. Mention the chemical change that proinsulin undergoes, to be able to act as mature insulin.
Ans.
[CBSE Topper 2018]
6. Write the two specific ‘cry’ genes that encode the proteins which control cotton bollworms.
Ans.
[CBSE Topper 2019]
Biotechnology and its Applications 25

Short Answer Type-II Questions (SA-II) [3 marks ]

7. Recombinant DNA-technology is of great importance in the field of medicine. With the help of a
flow chart, show how this technology has been used in preparing genetically engineered human
insulins.
Ans.
[CBSE Topper 2015]
8. Explain enzyme-replacement therapy to treat adenosine deaminase deficiency. Mention two

disadvantages of this Procedure.
Ans.
[CBSE Topper 2016]
9. Explain the various steps involved in the production of artificial insulin.

Ans.

[CBSE Topper 2017]
Biotechnology and its Applications 27

Organisms And Population
Ch 5:
28
NCERT BOOK Ch 13 Special Concept MAPS
ORGANISMS AND IT’S

ENVIRONMENT ORGANISMS AND
Biotic and abiotic factors affect the biome POPULATION
in a region.
POPULATION
Abiotic Factors
• Temperature: Organism which can tolerate Population Growth
wide range temperature are called as
• If N is the population density at time t, then its
eurythermal and those with narrow temperature
density at time t+1 is: Nt+1= Nt + [(B + I) - (D + E)
range are called as stenothermal.
where, B = Birth, I = Immigrants, D = Death,
• Water: Organisms tolerating wide range of E = Emigrants
salinities are euryhaline and those with limited
• Exponential Growth: Equation Nt = N0ert where
salinities are stenohaline.
Immigration (I) Nt = population density after time t,
• Light: Light is available to an organism and it N0 = population density at time zero, r = intrinsic
varies from habitat to habitat hence determines rate of natural increase.
the type of biome in a habitat. dN = rN
dt
K a
Population
Natality (B) Mortality (D)
Response to Abiotic Factors Density (N) dN = rN( K - N )
b dt K
• Regulaters: They maintain their internal

Population Density (N)
constant environment.
• Conform: They cannot maintain internal body Time (t)
condition. Verhulst - Pearl Logistic Growth Curve
• Migrators: Organism can move away Emigration (E) Where a = when response are not limiting the
temporarily from stressful environment. growth, plot is exponential.
• Suspend: Organism reduce metabolic activity to b = when responses are limiting the growth, plot
cope up with stressful condition. is logistic, K is carrying capacity.
E.g. Bear (hibernation), snail and fish (aestivation), • Logistic Growth: dN/dt= rN(K-N/K) where N=
zooplankton (diapause state of suspended population density at time t, r=intrinsic rate of
development). natural increase, K=carrying capacity.
(i) Population Attributes

es
m
or
nf Birth rate, death rate, sex ratio, age distribution.
Co
Regulators
Age pyramid for human population:
Post-reproductive
Partial Regulators
Reproductive
Pre-reproductive
Internal level
Expanding Stable Declining
External level
Adaptations
Any attribute of the organism (morphological,
physiological or behaviollral) that enables the
organism to survive and reproduce in its habitat. Population Interactions
Eg: Allen’s rule- Mammals from colder climates
generally have shorter ears and limbs to minimize Species A Species B Name of Interaction Example
heat loss.
Lichens show mutualistic relationship between a fungus and
+ + Mutualism photosynthesising algae or cyanobacteria. Similarly, the mycorrhizae
are associations between fungi and the roots of higher plants.
Flamingoes and fishes compete for common food, the zooplankton.
The Abingdon tortoise in Galapagos Islands became extinct within a
decade after goats were introduced on the island, apparently due to
the greater browsing efficiency of the goats. Competitively superior
- - Competition barnacle Balanus dominates the intertidal area, and excludes the
smaller barnacle Chathamalus from that zone (competitive release).
‘Competitive Exclusion Principle’ states that two closely related
species competing for the same resources cannot co-exist indefinitely
and the competitively inferior one will be eliminated eventually.
Prickly pear cactus-moth, Monarch butterfly-bird, phytophagous
+ - Predation (feeding on plant sap and other parts of plants)
Human liver fluke (a trematode parasite) depends on two

intermediate hosts (a snail and a fish) to complete its life cycle. The
malarial parasite needs a vector (mosquito) to spread to other hosts.
Parasites that feed on the external surface of the host organism are
+ - Parasitism called Ectoparasites e.g: lice on humans and ticks on dogs. Cuscuta, a
parasitic plant that is commonly found growing on hedge plants.
Endoparasites are those that live inside the host body at different
sites (liver, kidney, lungs, red blood cells, etc.). Brood parasitism in
birds is a fascinating example of parasitism in which the parasitic bird
lays its eggs in the nest of its host and lets the host incubate them.
29
TOPPER’S SOLUTION
1. Name the type of association that the genus Clomus exhibits with higher plants.
Ans.
[CBSE Topper 2014]

2. Construct an age pyramid which reflects an expanding growth status of human population.
Ans.
[CBSE Topper 2014]
3. State Gause’s ‘Competitive Exclusion Principle’. How have the recent studies modified this principle ?
Ans.
[CBSE Topper 2019]
Long Answer Type-I Questions (LA-I) [3 marks ]

4. (A) State how the constant interval environment is beneficial organisms
(B) Explain any two alternatives by which organisms can overcome stressful external conditions.

Ans.

[CBSE Topper 2014]
5. Predation is usually referred to as a detrimental association. State any three positive roles that a
predator plays in an ecosystem.
Ans.
[CBSE Topper 2016]
6. Different animals respond to changes in their surroundings in different ways. Taking one example
each, explain ‘‘some animals undergo aestivation while some others hibernation’’. How do fungi
respond to adverse climatic conditions ?
Ans.
[CBSE Topper 2017]
Organisms and Populations 31

Long Answer Type-II Questions (LA-II) [5 marks ]
7. (A) Study the flow chart given below and complete the equation that follows by identifying 1, 2, 3 and 4.
Nt + 1 = Nt + {(1 + 2) – (3 + 4)}

(B) Mention the different ways by which the population density of different species can be measured.
Ans.
[CBSE Topper 2019]

Biodiversity and Conservation
PATTERNS OF Ch 6:
BIODIVERSITY HOW DO WE CONSERVE NCERT BOOK Ch 15
Special Concept MAPS
BIODIVERSITY?
(a) Latitudinal Gradients: Species diversity reduces
as we move from equator towards poles. In Situ Conservation: Conservation of species in its
(b) Species Area Relationship: Explained by natural environment like biodiversity hotspot, sacred
Alexander von Humboldt equation: groves, Ramsarsites biosphere reserves, national
log S = log C + Z log A parks and sanctuaries.
where, S = species richness, A = area, Z = slope Ex Situ Conservation: Threatened animals and plants
of the line (regression coefficient), C = Y - intercept are taken out from their natural habitat and WHY SHOULD BE CONSERVE
S = CAz conserved in special settings like zoological parks, BIODIVERSITY?
Log S = Log C + Z Log A
botanical gardens and wildlife safari parks.
• Narrowly Utilitarian: Conserving biodiversity
e for economic benefits of humans (medicines,
al
g sc latex, dyes, resins, perfumes etc.).
-lo
log • Broadly Utilitarian: Biodiversity conservation as
it plays major role in functioning of ecosystem.
Species Richness
Area
LOSS OF BIODIVERSITY
TYPES OF BIODIVERSITY
4 main causes of loss of biodiversity (evil quartet).
• Genetic Diversity: High level of genetic diversity i. Habitat loss and fragmentation
over its distribution range. ii. Over-exploitation: E.g. Extinction of passenger
• Species Diversity: Diversity at species level pigeons etc.
• Ecological Diversity: Different types of iii. Alien species invasions:
ecosystems in a region. E.g. Nile perch fish lead to extension of more than
200 catfish, carrot grass (Parthenium), Lantana,
Invertebrates Vertebrates water hyacinth (Eicchornia), Clarias gariepinus.
Mammals iv. Co-extinctions
Other animal groups BIODIVERSITY AND
Fishes
Crustaceans
Birds
Molluscs
CONSERVATION IMPORTANCE OF SPECIES
DIVERSITY TO THE ECOSYSTEM
Insects
Reptiles
Rivet Popper Hypothesis by Paul Ehrlich: In an
airplane (ecosystem) all parts are joined together
Plants Amphibians
using thousands of rivets (species), if every
Ferns and passenger takes a rivet (removal of a species)
Mosses allies initially no threat to safety of plane but later the
plane will crash (ecosystem will collapse).
Fungi Angiosperms
Algae Lichens
33
TOPPER’S SOLUTION

1. The following graph shows the species-area relationship. Answer the following question as
directed. Species richness log-log scale.

(A) Name the naturalist who studied the kind of relationship shown in the graph. Write the
observation made by him.
(B) Write the situations as discovered by the ecologists when the value of ‘Z’ (Slopeof the
line) lies
(i) 0.1 and 0.2
(ii) 0.6 and 1.2
What does ‘Z’ stand for?
(C) When would the slope of the line ‘b’ become steeper.
Ans.
[CBSE Topper 2014]

1
CBSE
TERM-2 SAMPLE PAPER
14th January 2022
BIOLOGY
Time allowed: 2 Hours Maximum Marks: 35
General Instructions:
(i) All questions are compulsory.
(ii) The question paper has three sections and 13 questions. All questions are compulsory.
(iii) Section–A has 6 questions of 2 marks each; Section–B has 6 questions of 3 marks each; and Section–C
has a case-based question of 5 marks.
(iv) There is no overall choice. However, internal choices have been provided in some questions. A student
has to attempt only one of the alternatives in such questions.
(v) Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION - A
(Section A has 6 Questions of 2 marks each.)
1. Humans have innate immunity for immediately once a pathogen attacks. It is
essentially made up of barriers that aim to keep
protection against pathogens that may
viruses, bacteria, parasites, and other foreign
enter the gut along with food. What are particles out of our body or limit their ability to
the two barriers that protect the body spread inside the body.
from such pathogens? 2
Caution

Ans. Microbial pathogens enter the gut of  While answering, students should read properly
humans along with food: that which type of barriers are asked, as in this
question only gastrointestinal tract is involved, so
 Physical barriers: Mucus coating of the only barriers related to it should be written in the
epithelium lining the gastrointestinal answer.
tract helps in trapping microbes entering
2. A patient admitted in ICU was diagnosed
our body.
to have suffered from myocardial
 Physiological barriers: Acid in the infarction. The condition of coronary artery
stomach, saliva in the mouth prevent
is depicted in the image below. Name two
microbial growth.
bioactive agents and their mode of action
Related Theory that can improve this condition.
 The innate immune system is made of defense
against infection which can be activated
Sample Paper 1 [CBSE Term-2 Sample Paper 2022] 35

eradication of pests is undesirable because in
their absence the beneficiary predatory and
parasitic insects that depend upon them as food
or hosts will not be able to survive. Therefore, the
use of biocontrol agents will greatly reduce our
Clot
dependence on toxic and harmful chemicals and
Cholesterol
pesticides.
Reduced
bloodflow
3. Identify the compound chemical structure
is shown below. State any three of its
physical properties. 2
HO
A B
O
OR
H
N CH
Substantiate by giving two reasons as to 3
why a holistic understanding of the flora
HO
and fauna in the cropland is required before
introducing an appropriate biocontrol Ans. It is Morphine.
method. 2 Physically it appears as a white, odourless,
crystalline compound.
Ans. Streptokinase (produced by the bacterium
Streptococcus) is used as a ‘clot buster’ for Related Theory
removing clots from the blood vessels of  Morphine acts as a depressant and slows down
patients who have undergone myocardial body functions. It is an effective sedative and a
infarction. painkiller taken by patients who have undergone
Statins (produced by the yeast Monascus surgery.
purpureus) acts by competitively inhibiting It is generally consumed by snorting and injection.
the enzyme responsible for synthesis
4. Water samples were collected at points
of cholesterol and thus act as blood-
A, B and C in a segment of a river near a
cholesterol lowering agents.
sugar factory and tested for BOD level. The
BOD levels of samples A, B and C were 400
Related Theory mg/L, 480 mg/L and 8 mg/L respectively.
What is this indicative of ? Explain why the
 Myocardial infarction is commonly known as a
heart attack and is a deadly medical emergency, BOD level gets reduced considerably at the
in which the heart muscle begins to die because it collection point C? 2
does not get enough blood flow due to a blockage Sewage Discharge Point
Upstream
in the arteries that supply blood to the heart. A
Blockage can be due to cholesterol deposition. B
C
Downstream
OR STP
Sewage treatment
Eradication of pests will disrupt predator- plant
prey relationships, where beneficial
predatory and parasitic insects which Ans. At collection points A and B, the BOD level
depend upon flora and fauna as food or is high due to high organic pollution caused
hosts, may not be able to survive. by sugar factory and sewage discharge.
Holistic approach ensures that various life At the collection point C, the water was
forms that inhabit the field, their life cycles, released after secondary treatment/
patterns of feeding and the habitats that biological treatment (where vigorous
they prefer are extensively studied and growth of useful aerobic microbes into
considered. flocs consume the major part of the organic
matter present in the river water or effluent
Related Theory due to sugar factory and sewage discharge).
 When biological methods are used for controlling
plant diseases and pests it is termed as Biocontrol.
The organic farmer is aware of the fact that

fluctuations in the temperature. Out of the
Related Theory
regulators and the conformers, which of the
 The primary treatment is also known as physical two will have better chances of survival?
treatment as it basically involves physical removal
Give two adaptations that support them to
of small and large particles from the sewage
survive in the ambient environment? Give
with the help of techniques like filtration and
sedimentation. The secondary treatment is also one suitable example. 2
known as Biological Treatment because it involves
Ans. The relationship between the plant and
the use of microbes for sewage treatment.
pollinator is called mutualism. Fig depends
BOD can be defined as the amount of the oxygen
on wasp for pollination, and wasp depends

that would be consumed if all the organic matter

on fig for food and shelter.
in one litre of water were oxidised by bacteria. The
sewage water is treated till the BOD is reduced. With the decline in population of figs, wasp
Thus, indirectly, BOD is a measure of the organic loses its source of food and shelter.
matter present in the water. The greater the BOD
of waste water, more is its polluting potential. Related Theory
5. An ecologist study an area with population  In order to safe-guard the mutually beneficial system,
plant-animal interactions involve co-evolution of
A, thriving on unlimited resources and
the mutualists, i.e., the evolution of the flower and
showing exponential growth, introduced its pollinator species are tightly linked with one
population B and C to the same area. What another. There is a tight relationship between species
will be the effect on the growth pattern of fig trees and pollinator species of wasp. In this a
of the population A, B and C when living particular fig species can be pollinated only by its
together in the same habitat? 2 ‘partner’ wasp species and no other species. The
female wasp is benefitted by using the fruit as an
Ans. This interaction will lead to competition oviposition (egg-laying) site and developing seeds
between the individuals of population A,B within the fruit for nourishing its larvae. In return the
and C for resources. Eventually the ‘fittest’ wasp pollinates the fig inflorescence while searching
individuals will survive and reproduce. for suitable egg-laying sites.
The resources for growth will become finite OR
and limiting, and population growth will
become realistic. Regulators;
Thermoregulation, Osmoregulation
Related Theory
Birds/mammals (any one)
 Practically unlimited resources are not available
to population of any species in order to permit
exponential growth. Therefore, limited resources Related Theory
result in competition between individuals. A given  Conformers are the organisms which depends
habitat in nature, has enough resources to support upon the changes in its external environment. Like
a maximum possible number, beyond which no aquatic animals change the osmotic concentration
further growth is possible. This limit of nature is of the body fluids with that of the surrounding air,
termed as nature’s carrying capacity (K) for that water osmotic concentration. They are also called
species in that habitat. as ectotherms as they depend on external sources
of body heat since they cannot regulate their body
6. With the decline in the population of fig temperature as per the variations in the external
species it was noticed that the population temperature. Examples: amphibians, reptiles,
of wasp species also started to decline. fishes.
What is the relationship between the two Regulators are the organisms that are capable of
and what could be the possible reason for controlling their internal environment irrespective
decline of wasps? of their external surroundings to an extent. They
OR are also called as endotherms as these animals
depend on the internal heat generation for survival.
With the increase in the global temperature,
the inhabitants of Antarctica are facing

SECTION - B
(Section B has 6 Questions of 3 marks each.)
7. How do normal cells get transformed Pneumonia: Bacterial disease caused by
into cancerous neoplastic cells? Elaborate Streptococcus pneumoniae and Haemophilus
influenzae, which infects the alveoli of the lungs.
giving three examples of inducing agent.
The infection spreads to a healthy person by
OR inhaling the droplets/aerosols that are released by
A person is suffering from a high grade an infected person.
fever. Which symptoms will help to Malaria is caused by Plasmodium (a tiny
identify if he/she is suffering from Typhoid, protozoan). The disease spreads from an infected
Pneumonia or Malaria? 3 individual to a healthy person through the vector
female Anopheles mosquito. The malaria can
Ans. Transformation of normal cells into become fatal if left untreated, by disrupting the
cancerous neoplastic cells may be induced blood supply to vital organs and thus may cause
by following physical, chemical or biological seizures, mental confusion, kidney failure, coma
agents causing DNA damage: and even death.
 Ionising radiations like X-rays and gamma 8. Recognition of an antigenic protein of
rays a pathogen or exposure to a pathogen
 Non-ionizing radiations like UV. occurs during many types of immune
 Chemical carcinogens present in tobacco responses, including active immunity and
smoke induced active immunity. Specify the types
 Cellular oncogenes (c-onc) or proto- of responses elicited when human beings
oncogenes, when activated under certain get encountered by a pathogen. 3
conditions cause cancer. Viruses with
oncogenes can transform normal cells to Ans. When our body encounters an antigenic
cancerous cells. (any 3) protein or a pathogen for the first time
it produces a response which is of low
intensity and our body retains memory of
Related Theory the first encounter.
 The cell growth and differentiation in human body  The subsequent encounter with the
is a highly controlled and regulated process. But same pathogen elicits a highly intensified
in cancerous cells, there is a breakdown of these response carried out with the help
regulatory mechanisms. The property by which of two special types of lymphocytes
normal cells differ from cancerous cells is contact present in our blood, B-lymphocytes, and
inhibition by virtue of which contact with other T-lymphocytes.
cells inhibits their uncontrolled growth, whereas
cancerous cells have lost this property. Therefore,
 The B-lymphocytes produce an army of
the cancerous cells divide continuously to give rise
proteins in response to these pathogens
into our blood to fight with them. These
to masses of cells called tumours or neoplasm.
proteins are called antibodies. The T-cells
OR themselves do not secrete antibodies but
help B-cells produce them.
Ans. If the person has sustained high fever
(39° to 40°C), weakness, stomach pain,
constipation, headache and loss of appetite,
it is Typhoid. Related Theory
 Active Immunity: When an individual (host) is
If the person has fever, chills, cough and
exposed to antigens in the form of living or
headache; and the lips and fingernails turn
dead microbes or other proteins. It results in the
gray to bluish, it is Pneumonia.
production of antibodies. This kind of immunity is
If the person has chills and high fever slow and thus takes time to give its full effective
recurring every three to four days then, it response, but its effect is long lasting. It has no side
is Malaria. effects.
The type of immune response produced by
Related Theory B-lymphocytes is termed as humoral immune
 Typhoid: Bacterial infection caused by Salmonella response or antibody mediated immune response.
typhi, which enter the small intestine through The type of immune response produced by
contaminated food and water and then migrate T-lymphocytes is termed as Cell-mediated immune
through blood to other organs. response or cell-mediated immunity (CMI).

9. In a pathological lab, a series of steps were undertaken for finding the gene of interest. Describe
the steps, or make a flow chart showing the process of amplification of this gene of interest. 3
Ans. The flow chart shows the three steps involved in the process of PCR showing the following
 Denaturation The DNA strands are treated with a temperature of 94°C (Heat) and the strands are
separated. Each of the two separated DNA strands act as a template for the synthesis of a new
strand.
 Annealing The primers anneal to the complementary strands. This step is carried out at a slightly
lower temperature of 40ºC to 60ºC.
 Extension The DNA polymerase facilitates the extension of the strands by adding dNTPs
(deoxynucleoside Triphosphates) complementary to those of the template DNA. Taq DNA Polymerase
also requires Mg2+ as a cofactor.
Diagram : Polymerase Chain Reaction
Region to be amplifed
5' 3'
ds DNA (a) Denaturation
3' 5'
Heat
5' 3'
3' 5'
Primers (b) Annealing of primers
5' 3'
3' 5'
DNA polymerase
(Taq polymerase)
+ deoxynucleotides
5' 3'
3' 5'
(c) Extension of primers
5' 3'
3' 5'
30 cycles
Amplified
(~1 billion times)
Diagram : Polymerase Chain Reaction

10. (A) ‘The Evil Quartet’ describes the rates
of species extinction due to human Ans. (A) When a large habitat is broken into
activities. Explain how the population of small fragments due to various activities,
organisms is affected by fragmentation mammals and birds requiring large
territories and certain animals with
the habitats.
migratory habitats are badly affected,
(B) Introduction of alien species has led leading to population decline.
to environmental damage and decline
(B) Nile perch introduced in Lake Victoria
of indigenous species. Give any one
eventually led to the extinction of an
example of how it has affected the
ecologically unique assemblage of more
indigenous species?
than 200 species of cichild fish.
(C) Could the extinction of Steller’s sea
 Parthenium/Lantana/water hyacinth
cow and passenger pigeon be saved
caused environmental damage and
by man? Give reasons to support your
threat to our native species
answer. 3

 African catfish-Clarias gariepinus Related Theory

introduced for aquaculture purposes
 Sacred groves are found in Khasi and Jaintia Hills
is posing a threat to the indigenous
in Meghalaya, Aravalli Hills of Rajasthan, Western
catfishes in our rivers. (Any one)
Ghat regions of Karnataka and Maharashtra and
(C) Yes; Humans have overexploited natural the Sarguja, Chanda and Bastar areas of Madhya
resources for their ‘greed’ rather than Pradesh.
‘need’ leading to extinction of these
animals. Sustainable harvesting could The species-area relationship is found out using
the slope. Slope of regression or regression
have prevented extinction of these
coefficient is used to measure species richness
species.
along an area. In smaller regions, an analysis of
species-area relationship shows that the values
Related Theory
of slope of regressionis the same irrespective of
 Examples of habitat loss: the taxonomic assemblage or the region. Whereas
(i) The tropical rain forests which were once when analysis is carried out in large areas the slope
covering more than 14 per cent of the earth’s of regression was found to be much steeper. Very
land surface, now cover only about 6 per cent large areas like the entire continents, the analysis
of the total area due to their fast destruction. of the species-area relationships will result in a
slope that is much steeper i.e., the Z values are in
(ii) The Amazon rain forest, that are called the
the range of 0.6 to 1.2.

‘lungs of the planet’, harbouring millions

of species, is being cut and destroyed for 12. The image below depicts the result of gel
cultivating soya beans or for conversion to electrophoresis
grasslands for raising beef cattle.
11. (A) The image shown below is of a sacred

grove found in India. Explain how has
human involvement helped in the
preservation of these biodiversity rich
regions.
If the ladder represents sequence length

upto 3000 base pairs (bp),
(A) Which of the bands (I - IV) correspond
to 2500 bp and 100 bp respectively?
(B) Explain the basis of this kind of
separation and also mention the
significance of this process. 3
(B) Value of Z (regression coefficient) is Ans. (A) Band III corresponds to 2500 base pairs,
considered for measuring the species and Band IV corresponds to 100bp.
richness of an area. If the value of Z (B) The fragments will resolve according
is 0.7 for area A ,and 0.15 for area B, to their size. The shorter sequence
which area has higher species richness fragments would move farthest from
and a steeper slope? 3 well as seen in Band IV (100 bp) which
is lighter as compared to Band III which
Ans. (A) India’s history of religious and cultural is heavier being 2500 base pairs.
traditions emphasized the protection of
nature. In many cultures, tracts of forest The significance of electrophoresis is
are set aside, all the trees and wildlife to purify the DNA fragments for use
within are venerated and given total in constructing recombinant DNA by
protection. Sacred groves in many states joining them with cloning vectors.
are the last refuges for a large number
of rare and threatened plants. Related Theory
(B) Area A will have more species richness  The basis of gel electrophoresis is that the DNA
and a steeper slope. fragments separate according to their size
through sieving effect provided by the agarose

gel. Therefore, the smaller the fragment size, the interest) are used in constructing recombinant
farther it moves. DNA by joining them with cloning vectors with the
The purified DNA fragments (containing gene of help of DNA ligase.
SECTION - C
(Section C has a case-based question of 5 marks.)
13. Some restriction enzymes break a (A) Which of the above 4 farm lands has
phosphodiester bond on both the DNA successfully applied the concepts
strands, such that only one end of each of Biotechnology to show better
molecule is cut and these ends have management practices and use of
regions of single stranded DNA. BamH1 is agrochemicals? If you had to cultivate,
one such restriction enzyme which binds which crop would you prefer (Bt or
at the recognition sequence, 5’-GGATCC- 3’ Non- Bt) and why?
and cleaves these sequences just after the (B) Cotton Bollworms were introduced in
5’- guanine on each strand. another experimental study on the
(A) What is the objective of this action? above farm lands wherein no pesticide
(B) Explain how the gene of interest is was used. Explain what effect would a
introduced into a vector. Bt and Non Bt crop have on the pest.
(C) You are given the DNA shown below. 5
5’ ATTTTGAGGATCCGTAATGTCCT 3’
3’ TAAAACTCCTAGGCATTACAGGA 5’ Ans. (A) The two different DNA molecules will
If this DNA was cut with BamHI, how have compatible ends to recombine.
many DNA fragments would you (B) Restriction enzyme cuts the DNA of
expect? Write the sequence of these the vector and then ligates the gene of
double-stranded DNA fragments with interest into the DNA of the vector.
their respective polarity.
(D) A gene M was introduced into E.coli (C) 2 fragments
cloning vector PBR322 at BamH 1 5’ ATTTTGAG 3’5’GATCCGTAATGTCCT 3’
site. What will be its impact on the 3’ TAAAACTCCTAG 5’.3’GCATTACAGGA
recombinant plamids? Give a possible 5’
way by which you could differentiate
(D) BamHI site will affect tetracycline
non recombinant to recombinant
antibiotic resistance gene, hence
plasmids.
the recombinant plasmids will
OR
lose tetracycline resistance due to
GM crops especially Bt crops are
inactivation of the resistance gene.

known to have higher resistance to

pest attacks. To substantiate this an Recombinants can be selected from
experimental study was conducted in non recombinants by plating into a
4 different farmlands growing Bt and medium containing tetracycline, as
non Bt-Cotton crops. The farm lands the recombinants will not grow in
had the same dimensions, fertility and the medium because the tetracycline
were under similar climatic conditions. resistance gene is cut.
The histogram below shows the usage
of pesticides on Bt crops and non-Bt Related Theory
crops in these farm lands.  Each restriction endonuclease acts by ‘inspecting’
the length of a DNA sequence. On finding
3.5 its specific recognition sequence known as
palindromic nucleotide sequences, the enzyme
3 Bt
Non-Bt binds to the DNA and cut each of the two strands
Pesticide use (kg a.i jacre)
2.5 of the double helix at specific points in their sugar

-phosphate backbones.
2 Insertional inactivation: It is a method in which
recombinants and non-recombinants are
1.5
differentiated from each other on the basis of
1 their ability to produce colour in the presence
of a chromogenic substrate. This method was
0.5 developed as selection of recombinants due to
inactivation of antibiotic gene is an inconvenient
0
Farm Farm Farm Farm method in terms of simultaneous plating on two
Land I Land II Land III Land IV plates having different antibiotics.

OR Related Theory
(A) Farm Land II.  Bt cotton is created using the bacterium Bacillus
Bt crop. thuringiensis as some strains of it produce proteins
Because the use of pesticides is highly that kill certain insects such as lepidopterans
reduced for Bt crop // Decrease of (tobacco budworm, armyworm), coleopterans
pesticide used is also more significant (beetles) and dipterans (flies, mosquitoes).
for Bt crop. Protein crystals are formed by B. thuringiensis
during a particular phase of their growth. A toxic
(B) In Bt cotton a cry gene has been
insecticidal proteinis present in these crystals. The
introduce from bacterium Bacillus
thuringiensis (Bt) which causes synthesis bacterium itself is not affected or killed by this
of a toxic protein. This protein becomes toxin because the Bt toxin protein exist as inactive
active in the alkaline gut of bollworm protoxins, but when an insect feed on such a plant
feeding on cotton, punching holes in the and ingest the inactive toxin, the protoxin gets
lining causing death of the insect. converted into an active form due to the alkaline
However; a Non-Bt crop will have no pH of the gut, that solubilize the crystals.
effect on the cotton bollworm/the yield
of cotton will decrease/non-Bt will
succumb to pest attack.

2
TERM-2
SAMPLE PAPER
SOLVED
BIOLOGY
Time Allowed: 2 hours Maximum Marks: 35
General Instructions: Same instructions as given in the Sample Paper 1.
SECTION - A
1. Give reasons for the following:

(A) An inoculum of curd is added to milk for
B A
curdling it.
(B) Dough has a puffed-up appearance.
OR
4. (A) Ramesh explained Riya that ecology is
Why it is considered beneficial to construct a

defined as the branch of science that deals

biogas plant in rural areas? 2 with the study of the interactions among
2. The diagram given below shows the organisms. Elaborate the definition to
formation of a tumour in between the make her understand better.
normal cells. The cancer cells divide (B) Due to global warming, life of many
uncontrollably. Name the process in which organisms has changed and became
the cells from these tumours migrate difficult. Which among eurythermal or
through blood or lymph to other parts of the stenothermal organisms can cope up
body, and wherever they get lodged in the better during global warming? 2
body, they result in the development of a
5. (A) Roma was wondering about the diverse
new tumour. Which kind of tumour is shown

organisms present around her. She was

this process? 2
A tumour is forming excited by the fact that so many different
types of plants and animals and even
microorganisms are present around us.
What is the term used for this? Define it.
(B) Within a species, how different sub-
species, variety, breeds and forms are
created? Illustrate with an example. 2
Cancer cells
dividing
Normal 6. (A) After the Covid-19 pandemic, government

cells
is stressing on vaccination campaign. What
3. In the diagram given below, a bacterial cell is it that prevents a person to suffer from a
is shown. Write the name of the part labeled disease he/she is vaccinated against? Give
as part ‘A’ and ‘B’. Also mention the use of one reason.
part ‘A’ in rDNA technology. 2
Sample Paper 2 43
(B) It is advised to avoid crowded and closed
OR
places like cinema halls, etc, during What do you mean by withdrawal syndrome
changing weather. Why? in case of drug and alcohol abuse? 2
SECTION - B
(Section B has 6 Question of 3 marks each.)
7. (A) Suhani and her friends went for

(B) RNA interference is a method of

educating their colony regarding the cellular defense in which silencing of a

spread of diseases via mosquitoes. They specific mRNA is performed through a
emptied all the overhead tanks, which complementary RNA molecule that binds
were not in use for last few months. to and prevents translation of the mRNA.
What was the purpose of this act? From where does this complementary
Name the pathogen which is responsible RNA come from?
3
for causing malaria (mosquito borne
disease). 10. (A) The given picture shows the antigen-

antibody reaction. Name a technique

(B) The thymus gland of a person is removed.
based on the principle of antigen-
Will the immune system of that person
antibody reaction used in the detection
be affected? If yes, how? 3 of a virus.
8. The following picture shows the three basic
steps of genetic engineering. Write down
these steps briefly.
Antibody Antigen Antigen-antibody

complex
OR
(B) It was an amazing discovery in the field
One of the crucial steps of genetic engineering
of biotechnology that bacterium Bacillus
is the identification of recombinant DNA
thuringiensis produces a toxin that can
containing the desired gene. This is done by a
kill insects belonging to a particular
process called insertional inactivation. Explain
group. But the bacteria itself do not get
this process with the help of an example. 3
killed by the toxin it produces. Explain
9. (A) A 4-year-old girl undergone the first gene

the major reason behind this? 3
therapy in 1990 as shown in the picture
below. For which disease she was treated
11. (A) Parasites are well adapted to survive

inside the body of their respective hosts.

and name the scientists responsible for
Enlist any two adaptive features evolved
attempting this successful therapy?
in parasites that enable them to survive
successfully in or on their hosts.
(B) Among all the abiotic factors that
influences life of organisms, why
temperature is considered to be the most
relevant factor? 3
12. The available species inventories to estimate
the global species diversity do not include
the diversity of prokaryotic species. The
biologists are still unaware of the total
prokaryotic diversity. Why? Give reasons. 3
SECTION - C
13. A school student trip was organized and treatment of sewage before it can be
students were taken to a sewage treatment discharged into rivers.
plant, where the students observed the Based on this, answer the following questions:

PRETREATMENT
AIR
SCUM
OVERFLOW TRASH
SECONDARY PRIMARY
AERATION
DRY SLUDGE FINISHING
SLUDGE DRYER
DIGESTION METHANE
(A) What do you mean by waste water? Based on this answer the following
(B) Why reduction in BOD is required in the questions:
treatment of sewage water?
(C) The process which involves removal
of large and small particles through
filtration and sedimentation is called as?
(D) State two advantages of sewage
treatment plants. (A) (i) Apart from making curd, what

OR is the function of microbe

Lactobacillus?
Rekha observed the following pictures of
microbes showing virus and bacteria. On (ii) Name any two enzymes produced by

seeing these pictures, it reminded her of the microbes that are used for clarification
beginning of the Covid-19 pandemic. She of bottled juices.
started cursing microbes as she thought that (B) (i) Name the fungus from which first

they are a curse on this earth. But her teacher antibiotic was isolated.
told her that all the microbes are not harmful (ii) Write any two roles served by

for us. Microorganisms are very useful as they Saccharomyces cerevisiae. 5

provide various medicines, household products,
bioactive molecules, etc.
Sample Paper 2 45
SOLUTION
SAMPLE PAPER - 2
SECTION - A
1. (A) The inoculum contains millions of Lactic 5. (A) The variety of life on earth at all its levels,
acid bacteria (LAB) or Lactobacilli which from genes to ecosystems is referred
have the ability to convert the lactose to as biodiversity. Biodiversity can be
sugar present in the milk into lactic acid. simply defined as the number and variety
This lactic acid results in coagulation and of organisms found within a specified
digestion of milk protein casein. Therefore, geographic region. It refers to the varieties
the milk changes into curd. of plants, animals and microorganisms, the
(B) The dough has a puffed-up appearance genes they contain and the ecosystems
due to the production of CO2 gas which they form.
is produced through the process of (B) Different sub-species, variety, breeds, forms
fermentation by bacteria. are formed due to genetic diversity within
OR the species.
Cattle dung serves as the raw material for Example: The medicinal plant Rauwolfia
the biogas plant and it is available in plenty vomitoria growing in different Himalayan
amount in rural areas. In agriculture, the ranges shows genetic variation in terms
spent slurry from the biogas plant is used as of the potency and concentration of the
a manure. Also, the biogas is used for lighting active chemical called reserpine that the
and cooking in rural areas as distribution is only plant produces.
in short distances. Therefore, it is beneficial to
construct a biogas plant in rural areas. Related Theory
 Genetic diversity is defined as the measure of
2. The process in which the cells of the tumours

variety of genetic information contained within the

migrate through blood or lymph to other parts species. Another example is: India has more than
of the body, and wherever they get lodged in 50,000 genetically different strains of rice, and 1,000
the body, they result in the development of a varieties of mango.
new tumour is called as Metastasis. 6. (A) The vaccine contains the dead pathogen
The process of Metastasis is shown by that provokes the active immunity of an
malignant tumours. individual leading to the formation of
3. The name of the part labeled as part ‘A’ and antibodies that protect him/her from the
‘B’ is: disease.
A – Plasmid, B – Nucleoid
In rDNA technology, plasmid is used as a Related Theory
cloning vector to transfer the gene of interest  Active Immunity: When an individual (host) is
into the host cell. exposed to antigens in the form of living or dead
microbes or other proteins. It results in the production
4. (A) Ecology is the field that deals with the of antibodies. This kind of immunity is slow and thus
balance between development and takes time to give its full effective response, but its
maintenance of natural environment and effect is long lasting. It has no side effects.
biotic communities, use and conservation of  An active immunity is induced in our body by
resources, finding solutions of local, regional deliberately injecting the microbes/antigens either
and global environmental problems. through immunization/vaccination (termed as
(B) The organisms that can cope up better artificial immunity) or through natural infection by
during global warming are Eurythermal infectious organisms (termed as natural immunity).
organisms. These organisms have greater (B) During changing weather, the germs or
adaptability. pathogens are more active and prevalent
in the atmosphere as the conditions
Related Theory are suitable for their growth and these
 Eurythermal are the organisms that can tolerate and pathogens are more in crowded and closed
thrive in a wide range of temperatures. Examples: places. Therefore, the chances of infection
most mammals and birds. Stenothermal are the are high in such places.
organisms that can tolerate a narrow range of
temperatures. Example: amphibians.

Related Theory Related Theory

 Infectious agents are more active during changing  The person becomes addicted and dependent on
weather as moist conditions favors the growth drugs or alcohol in the absence of any guidance or
of pathogens. Also, at that time the body of the counselling. The tendency of the body to manifest
individual is adapting the changing environmental a characteristic and unpleasant withdrawal
conditions of temperature, humidity, etc., so the syndrome if regular dose of drugs/alcohol is
person is more vulnerable to diseases and thus can abruptly discontinued is called as Dependence. The
easily get infected by these pathogens. withdrawal symptoms include anxiety, shakiness,
nausea and sweating that are relieved when use is
OR resumed again. The withdrawal symptoms can be
Withdrawal syndrome is also known as severe and even life threatening and the person may
discontinuation syndrome. This occurs in require medical supervision. The patient can break
individuals who have developed physiological all social norms in order to get sufﬁcient funds to
dependence on drugs or alcohol and who satiate his/her needs due to dependence on drugs
or alcohol. This can lead to many social adjustment
discontinue or reduce their use of it.
problems.
SECTION - B
7. (A) The purpose behind emptying the the β-galactosidase gene and thus it does not
overhead tanks was to prevent mosquito code for the enzyme, hence the chromogenic
borne diseases as the water in the tanks substrate is not acted upon by the enzyme,
was stagnant and can become a breeding thus the colonies do not produce any colour
ground for the mosquitoes. The pathogen and are identified as recombinant colonies.
which is responsible for causing malaria is 9. (A) In 1990, the first clinical gene therapy was
Plasmodium (a protozoan). given to a 4-year-old girl suffering from
(B) Thymus gland is a primary lymphoid organ Adenosine Deaminase (ADA) deficiency by
where immature lymphocytes differentiate Michael Blease and W. French Andreson of
into antigen-sensitive lymphocytes. Therefore, National Institute of Health.
removal of thymus gland makes the immune
system weak and as a result the person’s body Related Theory
becomes more prone to infectious diseases.  The enzyme adenosine deaminase is very important
8. The three basic steps of genetic engineering or for the immune system to function. The cause of the
disorder is deletion of the gene coding for adenosine
making a Genetically Modified Organism(GMO)
deaminase.
are:
(B) This complementary RNA can come from:
(i) Identification of DNA with desirable genes.

(i) An infection by viruses having RNA

(ii) Introduction of the identified DNA into the

genomes.

suitable host to form recombinant DNA

(rDNA). (ii) Mobile genetic elements (transposons)

that replicate via an RNA intermediate.

(iii) Maintenance of introduced DNA in the host
and transfer of the DNA to its progeny. 10. (A) The technique that is based on the principle
of antigen-antibody interaction and used in
OR
the detection of a virus is Enzyme-Linked
Insertional inactivation refers to the insertion of Immunosorbent Assay (ELISA).
a certain gene in the host DNA at a particular
site. Due to this insertion, the function of the Related Theory
gene at whose site insertion has taken place  Antigen-antibody interaction refers to a specific
gets inactivated. This process is used to identify chemical interaction between antibodies produced
recombinant DNA containing organisms from by B-lymphocytes and antigens from any source
those who are non-recombinants. during an immune reaction. Antibodies recognize
Example: A recombinant DNA is inserted specific proteins present on antigen surface. The
reaction between antigen and antibody leads
within the coding sequence of an enzyme,
to agglutination. ELISA can be used to detect an
β-galactosidase, that results into inactivation
antibody to HIV.
of the gene for synthesis of this enzyme. This
(B) Bacillus thuringiensis forms protein crystals
is known as insertional inactivation. If the
during a particular phase of their growth. A
plasmid in the bacteria is devoid of the insert
toxic insecticidal protein is present in these
(foreign DNA), it will result in the formation of
crystals. But the bacterium itself is not
blue-coloured colonies due to the presence of a
affected or killed by this toxin because the
chromogenic substrate. Whereas the presence
BT toxin protein exist as inactive protoxins,
of insert results into insertional inactivation of
Sample Paper 2 47
but when an insect feed on such a plant
and ingest the inactive toxin, the protoxin Related Theory
gets converted into an active form due to  Temperature influences the distribution of species as
the alkaline pH of the gut, that solubilize the species are able to grow within a narrow range
the crystals. The activated toxin binds to of temperature which is known as the optimum
temperature. The organisms are able to survive
the surface of midgut epithelial cells and
by maintaining all biological processes within an
make it porous resulting in cell swelling and
optimum temperature. The primary factors that
lysis and finally cause death of the insect.
affect the organisms are temperature, water,
11. (A) Parasites have evolved special adaptations humidity, pH.
that enable them to survive successfully, in 12. Biologists are still unaware of the total
or on their hosts they are: prokaryotic diversity because of the following
(i) Loss of unnecessary sense organs.

reasons:
(ii) Presence of adhesive organs or suckers

(i) The conventional taxonomic methods
to cling on to the host. are not suitable for identifying microbial
(iii) Loss of digestive system. species.
(iv) High reproductive capacity. (Any two) (ii) Many microbial species cannot be cultured
(B) Temperature is an important ecologically under laboratory conditions.
environmental factor that affects the (iii) If biochemical or molecular criteria for
different aspects of the living organism. delineating microbial species is accepted
Different types of physiological activities and followed, then their diversity alone
such as enzymatic activities as well as might run into millions.
geographical distribution of different
species depends on the temperature
conditions and levels of their thermal
tolerance. Therefore, the living organism
is required to maintain specific internal
temperatures.
SECTION - C
13. (A) Waste water is the water that is produced OR
after the use of fresh water by human (A) (i) Lactobacillus increases the nutritional

beings for variety of applications such as value of the curd by increasing the
domestic, commercial and industrial use. amount of vitamin B12 in it.
(B) The greater the BOD of sewage water, (ii) Two enzymes produced by microbes

more is its polluting potential. So, the that are used for clarification of bottled
sewage water is treated, till its BOD is juices are pectinase and protease.
reduced to reduce the organic matter (B) (i) The fungus/mould from which first
present in it.

antibiotic was isolated was Penicillium

(C) The process which involves removal of notatum.
large and small particles through filtration (ii) Two roles of Saccharomyces cerevisiae
and sedimentation is called as primary

are:
treatment of sewage.
(i) It is used in bread making.
(D) The advantages of sewage treatment

(ii) It is used in the commercial production

plants (STPs) are:

of ethanol.
(i) STPs preserve natural environment

against pollution. Related Theory

(ii) STPs
eliminate disease-causing  Saccharomyces cerevisiae is also known as baker’s
bacteria and kills harmful organisms and brewer's yeast.
from the sewage water before its
discharge into the rivers. In this way,
STPs reduces risk to public health and
the environment.

3
TERM-2
SAMPLE PAPER
SOLVED
BIOLOGY
SECTION - A
1. (A) During a discussion on biodiversity, the

Why eradication of insect pests is not
teacher showed the following picture of recommended by organic farmers? 2
Amazon rainforest and labelled it as Lungs
of the Planet. Why Amazon rainforest are 4. The given diagram shows the release
termed as ‘Lungs of the Planet’? of histamine near an injury site in the
body. Discuss the role of histamine in
inflammatory response.
(B) Name any two biodiversity hotspots of

India. 2
2. (A) Reema was buying vegetables from the

supermarket and she noticed one of the

labels as GM foods. What do you mean
by GM foods? OR
(B) Many multinational companies use Explain the role of lymph nodes (secondary
bioresources without authorization from lymphoid organs) in our immune system. 2
the concerned country and its people.
What is this practice called? 2 5. (A) Ruminant animals like cattle harbour

methanogens in their rumen (a part

3. What is the role of microbes in producing the of their digestive tract). What is the
following types of cheese? function of these methanogens?
(A) Swiss cheese (B) How Lactobacillus bacteria improve the
(B) Roquefort cheese nutritional quality of curd? 2
OR
Sample Paper 3 49
6. Tobacco smoking is very harmful for blood. How does tobacco smoking lead to
the person’s health as it leads to severe oxygen deficiency in human body? 2
consequences like oxygen deficiency in
SECTION - B
7. (A) The following picture shows the roots of

bioreactor for him? Also, list the various
a tobacco plant infected with nematode components of a bioreactor. 3
Meloidogyne incognita, which decreases
the yield and quality of tobacco plants. 10. An instructor showed a slide to students
How the nematode infection in the roots depicting Anabaena and a picture
of tobacco plants controlled with the of mycorrhiza, both of which act as
process of RNA interference? biofertilisers. How do Anabaena and
mycorrhiza act as biofertilisers? 3
11. (A) Give reasons for the following:

(i) Enzyme cellulase is needed to isolate
(B) A cow named “Rosie” was a transgenic

genetic material from plant cells and

cow. Why it is considered to be different not from animal cells.
from a normal cow?
(ii) Exonuclease are not used for creating a
OR

recombinant DNA molecule.

Enlist any three transgenic organisms and (B) Who were responsible for the synthesis
their application. 3 of first recombinant DNA molecule and
8. A hypothesis was proposed to explain the in which year? 3
importance of biodiversity for survival of 12. Classify the following diseases as infectious
species. Who gave this hypothesis? Explain diseases and non-infectious disease. Also
the hypothesis briefly. 3 mention the basis of your classification. 3
9. Akshat became curious after seeing a very (a) Scurvy
large vessel in a factory in which millions of (b) Cancer
microorganisms were cultured to produce (c) Syphilis
a recombinant protein. The scientists told
(d) AIDS
him that it was a bioreactor. Can you define
SECTION - C
13. The given picture depicts an animal named

kangaroo rat that seldom drinks water. It has
a thick coat to minimise evaporation and rarely
comes out of its humid and cool burrow during
day time. 90% of its water requirement is met
by metabolic water which is produced by
respiratory breakdown of fats whereas 10% is
obtained from the food. It conserves water by
producing almost solid urine and faeces.
Based on this answer the following
questions:

(A) Kangaroo rats live in deserts, which are Carrying capacity-the maximum
very hot and dry. How does the kangaroo population that can be supported by an
ecosystem
rat get the water it needs?
Population size
(B) Due to the adaptations shown by
Kangaroo rat, it is said to be a regulator.
Justify the statement by defining it.
(C) Kangaroo rat is able to perform
homeostasis. How would you define
Time
homeostasis?
(D) List any two adaptations of kangaroo rat
that helps it to survive in a hot and dry
climate.
OR
The teacher presented the following two
pictures to her students in order to make them
understand about the carrying capacity of a (A) Which factors are responsible for
population. decreasing the density of a population in
Based on this answer the following a given habitat?
questions: (B) Which growth curve is followed by
human population?
(C) What does niche overlap indicates?
(D) Differentiate between immigration and
emigration. 5
Sample Paper 3 51
SOLUTION
SAMPLE PAPER - 3
SECTION - A
1. (A) Among all the rainforests found on Earth, insects that depend on them as food or hosts
the largest one is Amazon rainforest. In would not be able to survive.
Amazon rainforest, billions of tree and
plant species are present. They take in Related Theory
tonnes of carbon dioxide and converts it to  Organic farming requires the knowledge and
oxygen. This rainforests contributes about understanding of various life forms present in
18% to 20% of the world oxygen. Thus, they the field such as predators, pests, their life cycles,
are considered as the lungs of the planet. patterns of feeding and the habitats that they prefer,
so that they can be used in biocontrol measures.
Ultimately, this will greatly reduce our dependence
Related Theory on toxic and harmful chemicals and pesticides.
 Rainforests refer to those forests where there is
continuous rainfall. It constitute some of the globe’s 4. Histamine is released by basophils and mast
most important ecosystems and environments. The cells as a part of local immune response in
globe’s rainforests cover nearly 2% of the earth’s order to cause inflammation. Histamine is an
total surface area and host more than 50% of the organic nitrogenous compound. Release of
world’s animals and plants. histamine causes the capillaries to become
(B) The two biodiversity hotspots of India are: more permeable to the WBCs and as a
(i) Western Ghats and Sri Lanka result they attack the foreign bodies in the
(ii) Indo-Burma affected areas. Therefore, histamine causes
inflammation so that other chemicals are also
(iii) Himalaya (Any two)
released out and help in the repair work.
2. (A) Genetically modified (GM) foods are OR
defined as the foods that are derived from
Lymph nodes are small solid structures that
organisms whose genetic material (DNA)
are present at different points along the
has been manipulated by incorporating a
lymphatic system. The function of the lymph
gene that will express a desirable trait. nodes is to trap the microorganisms or other
antigens that enters the lymph and tissue fluid.
Related Theory
As a result, the antigens that are trapped in
 The organisms in which DNA is manipulated are the lymph nodes, bring about the activation of
known as genetically modified organisms/transgenic/
lymphocytes present there and thus elicit the
genetically engineered.
immune response.
(B) The practice of exploiting the bioresources
by the multinational companies and Related Theory
organizations without authorization from  Secondary lymphoid organs are the sites where
the concerned country and its people is interaction of lymphocytes with the antigen takes
called as Biopiracy. place, which then proliferate and develop to become
3. (A) ‘Swiss cheese’: in this kind of cheese the effector cells.
large holes are formed due to production 5. (A) Methanogens (anaerobic microbes) help in
of a large amount of CO2 by a bacterium the digestion of cellulose in the rumen of
named Propionibacterium shermanii. the cattle.
(B) ‘Roquefort cheese’: are ripened by growing (B) Lactobacillus bacteria improve the
a specific fungus known as Penicillium nutritional quality of curd by increasing the
roqueforti on them, that gives them a amount of a nutrient, Vitamin B12.
particular flavour.
6. There is an increase in the content of carbon
OR monoxide (CO) in the blood of the person who
Organic farmers believe that ‘biodiversity smokes tobacco. CO has greater afﬁnity to
furthers health’. They do not recommend haemoglobin than oxygen and forms a stable
eradication of insect pests because in their bond with haemoglobin and does not allow
absence the beneficial predatory and parasitic oxygen to bind. This results in reduction of

oxygen carrying capacity of haemoglobin. As a Bt Cotton The transgenic
result, this reduces the content of haemoglobin cotton plant is pest
bound oxygen and leads to oxygen deficiency resistant, herbicide
in human body. tolerant and gives
high yield.
Related Theory
 Due to tobacco smoking less oxygen reaches the Cattles (cow, sheep, The transgenic
mind, heart, muscle tissue and different organs. goat) animal produces
Therefore, lung function is reduced due to the therapeutic human
narrowing of the lung airways and extra mucus in proteins in their milk.
the lungs. Smoking also damages alveolar walls,
8. Paul Ehrlich, a Stanford ecologist, gave ‘rivet
which reduces respiratory surface (emphysema).
popper hypothesis’ to explain the importance
7. (A) In the technique of RNA interference or of biodiversity for survival of species.
gene silencing, nematode specific genes/ (i) In his hypothesis, he considered the
DNA is introduced in the host plant. This ecosystem as an airplane, in which all
DNA then produces two types of RNA – parts are joined together using thousands
sense and anti-sense RNA. As a result, these of rivets (species).
two strands of RNA, binds with each other
(ii) If every passenger, travelling in it, starts
to form a double-stranded RNA as they
popping a rivet to take home (causing a
both are complementary to each other in
species to become extinct), it may not
sequence. Since dsRNA cannot translate, as
affect flight safety (proper functioning
a result, its expression is blocked and thus
of the ecosystem) initially, but as more
it leads to RNA interference. Therefore, the and more rivets are removed, the plane
mRNA of nematode is silenced and the becomes dangerously weak over a period
parasite cannot survive in the transgenic of time.
host.
(iii) Also, which rivet is removed may also
be critical. For example, loss of rivets on
Related Theory
the wings (key species that drive major
 The roots of tobacco plants are infected by a ecosystem functions) is obviously a more
nematode Meloidogyne incognita.
serious threat to flight safety than loss of
(B) The transgenic cow “Rosie” do not produce a few rivets on the seats or windows inside
only normal milk like other cows, but it the plane.
produced human protein-enriched milk
(2.4 g/L). Human alpha-lactalbumin was
9. To produce the cloned gene of interest
on a large scale, the large volume vessels
present in the milk and was nutritionally a
called as bioreactors, having a capacity of
more balanced product for human babies
approximately 100-1000 liters are used, in
than natural cow-milk.
which raw materials are biologically converted
Related Theory into specific products, individual enzymes, etc.,
 Rosie was the first transgenic cow created in 1997.
using microbial plant, animal or human cells.
The various components of a bioreactor are:
Caution
(i) Agitator system
 Students should remember that Rosie was the first
transgenic cow, but the first transgenic animal was (ii) Oxygen delivery system
a mouse. Almost 95% of all transgenic animals (iii) Foam control system
are mice. These transgenic mice are developed for
the purpose of studying human physiology and (iv) Temperature and pH control system
development. (v) Sampling port to withdraw culture
OR periodically.
Following table shows the transgenic organisms
and their application: Related Theory
 A bioreactor provides the optimal conditions for
Transgenic Application producing the desired product by providing optimum
organism growth conditions like temperature, pH, substrate,
salts, vitamins and oxygen.
Flavr Savr Tomato This transgenic
variety of tomato 10. Fungi form symbiotic associations with plants
have increased shelf which are known as mycorrhiza. In such
life due to delayed associations, the fungal symbiont absorbs
ripening and better phosphorus from soil and transfers it to the
nutrient quality. plant. Many members of the genus Glomus
form mycorrhiza.
Sample Paper 3 53
Cyanobacteria are the autotrophic microbes synthesized the first recombinant DNA
that are found in aquatic and terrestrial molecule.
environments. Many of them can fix 12. Infectious diseases – Syphilis, AIDS
atmospheric nitrogen, for example: Anabaena,
Non-Infectious diseases – Scurvy, Cancer
Nostoc, Oscillatoria, etc., and serve as an
important biofertilizer in paddy (rice) fields. Basis of classification: Infectious diseases are
Cyanobacteria also add organic matter to the those diseases that are easily transmitted from
one person to another via pathogens. Non-
soil and thereby increases its fertility.
infectious diseases are those which cannot
Related Theory be transmitted from one person to another
 Biofertilisers are organisms which enrich the nutrient and are not caused by pathogens. The cause
quality of the soil by increasing the availability of of such diseases are nutritional deficiencies,
nutrients to the crops. malfunctioning of organs, etc.
11. (A) (i) The plant cell wall is made up of
Related Theory

cellulose, therefore, in order to digest

 Since infectious diseases are transmitted from one
cellulosic cell wall the enzyme cellulase person to another via pathogens, such as, the cause
is used, whereas the animal cells lack a of Syphilis is a bacterium called Treponema pallidum
cell wall and thus they do not need this and AIDS spreads through Human Immunodeficiency
enzyme. Virus (HIV).
(ii) Exonucleases are not used for creating

Caution
rDNA molecule because they only  In case of non-infectious diseases, pathogens are do not
remove the nucleotides from the ends of play any role, such as Scurvy is caused by Vitamin C
DNA molecule and not at any particular deficiency and cancer is caused by Oncogenic
desired site/region within DNA. transformation of cells due to carcinogens such as
X-rays, UV rays, etc.
(B) In 1972, Stanley Cohen and Herbert Boyer
SECTION - C
13. (A) Kangaroo rat get the water from the seeds OR
it eats. (A) The factors that are responsible for
Explanation: Kangaroo rats get the water decreasing the density of a population in a
they need from food. They eat mostly given habitat are mortality and emigration.
seeds. 90% of its water requirement is met (B) S-shaped growth curve is followed by
by metabolic water which is produced by human population.
respiratory breakdown of fats whereas (C) Niche overlap indicates that there is
10% is obtained from the food. sharing of one or more resources between
(B) Kangaroo rat is a regulator because it the two species.
performs homeostasis with the help of (D)
thermoregulation and osmoregulation by
behavioural changes and physiological Immigration Emigration
adjustments.
It can be defined It is defined as the
(C) Homeostasis is the process by which the
as the number of number of individuals
organisms try to maintain the constancy
individuals of the of the particular
of its internal environment despite varying
same species that population who left
external environmental conditions.
have entered into the the habitat and moved
(D) The kangaroo rat is adapted to desert life. habitat from outside elsewhere during the
The adaptations are as follows: during the time period time period under
(i) They can survive without drinking

under consideration. consideration.
water, by getting moisture from their
fatty seed diet.
(ii) Produce concentrated urine and do

not use water for regulation of body

temperature.

4
TERM-2
SAMPLE PAPER
SOLVED
BIOLOGY
SECTION - A
1. The following picture shows the roots 3. There is a growing trend of organic farming
of leguminous plants with root nodules and nowadays everyone is preferring
harbouring a beneficial bacterium – organic products over conventional ones.
Rhizobium. How organic farming is advantageous over
How does Rhizobium acts as a biofertilizer conventional farming?
and why it is categorised as a symbiotic OR
bacterium? 2 Why Nucleopolyhedrovirus serve as excellent
biocontrol agents? 2
4. (A) Reema was studying about plasmids

and came across the term ‘marker gene’.

What is the importance of a marker
gene?
(B) Although the retroviruses cause severe

diseases, yet they are efficiently used

in genetic engineering experiments.
Explain briefly how? 2
5. The Monarch Butterfly is avoided by
predators and thus does not get eaten up.
2. (A) Why an antibody molecule represented

Why?
as H2L2? OR
(B) A person suffers from sustained high Define commensalism and give one of its
2

fever, weakness, constipation, headache examples.

and loss of appetite. Identify the disease
from which the person is suffering and
6. The human activities are largely responsible
for the accelerated rates of species extinctions
also name the diagnostic test which
and the biological wealth of our planet has
confirms this disease. 2
been declining rapidly. Mention any two
human activities responsible for it. 2
Sample Paper 4 55
SECTION - B
7. (A) The given picture shows a typical sewage

(B) Why coral reefs are specifically found in

treatment plant. How is activated sludge Tamil Nadu on the east coast of India? 3
produced during sewage treatment?
11. The German naturalist and geographer
Alexander von Humboldt explored the
wilderness of South American jungles. Based
on his observations, he plotted a graph
between species richness and area and gave
the following relationship as shown in the
graph below.
(A) What was his observation from the
studies conducted?
(B) During sewage treatment, the step
(B) If Z represents the slope of the line
of secondary treatment is called as (regression coefficient), then what is the
biological treatment. Why? 3 significance of the slope of regression
in a species – area relationship? 3
8. Reshma was studying about restriction
enzymes and came across names of several S = CAz
restriction enzymes such as SalI, EcoRI, PvuI, Log S = log C + Z log A
etc. Describe the basic steps involved in the
Species richness
nomenclature of restriction enzymes.
3 le
. .
HindIII . . . sca
A 3. 5 AGC T T3
log
5 A AGC T T 3 5
. . digest . . . . -
log
3 T T CGA A 5 3 T T CGA 5 3 A5
.
5 protruding ends
. . . . . .
5 C T GC AG3 PstI 5 CT GCA 3 G35
3
.
GACGT C 5
.
Idigest .
G 5
. . . Area
3 3 A C G T C5
3
.
protruding ends Showing species area relationship.
5
.
G AT A T C 3
.
EcoRV 5
.
GA T 3
.
5
.
AT C 3
. Note that on log scale the realtionship
3
.
C T A T AG 5
.
digest 3
.
CT A 5
. 3
.
T AG 5
.
becomes liner
Blunt ends
12. Sunita is surprised to see that in most of the
9. A genetically modified or transgenic variety gene cloning experiments E. coli is used as
of rice was created in 1990s to improve the host. Give three reasons for the extensive
human health. Name the variety and the use of E. coli.
reason for which it was created. Also briefly OR
explain how it was made and by whom. 3 Which three critical research areas of
10. (A) In our childhood, we have heard the story

biotechnology are there? 3
of Koel and Crow in which Koel lays her
eggs in the nest of a Crow. What is this
phenomenon called as? Explain briefly.
SECTION - C
13. Risha saw the poster given below pasted on a

wall near her house. As she inquired about this
from her mother, she told her that one should
take precautions if he/she is suffering from
common cold, etc., so that it does not spread
to other people.
Based on this answer the questions that
follow:

(A) To which category do the above shown (A) Name the disease from which the person
disease/infection belong? Write any is suffering as shown in the picture.
two modes of spread of such type of (B) Which pathogen is responsible for
infection? causing the disease shown in the given
(B) What do you mean by droplet infection? picture?
Give two examples of disease that (C) What is the mode of transmission of the
spread through droplet infection. disease shown in the picture?
OR (D) List any two symptoms of the disease
Given below is the picture showing the legs of depicted in the picture. 5
a person suffering from an infectious disease.
Answer the questions that follow:
follow:
Sample Paper 4 57
SOLUTION
SAMPLE PAPER - 4
SECTION - A
1. Rhizobium is a symbiotic bacterium that
resides in the nodules present on the roots Related Theory
of leguminous plants and fixes atmospheric  There are two sub-types of marker genes, i.e., a
selectable marker and a screenable marker.
nitrogen into nitrogenous compounds that
can be utilised by plants as nutrients. Such a (B) When a retrovirus enters a host cell, it
relationship is beneficial to both bacteria and produces DNA from its RNA sequence
plant and thus called as symbiotic relationship. with the help of an enzyme called reverse
transcriptase. In genetic engineering
2. (A) An antibody has four peptide chains i.e., experiments, the disease-causing gene
two small chains called as light (L) chains
is removed from retroviruses, therefore
and two longer chains called as heavy
they can be used as vectors to deliver
(H) chains. Therefore, an antibody is
recombinant DNA into animal cells.
represented as H2L2.
Related Theory
Related Theory
 Retroviruses have RNA as their genetic material.
 Antibodies are a class of proteins also called as
Retrovirus DNA formed by reverse transcriptase is
immunoglobulins that are produced when an
added to host cell genome, by an enzyme integrase.
antigen attacks the body. The different types of
The retrovirus then continues to infect host cells and
antibodies produced in our body are IgA, IgM, IgE,
add genetic material to them, thus the retroviruses
IgG.
are useful in biotechnology to deliver desirable
(B) The person is suffering from Typhoid. The

genes.
diagnostic test that confirms typhoid is
5. The Monarch Butterfly is avoided by predators
Widal test.
because the butterfly is highly distasteful to
3. The conventional farming involves practices its predator (birds). This butterfly has a special
that use chemical methods to kill both useful chemical in their body which they acquires
and harmful life forms indiscriminately, during their caterpillar stage by feeding on a
whereas organic farming is a holistic approach, poisonous weed. These chemicals have fatal
that is based on an understanding of the effect on the predator body.
webs of interaction between the myriad of
organisms that constitute the field fauna Related Theory
and flora. Also in organic farming, the insects  During the larval stage monarch butterfly obtains
(pests) are not eradicated, but instead are kept nutrients by consuming milkweed leaves as its food,
at manageable levels by controlling them due to which it secretes a substance called cardiac
via natural predation rather than introducing glycosides, which have fatal effect on the predator
chemicals. body.
OR
OR
Nucleopolyhedrovirus are excellent for The interaction where one species is benefitted
species-specific, narrow spectrum insecticidal and the other is neither benefitted nor harmed
applications. They have no negative impacts is called commensalism.
on plants, mammals, birds, fish or even Example: An orchid growing as an epiphyte
on non-target insects, that is one of the on a mango tree. The orchid gets shelter but
desirable qualities in an overall integrated pest derives no nutrition from the mango tree,
management (IPM), when beneficial insects while the mango tree is neither harmed nor
are being conserved or when an ecologically benefitted.
sensitive area is being treated. 6. The human activities that has led to loss of
4. (A) Marker gene is used to determine that the biodiversity are:
nucleic acid sequence has been successfully (i) Destruction of habitats of animals by
inserted into an organism's DNA or not. humans.
(ii) Over-exploitation of natural resources and
their degradation.

(iii) Alien species invasions: Through human manage to survive, they usually thrive and
activities, species of animals and plants exclude native species through competition
have been introduced to new habitats or predation.
all over the world. When these species (iv) Hunting (Any two)
SECTION - B
7. (A) When the BOD (Biochemical Oxygen Caution
Demand) of sewage or waste water is
 While writing about golden rice remember that
reduced significantly, the effluent is then naturally rice is devoid of vitamin A, it is incorporated
passed into a settling tank where the by genetic engineering only.
bacterial ‘flocs’ are allowed to sediment.
10. (A) The phenomenon is called as brood
This sediment is known as activated sludge.

parasitism. It is a type of parasitism in which

(B) The secondary treatment is also known as one organism i.e., the parasitic bird lays its
biological Treatment because it involves eggs in the nest of another organism (host)
the use of microbes (living organisms) for so that the host incubate them. The eggs of
sewage treatment. the parasitic bird have evolved to resemble
8. The restriction enzymes are named in the the host’s egg in size and colour, so that
following manner: the host bird cannot detect and eject the
(i) The first letter of the name comes from the foreign eggs from the nest.
genus. Example: The cuckoo (koel) acts as the
(ii) The second two letters come from the parasite and the crow is the host during the
species of the prokaryotic cell from which breeding season (spring to summer).
the enzymes were isolated. (B) Coral reefs are specifically found in Tamil
Example: The restriction enzyme isolated Nadu on the east coast of India because of
from Escherichia coli RY 13 i.e., EcoRI – high salinity, optimal temperature and less
letter E comes from the genus Escherichia siltation, which are essential for the corals
and the second two letters co comes from to colonise. If siltation and fresh water
the species coli. inflow are high, then corals do not colonise.
(iii) The letter ‘R’ is derived from the name of
strain in EcoRI. Related Theory
(iv) Roman numbers following the names  Siltation is the water pollution caused by soil erosion
indicate the order in which the enzymes or sediment spill.
were isolated from that strain of bacteria. 11. (A) Alexander von Humboldt observed that

9. Golden rice is a genetically modified or within a region, species richness increased

transgenic variety of Oryza sativa (rice), that with increasing explored area, but only up
has been developed as a fortified food for areas to a limit.
where there is a shortage of dietary vitamin (B) The species-area relationship is found out
A. It contains a precursor of pro-vitamin A, using the slope. Slope of regression or
known as β-carotene, which is introduced in regression coefficient is used to measure
the rice with the help of genetic engineering. species richness along an area. In smaller
The rice grains are golden yellow in colour regions, an analysis of species-area
due to β-carotene and thus called Golden rice. relationship shows that the value of slope
It was developed at Swiss Federal Institute of of regression is the same irrespective of
Technology by Professor Ingo Potrykus and the taxonomic assemblage or the region.
Peter Beyer. Whereas when analysis is carried out in
large areas the slope of regression was
Related Theory found to be much steeper.
 Although rice plant produces beta-carotene pigment 12. E. coli is used extensively as host because:
naturally in its leaves, but it is absent in the seed
endosperm, as the pigment helps in photosynthesis (i) It does not contain any elements that
and photosynthesis do not takes place in endosperm. interfere with replication and recombination
Since beta-carotene is the precursor of pro-vitamin of DNA.
A, it is introduced in rice variety. Compared to (ii) It is easy to transform and grow.
other vitamin supplements, it is a simple and less-
expensive alternative. However, it is still not available
(iii) It supports replication of inserted DNA.

for human consumption because of significant OR

opposition from environmental activities. Three critical research areas of biotechnology
are:
Sample Paper 4 59
(i) Best catalyst in the form of improved (ii) Optimal conditions through engineering for
organism usually a microbe or pure a catalyst to act are created.
enzyme is provided. (iii) The protein/organic compound are purified
by downstream processing technologies.
SECTION - C
13. (A) The above shown disease/infection belongs person either contain saliva, sputum or
to the category of infectious diseases. nasal discharge which may be breathed in
These are those diseases that are easily by healthy people and cause infection in
transmitted from one person to another them. Airborne diseases can have a droplet
via pathogens. These diseases are very mode of transmission.
common and every person suffers from Example: Common cold, Flu, Diphtheria,
them at some point of their life. Plague, Rubella, Covid-19. (Any two)
Example: AIDS, typhoid, common cold, etc. OR
Infectious diseases spread through the (A) Elephantiasis is the disease from which the
following modes: person is suffering as shown in the given
• Through air: The disease spread through

picture.
droplets released in the air during (B) The pathogen or causative agent
sneezing or coughing E.g., common cold, responsible for Elephantiasis is Wuchereria
tuberculosis. bancrofti and Wuchereria malayi (filarial
• Through water: It can spread with intake

worms).
of contaminated water, E.g., Cholera, (C) The Elephantiasis or Filariasis disease is
Typhoid. transmitted by the vector female Culex
• Sexual contact: Can spread through

mosquito.
sexual contact or the exchange of body (D) The symptoms of Elephantiasis/Filariasis are
fluids. E.g., Syphilis, AIDS. as follows:
• Through vectors: The infectious agent
(i) Slowly developing chronic inflammation

can be carried via animals like flies of the organs infected by these worms
and mosquitoes from sick person to a which are usually lymphatic vessels of
healthy person. E.g., Rabies, Malaria the lower limbs.
(Any two) (ii) The genital organs also get affected

(B). Droplet infection: When a person sneezes

thus causing gross deformities.
or coughs, the droplets are released in the
air that can spread the infection to other
person. These droplets of an infected

5
TERM-2
SAMPLE PAPER
SOLVED
BIOLOGY
SECTION - A
1. (A) The picture given below is of the bird

OR
named Dodo (Mauritius) that has become What do you mean by phytophagous
extinct. Write any two names of animals insects? Give an example. 2
that have become recently extinct.
3. (A) What is the importance of distillation

process performed during the production

of certain alcoholic drinks?
(B) Which organism is commercially
exploited for the production of single cell
protein? 2
4. (A) Every year we hear several incidences of

Dengue fever in our country. Name the

vector of this disease.
(B) Interferons play an important role during
viral infection. Write their role. 2
(B) Specify the main objective of
establishment of IUCN. Also mention the
5. (A) What will happen if oxygen availability is

reduced to activated sludge flocs?

year in which it was established. 2
(B) Who is responsible for the development
2. Given below is the picture of a hummingbird, of technology of biogas production in
which is known for its unique wings as it can India? 2
fly backwards. Why polar region is not a
suitable habitat for hummingbirds? 6. (A) Name any two genetically engineered

vaccines.
(B) Which antibody is produced in response
to allergy in our body?
OR
Give one similarity and one difference
between morphine and heroin. 2
Sample Paper 5 61
SECTION - B
7. (A) Why the species diversity of animals

9. There has been an alarming situation
which is around 72%, is much more than globally about the gradually increasing
the species diversity of plants which is average global temperatures in the recent
only 22%? years. If this situation continues, would you
(B) Certain regions have very high levels expect the distributional range of some
of species richness and high degree of species to be affected? If yes, how? Explain.
endemism. What is the name given to OR
such regions?
3 Write any three features of animals that
8. (A) Rahul while working in a company help them to survive in water scarce
environment. 3

dealing with production of proteins in

bioreactors, forgot to add antibiotic to 10. In order to clean rivers, Government has
the medium in a bioreactor in which the initiated several plans such as Ganga
recombinant bacterium was growing. Action Plan and Yamuna Action Plan. Which
What would happen? Ministry of Government had initiated these
motor turning plans? What are the objectives of these
the paddles
air out
plans? 3
11. (A) Rishabh wants to separate DNA fragments

cooling jacket
according to their size. Which technique he
paddle wheel
should use?
(B) List the two core techniques of modern
biotechnology. 3
temperature
recorder
12. (A) All human beings do not suffer from

cooling cancer diseases although every

water in
individual have cellular oncogenes. Give
reason.
AIR air supply
tap FILTER
(B) How cancerous cells are different from
(B) Why ‘plasmid’ is regarded as an important

the normal cells? 3
tool in genetic engineering? 3
SECTION - C
13. Gene manipulation is a fast-emerging science immune system to function properly.

that started with development of recombinant Name the enzyme whose deficiency
DNA molecule. It is also known as genetic is responsible for the disease. By
engineering. This technology which basically which technique it can be cured?
involves cutting and ligating of desired DNA (ii) Write any two advantages of

fragments, is based on two important discoveries genetically modified crops.

in bacteria. One of them is the plasmid in bacteria (B) Name two more methods that are used
and the other is restriction endonucleases. The to treat the disease of the five-year-old
birth of recombinant DNA technology occurred boy.
when Cohen and Boyer (1973) successfully
OR
introduced a piece of gene containing foreign
DNA into plasmid of E. coli. The teacher was comparing the conventional
crops with transgenic crops and presented
the picture shown below which depicts the
follow:
advantages of a genetically modified corn over
(A) (i) A five-year-old boy was found to be

a conventionally grown corn.

deficient in his immune system since
birth. His family was told that this
follow:
was due to an enzyme deficiency
which is very important for the

Conventional Corn Genetically Modified Corn (A) In transgenics, which gene determines
the expression of transgene in target
tissue?
(B) Give one major concern regarding the
production of genetically modified crops.
(C) Name any one genetically modified
crop apart from corn and its genetically
conferred trait.
(D) List any two advantages of producing
genetically modified crops with respect to
farmers. 5
Sample Paper 5 63
SOLUTION
SAMPLE PAPER - 5
SECTION - A
1. (A) The animals that have become recently
extinct are:
Related Theory
 Wine and beer are filtered, pasteurized and bottled
(i) Quagga (Africa) without distillation whereas whisky, brandy and rum
(ii) Thylacine (Australia) are produced by distillation of the fermented broth.
(iii) Steller’s Sea Cow (Russia) (Any two) The alcoholic content of beer is 3-6% and in wines,
it is around 9-12% whereas the alcoholic content of
(B) The main aim of IUCN is to maintain a brandy is 35-60%, whisky is 40-50% and that of rum
complete record of every species that is 40%.
ever lived and it works in the field of
(B) The organism that is commercially used
nature conservation and sustainable use
for the production of single cell protein is
of natural resources. It was established in
Spirulina.
1948.
4. (A) The vector for Dengue fever is Aedes
Related Theory aegypti mosquito.
 IUCN stands for International Union for Conservation
of Nature. The headquarter of IUCN is in Switzerland. Related Theory
 The causative agent of the Dengue fever is Flavivirus.
2. The polar region is not a suitable habitat for The symptoms of this disease include high fever,
hummingbirds because in small animals like severe headache, joint pain, nausea and vomiting.
hummingbirds, they have a larger surface area
(B) Interferons are glycoprotein released by
relative to their volume, therefore, they tend
virus-infected cells. The non-infected cells
to lose body heat very fast when the outside
are protected from further viral infection by
temperature is cold. This means, they have to
these interferons.
expend much energy to generate body heat
through metabolism. This is why very small 5. (A) If oxygen availability is reduced it will
animals are rarely found in polar regions. cause center of the flocs to become anoxic
OR (oxygen deficient) that will result in the
death of bacteria and fungi and eventually
Phytophagous insects are those insects that
it leads to the breakage of flocs.
generally feed on plant sap and other parts of
green plants. They include species that attack (B) The efforts made by Indian Agricultural
roots, stems, leaves, flowers, and fruits, either Research Institute (IARI) and Khadi and
as larvae or as adults or in both stages. Village Industries Commission (KVIC) led
to the development of the technology of
Example: Beetles, moths, grasshoppers
biogas production in India.
Related Theory 6. (A) Two genetically engineered vaccines are:
 Some insects are leaf feeders, that are either external 1. Hepatitis B vaccine

or they may mine the tissues. “Phytophagous” is 2. Herpes vaccine

often synonymous with “herbivorous,” although the (B) The antibody that is produced in response
herbivores are sometimes restricted to those species
to allergy in our body is IgE.
feeding on herbs. Phytophagous can be grouped
as monophagous (using only one plant genus or OR
species), oligophagous (use plants within a family), Similarity: Both morphine and heroin are
polyphagous (use plants in many plant families). extracted from the latex of plant Papaver
3. (A) Distillation is the process of separating somniferum.
alcohol from water by the process of Difference: Morphine is an effective sedative
evaporation and condensation. It is and painkiller while heroin acts as depressant
performed to increase the alcoholic content and slows down body functions.
of alcoholic drinks.
Related Theory
 Heroin is obtained from diacetylation of Morphine.

SECTION - B
7. (A) Species diversity of plants less than that of (i) On earth, life is not possible without water
animals because of the following reasons: and life originated in water only. Also, the
(i) The animals adapt themselves to ensure plants productivity and distribution are very
much dependent on water. Plants require

their survival in changing environments.

For example: Most animals possess water and sunlight as a source of energy to
simple or complex nervous system prepare food through photosynthesis.
to control and coordinate various (ii) Many animals use diurnal and seasonal
activities. Since insects possess variations in light intensities and duration
repeated body segments with external (photoperiod) as cues for timing their
cuticles and paired appendages, they foraging, reproductive and migratory
have developed a potential to survive activities.
in different habitats.
(iii) Water holding capacity of soils is
(ii) Plants being immobile as compared

determined by soil composition and grain

to animals that can move around,
size. Also, the type of vegetation which
have less adaptations as they are not
will grow in a particular type of soil
exposed to different habitats.
depends on its pH, mineral composition
(B) The regions having high levels of species and topography and indirectly it dictates
richness and high degree of endemism are the type of animals that can be supported
called as biodiversity hotspots.
there.
Related Theory OR
 Endemism refers to species confined to that region Some features of animals which help them to
and not found anywhere else. survive in water scarce environment are:
8. (A) In a bioreactor, where recombinant bacteria (i) No sweating/uricotelic/deposition of fat in
are growing, the presence of antibiotics in subepidermal layer/burrowing nature/thick
the medium makes sure that the bacteria skin/ body covered with scales.
retain the plasmid containing the antibiotic (ii) Use of metabolically produced water.
resistant gene as well as the gene of interest. (iii) Mucous layer on the surface to reduce
Therefore, in the absence of antibiotic, the water loss by perspiration.
recombinant bacterium does not need to (iv) Various hormones in humans like ADH help
produce a gene, which can make it resistant reduce water loss. (Any three)
to antibiotic because the pressure will be
eliminated and thus the bacteria will not 10. The Ministry of Environment and Forests had
maintain the copy number of the plasmid. initiated Ganga Action Plan and Yamuna
Hence, the plasmid will be lost and also the Action Plan.
gene of interest, which will result in reduction The major objectives of these plans are:
of the quantity of the desired product. (i) To clean and save major rivers (Ganga and
(B) Plasmid is used to multiply or express Yamuna) of the country from pollution.
particular genes and act as vector to (ii) To improve the water quality by interception,
transfer piece of foreign DNA attached to diversion and treatment of domestic sewage
them. and present toxic and industrial chemical
wastes from identified grossly polluting units
Related Theory entering in to the river.
 Plasmid is defined as an autonomously replicating (iii) To set up a greater number of sewage
circular extra-chromosomal DNA present in some
bacteria. treatment plants.
9. The geographical distribution of different Related Theory

species is largely dependent on their levels Ganga action plan came into force in 1985 whereas

of thermal tolerance, water, light and soil. In Yamuna action plan was launched in 1993.
recent years the average global temperature is
gradually increasing, which is a matter of great
11. (A) The technique which Rishabh should use to
separate DNA fragments according to their
concern. If this continues, the distributional
size is gel electrophoresis.
range of some species would be affected
because increasing global temperature leads (B) Modern biotechnology consists of two core
to excessive heat, drought, soil erosion, etc. techniques, which are:
Following points show how the plants and
animals and abiotic factors are interdependent:
Sample Paper 5 65
(i) Genetic engineering: It refers to the field
these proto-oncogenes get activated and
of biotechnology that involves the use lead to oncogenic transformation of cells,
of techniques to modify the chemical thus, causing cancer. This activation is
nature of genetic material (DNA and brought about by carcinogens which can
RNA). This includes the introduction be physical, chemical or biological.
of the genetic material into another
organism (host), in order to change the Related Theory
phenotype of the host organism.  The chemical carcinogens present in tobacco smoke
(ii) Bioprocess engineering: These methods

have been identified as a major cause of lung cancer.
involve maintenance of sterile environment (B) In normal cells of human body, the cell
i.e., microbial contamination-free in growth and differentiation is a highly
chemical engineering processes to enable controlled and regulated process. But in
growth of only the desired microbe/ cancerous cells, there is a breakdown of
eukaryotic cell. This results in production these regulatory mechanisms. Normal
of microbes/cells in large quantities for the cells also shows the property of contact
manufacture of biotechnological products inhibition because of which contact with
like antibiotics, vaccines, enzymes, etc. other cells inhibits their uncontrolled
12. (A) Every human being has cellular oncogenes growth, whereas cancerous cells have lost
or proto-oncogenes. These code for certain this property. As a result, the cancerous
growth factors. But under certain conditions, cells divide continuously to give rise to
masses of cells called tumour or neoplasm.
SECTION - C
13. (A) (i) The enzyme whose deficiency is
(ii) Difficulty of preserving the identity of

responsible for the disease is Adenosine non-GM crops

deaminase. It can be cured by the (iii) Harm to other organisms (Any one)
technique of gene therapy.
(ii) Two advantages of genetically modified

Related Theory
crops are:  Gene movement from crop to weed through pollen
• GM crops are tolerant to stresses transfer has been seen for GM crops when the crop is
grown near a closely related weed species. Similarly,

such as heat, cold, drought.

insects developed a resistance to pesticides.
• GM crops are pest resistant, thus

Potential cross-pollination of GM seeds onto non-

reduce the use of pesticides. GM crops is also a concern to farmers
Example: Bt cotton A study showed that a gene contained within Bt corn
can be harmful to the larvae of a monarch butterfly.

(B) Two methods that are used to treat

adenosine deaminase deficiency besides (C)
gene therapy are: Genetically Genetically conferred trait
(i) Bone marrow transplantation modified crop
(ii) Enzyme replacement therapy Soyabean Herbicide tolerance
OR Canola Altered fatty acid
(A) A reporter gene is used to determine composition
whether the recombinant DNA has been
Plum Virus resistance
successfully introduced into a cell or not.
(Any one)
Related Theory
 Reporters are used as indicators to study gene (D) The advantages are as follows:

expression. A transgenic organism contains a (i) Increased crop yields

gene introduced by one or the other technique of
(ii) Diminished use of pesticides and
transfection in its genome. This introduced gene with

the help of transfection is called transgene.

herbicides.
(B) (i) Development of resistant weeds and

(iii) Increased profits earned by farmers.
insects (Any two)

6
TERM-2
SAMPLE PAPER
SOLVED
BIOLOGY
SECTION - A
1. Given below is the picture of a transgenic

crop – Bt cotton. It is an insect resistant
variety. In these plants, a gene is
incorporated which produces a toxic protein
that kills the insects. Name the toxic protein
and source organism. What type of changes
occur in the gut of insects on consuming this
protein? 2
OR
How the limitation of traditional hybridisation
process was overcome by the use of technique
of genetic engineering? 2
3. Why did the Indian Parliament clear the
2. The following picture shows the apparatus second amendment of the Indian patents
involved in the process of gel electrophoresis. bill?
In the technique of gel electrophoresis, which
OR
material is used as matrix? Also mention its
role. List any two advantages of using a
biopesticide. 2
4. Calculate the death rate for the week, in
which 5 individuals died in a week in the
laboratory population of 100 individuals. 2
Sample Paper 6 67
5. (A) What is the application of genetically 6. (A) What is the ill-effect of excessive use of

engineered bacterium Pseudomonas antibiotics?

Putida? (B) Who coined the term “Antibiotics”? 2
(B) What is the role of C-peptide in human
insulin? 2
SECTION - B
7. A lab technician runs a PCR machine for 9. (A) What do you mean by BOD Test? When

years by simply making use of the samples is this test performed during sewage
and components available to him. But he is treatment?
not having knowledge of all the components. (B) Three samples of water are taken, their

Enlist the basic components of a Polymerase BOD was measured and found to be
Chain Reaction (PCR) to make him understand 40 mg/L, 10 mg/L and 600 mg/L. Which
the process in a better way? 3 sample of water is most polluted? 3
8. (A) A famous example of mutualism is

10. Name the following:

between pollinating species of wasps (A) A drug used for helping patients cope
with specific fig plants. What are with mental illness like depression but
the benefits that the female wasps often misuse.
derive from the fig trees from such an
(B) Plant source of the drug popularly called
interaction?
“smack.”
(C) Protozoan parasite that causes amoebic
dysentery in humans. 3
11. Enlist the benefits that are demonstrated by
plants with mycorrhizal association.
OR
How biofertilisers are responsible for
(B) Why predators are termed as ‘prudent’
increasing the fertility of soil? 3
in nature? 3 12. A doctor always advice his/her patients to
maintain good health by practicing certain
good habits. List any three of them. 3
SECTION - C
13. The teacher showed a picture depicting a wildlife (A) There is a region in Biosphere Reserve
sanctuary and explained that a sanctuary which is legally protected and where no
is a place where wild animal and plants are human activity is allowed. What is that
protected in their natural surroundings. The region called as?
activities such as collection of forest products, (B) Which is the first wildlife Sanctuary in
harvesting of timber, private ownership of land is India?
allowed here.
(C) In which year the Indian Board for
Based on this answer the following questions: Wildlife constituted?
(D) Define the following with respect to
Biosphere reserve:
(i) Buffer zone
(ii) Transition zone
OR
Alien species or non-native species are often
introduced deliberately into a habitat for their
economic and other uses. They often become
invasive and drive away local species. Exotic

species have proved harmful for both aquatic (A) (i) Define invasive species.
and terrestrial ecosystem. The following (ii) Name one invasive species introduced

picture shows an invasive plant – water in India apart from water hyacinth.
hyacinth (Eichhornia crassipes) that was (iii) What do you mean by an endemic
introduced in India because of its beautiful

species?
flowers and shapes of leaves. But it clogged
(B) Mention any two ways in which an
many waterbodies resulting in death of
invasive species affects an ecosystem. 5
aquatic plants and animals.
Based on this answer the following questions:
Sample Paper 6 69
SOLUTION
SAMPLE PAPER - 6
SECTION - A
1. The bacterium Bacillus thuringiensis produces 4. Death rate is the number of deaths in a
the toxic protein called as ‘cry protein’ which particular area in a particular time period per
is lethal to certain insects. This protein is 1000 individuals.
formed in an inactive form called as protoxin. It is calculated by:
Prototoxin becomes active toxin inside the gut
of the insects due to its alkaline pH. Activated Total number of death
Death rate = × 1000
toxin bind to surface of midgut epithelial cells Total population
and cause perforation, swelling, lysis of cells 5
which ultimately leading to death of the insect. = × 1000
100

2. Agarose is the most commonly used matrix. = 50 individuals per 1000 individuals
The basis of gel electrophoresis is that the

per week.
DNA fragments separate (resolve) according

to their size through sieving effect provided Therefore, the death rate is 5% per week.
by the agarose gel. Therefore, the smaller the
fragment size, the farther it moves. Related Theory
 Death rate can be defined as the number of
Related Theory individuals that are lost per unit of population
per unit time due to different reasons like death,
 Agarose is a natural polymer extracted from sea
certain environmental changes such as competition,
weeds.
predation.
OR
5. (A) Pseudomonas putida is capable of digesting
The limitation of traditional hybridisation process

hydrocarbons of crude oil, thus are used for

was overcome by the use of techniques of scavenging oil spills.
genetic engineering, including:
(B) C-peptide is present in immature form
(i) Creation of recombinant DNA. of insulin (pro-hormone/pro-insulin). It
(ii) Use of gene cloning and gene transfer. serves as a linker between the A- and
This allows isolation and introduction of the B- chains of insulin and facilitates the
only one or a set of desirable genes without efficient assembly, and folding of insulin
introducing undesirable genes into the target in the endoplasmic reticulum of beta cells
organism. of the pancreas. But, this C-peptide gets
3. The Indian Parliament cleared the second removed during maturation of insulin.
amendment of the Indian Patents Bill which 6. (A) Excessive use of antibiotics can lead to
takes some issues into consideration, including infection or colonization with resistant
biopiracy, patent terms, emergency provisions pathogens. consuming antibiotics unnecessarily
and research and development initiative. The for viral infection is common and thus lead
amendment of this bill has empowered India to increasing rates of antibiotic resistance
to prevent unauthorized exploitation of their among Streptococcus pneumoniae and other
bio-resources and traditional knowledge by commonly infecting pathogens.
other countries.
OR Related Theory
 The factors that cause overuse of antibiotics are past
The advantages of using a biopesticide are:
experience, patient’s expectations, lack of education
(i) With the use of biopesticide, there is great and economic incentives.
reduction in the use of agrochemicals
(B) The term ‘antibiotics’ was given by Selman
which are responsible for pollution, thus
Waksman (1942).
biopesticides are eco-friendly.
(ii) They serve as a permanent control of pests
by having a long persisting effect. Also,
they leave no toxic residue.

SECTION - B
7. Basic components of PCR are as follows:
Related Theory
(i) DNA template – It is the double-stranded
 Measuring of Biochemical Oxygen Demand test was
DNA that needs to be amplified. given by Sawyer and McCarty in the year 1978.
(ii) Primers – These are chemically synthesised
oligonucleotides (short segment of DNA) Caution
that are complementary to the regions of  Many students get confused with the term BOD,
DNA template. and think it as the amount of oxygen required by
organisms. It actually refers to the amount of oxygen
(iii) Taq Polymerase – This enzyme is isolated
consumed by bacteria during oxidation of organic
from a thermophilic bacterium – Thermus matter in 1 liter of water.
aquaticus, having the property of
remaining active even at high temperature 10. (A) Heroin

during the denaturation of double stranded (B) Papaver somniferum

DNA. It is a DNA polymerase that helps in (C) Entamoeba histolytica
the amplification of a segment of DNA. 11. Plants with mycorrhizal association demonstrate
(iv) Nucleotide bases – These are utilized or benefits such as:
added by DNA polymerase to the growing (i) Resistance to root-borne pathogens.
chain.
(ii) Tolerance to salinity and drought.
8. (A) The female wasp is benefited by using (iii) Overall increase in plant growth and
the fruit as an oviposition (egg-laying)
development.
site and also uses some of its developing
seeds within the fruit for nourishing its OR
larvae. In return, the wasp pollinates the fig A biofertilizer can be defined as a fertiliser that
inflorescence while searching for suitable is made up of living microorganisms.
egg-laying sites. It promotes plant growth when applied to the
(B) There is a possibility of prey becoming field, by increasing the supply or availability of
extinct, if a predator is too efficient primary nutrients to the host plant. Therefore,
and over exploits its prey and as a this helps in increasing the fertility of the
consequence the predator will also soil. The main sources of biofertilisers are
become extinct due to lack of food. several species of bacteria and cyanobacteria
This is why the predators eat the prey which have the ability to fix free atmospheric
population in a manner that the prey nitrogen into organic compounds and making
conlinus to survive and is not over it available to plants to be used as a nutrient.
exploited. Just because of this reason, Another is one fungi which form symbiotic
predators eat the prey population in a associations with plants, known as mycorrhiza.
manner that the prey continues to survive In such associations, the fungal symbiont
and is not over exploited. Just because absorbs phosphorus from soil and transfers it
of this reason predators are ‘prudent’ in
to the plant. This promotes plant growth.
nature.
One of the major advantages of biofertilizers
9. (A) Biochemical
Oxygen Demand (BOD) is that they are eco-friendly and cost-effective.
test refers to a bioassay procedure that
measures the oxygen consumed by bacteria 12. Good health can be achieved and maintained
from the decomposition of organic matter by:
over a period of five days at an incubation (1) Intake of balanced diet, keeping personal
temperature of 20°C. BOD is expressed hygiene and doing regular exercise.
in milligrams per litre of sample water.
(2) Performing regular yoga to achieve
Biochemical Oxygen Demand is used in
physical and mental health.
secondary sewage treatment or biological
sewage treatment. (3) Being aware about diseases and their
(B) The BOD level and oxygen content are effect on different bodily functions.
inversely related to each other, thus when (4) Getting vaccination or immunization
BOD levels are high, dissolved oxygen against infectious diseases.
levels decrease because the oxygen (5) Disposing of wastes properly, controlling
present in the water is consumed by the vectors and maintaining hygiene in food
bacteria. Therefore, higher the BOD higher
and water resources.
the water is polluted.
(Any three of the above)
As a result, the sample with BOD value of
600 mg/L is highly polluted water.
Sample Paper 6 71
SECTION - C
13. (A) The region in Biosphere Reserve which is OR
legally protected and where no human (A) (i) The alien species that is unintentionally

activity is allowedis called a Core zone. or deliberately introduced for different

(B) The first Wildlife Sanctuary in India is purposes, turn invasive, and cause
Manas National Park or Manas Wildlife decline or extinction of indigenous
Sanctuary. species.
(C) Indian Board for Wildlife was constituted in (ii) The invasive weed species carrot grass

1952. (Parthenium) or Lantana camara was

Explanation: The main purpose of the introduced in India that led to the
board was to advise the Government on environmental damage and posed a
the means of conservation and protection threat to our native species.
of wildlife, construction of national parks, (iii) An endemic species refers to a species

sanctuaries and zoological gardens as well that is native to where it is found.

as promoting public awareness regarding (B) Invasive species can be a major cause
conservation of wildlife. of biodiversity loss in an ecosystem.
(D) (i) Buffer zone may accommodate
Invasive species competes with the native
education, training, tourism and species for resources and therefore lead
recreation, an area with limited human to extinction of native species. They can
interference. reduce biodiversity and alter the food web
(ii) Transition zone is the large outer area

and habitats.
of a reserve where people live and
work, using the natural resources of the
area in a sustainable manner.

7
TERM-2
SAMPLE PAPER
SOLVED
BIOLOGY
SECTION - A
1. (A) Why does a person shivers considerably

4. During sewage treatment, list the events
while suffering from malaria? that lead to a significant reduction in
(B) Who established that the malarial Biochemical Oxygen Demand (BOD) of a
parasite is transmitted by the bite of a primary effluent. 2
female Anopheles mosquito?
5. How the technique of PCR serves as an
OR important tool for early diagnosis of an
Why intake of cannabinoids is banned in infectious disease? 2
sports and games? 2
6. The following picture depicts an insect
2. Write any two benefits that Lactic Acid that closely resembles a leaf. What is this
Bacteria (LAB) provides. 2 phenomenon called as? How does this
phenomenon help an insect?
3. Roma was confused after hearing about
red data book which is shown in the picture
below. She thinks it to be a storybook. To
clear her confusion, explain briefly what do
we mean by red data book. When and who
initiated the red data book? 2
OR
Give the difference between the two main
branches of ecology. 2
Sample Paper 7 73
SECTION - B
7. (A) The following microbes share a common

served as a cure but it was not a permanent
characteristic. List that characteristic. cure. Why? Suggest a possible permanent
Aspergillus niger, Clostridium butylicum cure. 3
and Lactobacillus.
10. Water is used by every cell of our body and
(B) Why in the treatment of waste water rich

thus it is very essential for life. List any three

in organic matter, aerobic degradation features of plants that help them to survive
is more important than anaerobic in water scarce environment. 3
degradation? 3
11. It is observed that tropical regions have
8. (A) It is very essential to make host cells

greater biodiversity as compared to

competent so that they can take up the temperate regions. Briefly explain the
desired DNA. Describe the two physical reasons responsible for it.
methods of making the cells competent
OR
for transformation with recombinant
DNA. How does the loss of biodiversity in a
particular region affect that region? 3
(B) Expand – cDNA and Bt. 3
12. Describe the structure and the process of
9. The introduction of genetically engineered
activation of human insulin with the help of
lymphocytes into an ADA deficiency patient
a well labelled diagram. 3
SECTION - C
13. Any individual can suffer from cancer, although OR

the risk goes up with age. But the risk depends A 34-year-old woman showed the symptoms
on factors such as smoke, lifestyle choices such of sudden onset of fever, crippling joint pains,
as eating habits, frequency of exercise, family lymphadenopathy. The following picture shows
history of cancer, etc. Given below is a picture one of the symptoms of the disease.
showing a comparison between a normal cell Based on the following picture and description
and a cancerous cell. answer the following questions:
Normal Cells Cancer Cells
(A) Based on the above mentioned

symptoms, name the disease. How can
(A) Define cancer. this disease be prevented?
(B) Give the difference between benign (B) List two ways by which vector-borne
tumours and malignant tumours. diseases can be prevented.
(C) Write about any two diagnostic (C) What are pathogens? How do they enter
techniques to detect cancer. our body? 5

SOLUTION
SAMPLE PAPER - 7
SECTION - A
1. (A) The parasites (sporozoites) infect RBCs and 4. The primary effluent produced during primary
rupture them which results in the release of treatment is passed into large aeration tanks,
a toxic substance called as haemozoin. This where it is constantly agitated mechanically
toxin is responsible for the chill (shivering) and air is pumped into it. This leads to vigorous
and high fever recurring every three to four growth of useful aerobic microbes into flocs.
days in malaria. The organic matter in the effluent is consumed
(B) Sir Ronald Ross. by these microbes, thereby, decreasing BOD
(Biochemical Oxygen Demand) of the effluent.
Related Theory
Sir Ronald Ross of the Indian Medical Service,
Related Theory

established on 29th August, 1897 that malarial  Flocs are masses of bacteria associated with fungal
parasite is transmitted by the bite of a female filaments to form mesh like structures. During their
Anopheles mosquito. growth, the major part of the organic matter in
the effluent is consumed by these microbes and
OR converted into microbial biomass. As a result, the
The intake of cannabinoids is banned in sports BOD (Biochemical Oxygen Demand) of the effluent
and games because sportspersons misuse is significantly reduced.
these drugs to enhance their performance. In 5. The technique of PCR, i.e., Polymerase chain
order to increase muscle strength and bulk and reaction is very effective and thus it enables
to promote aggressiveness, the sportspersons the specific amplification of the desired DNA
misuse narcotic analgesics, anabolic steroids, from a limited amount of DNA template.
diuretics and certain hormones in sports, Therefore, it can detect the presence of an
that leads to an increase in their athletic infectious organism in the infected patient at
performance. This can negatively affect their an early stage of infection, even before the
general health and in long run can hamper the infectious organism has multiplied to a large
normal functioning of organ systems. number.
2. The two benefits of Lactic Acid Bacteria (LAB)
are: Related Theory
(i) LAB increases the nutritional quality of  Technique of PCR is routinely used to detect HIV in
suspected AIDS patients and also used to detect
curd by increasing the amount of Vitamin
mutations in genes in suspected cancer patients.
B12.
(ii) It checks the growth of disease-causing
6. This phenomenon is called as camouflage.
Camouflage or cryptic colouration is a type of
organisms in the gut.
defense mechanism that gives the organisms
3. A Red Data Book is a document that keeps a like insect, the ability to blend or merge with
record of all the rare and endangered species the surroundings or background. This helps
of animals, plants and fungi. IUCN red list of them to conceal their presence or identity in
threatened species is an inventory of global order to avoid being detected easily by the
conservation status of biological species, which predator or to deceive their prey.
is compiled in Red Data Book.
OR
IUCN established the Red Data Book to
The two main branches of ecology are
safeguard the rare species of flora and fauna
autecology and synecology and the difference
on Earth, so as to prevent their extinction and
between them are:
it was initiated in 1964.
Autecology Synecology
Related Theory
 Red Data Book has its origins from Russia. But at the It is the study of It is the study of
present time, the International Union for Conservation individual organism group of organisms of
of Nature (IUCN) maintains the Red Data Book. The or individual species. different species in a
IUCN was founded in 1948 with an aim to maintain It is also known as community. It is also
a complete record of every species that ever lived population ecology. known as community
and it works in the field of nature conservation and ecology.
sustainable use of natural resources.
Sample Paper 7 75
SECTION - B
7. (A) The common characteristic of the microbes
from the marrow cells and to introduce them
Aspergillus niger, Clostridium butylicum into the cells at early embryonic stages. The
and Lactobacillus is that they all produce lymphocytes of bone marrow then contain
organic acids as a part of their metabolism the functional ADA gene and reactivate the
and thus are useful for commercial and patient’s immune system.
industrial production.
Related Theory
Related Theory  Adenosine deaminase deficiency is an autosomal
 Aspergillus niger (a fungus) produces citric acid, recessive metabolic disorder that causes immuno
Clostridium butylicum (a bacterium) produces deficiency.
butyric acid and Lactobacillus (a bacterium) 10. The features of plants that help them to survive
produces lactic acid. in water scarce environment are:
(B) The aerobic heterotrophic bacteria (i) They have a thick cuticle on their leaf
bring aerobic degradation of sewage. surfaces and have sunken stomata
During their vigorous growth, the aerobic (arranged in deep pits) to minimize water
microbes consume a major part of the loss through transpiration.
organic matter and thus reduce the
(ii) They follow a special photosynthetic
BOD significantly. Therefore, aerobic
pathway known as Crassulacean Acid
degradation is more important.
Metabolism (CAM) that enables their
Whereas anaerobic degradation is done stomata to remain closed during day time.
after the aerobic degradation (where This also minimize water loss through
the BOD is already pulled down below a transpiration.
threshold level). In anaerobic degradation, (iii) Absence of leaves in some desert plants
only the bacteria and fungi (present in the like Opuntia in which the leaves are
flocs) in the activated sludge are digested reduced to spines to reduce water loss and
and anaerobic bacteria produce a mixture the photosynthetic function is taken over
of gases such as methane, hydrogen by the flattened stems. The stem is green,
sulphide and carbon dioxide. Therefore, it is succulent and fleshy.
less important.
(iv) The roots of these plants grow very deep in
8. (A) The two different physical methods for search of available underground water.
making the cells competent are: (Any three)
(i) Micro-injection: In this method the 11. The tropical regions have greater biodiversity
recombinant DNA is directly injected as compared to temperate regions because of
into the nucleus of an animal cell. the following reasons:
(ii) Biolistics or gene gun: This method (i) Speciation is generally a function of time.
includes physical introduction of foreign The temperate regions were subjected to
DNA in cells and is suitable for plants. frequent glaciations in the past whereas
In this method the cells are bombarded the tropical latitudes remained relatively
with high velocity micro-particles of undisturbed for millions of years and
gold or tungsten coated with DNA. therefore the tropics got a long evolutionary
(B) cDNA – Complementary DNA, Bt – Bacillus time for species diversification.
thuringiensis. (ii) The Tropical environments are less seasonal
9. Genetically engineered lymphocytes are as compared to temperate environments
created by taking lymphocytes from the blood and are relatively more constant and
of ADA deficient patients and grown in a predictable. Therefore, niche specialization
culture. With the help of a retroviral vector, a is promoted in such constant environments
functional ADA cDNA is then introduced into which lead to a greater species diversity.
the lymphocytes. Then these lymphocytes (iii) More amount of solar energy is available
are returned to the patients. Most of the in the tropics which contributes to higher
lymphocytes are short lived having an average productivity and thus lead to greater
lifespan of a week to a few months. Since diversity.
lymphocytes are not immortal, therefore, (iv) The resource availability is higher and rate
the patients require periodic infusion of of extinction is low in tropics.
such genetically engineered lymphocytes. A
OR
permanent cure of ADA deficiency is to isolate
a normal functioning gene producing ADA Loss of biodiversity in a region may lead to:

(i) Decline in plant production.
Proinsulin
(ii) Lowered resistance to environmental
S—S
disturbances; like drought.
S
(iii) Increased variability in certain ecosystem S
S
processes, example - plant productivity, S
water use, etc.
A-peptide
12. Insulin consists of two short polypeptide S—S
chains, i.e., chain A and chain B, which are S S Insulin

linked together by disulfide bridges. S S
Insulin is synthesized as a pro-hormone in + B-peptide

mammals including humans. It contains an
extra stretch called the C peptide. The C peptide Free C- peptide
is absent in mature insulin and therefore it is Maturation of Proinsulin into
removed during maturation into insulin. insulin (simpli ed)
Related Theory
 Pro-hormone is the form of hormone which needs to
be processed before it becomes a fully mature and
functional hormone.
SECTION - C
13. (A) Cancer is a disease that is characterised
(v) Monoclonal
antibodies are the
by uncontrolled division of cells in a part antibodies against cancer-specific
of body that spreads to other parts of the antigens that are used to detect certain
body through blood and lymph. cancers. (Any two)
(B) Benign tumours: These kinds of tumours OR
remain confined to their original location (A) Based on the mentioned symptoms,
and thus, do not spread to the other parts the disease's name is chikungunya. This
of the body. Such tumours cause little disease can be prevented by elimination of
damage. mosquitoes and their eggs.
Malignant tumours: These tumours are (B) Vector-borne diseases can be prevented
a mass of proliferating cells called as by:
neoplastic or tumour cells. These cells • avoiding stagnation of water in and
invade and damage the surrounding

around residential areas.

normal tissues/cells by growing very
• regular cleaning of household coolers.
rapidly.

• use of mosquito nets.

(C) Cancer can be detected by the following
methods: • introducing fishes like Gambusia in

ponds that feed on mosquito larvae

(i) Biopsy: In this method a piece of
• spraying of insecticides in ditches,

the suspected tissue is cut into thin
sections and then it is stained and drainage areas and swamps, etc.
examined under microscope by a • doors and windows should be provided

pathologist. Such a study is termed as with wire mesh to prevent the entry of
histopathological study. mosquitoes.
(ii) Radiography involves the use of X-rays
(Any two)
to detect cancer of the internal organs. (C) Pathogens are defined as the disease-
(iii) Computed tomography (CT) uses
causing organisms. These include bacteria,
X-rays to generate a three-dimensional viruses, fungi, protozoans, helminths, etc.
image of the internal tissue. The pathogens enter our body through
(iv) Magnetic Resonance Imaging (MRI) different means such as air, water, soil,
food, etc., and start multiplying and

uses strong magnetic fields and non-

ionising radiations to accurately detect interfering with our normal vital activities.
pathological and physiological changes
in the living tissue.
Sample Paper 7 77
8
TERM-2
SAMPLE PAPER
SOLVED
BIOLOGY
SECTION - A
1. (A) It is always advised that breast feeding

is best for the new born as breast fed Sea otter absent
babies tend to be more immune than the
Sea otter
bottle-fed babies. Why? (keystone species) Kelp
(B) What do you mean by anamnestic

response? 2
Overgrazed
2. (A) Anshika’s mother explained her the

kelp
formation of bread by showing the Sea

following pictures of the rising of the urchin Explosion of
sea urchin
dough. Which microorganism is used for population
fermenting the dough in the making of Removal of the keystone sea otter : sea urchins overgraze kelp
bread? and destroy the kelp forest community
4. People usually discriminate individuals

suffering from AIDS due to certain
misconceptions and finally it leads to social
boycott of such individuals. Do you think this
is ethically correct? If not, why? Suggest one
preventive measure for the disease. 2
5. Describe the chemical method of making
cells competent for transformation with
(B) What do you mean by toddy? recombinant DNA.
OR OR
Mention the role of baker’s yeast in the Which category of enzymes is termed as
production of bread. 2 ‘molecular glue’ and why? 2
3. The given picture shows a keystone species 6. During a visit to a national park, teacher
– sea otter along with other species like was explaining about ecological niche,
kelp and sea urchin. What do you mean habitat, etc., specify the difference between
by keystone species and what is its an ecological niche and habitat. 2
importance? 2

SECTION - B
7. (A) What do you mean by Bioconversion?

(B) Name two commonly used vectors in
rDNA technology.
(C) How many fragments will be produced
when a linear DNA and a plasmid DNA
having three restriction sites for EcoRI
are cut with the restriction enzyme? 3
8. There is always an increasing demand of
food supply in our country. A farmer has 10. Suresh was observing that in a field, insects
mainly three options to increase the food were not able to infect the plants, instead
production. List these three options. 3 insects were killed on eating the plants.
Explain the reason why it happened? Give
9. The following pictures show the symptoms
of some diseases such as sneezing in case
some examples of such crops. 3
of common cold and skin rash in case of 11. Which are the three types of age pyramids?
chikungunya. Write the mode of transmission Depict each of them with a diagram. 3
of infection for the following diseases: 3
(A) Common cold 12. Elaborate with the help of examples that
alien species are highly invasive and are a
(B) Chikungunya
threat to indigenous species.
(C) Ascariasis
OR
List any three consequences of the loss of
biodiversity? 3
SECTION - C
13. In order to spread awareness regarding People extensively use antibiotics for the
organic farming, students pasted the following treatment of several diseases. Komal know
posters inside and outside the school campus. that antibiotics are produced by microbes and
Based on this answer the following are very useful to treat many diseases.
questions: Based on this answer the following

questions:
GREENLEAF
VERMICOMPOSE CROP ROTATION
MANURES
ORGANIC
FARMING
MANURES
BIOLOGICAL
MANAGEMENT
BIO FERTILIZERS ANIMAL

HUSBANDRY
(A) (i) What is organic agriculture?

(ii) How do organic farmers manage

fertility?
(B) How are crop damage by insect pests (A) What are antibiotics?
managed on organic farms? (B) How does antibiotic resistance happen?
OR (C) What precautions must be taken while
taking antibiotics? List any two. 5
Sample Paper 8 79
SOLUTION
SAMPLE PAPER - 8
SECTION - A
1. (A) Mother’s milk especially the colostrum Preventive measures are as follows:
(yellowish fluid) secreted during initial days (i) Making blood (from blood banks) safe from
of lactation by the mother which contains HIV.
abundant antibodies (IgA) that gives (ii) Use of only disposable needles and
protection to the infant. These antibodies syringes in public and private hospitals and
are not available to the bottle-fed babies. clinics is ensured.
(iii) Condoms are distributed free of cost and
Related Theory safe sex is being advocated.
 When such ready-made antibodies are directly (iv) Controlling drug abuse.
given to an individual to protect the body against
(v) Promotion of regular check-ups for HIV in
foreign substances. Such kind of immunity is called
as passive immunity. This type of immunity is fast
susceptible populations. (Any one)
acting but it lasts for only few days/months. 5. In the chemical method or CaCl2 method, the
(B) The anamnestic response is also known as cells are treated with a specific concentration
of a divalent cation, such as calcium, that

secondary or booster immune response

that occurs due to second or subsequent increases the efficiency with which the DNA
encounter with the same pathogen. As enters through the pores present in the
compared to a primary immune response bacterial cell walls.
which is of low intensity, the secondary Recombinant DNA is then forced into such cells
response is highly intensified with a shorter by incumbating the cells with recombinant
lag period and greater production of DNA on ice first, and then they are given heat
antibodies and it lasts longer. shock by placing them at 42ºC for a short
2. (A) For making bread, the dough is fermented duration, and then putting them back on
using baker’s yeast, Saccharomyces ice. This enables the bacteria to take up the
cerevisiae. recombinant DNA.
(B) Toddy is a traditional drink of some OR
parts of southern India which is made by DNA ligases are termed as ‘molecular glue’
fermenting sap from palm trees, coconut, as they repair broken DNA by joining two
etc. nucleotides. It is used in rDNA technology
or genetic engineering to reverse the
OR action of restriction enzymes by joining the
Saccharomyces cerevisiae, also known as complementary DNA strands or ends together.
Baker’s yeast, is responsible for the alcoholic Example: T4 DNA Ligase.
fermentation of sugars in wheat flour, that 6. The difference between an ecological niche
produce ethanol and CO2. CO2 raises the bread and habitat is as follows:
when baked and makes it soft.
3. A keystone species is an organism which helps Niche Habitat
to define an entire ecosystem. It plays vital role It is defined as the It refers to a
in sustaining the community. The ecosystem particular area within specific space or
would be dramatically different or cease to a habitat or physical place wherein an
exist altogether, without its keystone species. space occupied by organism lives,
This means that if the species disappear from an organism. Niche grows, adapts and
the ecosystem, no other species would be able of an organism reproduces. Various
to fill its ecological niche. comprises of an abiotic factors like
Example: Sea otter is the keystone species and invariably defined temperature, sunlight,
in its absence the sea urchins overgraze kelp range of conditions rainfall, types of
and destroy the kelp forest community. that the organism soil, etc., determine
can tolerate, diversity the presence of
4. No, it is not ethically correct at all. Individual in the resources organisms present in
suffering from AIDS should not be discriminated it utilises and a an area.
as it is like any other disease. AIDS is not distinct physical and
contagious, i.e., it does not spread by shaking functional role in the
hand, talking or using common utensils. ecological system.

SECTION - B
7. (A) Bioconversion refers to the process by
Examples: Bt cotton, Bt corn, Bt rice, Bt tomato,
which organic materials such as plant or Bt potato and Bt soyabean, etc.
animal waste are converted to specific 11. The age pyramids can be classified into three
usable product by biological processes or categories:
microbial, activity.
(i) Expanding or growing
(B) The two commonly used vectors in rDNA
(ii) Stable
technology are Plasmid and Bacteriophage.
(iii) Declining
(C) Number of fragments produced in a linear
DNA are 4. Post-reproductive
Number of fragments produced in a
Reproductive
plasmid are 3. Pre-reproductive
8. To increase the food production there are Expanding Stable Declining
following three options:
(i) Agro-chemical based agriculture. Related Theory
(ii) Organic agriculture.  Age pyramid is formed when the age distribution i.e.,
per cent individuals of a given age or age group is
(iii) Genetically engineered crop-based agriculture.
plotted for the population.
9. The mode of transmission of infection for the 12. It has been seen for a long time that when
following diseases is as follows:
alien species are introduced unintentionally
Disease Mode of transmission or deliberately for any purpose, some of
them become invasive, and cause decline or
Common cold It spreads through droplets extinction of indigenous species.
resulting from cough or
Example:
sneezes of an infected
person (droplet infection) (i) In East Africa, introduction of the Nile
or through contaminated perch into Lake Victoria eventually led to
objects such as pens, the extinction of an ecologically unique
books, cups, doorknobs, assemblage of more than 200 species of
computer keyboard or cichlid fish in the lake.
mouse, etc. (ii) In India, the introduction of the invasive
Chikungunya It is transmitted by the weed species like carrot grass (Parthenium),
bite of Aedes aegypti Lantana and water hyacinth (Eicchornia)
mosquito. led to the environmental damage and
posed a threat to our native species.
Ascariasis Gets transmitted when a
healthy person consume (iii) The recent illegal introduction of the
water, vegetables, fruits, African catfish Clarias gariepinus for
etc., or get exposed to soil, aquaculture purposes is posing a threat to
water, plants, etc., that are the indigenous catfishes in Indian rivers.
contaminated with the OR
faecal matter of infected The consequences of loss of biodiversity:
persons contains eggs of
the parasite. (i) Declining biodiversity lowers the quality
of the ecosystem’s services which often
10. When the insects were not able to infect the include maintaining the soil, purifying
plants and were getting killed upon eating water that runs through it, and supplying
them is because of a reason that such plants food and shade, etc.
are genetically modified pest resistant plants
that produce a toxin that kills insects when (ii) Loss of biodiversity result in the extinction
they feed on them. of many species.
Bacillus thuringiensis (Bt) is a bacterium that (iii) Human beings are very much dependent
produce a toxin named Bt toxin. This toxin is on biodiversity for food and other
fatal for insects, therefore, Bt toxin gene has requirements, therefore, its loss will be
been cloned from the bacteria and expressed in hard-pressed for mankind.
plants to provide resistance to insects without
the need for insecticides. Thus, it is called as
biopesticide.
Sample Paper 8 81
SECTION - C
13. (A) (i) Organic agriculture is a system of
(B) On exposure to antibiotics, bacteria can
farming that mimics natural ecosystems. develop ways to escape their effects.
It balances pest and beneficial organism We should be careful about how we use
population and maintain and replenish antibiotics, because bacteria are able to
fertility of the soil. adapt. Using antibiotics when they are
(ii) Organic farmers manage fertility or

not necessary may cause them to become
crop nutrients through crop rotation, ineffective when they are really needed.
which includes application of plant and A person does not become resistant to
animal organic matter, generally in the an antibiotic, but the bacteria become
form of compost. Soil structure, organic resistant to treatment.
matter content and soil microbial life (C) The precautions that should be taken while
is improved by appropriate tillage and taking antibiotics are:
cultivation practices. (i) Antibiotics should be taken only when

(B) In organic farming crop damage by insect advised by a qualified doctor.

pests is prevented primarily through the (ii) A person must complete the full course

use of natural pesticides (mainly extracted of antibiotics as prescribed by doctor.

from plant or animal origins), biological (iii) Antibiotics should be taken in proper
and cultural practices such as crop rotation;

doses.
habitat management; beneficial organism
(iv) Antibiotics should not be taken
releases; sanitation; and timing.

unnecessarily as it can kill the useful

OR bacteria in the body.
(A) Antibiotics are the chemical substances
that are produced by some microbes
and can kill or retard the growth of other
(disease-causing) microbes.

9
TERM-2
SAMPLE PAPER
SOLVED
BIOLOGY
SECTION - A
1. What are the two factors on which the

species diversity of a region depends?
OR
An alien fish species is posing a threat to the
indigenous catfishes in our rivers. Name this
alien fish species. 2
2. (A) Name the pathogenic organism for the

following:
(i) Elephantiasis
(ii) Amoebiasis 6. The following beautiful picture shows
an association between two types of
(B) Which antibody is produced in response
organisms. Name the type of relationship
to allergy in our body? 2
and the organisms involved.
3. Write any two disadvantages of using
chemicals like insecticides, pesticides and
weedicides by farmers? 2
4. (A) Give an example of a disease in which

the body lose the ability to differentiate

between foreign particles and self-cells
and thus start attacking and destroying
self-cells. Also give the term used for
such diseases.
(B) Which primary lymphoid organ in birds
is considered equivalent to mammal’s
bone marrow? 2
5. In biology lecture, a teacher explained her OR
students about the effect of dengue fever on How the two organisms involved in
human body by showing the following picture. their association named as mycorrhizae
List any four characteristic features of dengue benefitted by their association? Also,
fever by which one can recognize it. 2 name the type of relationship among the
organisms. 2
Sample Paper 9 83
SECTION - B
7. List any three industrial enzymes produced yield of crops. Still, it is suggested to make
by microbes and their commercial uses. 3 less use of such agrochemicals. Give any
three disadvantages of using them. 3
8. The given picture shows the binding of DNA
probes to their complementary DNA. Probes 9. Write any three features of animals that
are made complementary to the gene of help them to survive in water scarce
interest so that they can bind and indicate environment. 3
the presence of the gene. Why the use of
probes considered better than conventional 10. Which two different categories of microbes
diagnostic tools for disease diagnosis? are present naturally in sewage water?
Describe their role in cleaning sewage water
3
DNA Denatured
sample ssDNA DNA probes into usable water.
gene of
interest 11. Nowadays it is said that we require another
green revolution, due to the current food
crisis. What were the major limitations of
the earlier green revolution? 3
OR 12. Broadly classify the extinction processes. 3
The use of agrochemicals like pesticides and
fertilisers has significantly increased the
SECTION - C
13. The following picture shows the action of Advik was confused about the desirable
restriction enzymes on DNA. properties of a cloning vector. His teacher
Based on the knowledge of rDNA technology explained him about the cloning vector with
answer the following questions: the help of the following picture.
Based on the information answer the
EcoRI
following questions:
Promoter
Multiple
IDNA fragments Cloning
Sticky end join at sticky ends Site (MCS)
PLASMID
Sticky end
Selectable
Market
Recombinant DNA Origin of Replication

(A) Name the enzymes that are used to (A) (i) Who discovered the cloning vector

cleave both plasmid and the host DNA. pBR322?

(B) In which year the first recombinant DNA (ii) Which microorganism was used to

molecule was synthesized? manufacture genetically engineered

(C) Expand ‘BAC’ and ‘YAC’. insulin?
(D) Who isolated and characterized the first (iii) Name the vectors that are designed

restriction enzyme – HindII and from to replicate in the cells of two

which organism it was isolated? different species.
OR (B) What is the difference between cloning
vectors and expression vectors? 5

SOLUTION
SAMPLE PAPER - 9
SECTION - A
1. The two factors on which the species diversity 4. (A) Example: Rheumatoid arthritis/Addison’s
depends are: disease/Hashimoto’s fabricius.
(i) Species richness: It is defined as the Such diseases are termed as Autoimmune
number of species present per unit area. diseases or disorders.
Therefore, if species richness is higher than (B) Bursa of fabricus.
the species diversity increases.
5. Following are the characteristic features of
(ii) Species evenness: It is defined as the
dengue fever:
relative abundance of species in an area.
Thus, the level of species diversity of an (i) Multiple rashes and wounds on the skin
ecosystem is determined by the number of (ii) Loss of appetite
individuals and variety. (iii) Diarrhoea and vomiting
OR (iv) Gum and nose bleedings
The alien fish species that is posing a threat (v) Severe joint and muscle pain
to the indigenous catfishes in our rivers is (vi) Fatigue, nausea, and vomiting
Clariasgariepinus (African catfish).
(vii) A sudden drop in blood pressure
2. (A) The pathogenic organism for the following (viii) Pain behind the eyes coupled with extreme
diseases are as follows:
headaches (Any four)
(i) Elephantiasis: Wuchereria bancrofti

6. This type of relationship is called as lichens.

and Wuchereria malayi (filarial worms).

Lichens represent a mutual relationship between
(ii) Amoebiasis: Entamoeba histolytica a fungus and photosynthesizing algae or
(B) The antibody that is produced in response cyanobacteria. The fungus helps in the absorption
to allergy in our body is IgE. of nutrients and provides protection, whereas the
3. The disadvantages associated with the use algae, being photosynthetic prepares the food.
of chemicals like insecticides, pesticides and OR
weedicides are: The mycorrhiza is an association between fungi
(i) They are toxic and extremely harmful to and roots of higher plants. Such a relationship is
human beings and animals. called as mutualism. In mycorrhizae, the fungi
(ii) Cause soil and groundwater pollution, help the plant in the absorption of essential
thereby polluting fruits, vegetables and nutrients from the soil while the plant provides
crop plants. food for the fungi.
SECTION - B
7. The different enzymes produced by microbes Enzyme Uses
and their uses is as follows:
Streptokinase It is used as a ‘clot buster’
Enzyme Uses for removing clots from the
blood vessels of patients who
Lipases Used in detergent
have undergone myocardial
formulations and are
infarction leading to heart
helpful in removing oily
attack.
stains from the laundry.
Pectinases Used for the clarification of

and Proteases bottled juices.
Sample Paper 9 85
8. Probes are considered to be better than 10. Bacteria and fungi are the two naturally
conventional diagnostic tools because: occurring categories of microbes in sewage
(i) Probes are highly specific and binds water. The bacteria form flocs along with fungal
mycelia and these flocs are utilized during
efficiently to the gene of interest. Using
the secondary treatment of sewage. After
them is relatively rapid and much simpler
separation of the grit and debris, the primary
method. effluent is taken for secondary treatment. The
(ii) Probes serve as a highly precise method as effluent is then passed to an aeration tank
when combined with PCR especially, even where it is agitated and air is pumped into
a single molecule in the test sample can be it. As a result, this leads to vigorous growth
detected. of bacteria that consume the organic matter,
(iii) While using a probe, microbial culture is not thereby decreasing BOD of the sewage.
required, so the risk of accidental infection 11. The major limitations of the earlier green
to laboratory personnel is eliminated. revolution were:
OR (i) Green revolution involved excessive use
The use of agrochemicals has many of fertilizers and pesticides which led to
disadvantages such as: pollution of the water bodies, soil, and food
(i) They cause environmental pollution. items.
(ii) Heavy treatment of soil with agrochemicals (ii) Lack of better management practices.
can cause populations of beneficial soil (iii) Limited availability of improved crop
microorganisms to decline. varieties.
(iii) Highly dangerous to humans and animals
12. Classification of extinction processes:
in their concentrated forms.
(i) Natural extinction: It is due to a change
9. Some features of animals which help them to in environmental conditions. It is at a very
survive in water scarce environment are: slow rate.
(i) No sweating/uricotelic/deposition of fat in (ii) Mass extinction: Mass extinction occurs
subepidermal layer/burrowing nature/thick due to catastrophes. In this case, a large
skin/ body covered with scales. number of species became extinct in
(ii) Use of metabolically produced water. millions of years.
(iii) Mucous layer on the surface to reduce (iii) Anthropogenic extinction: Extinction
water loss by perspiration. of species is due to man’s activities. It is
(iv) Various hormones in humans like ADH help occurring in a short period of time.
reduce water loss. (Any three)
SECTION - C
13. (A) Restriction endonucleases are the enzymes (A) (i) pBR322 is a plasmid vector discovered

that are used to cleave both plasmid and by Rodriguez and Bolivar in 1977.
the host DNA. (ii) Escherichia coli (bacteria) was used to

These enzymes cleave DNA or cut manufacture genetically engineered

phosphodiester bond at specific sites insulin.
within the polynucleotide chain. (iii) The vectors that are designed to

(B) The first recombinant DNA molecule was replicate in the cells of two different
synthesized in the year 1972 by Paul Berg, species are called as shuttle vectors.
Herbert Boyer, Annie Chang, and Stanley (B)
Cohen of Stanford University and the
University of California, San Francisco. Cloning vector Expression vector
(C) ‘BAC’ stands for Bacterial Artificial They are the DNA The cloning vector
Chromosomes and ‘YAC’ stands for Yeast molecules that can containing suitable
Artificial Chromosomes. carry a foreign DNA expression signals
(D) The first restriction endonuclease–HindII segment into the to have maximum
was isolated and characterized by host cell. Example: gene expression. The
plasmids, cosmids, expression signals
Smith, Wilcox and Kelley in 1968 from
etc. include insertion of a
Haemophilus influenzae. strong promoter and
OR terminator, etc.

10
TERM-2
SAMPLE PAPER
SELF-ASSESSMENT
BIOLOGY
SECTION - A
1. Certain features are required to make a (A) What is meant by flocs?

stable biological community. List any two. (B) What is a fermenter or bioreactor?
OR
5. Name the organisms shown in the given
List any two advantages of the IUCN Red
picture and what kind of relationship they
list. 2 share? Describe briefly.
2. (A) Mention the role of cyanobacteria in the

paddy field that is beneficial for the rice

crop.
(B) Who worked on the chemotherapeutic
effectiveness of penicillin? 2
3. Our body has different types of barriers as
a part of innate immunity that prevent the
entry of foreign agents. Name the type of
barrier of innate immunity, which involves:
(A) Macrophages 2
(B) HCl of stomach
4. The given picture shows the surface of the

cultural medium in a fermenter, which is OR
having white foam like substance known as State Gause’s ‘Competitive Exclusion
flocs. 2 Principle’. 2
6. (A) Suman was confused to observe that

the fruit juices that we prepare at home

are not clear whereas bottled fruit juices
appear clearer. Give reason for this.
(B) How statins help in lowering the blood
cholesterol level? 2
Sample Paper 10 87
SECTION - B
7. List any three factors by which the health of as a result could not achieve the goals of
an individual is affected. 3 her experiment. Elaborate the reason.
(B) After the process of gel electrophoresis,
8. Represent diagrammatically the technique
the DNA needs to be extracted. By which
of recombinant DNA technology. 3
process this is done?
9. The given picture shows one of the OR
symptoms of a fungal disease that is caused Give three points of difference between
by Microsporum. Name the disease and plasmid DNA and chromosomal DNA. 3
also write its mode of transmission and
symptoms. 3 11. In a pond there were 30 water hyacinth
plants. 10 new water hyacinth plants were
added in a year through the process of
reproduction. Calculate the birth rate of the
population and also define birth rate. 3
12. Threatened species are the species which
are vulnerable to endangerment in the near
future. But these species can be saved by
using different techniques to protect their
gametes. Describe any three methods used
10. (A) Reema was conducting an experiment for protection of gametes of threatened
species. 3

using a PCR machine. By mistake she

missed the PCR denaturation step and
SECTION - C
13. The given picture depicts the effect of an (iii) What are Cry genes? In which

insect resistant plant on the pests. It shows organism are they found?
how insecticidal proteins are produced by the (B) Bt tobacco was first cultured to kill which
plants that specifically kill the insect larva and worm.
thus save the plant from infection. (i) Human lymphocytes
Based on this answer the following (ii) Plant cells
questions:
OR
Plants expressing Insecticidal proteins
insecticidal kill insect larva The following picture shows a tobacco plant
proteins by distinct mechanisms infected with a nematode.
Answer the questions that follow: 5
Reduced
selection
pressure
Cry1Ac Vip3A Cry2Ab Toxin A
(A) (i) Which organism is responsible for

the production of an insect resistant (A) Which part of tobacco plant is infected
transgenic cotton by inserting a piece by Meloidogyne incognita?
of DNA?
(B) Which vector is popularly used to
(ii) What is the trigger for activation of

transfer nematode-specific genes into

toxin of Bacillus thuringiensis inside the tobacco plants?
insect?

(C) How are tobacco plants benefited when (D) What is the role of Agrobacterium in the
nematode specific genes are introduced production of dsRNA in tobacco plant?
into them using certain vectors? Name
the vector used.
Scan QR code to download

solutions of this paper
Sample Paper 10 89
SELF EVALUATION CHART

Sample Paper - 10
Question Marks Topic Full Marks Calculate

(Subject) (Type) (Chapter Name) (Breakdown) Marks
The importance of
species diversity to the Mention two features (1m + 1m)
2 Marks
Q1 ecosystem Must have factors: Variation in productivity,
(SA-I) 2
(Biodiversity And Its resilience to invasion/disturbances
Conservation)
Mention two advantages (1m + 1m) OR

Loss of biodiversity
OR 2 Marks
(Biodiversity And Its Use keywords: threatened and endangered
Q1 (SA-I)
Conservation) species 2
Cyanobacteria
Q2 (A) (Microbes In Human Mention two points on the role (0.5m + 0.5m)
Welfare) Use keywords: atmospheric nitrogen, biofertilizer
2 Marks
(SA-I) Antibiotics 2
Name of scientists (0.5 m + 0.5m)
Q2 (B) (Microbes In Human
Based on chemotherapeutic property of penicillin
Welfare)
Immunity
2 Marks
Q3 (Human Health And Name of barriers (1m + 1m)
(SA-I) 2
Diseases)
Microbes in sewage
Define flocs (1m)
treatment
Q4 (A) Remember to include: bacteria and fungal
(Microbes In Human
filaments
2 Marks Welfare)
(SA-I) Microbes in industrial 2
Define fermenters or bioreactors (1m)
productS
Q4 (B) Must mention: All features of bioreactors, and its
(Microbes In Human
use
Welfare)
Commensalism Name of two organisms (0.5m + 0.5m)

2 Marks
Q5 (Organisms And Name of relationship (1m)
(SA-I) 2
Population) Use keywords like predators, stinging tentacles
Explanation of given Principle (2m) OR

Competition
OR 2 Marks
(Organisms And Must mention: effect of limited resources, inferior
Q5 (SA-I)
Population) species 2
Enzymes
Q6 (A) (Microbes In Human Name of two enzymes (0.5m + 0.5m)
2 Marks Welfare)
(SA-I) Bioactive molecules 2
Role of statins (1m)
Q6 (B) (Microbes In Human
Must mention: Action by competitive inhibition
Welfare)
Health Explain three factors (1m + 1m + 1m)

3 Marks
Q7 (Human Health And Provide information on: Inborn defects, pathogenic
(SA-II) 3
Diseases) infections and lifestyle issues
Processes of recombinant Diagram (2m)

3 Marks dna technology Labeling (1m)
Q8
(SA-II) (Biotechnology-Principles Must include: Foreign and vector DNA, Ligases, 3
And Processes) Recombinant DNA and Cloning host

Fungal diseases Name of disease (1m)

3 Marks
Q9 (Human Health And Mode of transmission (1m)
(SA-II) 3
Diseases) Symptoms (1m)
Amplification of gene of
interest using pcr Reason (2m)
Q10 (A) (Biotechnology- Must describe: importance of separation of DNA
Principles And strands
Processes)
3 Marks
(SA-II) 3
Separation and isolation
of dna fragments
Q10 (B) (Biotechnology- Name the process (1m)
Principles And
Processes)
Tools of recombinant
Difference (1.5m + 1.5m) OR
dna technology
OR 3 Marks Use keywords: prokaryotic and eukaryotic cells,
(Biotechnology-
Q10 (SA-II) extrachromosomal and linear DNA
Principles And 3
Include one use
Processes)
Birth rate or natality

3 Marks Calculation and formula (1m + 1m)
Q11 (Organisms And
(SA-II) Definition (1m) 3
Population)
Ex situ conservation
3 Marks Description of three methods
Q12 (Biodiversity And Its
(SA-II) Mention the conditions needed (1m + 1m+ 1m) 3
Conservation)
Biotechnological
applications in PART (i)- Name (1m)
Q13 (A) agriculture PART (ii)- Write about the trigger (1m)
(Biotechnology And Its PART (iii)- Definition and Name of organism (1m + 1m)
Applications)
5 Marks
(Case Based) 5
Characteristics
of cloning vector
Q13 (B) (Biotechnology- Name (1m)
Principles And
Processes)
OR
Name of affected part (1m)
Q13 (A)
Name of vector (1m)

Q13 (B)
Remember to write scientific name properly
OR
Pest resistant plants
5 Marks
(Biotechnology And Its Benefit of introduction of nematode-specific
(Case Based)
Q13 (C) Applications) genes into the tobacco plant (1m) 5
Name the vector used (1m)
Focus on the process in your answer

Q13 (D) Use keywords like host plant, double stranded
RNA, RNA interference (1m)
TOTAL
35
Self Evaluation Chart Sample Paper 10 91

11
TERM-2
SAMPLE PAPER
SELF-ASSESSMENT
BIOLOGY
SECTION - A
1. (A) Name the fish that help in eradication of

mosquito larvae? I attack I attack

(B) Give a scientific term to the disease that Invaders outside infected
jumps from a non-human animal to a the cells. cells.
human? Give one example. 2
2. The given picture shows a Calotropis plant
growing in a field, which is said to be not
eaten or browsed by cattle and goats. Why
is it so? Give reasons.
B-Cells T-Cells
4. (A) Having started working in a research-

based organisation, Ritesh was confused

between the terms genetically modified
organisms and transgenic organisms.
Are these two terms different or similar?
Define them.
(B) There is an increase in the production of

recombinant therapeutics worldwide.

What is the advantage of using these
OR recombinant therapeutics? 2

Write any two adaptations of Cuscuta as a 5. Explain microbial biocontrol with an example.
parasitic plant. 2
OR
3. Teacher showed the given picture to explain
What do you mean by biofertilizers and
the difference between action of B-cells and
why there is a pressure to shift to organic
T-cells. Mention the site of maturation of
B-cells and T-cells. Also give one difference
farming? 2
between them. 2

6. Name the following: (B) Type of association that the genus
(A) A species of virus used as biological Glomus exhibits with higher plants. 2
control agents.
SECTION - B
7. (A) Reema just recovered from typhoid

insulin caused allergies in some patients.
which is a water-borne infection. What How this problem was overcome?
measures should be taken to prevent Explain.
such water-borne diseases? (B) The Ministry of Environment and Forests
(B) Why diseases like cholera, dysentery, in India has set up an organisation
typhoid, etc., are more common in known as Genetic Engineering Approval
overcrowded places? 3 Committee (GEAC). Write any two
objectives of GEAC. 3
8. The mangroves are adapted to the
conditions prevailing in Sundarbans as 10. (A) For a cloning vector to be successful in

shown in the picture. Name and explain any rDNA technology, it must have several
three adaptations of mangroves. desirable properties such as origin of
replication, selectable marker, etc. If
in an experiment, the chosen plasmid
vector lacks a selectable marker, what
would be its effect on the experiment?
(B) With the use of rDNA technology, which
limitation of traditional hybridization
used for plant and animal breeding has
overcome? 3
11. (A) State what happens when a foreign gene

is ligated in the following sites of pBR322

OR plasmid?
(A) What are tropical rainforests? (i) SalI
(B) In India many plant species are found in (ii) PvuI
tropical forests. Name any two dominant (B) Why alkaline phosphatase enzyme is
plant species. used in rDNA technology to remove
(C) Give reasons, why the soil of tropical the phosphate group present at the 5’
deciduous forests is richer in nutrients as end of a DNA molecule leaving a free 5’
compared to tropical rainforests? 3 hydroxyl group? 3
9. (A) Earlier insulin used for the treatment of

12. Why are some molecules called bioactive
diabetes was extracted from pancreas molecules? Give two examples of such
of slaughtered cattle and pigs, but such molecules. 3
SECTION - C
13. Helianthus paradoxus or puzzle sunflower, is a

threatened species of sunflower as shown in
the picture below. The Puzzle Sunflower with
narrow habitat requirements, only occurring
in highly saline wetlands within deserts. These
wetlands are continuously threatened by
habitat degradation, groundwater withdrawal,
competition from non-native species, grazing,
and gas exploration.
Sample Paper 11 93
(A) Helianthus paradoxus is a threatened thus it becomes vulnerable to extinction. For
species of sunflower. What do you mean example: Dodo and passenger pigeon have
by threatened species? 1 become extinct due to over exploitation by
(B) Name one endangered species of an humans. The world is facing accelerated rates
Indian medicinal plant. 1 of species extinctions, largely due to human
(C) Define cryopreservation as a method of interference.
protection of threatened species. 1 (A) Name one species have become extinct
(D) In India, red list of plant species is due to over exploitation in Russia. 1
prepared by Botanical Survey of India. (B) Which region of the globe have highest
Where is the headquarters of Botanical species diversity? 1
Survey of India located and what is its (C) Which regions are termed as hotspots of
function? 2 biodiversity? 1
OR (D) List any two causes of loss of
When there is excessive exploitation of species, biodiversity. 5
whether it is a plant or animal, it results in
reduction of the size of its population and



Sample Paper - 11

Prevention and control of
2 Marks
Q1 (A) infectious diseases Name (0.5m)
(SA-I)
(Human Health and Diseases)
2
2 Marks Infectious Diseases Scientific term (0.5m)
Q1 (B)
(SA-I) (Human Health And Diseases) Two examples of the disease (0.5m + 0.5m)
2 Marks Predation Reason (2m)

Q2
(SA-I) (Organisms And Population) Use keywords: cardiac glycosides, defense mechanism
2
OR
Two adaptations (1m + 1m
OR 2 Marks Parasitism
Must mention about the specialised and adaptive
Q2 (SA-I) (Organisms And Population)
physical features of Cuscuta 2
Site of maturation (0.5m + 0.5m)

2 Marks Lymphoid Organs
Q3 Difference w.r.t site/position/connect/life-span OR
(SA-I) (Human Health And Diseases) 2
secretion (1m)
Genetically Modified Mentioning, terms are different or similar (0.5m)

Organisms Definition (1m)
Q4 (A)
(Biotechnology And Its Rember to include the terms: gene manipulation,
2 Marks Applications) transgenes
(SA-I)
Biotechnological
2
Applications In Medicine Advantage (0.5m)
Q4 (B)
(Biotechnology And Its Important keyword: immunological responses
Applications)
Microbes As Biocontrol Agents Explaination (1m)

2 Marks
Q5 (Microbes In Human Example (1m)
(SA-I)
Welfare)
2
Focus on the activity of microbial biocontrol agent
OR
Microbes As Biofertilisers Definition (1m)
OR 2 Marks
(Microbes In Human Reason (1m)
Q5 (SA-I)
Welfare) Must tell about the benefits of organic farming 2
Microbes In Industrial Products

2 Marks PART A- Name of species of virus (1m)
Q6 (Microbes In Human
(SA-I)
Welfare)
PART B- Name of association (1m) 2
Prevention And Control Of Four preventive measures (0.5m × 4)

Q7 (A) Infectious Diseases Use keywords: disposal, cleaning and disinfection of
(Human Health And Diseases) water
3 Marks
(SA-II) Explanation of reason (1m) 3
Infectious Diseases
Q7 (B) Must mention the link between infectious diseases and
(Human Health And Diseases)
overcrowded places
Naming and explanation (1m + 1m +1m)

Adaptations To Saline
3 Marks Focus on unique adaptations
Q8 Environments
(SA-II) Use keywords like halophytes, anaerobic conditions,
(Organisms And Population) 3
lenticels
Definition (1m)
OR 3 Marks Ecology
Must write about temperature and rainfall level in this
Q8 (A) (SA-II) (Organisms And Population)
region

Ecology
Name (0.5m + 0.5m)
Q8 (B) (Organisms OR
Remember: write only dominant species
3 Marks And Population)
(SA-II)
3
Ecology Reason (1m)
Q8 (C)
(Organisms And Population) Must write about the importance of decomposition
Genetically Engineered Insulin Name of process (0.5m)

Q9 (A) (Biotechnology And Its Explanation (1.5m)
Applications) Mainly focus on: genetically engineered insulin
3 Marks
(SA-II) 3
Ethical Issues
Q9 (B) (Biotechnology And Its Two objectives (0.5m + 0.5m)
Applications)
Characteristics Of Cloning
Explanation of the effect (2m)
Vector
Q10 (A) Must have keywords: transformants, non-transformants,
(Biotechnology-Principles
desired gene.
And Processes)
3 Marks
(SA-II) 3
Principles Of Genetic
Limitation (1m)
Engineering
Q10 (B) Include benefit of rDNA technology, desirable genes,
(Biotechnology-Principles
multiplication.
And Processes)
Characteristics Of Cloning
Vector Results (1m + 1m)
Q11 (A)
(Biotechnology-Principles Must write tetracycline and ampicillin resistant gene
3 Marks And Processes)
(SA-II) 3
Alkaline Phosphatases
Q11 (B) (Biotechnology-Principles Use (1m)
And Processes)
3 Marks Bioactive Molecules Explanation (mention the performed activity) (2m)

Q12
(SA-II) (Microbes In Human Welfare) Two examples (0.5m + 0.5m) 3
Q13 (A) Definition (1m)
Name (1m)
Q13 (B)
Loss Of Biodiversity And Remember: write species of Indian origin only
5 Marks
Conservation Of Biodiversity
(Case
(Biodiversity And Its Definition (1m) 5
Q13 (C) Based)
Conservation) Useful keywords: in vitro, liquid-N2 , -196°C temperature
Name of location (1m)

Q13 (D)
Function (1m)
OR
Name (1m)
Q13 (A)
Loss Of Biodiversity And Name of region (1m) OR

Q13 (B) 5 Marks
Conservation Of Biodiversity Must mention about number of different species
(Case
(Biodiversity And Its
Based) 5
Conservation)
Explanation (1m)
Q13 (C)
Use keywords: species richness, endemism
Q13 (D) Two causes (1m + 1m)
TOTAL
35
12
TERM-2
SAMPLE PAPER
SELF-ASSESSMENT
BIOLOGY
SECTION - A
1. (A) Name the property of normal cells, the

it has become an endangered species. What
absence of which in cancerous cells leads do you mean by endangered species? Give
to the formation of tumours. two examples. 2
(B) The tumours are classified into two
3. (A) Name the gases that are produced in
types, in which one of the types remains

anaerobic sludge digesters.

confined to the original location and
the other type of tumours invade (B) Which enzyme is used as a clot-buster in
neighbouring tissues. Name the two patients who have undergone myocardial
types of tumours. 2 infarction, to remove clots from blood
vessels? 2
2. (A) Given below is the picture of the plant
4. Some individuals experience sudden sneezing

Rauwolfia vomitoria. Genetic variation is

very important in this plant. Why? and wheezing after reaching a hill station,
while these symptoms disappear when they
return to the plains. What is such a response
called? How does the body produce it? 2
5. Egrets and grazing cattle are often seen
together as depicted in the picture. What
is this type of interaction called as? Give a
reason for such kind of association.
(B) A bird named Great Indian Bustard found

in Rajasthan is a threatened species.
What do you mean by threatened
species?
OR
Rahul read an article that hunting and
human population growth is major threats
to the Bengal tigers. Due to these reasons, OR
Sample Paper 12 97
Illustrate the relationship between biotic 6. (A) Define Antibiotics.
potential and environmental resistance. 2 (B) Which was the first antibiotic and who
discovered it? 2
SECTION - B
7. (A) If one of the insect pollinators becomes environmental conditions. How do they
3

extinct in an ecosystem. Would it affect do it?

the ecosystem? If yes, how?
10. (A) Reema (who works in a genetic
(B) Seed banks are used to store seeds of

engineering firm) was making her friend

different genetic strains. Briefly describe
understand that manipulation of living
the conservative strategy involved in
organisms by the human race is not
this.
ethical and should be regulated. Is it
(C) From the study of the fossil records, true? Why? Name the set of standards
it was found that mass extinction of which are used to regulate human
species happened earlier, even before activities in relation to biological world.
humans appeared.What could have
(B) A human protein α-1 antitrypsin is
triggered mass extinctions of species in
produced in a transgenic animal created
the past? 3 by the introduction of the gene which
8. (A) Why malaria is restricted to the tropics? codes for it. For what purpose this
(B) Explain why tetanus antitoxin is given
protein is used? 3
to a person injured in an accident with 11. (A) In most of the genetic engineering
a bleeding wound and not a tetanus

experiments, mice are used as the

vaccine? 3 preferred organism for transgenic
production. Why?
9. Explain briefly how desert ephemeral plants
are adapted to withstand hot and dry (B) RNA interference involves the silencing
environment? of specific mRNA that helps to prevents
OR
many parasitic infestations. How? 3
(A) How would you classify organisms on 12. (A) What are the different places where

the basis of their tolerance to salinity? methanogens are found?

(B) Certain animals like fungi, zooplankton (B) How do methanogens help in producing
and bears have the ability to cope up biogas? 3
with the temporary short lived stressful
SECTION - C
13. During a visit to a genetic engineering (A) Who developed the technique of PCR?
laboratory, students saw a PCR machine (B) What is the basis of the technique of
as shown in the picture. The students were PCR?
amazed as their teacher told them, this small (C) What is the source of Taq Polymerase
machine can make millions of copies of DNA enzyme used in PCR?
from a very small sample of blood, hair, etc.
(D) Name the final step of PCR and explain it
and that too within few hours.
briefly.
Based on this answer the following
OR
questions:

The following picture shows different types of bioreactors that are used in downstream processing.
Based on the below picture answer the following questions:
(a)
Biogas collector
(b) (f)
Sludge blanket
Filtered air
Sludge bed Treated water
UASB
Soil with Membrane module
biofilm
Odorous air
Excess sludge
BF
Immobilized
cell
(c) technology
External MBR
circult (e)
Fixed packed bed
Wastewater Proton exchange
inlet membrane Bio film layer
(d)
Cathode
Anode with
biofilm Aeration
Carrier PBB
MFC Biofilm layer
Aeration
MBBR
(A) (i) Why mechanical agitation is required in stirred tank bioreactor and not in air-lift reactors?

(ii) What do you mean by continuous culture? List one of its advantages.

(B) List any two advantages of stirred tank bioreactors over shake flasks. 5

Sample Paper 12 99

Sample Paper - 12

Cancer
Q1 (A) (Human Health and Name (1m)
2 Marks Diseases)
(SA-1) Cancer 2
Q1 (B) (Human Health and Name of tumours (0.5m + 0.5m)
Diseases)
Genetic Diversity Reason (1m)

Q2 (A) (Biodiversity and its
Conservation) Specifically write about chemical reserpine
2 Marks
(SA-1) Loss Of Biodiversity 2
Definition (1m)
Q2 (B) (Biodiversity and its
Conservation) Remember the keyword endangerment
Definition (1m) OR
OR 2 Marks Loss Of Biodiversity
Two examples (0.5m + 0.5m)
(Biodiversity and its
Q2 (SA-1) Conservation) Mention keyword: extinction and also about harmful
2
human activities
Microbes In Sewage
Treatment Names (0.5m + 0.5m + 0.5m)
Q3 (A)
(Microbes In Human NOTE: Mention only anaerobic activity gases
2 Marks Welfare)
(SA-1) 2
Enzymes
Q3 (B) (Microbes In Human Name (0.5m)
Welfare)
Name (1m)
2 Marks Allergies
Name of two chemicals (0.5m + 0.5m).
Q4 (Human Health And
(SA-1) Use keywords: hypersensitive, exaggerated, IgE, 2
Diseases)
histamine and serotonin
Name of interaction (1m)

2 Marks Commensalism
Reason (1m)
Q5 (Organisms and
(SA-1) Must mention the benefits getting by egrets from 2
Population)
grazing cattle
Define about biotic potential (0.5m) OR

OR 2 Marks Populations Define about environmental resistance (0.5m)
(Organisms And
Q5 (SA-1) Population) Explanation of relationship between them (1m)
2
Must provide their contradictory effect
Q6 (A) Definition (1m)

2 Marks Antibiotics
(Microbes in Human
(SA-1) Welfare) 2
Name (0.5m)
Q6 (B)
Name of discoverer (0.5m)

Causes Of Loss of Give yes or no (0.5m)

Biodiversity
Q7 (A) Explanation (1m)
(Biodiversity and its
Conservation) Use keyword: co-extinction and focus on process
3 Marks
(SA-2) Ex Situ Conservation Description of method
Q7 (B) (Biodiversity and its 3
Conservation) Mention the conditions required (1m)
Loss of Biodiversity
Q7 (C) (Biodiversity and its Names of trigger (0.5 m)
Conservation)
Malaria Explanation (1m)

Q8 (A) (Human Health and Must mention the role of warmth for Anopheles
Diseases) mosquitoes and malarial parasite
3 Marks
(SA-2) Vaccination and 3
Explanation (2m)
Immunisation
Q8 (B) Focus on the benefit of a tetanus antitoxin
(Human Health and
Diseases) Must give the role of vaccine
Adaptations In Plants Mention three adaptations (1m + 1m + 1m)

3 Marks
Q9 (Organisms And Use keywords: reduction of transpiration and
(SA-2) Population) 3
surface area
OR Abiotic Factors
(Organisms And Classifications (1m + 1m)
Q9 (A) Population) OR
3 Marks
(SA-2) Responses To Abiotic Name of the method adopt by fungi and 3
Factors zooplanktons (0.5m)
Q9 (B)
(Organisms And
Population) Name of the method adopt by bear (0.5m)
Give true or false (0.5m)

Ethical Issues Explanation (1m)
Q10 (A) (Biotechnology and its
Applications) Name of standards (0.5m)
3 Marks Remember to write about the importance of ethicals
(SA-2) 3
Transgenic Animals
Q10 (B) (Biotechnology And Its Use (in medical point of view) (1m)
Applications)
Transgenic Animals
Q11 (A) (Biotechnology and its Three reasons (0.5m + 0.5m + 0.5m)
Applications)
3 Marks
(SA-2) 3
Pest Resistant Plants Explanation (1.5m)
Q11 (B) (Biotechnology and its
Applications) Focus on the process
Production of Biogas by
Microbes
Q12 (A) Names (1m + 1m)
(Microbes in Human
Welfare)
3 Marks
(SA-2) 3
Production Of Biogas by
Microbes Explanation (1m)
Q12 (B)
(Microbes in Human Must write the term anaerobic decomposition
Welfare)

PART (i) Reasons (0.5m + 0.5m)

5 Marks PART (ii) Definition ( Must have feature- continous
Q13 (A) Bioreactors

(Case Based) add and drain of medium) (1m)

(Biotechnology- Advantage (1m)
Principles and 5
Processes)
5 Marks
Q13 (B) Two advantages (1m + 1m)
(Case Based)
OR
Name of the scientist (1m)
Q13 (A)
Amplification Of Gene Description (1m)

Q13 (B) Use keywords: DNA polymerase, new DNA and OR
5 Marks Of Interest Using Pcr
(Biotechnology- template strand
(Case Based) Principles and 5
Processes)
Q13 (C) Name of bacterium (1m)
Name (1m)
Explanation (1m)
Q13 (B)
Focus on the step
Use main keywords: Taq DNA Polymerase, dNTPs
TOTAL
35

BIOLOGY Educart Sample Papers Term 2 C-12 - Watermark-Compressed

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

BIOLOGY Educart Sample Papers Term 2 C-12 - Watermark-Compressed

Uploaded by

Copyright:

Available Formats

@Cbsebookshub - Join Us on Telegram

@Cbsebookshub - Join Us on Telegram

ADDRESS 28h15 Jyoti Block, Sanjay Place, Agra, U.P. 282002

Pugc,i��� I Agrawal Group Of Publications (AGP)

AGP contributes Rupee One on every book purchased by you to

Solved Sample Papers

Self Assessment (with Self-evaluation)

TOTAL 12m 18m 5m

Reading Time (Mandatory): 15 min

Short Answer I 4-5 minutes

Short Answer II 8-10 minutes

Case-based 13-15 minutes

Revision Time 15 minutes

TOTAL TIME: 120 minutes

Reading Time Hack!

Follow CBSE Marking Scheme*

Focus on Avoiding Silly Mistakes

Structure your Answers Correctly

Always Leave Time for Revisio

Score Full Marks

Score Full Marks Your

Diagram (1 mark) Diagram (1 mark)

Name of disease (1 mark) TOTAL Marks 37/40

Mode of transmission (1 mark) 2

TOTAL Marks 37/40

HUMAN HEALTH Typhoid Common Cold

AND DISEASES • Caused by Salmonella typhi

HUMAN HEALTH Typhoid Common Cold

Active Immunity Passive Immunity

Cellular Barrier Humoral Immune

Polymorpho nuclear leukocyte (PMNL),

SUBJECTIVE Type Questions

[CBSE Topper 2018]

2. How do cytokine barriers provide innate immunity in humans ?

[CBSE Topper 2018]

3. State the function of interferons.

[CBSE Topper 2019]

Short Answer Type Questions (SA) [2 marks ]

[CBSE Topper 2014]

[CBSE Topper 2017]

12 Biology Class XII

[CBSE Topper 2018]

7. List any four common approaches for treatment of cancer.

[CBSE Topper 2019]

Human Health and Diseases 13

• Rhizobium bacteria fix atmospheric nitrogen into MICROBES IN

• Curd- Lactic acid bacteria

MICROBES IN SEWAGE TREATMENT MICROBES IN PRODUCTION OF BIOGAS

Filtration & sedimentation Filtration & sedimentation

Effluent passed to settling tank

Flocs sediments to form – activated sludge

Pumped into Anaerobic Sludge Digester

Forms Biogas Effluent released into

SUBJECTIVE Type Questions

[CBSE Topper 2014]

[CBSE Topper 2016]

[CBSE Topper 2018]

[CBSE Topper 2017]

16 Biology Class XII

[CBSE Topper 2015]

Short Answer Type Questions (SA) [2 marks ]

[CBSE Topper 2015]

Microbes in Human Welfare 17

Pugc,i�� I Agrawal Group Of Publications (AGP)