Journal of Thrombosis and Haemostasis, 11: 1844–1849 DOI: 10.1111/jth.

12364

ORIGINAL ARTICLE

Type II antithrombin deficiency caused by a founder mutation

Pro73Leu in the Finnish population: clinical picture
M . P U U R U N E N , * P . S A L O , † S . E N G E L B A R T H , * K . J A V E L A * and M . P E R O L A †
*Hemostasis Laboratory, Finnish Red Cross Blood Service; and †Public Health Genomics Unit, Department of Chronic Disease Prevention,
National Institute for Health and Welfare, Helsinki, Finland

To cite this article: Puurunen M, Salo P, Engelbarth S, Javela K, Perola M. Type II antithrombin deficiency caused by a founder mutation
Pro73Leu in the Finnish population: clinical picture. J Thromb Haemost 2013; 11: 1844–9.

Summary. Background: It has been shown that some anti- Introduction

thrombin (AT) activity assays do not correctly detect
Antithrombin (AT) is a serine protease inhibitor and a
inherited type II AT deficiency, but erroneously classify
central anticoagulant molecule. It forms inactive com-
these patients as normal. Objectives: Our aim was to
plexes with thrombin, activated factor X (FXa), and
investigate the mutations causing type II AT deficiency
also, less importantly, activated FIX, FXI and FXII,
and to correlate the AT activity results with the genetic
inhibiting blood clotting in this manner. The presence of
findings. Patients/Methods: A large population (n = 104;
heparin speeds up the anticoagulant activity > 1000-fold
42 families) of Finnish patients with known AT type II
[1,2].
deficiency were interviewed for clinical data. Their AT
In AT deficiency, either AT antigen levels in the blood
activity was measured with five commercially available
are low and AT activity is reduced (type I), or only AT
methods, and the SERPINC1 gene was genotyped.
activity is reduced (type II). Type II deficiency is further
Results: The mutations detected in type II AT-deficient
divided into three subgroups: mutations affecting the
patients were as follows: p.Pro73Leu (AT Basel) in 37 of
reactive site (type IIRS), which disrupt the enzyme–inhib-
42 (88.1%) families; and p.Val30Glu, p.Arg425Cys and
itor interaction; mutations at the heparin-binding site
p.Pro439Ala in one family each. In two families, no
(type IIHBS), which interfere with AT binding to hepa-
mutation was detected. In the carriers of AT Basel two
rin; and pleiotropic effect defects (type IIPE), where a sin-
AT activity assays correctly identified most of the patients
gle mutation results in more than one functional defect
as AT-deficient, whereas three assays misclassified almost
[3]. Previously, these subtypes were referred to as IIa, IIb,
all of these patients as normal. Carriers of the founder
and IIc, respectively [1,3]. Inherited AT deficiency is a
mutation had, in addition to an elevated risk of venous
rare, autosomal dominant disorder, caused by mutations
thrombosis, a high risk of arterial thrombosis at young
in the antithrombin gene (SERPINC1). Over 250 different
age, especially stroke. Conclusion: In Finland, a popula-
mutations leading to AT deficiency have been reported
tion with a strong founder effect, AT type II deficiency is
thus far. Most of them are point mutations, minor dele-
caused predominantly by a single point mutation,
tions, or insertions, and a small minority are larger dele-
p.Pro73Leu. The mutation is associated with a significant
tions or loss of the whole gene [4–6].
thrombotic risk. Reduced AT activity caused by this Congenital AT deficiency increases the individual’s risk
mutation cannot be detected by all available screening for thrombotic complications ~ 30-fold (five-fold to 50-
methods. This must be taken into account in the choice fold) [1,7]. The clinical picture and severity of the disease
of laboratory method used for screening. vary greatly, depending on the type of deficiency and the
type and site of the mutation. Type IIHBS deficiency with
Keywords: antithrombin III deficiency; pregnancy compli- mutations affecting the heparin-binding site has been
cations; stroke; thrombophilia; venous thrombosis. reported to present a markedly lower risk for the develop-
ment of thrombosis [8]. The most common clinical find-
Correspondence: Marja Puurunen, Laboratory of Hemostasis, Finn-
ings are deep vein thrombosis and pulmonary embolism,
ish Red Cross Blood Service, Kivihaantie 7, 00310 Helsinki, Finland.
and pregnancy complications, mainly fetal loss [2]. Some
Tel.: +358 505690043; fax: +358 293001604.
E-mail: marja.puurunen@veripalvelu.fi
cases of arterial thrombosis have also been reported, but
the role of AT deficiency in arterial thrombosis is contro-
Received 16 May 2013 versial [1,2,9]. In the majority of thrombosis cases in
Manuscript handled by: P. H. Reitsma AT-deficient individuals, no predisposing factors can be
Final decision: P. H. Reitsma, 11 July 2013 identified [10].

© 2013 International Society on Thrombosis and Haemostasis


Functional assays are recommended in screening for
the deficiency [11]. Several studies have shown difficulties
in detecting AT deficiency with standard functional
assays. The phenomenon appears to be at least partially
associated with the mutation behind the deficiency [3,12–
15]. We have recently reported great variability in the
potential of various functional assays to recognize type II
AT deficiency, regardless of study principle, i.e. throm-
bin-based or FXa-based [16].
The aim of this study was to investigate the genetic
background of AT type II deficiency in Finns, a popula-
tion genetically characterized by a strong founder effect
and a relatively long period of isolation with slow growth.
We also hypothesized that an underlying mutation could
explain the differences in the results obtained with various
functional assays. In addition, we describe the clinical pic-
ture caused by the founder mutation found in the study
population.
Materials and methods
Patients
Nearly all individuals diagnosed with AT deficiency in
Finland (population 5.4 million) during 1971–2009 have
been added to the Register for Coagulation Disorders of
the Finnish Red Cross Blood Service. At the time of
investigation, there were 456 patients in the register, and
of those, 374 were still alive, aged > 18 years, and living
in Finland. Originally, the propositus of the family was
referred for testing because of a clinical manifestation
(most commonly, deep vein thrombosis or pulmonary
embolism). Other family members had been tested
regardless of clinical findings. In order to receive the
diagnosis of AT deficiency, the proband had been ana-
lyzed on two separate occasions. If the person was
known to have a first-degree family member with AT
deficiency, analysis was usually performed only once.
Subclassification as type I and II was performed accord-
ing to AT antigen levels. Our study was approved by
the Helsinki and Uusimaa Hospital District Ethical
Committee.
For the present study, all eligible patients in the regis-
ter were approached with questionnaires about their
thrombosis history, pregnancy complications, general
health and medication, and known risk factors and pre-
disposing factors for thrombosis, both in general and at
the time of past incidents. Altogether, 237 patients with
either type I or type II deficiency gave informed con-
sent, filled in the survey, and gave new blood samples
for genotyping and testing of their current AT status.
In this study, we focus on the 104 patients belonging to
42 families who had type II AT deficiency. The study
population consisted of 35 probands and 69 affected
family members with a previous diagnosis of type II AT
deficiency.
© 2013 International Society on Thrombosis and Haemostasis
15387836, 2013, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jth.12364 by Nat Prov Indonesia, Wiley Online Library on [10/06/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Type II AT deficiency caused by p.Pro73Leu 1845
Controls
The controls were a randomly selected subset of the FIN-
RISK 2007 cohort. The FINRISK cohorts are cross-sec-
tional population-based surveys carried out every 5 years
by the National Institute for Health and Welfare to assess
the health of the Finnish population. The FINRISK 2007
cohort is a random sample of 25–74-year-old Finns, strat-
ified by age and gender and collected from six geographic
regions of Finland [17].
Laboratory methods
In order to confirm the previous diagnosis in the new sam-
ple, AT activity was measured with a thrombin-based
assay (STA-Stachrom AT III; Diagnostica Stago SAS,
Asni
eres sur Seine, France). The same method had been
used in the original investigation at the time of diagnosis.
The antigen level was measured with an in-house assay,
performed according to Laurell [18]. In addition, the
samples were analyzed with four different commercial
functional AT methods, either thrombin-based (STA-
Stachrom AT III with a prolonged incubation time of
300 s [Diagnostica Stago SAS]; and Berichrom Antithrom-
bin [Siemens Healthcare Diagnostics Products, Munich,
Germany]) or FXa-based (Innovance Antithrombin [Siemens
Healthcare Diagnostics Products]; and HemosIL [Instru-
mentation Laboratory, Bedford, MA, USA]) [16].
The blood samples (citrate tube, 9 mL, Vacutainer
129713 [Becton Dickinson AG, Basel, Switzerland] for
AT assays, and 2 9 EDTA tube, 10 mL [Becton Dickin-
son 367863, Becton Dickinson AG] for mutation assays)
were taken by healthcare professionals in different centers
around Finland, and sent according to Clinical and
Laboratory Standards Institute recommendations to the
Finnish Blood Service for analysis.
Genetic studies
DNA extraction Genomic DNA was extracted from
whole blood samples at the Finnish National Institute for
Health and Welfare DNA laboratory with the Qiagen
Autopure LS instrument, using standard protocols and
reagents provided by the manufacturer.
Capillary sequencing The coding regions and splice sites
of SERPINC1 were sequenced by use of capillary
sequencing. Seven PCR amplicons covering the target
area were designed and amplified from genomic DNA
with a touchdown PCR protocol (Table 1). The PCR
products were treated with ExoSAP-IT shrimp alkaline
phosphatase (Affymetrix, Santa Clara, CA, USA), and
sequenced on an ABI 3730xl DNA Analyzer (Life Tech-
nologies Corporation, Carlsbad, CA, USA), following
standard procedures. PCR-amplified fragments were
sequenced in one direction if this was sufficient to cover
 15387836, 2013, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jth.12364 by Nat Prov Indonesia, Wiley Online Library on [10/06/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
1846 M. Puurunen et al

Table 1 PCR amplicons and primers

AGGGCTCAGAACAGAAGATCC

ACCATTTTTTTTTGACTTCTAT
gCCTTGAAGTAAATGGTGTTA

TCACCTCAAGAAATGCCTTA

agCGAAAAGCCAACAAATCC
GAGGGTGTCATTACAGGCA
gGGTATTGTTGCAGAAGGC
Forward/

gaaaGGAACTTGCCTTCCTG
GAATGACATCGGTGATTC
ggaAATCCAGAGCGGCCA

AGGCAAGTTCCGTTATC
Amplicon reverse Primer sequence

cccCTCCCGTGACAGGTC
TCCCATGAATCCCATGT
GAAGATTAGCGGCCAT

TGGGGTTTAGCGAAC
TTCAAGGCCAACAGG

GCCAAACTGAACTGC
1 F CAGCCTTTGACCTCAGTTCC
1 R GGCCTGGTCTTCTCAAAGG
2 F CTAGGGGTTGCAGCCTAGC

Extension primer
2 R CCAAAGGTGCTCCTAACAAGG
3 F TAGGCAGCCCACCAAACC
3 R TGAGTGGAGAGGAAGAACTCG
4 F TGCTGCCTGGGAAAATGGAGAAGC
4 R TCAGGGCTTCGGTCTCGCCA
5 F TGTCTTGTGTCAATAACTATCCTCCT
5 R ACTACCTTGCGGGTGGAGA

ACGTTGGATGGAAGAAGGCAACTGAGGATG
ACGTTGGATGAGGAAAATGCAGAGCAATCC
6 F GGTTGAAGCCAACTTTCTCC

ACGTTGGATGTTGAAGGGCAACTCAAGCAC

ACGTTGGATGAACAGGGTGACTTTCAAGGC
ACGTTGGATGCTATGATGTACCAGGAAGGC

ACGTTGGATGAACTAGGCAGCCCACCAAAC
ACGTTGGATGGGATTCATGGGAATGTCCCG
ACGTTGGATGCAGCCCTGTGGAAGATTAGC

ACGTTGGATGGAAGGTGTACTCACCTCAAG

ACGTTGGATGGCGGGACATTCCCATGAATC
ACGTTGGATGTGTTGGCCTTGAAAGTCACC
ACGTTGGATGGTGAGCTCATTGATGGCTTC
ACGTTGGATGGGCCATTCTGAGTACCTTGA

ACGTTGGATGACTGAACTGCCGACTCTATC
ACGTTGGATGCAAAGACTTCTCCGGTCTTC

ACGTTGGATGTTTGGTCGTACCTCCATCAG

ACGTTGGATGCATCTGATCAGATCCACTTC
6 R AGAGGTAGTGGGAGGGAAGG
7 F AAAAATGAACGGCAGAGTGG
7 R TTACCATGTGCCCCAATAGC

the target area, and in both directions otherwise. The

resulting chromatograms were analyzed with both ABI
VARIANT REPORTER v1.0 and SEQUENCER v5.1 (Gene Codes
Corporation, Ann Arbor, MI, USA) software packages.

Sequenom genotyping Samples were genotyped at the

Finnish Institute for Molecular Medicine with the iPlex
assay on the MassARRAY System (Sequenom, San PCR primer 2
Diego, CA, USA), with standard reagents and protocols.
The primer sequences are listed in Table 2. For each sam-
ple, two multiplex reactions were used to genotype 17 of
the 18 non-synonymous variable sites identified by capil-
ACGTTGGATGAGAGCGGCCATCAACAAATG

ACGTTGGATGTGAAGCAGCTGCAAGTACCG

ACGTTGGATGGAAGTGGATCTGATCAGATG
ACGTTGGATGTTGAAGGGCAACTCAAGCAC
ACGTTGGATGTGATGGAGAGTCGTGTTCAG

ACGTTGGATGCAGGTATTGTTGCAGAAGGC
ACGTTGGATGAATGACATCGGTGATTCGGC

ACGTTGGATGTCTCCAAAAAGGCGATTGGC
ACGTTGGATGGGCGATTGGCTGATACTAAC
ACGTTGGATGTTGGACAGTTCCCAGACACG
ACGTTGGATGCCTTATGGAATGCATCTGAG

ACGTTGGATGTGGCTACTCTGCCCATGAAG
ACGTTGGATGGGAAAGCTCACCCCTCTTAC

lary sequencing. One of the sites (NM_000488.3:

ACGTTGGATGTCCACGGCTTTTGCTATGAC
ACGTTGGATGTTGCTGCTCATTGGCTTCTG
ACGTTGGATGATCACCGATGTCATTCCCTC

ACGTTGGATGTTCTGTTCTGAGCCCTCATC
c.1312A>G) could not be assayed, as common nearby
variable sites prevented primer design for the target. As a
quality control measure, 20 samples were genotyped in
duplicate. The genotyping success rate was 100% for all
samples and sites, and genotype concordance was 100%
for the samples genotyped in duplicate.

Statistical analysis

STATSDIRECT statistical software (version 1.8.10, StatsDir-

PCR primer 1

ect Ltd., Cheshire, UK) was used for calculation of the

proportion of thrombosis. Statistical significance was set
Table 2 Sequenom genotyping primer sequences

at a P-value of ≤ 0.05.

Results
NM_000488.3)
Variant (ref.

c.409-2A>G

A total of 20 variable sites in the coding regions and splice

c.1202A>G

c.1315C>G
c.1171C>T

c.1273C>T

c.374G>A
c.878G>C
c.743T>G

c.158G>T
c.855C>A
c.653T>A

c.508T>C
c.685C>T

c.218C>T

c.481C>T
c.89T>A

sites of SERPINC1 were identified (Table 3) by capillary

c.3G>T

sequencing in a subset of 58 affected individuals, one from

each family with at least two cases of type I or type II AT
deficiency verified in the new study sample. This included 30
g.173879969G>A

g.173876635G>A

g.173873149G>A

g.173883881G>A

g.173881080G>A
g.173881053A>G
g.173873107G>C
g.173878965C>G
g.173878988G>T
g.173886395C>A

g.173883941C>A
g.173879911A>C
g.173880001A>T

g.173884010A>T
g.173876604T>C

g.173881154T>C
g.173883725C>T

families with type II deficiency. The variable sites included

NC_000001.10)

two common synonymous variants, four nonsense variants,

Variant (ref.

one splice site variant, and 13 missense variants. Seventeen

of the 18 rare non-synonymous variants were successfully
genotyped on the Sequenom iPLEX platform. All of the 17

© 2013 International Society on Thrombosis and Haemostasis

 15387836, 2013, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jth.12364 by Nat Prov Indonesia, Wiley Online Library on [10/06/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Type II AT deficiency caused by p.Pro73Leu 1847

Table 3 The variable sites detected in the whole population with both type I and type II antithrombin deficiency

Genomic position Alleles Variant (ref. Effect (ref.

(ref. NC_000001.10) (ref./alt.) NM_000488.3) Exon NP_000479.1)* Effect† dbSNP identifier

173886395 C/A c.3G>T 1 p.Met1Ile – –

173884010 A/T c.89T>A 2 p.Val30Glu – rs2227624
173883941 C/A c.158G>T 2 p.Cys53Phe p.Cys21Phe –
173883881 G/A c.218C>T 2 p.Pro73Leu p.Pro41Leu rs121909551
173883725 C/T c.374G>A 2 p.Gly125Asp p.Gly93Asp –
173881154 T/C c.409-2A>G 3 Splice site variant Splice site variant –
173881080 G/A c.481C>T 3 p.Arg161Ter p.Arg129Ter rs121909562
173881053 A/G c.508T>C 3 p.Ser170Pro p.Ser138Pro –
173880001 A/T c.653T>A 4 p.Ile218Asn p.Ile186Asn –
173879969 G/A c.685C>T 4 p.Arg229Ter p.Arg197OPA –
173879911 A/C c.743T>G 4 p.Val248Gly p.Val216Gly –
173878988 G/T c.855C>A 5 p.Tyr285Ter p.Tyr253Ter –
173878965 C/G c.878G>C 5 p.Arg293Pro p.Arg261Pro –
173878862 T/C c.981A>G 5 p.Val327= p.Val295= rs5877
173878832 T/C c.1011A>G 5 p.Gln337= p.Gln305= rs5878
173876635 G/A c.1171C>T 6 p.Arg391Ter p.Arg359Ter –
173876604 T/C c.1202A>G 6 p.His401Arg p.His369Arg –
173873149 G/A c.1273C>T 7 p.Arg425Cys p.Arg393Cys –
173873110 T/C c.1312A>G 7 p.Arg438Gly p.Arg451Gly –
173873107 G/C c.1315C>G 7 p.Pro439Ala p.Pro407Ala –

alt., alternative.
*Predicted effect of the mutation on the full-length preprotein.
†Effect on the mature protein with the signal peptide cleaved out.

sites were variable, and all of the 105 healthy randomly
selected controls from FINRISK 2007 were homozygous
for the reference allele at every site.
The mutations detected in type II AT-deficient patients
were as follows: p.Pro73Leu (AT Basel) in 37 of 42
(88.1%) families; and p.Val30Glu (AT Dublin), p.
Arg425Cys and p.Pro439Ala in one family each. In two
families, no mutation was detected with the methods
used. All but one (p.Val30Glu) were also confirmed to be
unambiguously consistent with disease transmission in the
pedigrees under a dominant model. None of the muta-
tions detected in type I patients was observed in the
type II population.
AT Basel affects the heparin-binding site of the AT
molecule, interfering with its anticoagulant function. AT
few patients with either p.Arg425Cys or p.Pro439Ala, or
no detectable mutation (Fig. 1). In the family with the AT
Dublin mutation, two family members had a clear AT
type II deficiency, whereas two other carriers of the same
mutation had normal AT activity and antigen values.
The clinical complications reported by patients with the
AT Basel mutation are shown in Table 4. The population
consisted of 30 probands and 58 family members. The
information on age at first onset of thrombosis was avail-
able for 22 patients. The mean age at first venous throm-
bosis in these patients was 50 years (range: 8–64 years),
and that for arterial thrombosis was 45 years (range:
100
AT activity (%) by different assays

Dublin is located within the N-terminal signal peptide, 80

possibly affecting the processing of the precursor protein.
The cotransmission of the p.Val30Glu with AT deficiency 60
was not consistent in the pedigree, possibly because of
ambiguity in the definition of the AT deficiency pheno-
40
type in this family. p.Arg425Cys and p.Pro439Ala are Arg425Cys No mutation
located near the C-terminus, disruption of which is
20
reported to result in pleiotropic defects in AT function. Val30Glu
Pro439Ala
AT activity in the carriers of the founder mutation AT
0
Basel was classified as normal in all patients with the 0 2 4 6 8 10
activity assays Berichrom Antithrombin and HemosIL, Patient number
whereas the STA-Stachrom AT III and Innovance Anti-
Fig. 1. The antithrombin (AT) activity results obtained with five dif-
thrombin assays identified all patients correctly, and the
ferent assays are concordant in carriers of mutations other than AT
STA-Stachrom AT III assay with prolonged incubation Basel. ◊ STA-Stachrom AT IIIâ, + STA-Stachrom AT IIIâ pro-
time identified some patients as having AT deficiency. longed incubation time, Berichrom Antithrombinâ, D Innovance
There was no discrepancy in the activity results for the Antithrombinâ, 9 HemosIL Antithrombinâ.

© 2013 International Society on Thrombosis and Haemostasis

 15387836, 2013, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jth.12364 by Nat Prov Indonesia, Wiley Online Library on [10/06/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
1848 M. Puurunen et al

Table 4 Clinical picture in carriers of p.Pro73Leu This mutation was first described in a single patient in
1985 [19]. Later, one patient with recurrent arterial
Clinical complication Patients, N = 88, no. (%)
thrombosis at a young age was reported to carry the same
Any 45/88 (51.1) mutation [20]. The clinical picture caused by this muta-
DVT 19/88 (21.6) tion has been unknown.
Recurrent DVT 2/19 (10.5)
Mutations affecting the heparin-binding site of the AT
Arterial thrombosis 10/88 (11.3)
Arterial thrombosis < 45 years 5/88 (5.7) molecule have previously been reported to be of low
Obstetric complications 17/49 (34.7) importance with regard to thrombotic risk [8]. However,
Recurrent obstetric complications 7/17 (41.2) our study shows that AT Basel is a malignant mutation
Pregnancies (no.) 163 causing a severe clinical picture. The overall prevalence of
Early miscarriages (before week 10) 22/163 (13.5)
either thrombosis or pregnancy complications in this pop-
Late miscarriages 7/163 (4.3)
ulation was high (51.1%). Pregnancy complications were
DVT, deep vein thrombosis. reported by 34.7% of women who had been pregnant,
with almost half of them suffering from recurrent prob-
24–67 years). No correlation between the level of AT lems. In previous reports, the rate of miscarriages has
activity and the risk of thrombosis was seen; even at lev- been lower, at ~ 20% [2]. Interestingly, the prevalence of
els near and at the lower limit of normal (80–92%), deep vein thrombosis was 21.6%, which is lower than
thrombotic complications were as prevalent as in the previously reported, but nearly 12% of the patients had
patients with very low levels of AT activity (55–69%) experienced arterial thrombosis [7]. Especially striking
(data not shown). The demographics and risk factor pro- was the high prevalence of stroke at a young age, with
file of the patients with AT Basel are shown in Table 5. nearly 6% of AT Basel carriers suffering from an ische-
No temporary risk factors at the time of thrombotic event mic stroke before the age of 45 years. This finding is
could be identified in 19 of 45 (42.2%) patients. Detailed novel, as it has been previously assumed that arterial
information on the five probands with early-onset stroke thrombosis in patients with AT deficiency is a rare phe-
is shown in Table 6. nomenon [1,2,9]. The affected individuals did not have
other significant risk factors explaining the early onset of
Discussion cerebrovascular disease, which further emphasizes the
pathogenic role of the underlying mutation. Overall, 42%
Aided by the unique genetic structure of the Finnish pop- of thrombotic events were idiopathic, which is in line with
ulation, we were able to show that inherited type II AT previous reports.
deficiency is caused, in the great majority (88%) of Finns, Patients carrying the AT Basel mutation are not
by a single founder mutation, AT Basel (p.Pro73Leu). detected with all commercially available functional assays.
This phenomenon has been reported by Cooper et al. pre-
Table 5 Patient demographics and additional prothrombotic risk viously, and has been confirmed in our study [3,16]. How-
factors in carriers of p.Pro73Leu ever, the assay principle (either thrombin-based or FXa-
based) does not appear to be decisive, but rather the test
Characteristic No. Percentage
itself. Therefore, at least in the Finnish population, it is
Age (years), median (range) 50.1 (21.9–80.7) – of paramount importance to use a screening test that is
BMI, median (range) 26.3 (18.4–43.4) – capable of reliably detecting these patients. The AT activ-
Female 64 72.7
ity level as such was not associated with the risk of
Male 24 27.3
Smoker 14 15.9 thrombosis, and even individuals with results close to
Obese (BMI > 30) 23 26.1 normal levels did have thrombotic events. On the basis of
Elevated blood pressure 17 19.3 our results, we recommend the use of STA-Sta-
High cholesterol 28 31.8 chrom AT III or Innovance Antithrombin for screening
Diabetes 4 4.5
of AT activity. Genetic testing for AT Basel in all Finnish
Malignancy 1 1.1
patients with an AT activity value below the normal limit,
BMI, body mass index. even if the result is nearly normal, seems to be justified.
The prevalence of this mutation in other countries is not
Table 6 Characteristics of the patients with stroke at a young age known; therefore, it is difficult to make recommendations
Patient 1 Female aged 35 years, smoker, no other risk factors for testing in other populations.
Patient 2 Male aged 40 years, obese (BMI 33.1), high cholesterol The clinical picture in type II AT deficiency most likely
Patient 3 Male aged 41 years, high cholesterol, febrile varies according to the underlying mutation. Our study
for unknown cause population is unique in allowing us to draw conclusions
Patient 4 Male aged 42 years, no risk factors
from a significant number of patients carrying the same
Patient 5 Female aged 45 years, no risk factors
mutation. However, a limitation of our study is that not
BMI, body mass index. all family members participated. The population is likely

© 2013 International Society on Thrombosis and Haemostasis


to be biased towards having more clinical complications,
as those individuals with a more severe clinical picture
may have been more prone to take part than those with
few or no symptoms. All patients with early-onset stroke
were probands. It is not possible to estimate the overall
risk associated with the AT Basel mutation in asymptom-
atic family members, but the risk is likely to be signifi-
cantly higher than in the normal population.
Furthermore, our study does not answer the question of
the need for primary prevention of thrombosis in the car-
riers of the mutation. However, it would seem reasonable
to treat all known risk factors for arterial thrombosis
aggressively in these patients. Thromboprophylaxis in
high-risk situations is warranted, as suggested in the
guidelines.
Addendum
M. Puurunen, P. Salo, S. Engelbarth, K. Javela, and M.
Perola: contributed to the study design, collection and
critical analysis of the data, and writing of the article,
and approved the final version to be published.
Acknowledgements
This study was funded by the Finnish Red Cross, the
Foundation for Promoting Laboratory Medicine, and the
Research Foundation for Clinical Chemistry.
Disclosure of Conflict of Interests
The authors state that they have no conflict of interest.
References
1 Kottke-Marchant K, Duncan A. Antithrombin deficiency: issues
in laboratory diagnosis. Arch Pathol Lab Med 2002; 126: 1326–
36.
2 Patnaik MM, Moll S. Inherited antithrombin deficiency: a
review. Haemophilia 2008; 14: 1229–39.
3 Cooper PC, Coath F, Daly ME, Makris M. The phenotypic and
genetic assessment of antithrombin deficiency. Int J Lab Hematol
2011; 33: 227–37.
4 Tait RC, Walker ID, Perry DJ, Islam SI, Daly ME, McCall F,
Conkie JA, Carrell RW. Prevalence of antithrombin deficiency in
the healthy population. Br J Haematol 1994; 87: 106–12.
5 Lane DA, Bayston T, Olds RJ, Fitches AC, Cooper DN, Millar
DS, Jochmans K, Perry DJ, Okajima K, Thein SL, Emmerich J.
Antithrombin mutation database: 2nd (1997) update. For the
Plasma Coagulation Inhibitors Subcommittee of the Scientific
© 2013 International Society on Thrombosis and Haemostasis
15387836, 2013, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jth.12364 by Nat Prov Indonesia, Wiley Online Library on [10/06/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Type II AT deficiency caused by p.Pro73Leu 1849
and Standardization Committee of the International Society on
Thrombosis and Haemostasis. Thromb Haemost 1997; 77: 197–
211.
6 Antithrombin mutation database. http://www1.imperial.ac.uk/de
partmentofmedicine/divisions/experimentalmedicine/haematology/
coag/antithrombin/. Accessed 15 May 2013.
7 van Boven HH, Vandenbroucke JP, Briet E, Rosendaal FR.
Gene–gene and gene–environment interactions determine risk of
thrombosis in families with inherited antithrombin deficiency.
Blood 1999; 94: 2590–4.
8 Finazzi G, Caccia R, Barbui T. Different prevalence of thrombo-
embolism in the subtypes of congenital antithrombin III defi-
ciency: review of 404 cases. Thromb Haemost 1987; 18: 1094.
9 Mahmoodi BK, Brouwer JL, Veeger NJ, van der Meer J. Hered-
itary deficiency of protein C or protein S confers increased risk
of arterial thromboembolic events at young age: results from a
large family cohort study. Circulation 2008; 118: 1659–67.
10 Vossen CY, Conard J, Fontcuberta J, Makris M, van der Meer
FJ, Pabinger I, Palareti G, Preston FE, Scharrer I, Souto JC,
Svensson P, Walker ID, Rosendaal FR. Risk of a first venous
thrombotic event in carriers of a familial thrombophilic defect.
The European Prospective Cohort on Thrombophilia (EPCOT).
J Thromb Haemost 2005; 3: 459–64.
11 Khor B, van Cott EM. Laboratory tests for antithrombin defi-
ciency. Am J Hematol 2010; 85: 947–50.
12 van den Besselaar AM, Haas FJ, Kuypers AW. Harmonization
and external quality assessment of antithrombin activity assays.
Thromb Res 2012; 129: 187–91.
13 Kristensen SR, Rasmussen B, Pedersen S, Bathum L. Detecting
antithrombin deficiency may be a difficult task – more than one
test is necessary. J Thromb Haemost 2007; 5: 617–18.
14 Odegard OR, Lie M, Abildgaard U. Antifactor Xa activity mea-
sured with amidolytic methods. Haemostasis 1976; 5: 265–75.
15 Rossi E, Chiusolo P, Za T, Marietti S, Ciminello A, Leone G,
De Stefano V. Report of a novel kindred with antithrombin hep-
arin-binding site variant (47 Arg to His): demand for an auto-
mated progressive antithrombin assay to detect molecular
variants with low thrombotic risk. Thromb Haemost 2007; 98:
695–7.
16 Javela K, Engelbarth S, Hiltunen L, Mustonen P, Puurunen M.
Great discrepancy in antithrombin activity measured using five
commercially available functional assays. Thromb Res 2013; 132:
132–7.
17 Vartiainen E, Laatikainen T, Peltonen M, Juolevi A, M€annist€ o
S, Sundvall J, Jousilahti P, Salomaa V, Valsta L, Puska P.
Thirty-five-year trends in cardiovascular risk factors in Finland.
Int J Epidemiol 2010; 39: 504–18.
18 Laurell CB. Quantitative estimation of proteins by electrophore-
sis in agarose gel containing antibodies. Anal Biochem 1966; 15:
45–52.
19 Chang JY, Tran TH. Antithrombin III Basel. Identification of a
Pro-Leu substitution in a hereditary abnormal antithrombin with
impaired heparin cofactor activity. J Biol Chem 1986; 261: 1174–6.
20 Szilagyi S, Peter A, Magyar MT, Balogh S, Bereczky Z. Recur-
rent arterial thrombosis associated with the antithrombin Basel
variant and elevated lipoprotein(a) plasma level in an adolescent
patient. J Pediatr Hematol Oncol 2012; 34: 276–9.