Journal of Food Composition and Analysis 43 (2015) 25–38

Contents lists available at ScienceDirect

Journal of Food Composition and Analysis

journal homepage: www.elsevier.com/locate/jfca

Study Review

A review of recent advances in melamine detection techniques

Kobun Rovina, Shafiquzzaman Siddiquee *
Biotechnology Research Institute, Universiti Malaysia Sabah, Kota Kinabalu, Sabah, Malaysia

A R T I C L E I N F O A B S T R A C T

Article history: Melamine is a nitrogen-rich chemical that has received much attention in recent years owing to a series
Received 11 October 2014 of highly publicized food safety incidents. It is purposely added to foods by unethical manufacturers in
Received in revised form 29 March 2015 order to elevate the organic nitrogen content, thus increasing the price and the profit made from such
Accepted 6 April 2015
products. Recently, several methods have been established to determine melamine content.
Available online 14 May 2015
Unfortunately, most of these methods require complicated pre-concentration and costly instruments,
and are time-consuming. Analytical procedures based on biosensors have emerged in scientific literature
Keywords:
as a very promising alternative method due to their simplicity, speed and sensitivity. This review
Aptamer-based sensors
discusses current advances in detection techniques for melamine and its compounds. Current and past
Capillary electrophoresis
Gas chromatography–mass spectrometry melamine contamination incidents, as well as modern instruments and analytical methods for
Liquid chromatography–tandem mass determining the presence of melamine and its analogues are presented, and the characteristics of
spectrophotometry melamine and related compounds are also described.
Matrix assisted laser ß 2015 Elsevier Inc. All rights reserved.
desorption/ionization-mass
spectrophotometry
Melamine
Micellar liquid chromatography
Milk products
Molecularly imprinted polymer-based
sensors
Surface plasmon resonance
Food safety
Food analysis
Regulatory issues in food compositional
standards
Food composition

Contents

1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26
2. Melamine: what it is, how it is used . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26
2.1. Chemical structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26
2.2. Industrial applications of melamine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27
3. Toxicology and metabolism of melamine and its analogues . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27
4. Melamine adulteration incidents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27
5. Melamine levels in food . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28
6. Modern instrument analytical methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28
7. Advances in detection modes of the determination of melamine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29
7.1. Molecularly imprinted polymer-based sensors (MIP) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29
7.2. Aptamer-based sensors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29
7.3. Colorimetric sensor. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32
7.4. Electrochemical biosensor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33

* Corresponding author at: Biotechnology Research Institute, Universiti Malaysia Sabah, Jln UMS, 88400 Kota Kinabalu, Sabah, Malaysia. Tel.: +60 88320000x8467;
fax: +6088 320993.
E-mail address: shafiqpab@ums.edu.my (S. Siddiquee).

http://dx.doi.org/10.1016/j.jfca.2015.04.008
0889-1575/ß 2015 Elsevier Inc. All rights reserved.
26 K. Rovina, S. Siddiquee / Journal of Food Composition and Analysis 43 (2015) 25–38

7.5. Optical based biosensor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35

8. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35

1. Introduction (Cook et al., 2005) and micellar liquid chromatography (MLC)

(Beltran-Martinavarro et al., 2014). These methods are highly
Melamine is a nitrogen-rich heterocyclic triazine that is widely sensitive and specific, but also time-consuming, and they require
used in the synthesis of melamine formaldehyde resins (MFR) for the costly instrumentation, extensive sample preparation and highly
production of paper finishers, flame retardant, commercial filters, skilled personnel. On the other hand, enzyme-linked immunosor-
moulding compounds and wrinkle-free textile, as well as nanomater- bent assay (ELISA) methods have the advantages of high throughput
ials, since the 1950s (Mecker et al., 2012). Melamine has high nitrogen- and rapid turnaround time in comparison to analytical instrumental
rich content, 66% by mass. Accordingly, it has been illegally added to methods. However, the procedure requires labour-intensive opera-
dairy products by unethical milk producers to obtain an incorrectly tions including incubation, washing and enzymatic reactions during
higher readout of apparent protein content than that determined by the signal generation process. Thus, there is a need to develop
the conventional standard Kjeldahl test (Kim et al., 2010). simple, rapid, low-cost, convenient and highly sensitive methods to
This has been a cause of serious diseases and many infants were detect melamine in milk and dairy products.
intoxicated because the addition of melamine into food products Advances in chemistry, physics, biochemistry and molecular
can cause death. In 2007 contaminated pet food caused the death biology have led to the development of biosensors, which can
of house pets due to melamine-induced kidney failure. The detect a large range of biological elements with greater assay
melamine was added to the raw materials used to make the pet selectivity and sensitivity. The development of electrochemical
food in order to falsely increase the nitrogen content of the biosensors for the detection of melamine is an important advance
product. This case resulted in more than 5300 pet food products in melamine detection techniques owing to their sensitivity,
being recalled. After that, another case occurred in 2008, this time selectivity, low cost, simplicity and possibility for miniaturization,
involving infants in China. In 2008, melamine was found to be a portability and integration in automated devices (Farre et al.,
harmful additive in pet food, animal feed, milk and protein sources 2009). This electrochemical analytical technique is a viable
including wheat gluten, rice protein concentrate and corn gluten alternative for determining lower concentrations of melamine in
(Ehling et al., 2007; Mfiligenzi et al., 2008). In the Republic of China food and dairy products. Furthermore, only a small amount of
about 294,000 children became victims of melamine-tainted milk, sample is needed when using nanotechnology. So far these
and six deaths were reported (Zhou et al., 2011). Ping et al. (2012) nanotechnologies have shown great potential for high throughput
reported that melamine and its metabolites are absorbed in the and rapid detection of melamine in developing technology (Sun
gastrointestinal tract and precipitate in the kidney to form crystals et al., 2010a).
resulting in the formation of kidney stones. The goal of this review is to cover recent advances in melamine
Melamine by itself has low toxicity, but when it is combined detection techniques. This review also discusses the physical and
with cyanuric acid it forms insoluble crystals which lead to kidney chemical structure of melamine, its applications and current and
stones or kidney toxicity. The outbreak of the acute renal failure in past melamine contamination incidents. An overview of the recent
cats and dogs in 2007 after the consumption of contaminated pet development of analytical methods for measuring melamine and
food suggested that the co-ingestion of melamine and cyanuric its analogues in various tainted foods are presented. Analytical
acid causes renal toxicity to occur (Brown et al., 2007; WHO, determination of melamine levels in food product is extremely
2008a). Melamine cannot be metabolized by the body; approxi- important due to its toxicity to humans and animals, which has
mately 90% of ingested melamine is excreted by the kidneys within caused many countries around the world to establish strict
24 h. The distribution of melamine is likely limited to the body controls for foods likely to be contaminated during harvest or
water fraction as melamine is unlikely to be bound in significant storage.
amounts to body tissues. When the amount of melamine ingested
exceeds the excretion capability of the kidneys, renal disease and
even death may occur. 2. Melamine: what it is, how it is used
The strong affinity between melamine and cyanuric acid results
in the formation of an insoluble melamine–cyanurate complex 2.1. Chemical structure
through hydrolysis. In this process the hydrogen bonding causes
crystallization, which leads to tissue injury including urolithiasis, Melamine (C3H6N6; MW: 126.12) is a small polar molecular
bladder cancer and even death (Lee et al., 2011; Sun et al., 2011; compound that contains three amino groups that is found in the
Cao et al., 2010; Langman et al., 2009). In order to regulate form of white crystals with high nitrogen levels (Liu et al., 2012).
melamine levels in food products and ensure national safety limits Interestingly, melamine can be hydrolyzed via deamination
it is necessary to establish rapid, effective, and sensitive melamine reactions and formed from cyanuric acid (2,4,6-trihydroxy-1,3,5-
detection methods. triazine), ammeline (4,6-diamino-2-hydroxy-1,3,5-triazine), and
The recent issues with melamine in food products have led to ammelide (6-amino-2,4-dihydroxy-l,3,5-triazine) under strong
extensive and intensive laboratory monitoring work. Recently, acidic and alkaline conditions. Melamine and its analogues are
various analytic methods have been developed and used to analyze also able to self-assemble in high molecular weight complexes
the level of melamine in food samples. Several methods are included organized by intra-molecular networks of hydrogen bonds and p–
such as gas chromatography (GC) (Yokley et al., 2000), high p aromatic ring stacking (Whitesides et al., 1991).
performance liquid chromatography (HPLC) (Ehling et al., 2007), Cyanuric acid is an oxytriazine melamine analogue that may be
high performance liquid chromatography/mass spectrum (HPLC/ produced as a by-product in melamine synthesis. It is a primary
MS) (Kim et al., 2008), surface enhanced Raman spectroscopy (Lin component in feed-grade biuret and a ruminant feed additive.
et al., 2008), capillary zone electrophoresis/mass spectrum (CE/MS) Cyanuric acids derivatives are components in sanitizing solutions
 K. Rovina, S. Siddiquee / Journal of Food Composition and Analysis 43 (2015) 25–38
used on food-processing equipment, utensils and other food
contact articles that regulated in the US. It can be found in
swimming pool water as the dissociation product of dichloroiso-
cyanurate, which is used for water disinfection. Drinking water is
also disinfected using sodium dichloroisocyanurate, which rapidly
dechlorinates to cyanurate (Matte et al., 1990).
Ammelide and ammeline are monoamino- and diaminooxy-
triazine analogues, which are produced as by-products of
melamine synthesis. Ammeline is used in lubricating greases
(USFDA, 2007). It can be obtained by heating dicyandiamide with
aqueous ammonia at 160–170 8C or synthesized by heating
melamine with concentrated sulfuric acid (H2SO4) for a short
time at 190 8C. Ammelide decomposes at 170 8C with water to form
carbon dioxide and ammonia. The physical and chemical proper-
ties of melamine and its analogues are shown in Table 1.
2.2. Industrial applications of melamine
In 2007, approximately 1.2 million tonnes of melamine were
produced worldwide, with the main producers located in China
and Western Europe (Bizzari and Yokose, 2008). Melamine
synthetically produced from chemicals production is generally
used in plastics, adhesives, laminates, paints, permanent-press
fabrics, flame retardants, textile finishes, tarnish inhibitors, paper
coatings and fertilizer mixtures (Zhang et al., 2008). Melamine can
be used as a colourant and as a fertilizer; however, the direct
addition of melamine to food is not approved in the USA. It is also a
common monomer in the manufacturing of plastics usually used in
the production of tableware such as cups, bowls, plates and
utensils (Liang et al., 2009). Melamine–formaldehyde polymer is
considered ideal for food contact applications due to its hardness,
heat resistance and general stability (De Fatima Pocas and Hogg,
2007). Melamine is also used in the production of pesticides. It can
be metabolized by two strains of soil bacteria, Pseudomonasstrain A
and Klebsiella terragena, and through successive de-amination
reactions, gives rise to ammeline, ammelide and cyanuric acid,
which are further broken down into biuret, urea and, ultimately,
ammonia and carbon dioxide (Shelton et al., 1997).
3. Toxicology and metabolism of melamine and its analogues
Melamine and cyanuric acid are quickly absorbed and excreted
in a crystal form in the urine of mono-gastric animals as they are
not metabolized by the body. The absorption, metabolism,
distribution, excretion and toxicokinetics of melamine have been
systemically investigated in various mammalian species such as
mice, dairy goats and pigs (Baynes et al., 2010). Hau et al. (2009)
reported that direct contact with melamine results in skin
irritation, and inhalation of melamine causes respiratory tract
irritation. Oral ingestion affects the digestive tract, resulting in
nausea, vomiting, and diarrhoea. In severe cases, hypertension,
Table 1
Physical and chemical properties of melamine and analogues.
Melamine
Structure
Chemical formula C3H6N6
Molecular weight (g/mol) 126.12
% nitrogen (w/w) 66.6
Appearance Fine white crystalline powder
Melting point (8C) 345–347 decomposes
Isoelectric point
Aqueous solubility (mg/l) 3240
27
oedema, or oliguria may also be observed, due to the interaction of
melamine with isomers to form crystals. The combination of
melamine and cyanuric acid causes the formation of crystals which
can lead to acute renal failure in animals, especially cats, within
48 h after ingestion. Melamine has been reported a low acute
toxicity, with lethal doses from oral intake in mice and rats
exceeding 3000 mg/kg body weight. However, some subchronic
studies in rats and mice have reported lethal doses of up to
18,000 mg of melamine/kg feed are related to the excretory organs
(Hau et al., 2009).
4. Melamine adulteration incidents
Since 1958, melamine has been added to cattle feed as a non-
protein nitrogen (NPN). However, it was discontinued in 1978
because it was found to be completely hydrolysed in ruminants
(Newton and Utley, 1978). In March 2004, Brown et al. (2007)
reported incidents of pet illness and acute renal failure occurring in
several Asian countries due to consumption of pet food products
manufactured at a single factory in Thailand. Subsequently,
consumers and other veterinarians reported on more illnesses
and deaths in pets that were potentially associated with the pet
food consumed. In 2007 and 2008, there were two reported
outbreaks of food-borne illnesses associated with melamine in
products such as milk, infant formula, frozen yoghourt, pet food,
biscuits, candy, and coffee drinks (Andersen et al., 2008).
The contamination of food with melamine became a hot issue in
September 2008 when the World Health Organization (WHO)
reported that more than 47,000 infants and young children in
China had been hospitalized due to urinary problems, renal tube
blockages, kidney stones and the death of several infants after the
consumption of melamine-contaminated infant formula and other
related dairy products. The contaminations of milk products were
further investigated by the Administration of Quality Supervision,
Inspection and Quarantine (AQSIQ), which revealed that 22
commercially available brands from China contained melamine
in their milk products. Melamine and its compounds were found at
levels ranging from 0.8% to 26% in wheat gluten and rice protein
extracts imported from China that were used to manufacture pet
food in the USA (Satzger, 2008). The State Council of China
announced that melamine levels in most food products ranged
from 0.09 mg/kg to 619 mg/kg, with products from the Shijangz-
huang Sanlu Company containing the highest levels of melamine,
up to 2563 mg/kg (WHO, 2008b). Other melamine-contaminated
food products that came from China included liquid milk,
confectionaries, frozen yoghourt, beverages and biscuits.
Other countries have also reported the presence of melamine in
other food products such as non-dairy creamer, ammonium
bicarbonate, dried whole egg and fresh hen eggs. The melamine
content in eggs was probably due to tainted feed and other
Cyanuric acid Ammelide Ammeline References
Liu et al. (2012)
C3H3N3O3 C3H4N4O2 C3H5N5O
129.07 128.09 127.10
32.6 43.7 55.1
White crystalline solid White powder White powder Bizzari and Yokose (2008)
360 Decomposes Decomposes
6.66
2000 76.9 75
28 K. Rovina, S. Siddiquee / Journal of Food Composition and Analysis 43 (2015) 25–38
milk-containing products made in China and also in other
countries of the world.
5. Melamine levels in food
The increased level of concern for food safety due to the
contamination of infant formula in 2008 has cased national
authorities and other organizations to assess tolerable daily intake
(TDI) in order to protect the general population including infants.
The dietary exposure to melamine and the risks caused by it were
also assessed (Wu and Zhang, 2013). Many countries worldwide
have currently established a tolerance level for melamine in order
to ensure a safe food supply and protect the health of their citizens.
This highlights the importance of a reliable and rapid method for
the detection of melamine.
TDI is an estimation of the maximum exposure to a certain
agent that the population may be exposed to or introduced to daily
in their lifetimes without any large risk (WHO, 2004). The FDA was
the first organization to provide an estimate for the TDI of
melamine due to the incidence of pet food contamination with
melamine. The initial TDI for melamine provided by the FDA was
0.63 mg/kg. This initial value was made by the analysis of data
taken from selected animal toxicity assays conducted by the
National Toxicology Programme (NTP) of the US Department of
Health and Human Services (NTP, 1983).
The World Health Organization has established a TDI for
melamine at 0.2 mg/kg of body mass. Maximum residue levels
(MRLs) for melamine have been established worldwide. The MRL
for infant formula in China and US is 1.0 mg/kg and 2.5 mg/kg for
milk and other milk products consecutively. In Europe, the Food
Safety Authority has established a limit of up to 2.5 mg/kg for all
products that have milk content greater than 15% (WHO, 2009). A
safety limit of melamine ingestion has been officially set by the
United Stated Food and Drug Administration (US FDA) at 2.5 ppm
for adults and at 1 ppm for infant formula (Zhu et al., 2009). The
Malaysian Ministry of Health has set MRLs for melamine content at
1.0 mg/kg in baby food products and 2.5 mg/kg for adult food
products (Wu and Zhang, 2013), while other countries such as New
Zealand, Nigeria and Canada have also set their own MRLs for
melamine content in food.
6. Modern instrument analytical methods
The presence of the melamine and related triazine compounds
in many milk products, animal feeds and other foods has increased
demand for a reliable method to determine melamine levels in
milk. Thus need to establish a more sensitive and accurate
technique capable of screening samples and confirming the
presence and level of melamine and other metabolites are
important due to the presence of melamine in milk, animal feeds
and other foods (Liu et al., 2012). Authorities and other parties have
involved in the food industry worldwide need to impose
regulations on melamine levels in these products to allowable
limits. To address this need, several methods have been developed
and published for determination of melamine. These methods can
be categorized into modern instrument analytical methods,
immunological assays and novel detection methods.
Modern instrument analytical methods that have been devel-
oped to detect the presence of melamine in milk are capillary
electrophoresis (CE), matrix assisted laser desorption/ionization-
mass spectrophotometry (MALDI-MS), nuclear magnetic reso-
nance (NMR), high performance liquid chromatography (HPLC),
micellar liquid chromatography (MLC), liquid chromatography–
tandem mass spectrophotometry (LC–MS/MS), gas chromatogra-
phy–mass spectrometry (GC–MS), low temperature plasma probe
combined with tandem mass spectrophotometry (LTP-MS2), and
vibrational spectroscopy and chemiluminescence (CL) analysis
(Sun et al., 2010b). Although these methods are very sensitive, time
consuming and labour intensive due to the complicated pre-
treatment of samples, which requires expensive instrumentation
and also high personnel cost (Ping et al., 2012).
The capillary electrophoresis method separates melamine by
applying a strong electric field to separate molecules. The
compounds are separated based on the difference in their
hydrophobicity, size and charge (Sun et al., 2010b). Basically,
capillary electrophoresis is a cost-effective and also efficient
analytical method used for small molecules. Its advantages include
requiring few samples, consuming fewer reagents and having a fast
separation speed. The pre-treatment steps for samples involving
melamine in milk and other matrices are simple. However, when
coupled with UV light, the sensitivity and reproducibility of the
detection is reduced.
Mass spectrometry (MS) methods are well known for being able
to easily determine contaminants due to the specificity and high
sensitivity of the methods. Currently, several LC–MS and LC–MS/
MS techniques are employed in labelling melamine and improving
the precision of developing methods (Chu et al., 2010; Desmarche-
lier et al., 2009). The FDA has proposed the use of LC–MS/MS as an
interim method for the determination of melamine and cyanuric
acid residues in foods at levels of 0.25 mg/kg in infant formula and
other dairy-containing food products or ingredients (FDA, 2009).
In recent years, HPLC has proven to be one of the most powerful
techniques for the analysis of biological matrices and pharmaceu-
tical preparations due to its high efficiency and good reproducibil-
ity. This method is able to simultaneously detect presence of
melamine and its analogues in rice, wheat and corn flours. The
detection limit of melamine is 5 ppm (Ehling et al., 2007).
However, HPLC is not always able to confirm target analytes
and is not a very accurate method for determining melamine. The
UV spectra for melamine has an absorption below 250 nm and
therefore erroneous quantification can occur if there is insufficient
care paid to the chromatographic conditions and optimization of
samples is not done (Sun et al., 2010b).
A method of high performance liquid chromatography with
fluorescence detection (HPLC-Fluo), based on studies of the
natural fluorescence emission of melamine (250/365 nm) has
developed and validated for melamine determination as an
adulterant of bovine UHT whole milk (Finete et al., 2015). A linear
range obtained from 0.05 to 10.0 mg/mL, with a value of r2 equal to
0.9998. The limits of detection and quantification of melamine are
0.0081 and 0.027 mg/mL respectively, or 0.023 and 0.076 mg/g of
milk, respectively. An overall mean recovery rate found of
95.4  1.2% (n = 9). Finete et al. (2014) have been reported that
high performance liquid chromatography with fluorescence detec-
tion (HPLC-Fluo) method is determined melamine in kitchen plastic
ware and limit of detection and quantification of melamine found of
0.0081 and 0.027 mg/mL, respectively, with a linear range
upto10 mg/mL. The results indicated that the use of kitchen plastic
ware made of melamine can contaminate food after heating in a
microwave oven.
MALDI-MS methods require extensive, time consuming and
costly sample pretreatment, which includes the extraction,
purification and derivatization of samples (Sun et al., 2010b).
The GC method is a common confirmation method used to analyze
melamine and its related compounds. The FDA initially developed
a GC–MS screening method in which melamine in sample extracts
was derivatized with trimethylsilyl (TMS) agent prior to analysis
(FDA, 2008). This method has been further improved by the
application of gas chromatography coupled with tandem mass
spectrometry (GC–MS/MS) and the use of 2,6-diamino-4-chlor-
opyrimidine as an internal standard (IS) with an LOD which could
reach 2 mg/kg (Miao et al., 2009). However, instrumentation is
 K. Rovina, S. Siddiquee / Journal of Food Composition and Analysis 43 (2015) 25–38
expensive and sample pre-treatment time-consuming in these
methods (Liu et al., 2012).
Enzyme Linked Immunosorbent Assays (ELISA) is screening
methods commonly used for large amounts of samples due to
simple sample preparation and low cost. They are also very sensitive,
fast and have high throughput. These methods have been used on
commodities such as milk, milk powders, wheat products and feeds
(Garber and Brewer, 2010; Yin et al., 2010). The Fluorescence
Polarization Immunoassay (FPIA) is especially for milk and milk
powders with an LOD of 9.3 ng mL1 (Wang et al., 2011). ELISA
methods are sufficiently sensitive and selective for the detection of
melamine. The sensitivity of ELISA techniques are greater compared
to LC methods. However, the drawback of these methods is the
possibility of false positives, which occur because most of the
antibodies show cross reactivity to structures of melamine related
compounds. Therefore, positive samples from ELISA methods need
to be rechecked for confirmation (Liu et al., 2012).
Micellar liquid chromatography-method has developed for
determination of melamine in swine kidney reported by Beltran-
Martinavarro et al. (2014). Melamine is eluted from the HPLC
column without interferences in <8.0 min. Mobile phase is a
0.11 M sodium dodecyl sulfate 7.5% propanol at pH 3 solution
running under isocratic mode through a C18 column at 1 mL/min
and absorbance detection at 210 nm. This method is validated
according to the Food and Drug Administration guidelines:
sensitivity, calibration range (0.3–30 mg/g), linearity
(r2 > 0.9997), precision (<7.6%), accuracy (8.3–3.6%), recovery
(82.1–92.4%) and robustness (<5.1%). In similar studies done by
Rambla-Alegre et al. (2010) and have eluted of melamine in nearly
9.3 min without overlapping the protein band or other endoge-
nous compounds. Validation has performed the following
analytical parameters are: linearity (0.02–100 ppm; r2 = 0.999),
limit of detection (5 ppb), intra- and inter-day precision (R.S.D.
<7.6% and <9.7%, respectively) and robustness (R.S.D. <7.4% for
retention time and <5.0% for area). Recoveries for several milk
samples are found in the 85–109% range.
Batista et al. (2014) have been used silica, C8 and C18
monolithic column for separation on a sequential injection
chromatography (SIC) system due its low-pressure operation.
The micellar chromatography on a SIC system is applied for the
determination of melamine in milk. A linear response is observed
within 2.0 and 6.0 mg/L of melamine with a LOD of 0.6 mg/L and
coefficients of variation at 2.9% (n = 6). Marco-Peiro et al. (2012)
have reported for the resolution and quantification of melamine in
plasma and urine has eluted in nearly 6.3 min without overlapping
the protein band or other endogenous compounds. The validation
has satisfactorily performed the following parameters are:
linearity (0.25–25 ppm; r2 > 0.9995), sensitivity, limit of detection
(50 ppb), limit of quantification (250 ppb), intra and inter-day
precision (RSD 0.7–10.2% and 1.0–9.1%, respectively) and recovery,
calculated as accuracy (85.7–103.8% and 94.8–103.6%, respective-
ly) and robustness (R.S.D. <7.1%).
Moreover, sample analyses should only include semi-quantita-
tive analyses and should use a specific antibody which works
against analytes. A summary of the methods that have been used
for the determination of melamine is shown in Table 2.
7. Advances in detection modes of the determination of
melamine
To date there have been several advances in detection methods
used to determine the level of melamine in milk products. For
about sixteen years, sensor technology has been widely used for
the detection of residues in foods because of its sensitivity,
rapidity, simplicity and cost effectiveness.
29
7.1. Molecularly imprinted polymer-based sensors (MIP)
Recently, molecular imprinting has received considerable
attention in the fields of polymer science and chemical analysis
due to its predetermined selectivity for target molecules, and its
high affinity and robustness of recognition. Generally, MIP is
synthesized in the presence of functional monomers, template
molecules and a cross-linking agent by covalent, non-covalent and
sacrificial spacer methods. For their stability, low cost and easy
preparation, MIP has gained wide acceptance as molecular
recognition materials in developing sensors.
A chemosensor based on MIP film has developed by Pietrzyk
et al. (2009) for selective detection of melamine. The method
combined a melamine-templated MIP-selective recognition film
and the piezoelectric transducer of a bulk-acoustic-wave resona-
tor. The MIP film is prepared by electropolymerization with
bis(2,20-bithienyl)- benzo-[18-crown-6]methane as a functional
monomer, and 3,30 -bis[2,20 -bis(2,20 -bithiophene-5-yl)] thia-
naphthene as a cross-linking monomer. The chemosensor has
been used successfully for the determination of melamine with an
LOD as low as 5 nM. Similarly, Liang et al. (2009) developed a
potentiometric sensor based on MIP for the determination of
melamine in milk. They used methacrylic acid as the functional
monomer and ethylene glycol dimethacrylate as the cross-linking
agent to fabricate a polymeric membrane, and an ion-selective
electrode for the detection of melamine in milk with an LOD of
6.0 mM. MIP-based sensing technology provides a useful platform
for the detection of melamine and its analogues and could be
applied for fast on-site monitoring of samples.
Furthermore, Ting et al. (2011) was developed a simple
electrochemical sensor based on MIP of para-aminobenzoic acid
(pABA) for melamine detection. The poly(para-aminobenzoic acid)
(P-pABA) film was deposited in apABA solution by potentiody-
namic cycling of potential with and without melamine on GCE. The
schematic interaction of H-bond between P-pABA and melamine
was shown in Fig. 1. In the optimal conditions, the relative redox
peak currents of hexacyanoferrate were linear. The concentration
of melamine ranged from 4.0 mM to 0.45 mM, with a linear
correlation coefficient of 0.9992 and LOD of 0.36 mM (S/N = 3). The
MIP sensor was successfully applied to the determination of
melamine in milk products with good precision and accuracy, and
it can be used as a routine method for the analysis of melamine in
food samples (Ting et al., 2011).
7.2. Aptamer-based sensors
Aptamer is a synthetic single-stranded nucleic-acid or peptide
molecules binding to specific target with high affinity and
specificity. It is normally screened with a combinatorial technique
called systematic evolution of ligands by exponential enrichment
(SELEX) (Citartan et al., 2012; Ellington and Szostak, 1990).
Aptamers offer several advantages over antibodies as they are
spontaneously synthesized possess appropriate storage properties
and could be modified so easily. Owing to their inherent
superiorities, they are widely used as recognition elements in
biosensor construction and entirely helpful in the detection of a
wide range of substances from metal ions, organic molecules,
peptides, protein to cells (Liu et al., 2009; Song et al., 2008).
The ability of pyrimidine to form hydrogen bonds with purines
has been well documented, and the hydrogen bonding between
thymine and 2,6-diamino-5-methylpyrimidin-4-one, which has a
similar molecular structure as melamine has been reported by
Chen et al. (2004). The single stranded oligonucleotide containing
thymines are bound to melamine via hydrogen bonding. Based on
this, recently several aptamer-based biosensors have been
developed for melamine detection. The selected aptamers are
30 K. Rovina, S. Siddiquee / Journal of Food Composition and Analysis 43 (2015) 25–38

Table 2
Summary of published methods for determination of melamine and related compounds in food products.

Method Matrix Analyses Detection limit Reference

LC–MS/MS Human urine Melamine, Cyanuric acid 0.00066 mg/kg Panuwet et al. (2012)
LC–MS/MS Rat plasma, liver, kidney, Melamine 0.00560–0.0083l mg/kg Wu et al. (2009)
spleen, bladder, and brain
LC–MS/MS Milk-based products and Melamine 0.01–0.10 mg/kg Ibáñez et al. (2009)
other food and beverage products
LC–MS/MS Milk and dairy products Melamine, Cyromazine 10 mg/kg Feng et al. (2008)
LC–MS/MS Kidney tissue Melamine, Ammeline, 0.092–0.140 mg/kg Filigenzi et al. (2008)
Ammelide, Cyanuric acid
LC–MS/MS Catfish, trout, tilapia, salmon, Melamine 0.0032 mg/kg Andersen et al. (2008)
and shrimp
LC–MS/MS Porcine muscle Melamine 0.0017 mg/kg Filigenzi et al. (2007)
LC–MS/MS Infant formula 4 ng/g Tittlemier et al. (2009)
LC–MS Catfish, pork, chicken, and pet food Melamine, Cyanuric acid 0.01 mg/kg Varelis and Jeskelis (2008)
HPLC–MS/MS Kidney tissue 1 mg/mL Filigenzi et al. (2008)
HPLC–MS/MS Muscle tissue 1.7 ng/g Filigenzi et al. (2007)
HPLC–MS/MS Porcine muscle tissue Melamine 1.7 ng/g Filigenzi et al. (2007)
HPLC–DAD Milk and dairy products Melamine 0.035–0.110 mg/kg Filazi et al. (2012)
HPLC–DAD Liquid milk Melamine 0.018 mg/kg Sun et al. (2010b)
HPLC–DAD, LC–MS/MS Plant origin protein powder Melamine 10 and 0.5 mg/kg Ding et al. (2008)
HPLC–DAD Rice protein concentrate feeds Melamine, Ammeline, 55–113 mg/kg Muñiz-Valencia et al. (2008)
Ammelide, Cyanuric acid
HPLC–DAD Pet food Melamine 0.1 mg/ml Kim et al. (2008)
HPLC–UV Infant formula Melamine 0.1 mg/kg Venkatasami and Sowa (2010)
HPLC–UV Dairy products Melamine 0.003 mg/kg Zheng et al. (2012)
HPLC–UV Cereal flours Melamine, Ammeline, 5–90 mg/kg Ehling et al. (2007)
Ammelide, Cyanuric acid
HPLC-Fluo Bovine UHT whole milk Melamine 0.0081 mg/mL Finete et al. (2015)
HPLC-Fluo Kitchen plastic ware Melamine 0.0081 mg/mL Finete et al. (2014)
GC–MS/MS Milk and milk products Melamine, Ammeline, 0.002 mg/kg Miao et al. (2009)
Ammelide, Cyanuric acid
GC–MS Milk products Melamine 0.0003 mg/kg Li et al. (2009)
GC–MS Liquid milk and milk powder Melamine 0.1 mg/kg Xu et al. (2009)
GC–MS Eggs Melamine 0.01 mg/kg Xia et al. (2009)
GC–MS Muscle 10 mg/kg Zhu et al. (2009)
LC–GC–MS Soil 2.5 ppb, 0.05 ppb Yokley et al. (2000)
MALDI-MS Urine 12.5 mg/mL Tang et al. (2009)
MALDI-MS Pet food Cyanuric acid 1.0 mg/kg Han et al. (2009)
NIR/FTIR Infant formula powder 1 ppm Mauer et al. (2009)
DAPCI-MS Milk 0.08 mg/kg Yang et al. (2009)
nanoEESI Milk 0.2 mg/L Li et al. (2009)
CE-DAD Milk 0.047 mg/mL Chen et al. (2009)
LTP-MS/MS Milk powder 6 ppb Huang et al. (2009)
LTP- MS/MS Lamb tissues, serum 10 ng/g Lv et al. (2010)
NMR Milk product 0.69 mg/kg Lachenmeier et al. (2009)
MLC Liquid and powdered Melamine 9 ng mL1 Beltran-Martinavarro et al. (2012)
milk samples
MLC Swine kidney Melamine 5 ppb Beltran-Martinavarro et al. (2014)
MLC Milk Melamine 0.6 mg/L Batista et al. (2014)
MLC Plasma and urine Melamine 50 ppb Marco-Peiro et al. (2012)

commonly the single stranded oligonucleotide of thymines with
the difference on the length of the sequence.
Qi et al. (2010) have proved that single-stranded DNA oligomers
including polyAn, polyCn, polyGn and polyTn could make AuNPs
stable without aggregation owing to enough negative charges on
their surface. The presence of melamine in the medium makes the
polyTn-stabilized AuNPs aggregate, indicating that specific inter-
actions occur between melamine and polyTn and the stability of a
single base unit in polyTn decreases with the length increase of the
polyTn. It is demonstrated the novel specific recognition of
melamine with thymine and this triple H-bond motif in aqueous
medium. Later, Huang et al. (2011) developed an aptamer-AuNPs-
based colorimetric sensor using label-free and labelled AuNPs. In
the label-free AuNPs procedure (as shown in Fig. 2), AuNPs are
coated by the negative-charged citrate ions which could prevent
AuNPs from aggregation in aqueous solution, while induce the
AuNPs aggregation in the presence of high concentration of salt.
However, aptamers (poly-T10) could strongly adsorb on AuNPs and
enhance the stability of AuNPs against the NaCl-induced aggrega-
tion. In the presence of melamine, aptamers will competitively bind
with melamine by the stronger affinity which will decrease the salt
tolerance of AuNPs and will result in the subsequent aggregation of
AuNPs.
In the label-based AuNPs procedure, the single-stranded
oligonucleotide labelled AuNPs is used for melamine determina-
tion, which is based on the combination of thymine with melamine
(Huang et al., 2011). The HSssDNA (HS-(CH2)6-TAGCTATG
GAATTCCTCGTAGGCATTTTTT) was first attached to the surface
of AuNPs. The DNA functionalized AuNPs can assemble when the
oligonucleotides hybridize, which causes the changes of colours.
Melamine could induce the hybridization. When added the
melamine, the functionalized AuNPs is assembled upon binding
of the oligonucleotide to melamine, which resulted in the red-to-
blue colour change. This assembly process is particularly revers-
ible. The dissociation occurs upon thermal denaturation, leading to
a blue-to-red colour change. Both assays are high selectivity and
high sensitivity with the detection limits are of 41.7 nM and
46.5 nM, respectively. The label-based method provides a better
stability, a better accuracy and a larger response range when
compared with label-free method.
 K. Rovina, S. Siddiquee / Journal of Food Composition and Analysis 43 (2015) 25–38 31

Fig. 1. The schematic of H-bonds and ‘‘p–p stacking’’ interaction (inset) between P-pABA and melamine in a polymerization complex (Ting et al., 2011).

Similarly, an AuNPs-based colorimetric aptasensor for mela-
mine has been developed using salt-induced aggregation of AuNPs
(Yun et al., 2014). They used 50-TTTTTTTTTTTTTTTTTTTT-30(dT20)
as melamine aptamer. The detection limits were found to be
1.5 mg/L to the naked eye, and 0.5 mg/L using UV–vis spectrome-
ter. The resonance scattering (RS) analysis is a new, rapid, simple,
convenient and sensitive analytical technique and has applied to
the analysis of trace nucleic acid, protein, drug and so on (Chen
et al., 2009a). The RS effect of nanoparticles has combined with a
highly selective aptamer reaction to assay Hg2+ and K+ with
satisfactory results (Cai et al., 2010; Wen et al., 2010). An RS
spectral assay has been developed using aptamer-modified AgNPs
as probe (Liang et al., 2011). AgNPs are modified by a single-strand
DNA to fabricate an Ag-aptamer probe for melamine. In the

Fig. 2. Aptamer-based colorimetric sensor for the detection of melamine (Huang et al., 2011).
32 K. Rovina, S. Siddiquee / Journal of Food Composition and Analysis 43 (2015) 25–38
presence of NaCl, the probe is stable. The increased RS intensity is
linear to melamine concentration in the range of 6.31–378.4 mg/L
with a detection limit of 3.1 mg/L.
7.3. Colorimetric sensor
The reaction between melamine and cyanuric acid or its
derivatives forms a stable cyanuric acid–melamine complex
through the interaction between diaminopyridine and diimide
moieties which exhibit three complementary NH  O and NH  N
hydrogen bonds. Such triple hydrogen bonding is considered to be
particularly useful for controlling molecular self-assembly due to
the reversibility, specificity, directionality and cooperative strength
of this class of interactions (Lehn et al., 1990; Sherrington and
Taskinen, 2001). Thus, the combination of melamine with cyanuric
acid derivatives has been used in the detection of melamine using Au
NPs, Ag NPs, Quantum Dots (QDs) and magnetic nanoparticles
(MNPs). Several researchers have reported on the use of Au NPs and
Ag NPs as colorimetric probes for chemical sensing and biosensing of
various substances including melamine in milk (Hong et al., 2012;
Hua et al., 2011). Thus, several colorimetric systems have been
Fig. 3. (A) Schematic representation of the colorimetric detection for melamine. (B) Visual colour change and the spectrophotometric demonstration.
Source: Lee et al. (2008) and Liu and Lu (2004).
designed to detect proteins, ions, viruses, DNA, cancerous cells,
b-lactamase and melamine using NPs.
Melamine controls the assembly of cyanuric acid derivative and
stabilizes Au NPs through hydrogen-bonding recognition, which
allows the optical properties of Au NPs to be tuned (Han and Li,
2010; Lee et al., 2010; Qi et al., 2010). According to Ai et al. (2009)
the existence of melamine reduces stability against aggregation
and causes Au NPs to visibly change colour from red to blue in a few
seconds. Au NP solutions show a particular colour because of the
surface electron oscillations induced by visible light of suitable
wavelength, which is dependent on inter particle spacing (Xing
et al., 2013). Au NPs easily bind to melamine due to the presence of
three amine groups (–NH2) in melamine (Fig. 3A). Fig. 3B shows the
colour changes and UV spectra of melamine–AuNPs after reaction.
The optical change in colour can be used to directly indicate the
presence of melamine in milk products (Lee et al., 2008). Melamine
has multiple binding sites including three exocyclic amino groups
and a three-nitrogen hybrid ring, which have strong binding
affinity to Au NPs by ligand exchange with weakly surface-bound
citrate ions and cross-link Au NPs (Chi et al., 2010). This enables
aggregation and causes a significant shift in the extinction
 K. Rovina, S. Siddiquee / Journal of Food Composition and Analysis 43 (2015) 25–38
spectrum as the solution colour changes from red to purple (Guo
et al., 2010; Lin et al., 2006). The colorimetric sensor technologies
based on Au NPs have attracted considerable attention due to their
unique properties such as colour rendering, biocompatibility,
stability and high extinction coefficients (Wu et al., 2012).
Li et al. (2010) used unmodified Au NPs directly as a
colorimetric sensor for melamine. The basic principle of this type
of sensor is based on the electrostatic reaction between the
negatively charged gold surface and the positively charged
amino groups of melamine. This visual detection technique for
melamine in raw milk using Au NPs has been reported with a LOD
of 0.4 mg/mL. In neutral media, melamine rapidly induces the
aggregation of Au NPs and the resulting colour change from red to
blue (or purple). However, this colorimetric assay has a relatively
low sensitivity. Chi et al. (2010) further developed the unmodified
Au NPs as a colorimetric sensor for the rapid detection of melamine
down to the 25 ppb level within 5 min based on a similar strategy.
Wei et al. (2010) came up with an easily prepared and rapid Au NP
sensor for melamine with an LOD of 40 ppb. Au NPs used as
colorimetric signals depend upon their colours of red or blue,
which corresponds to their dispersion or aggregation (Wu et al.,
2012).
Ai et al. (2009) have established a reliable, sensitive colorimet-
ric Au NP sensor that allows real-time detection of melamine in
milk products. The first step is synthesis of 1-(2-mercaptoethyl)-1,
3, 5-triazinane-2, 4, 6-trione (MTT), which specifically recognize
melamine by hydrogen bonding, and preparation of MTT-stabi-
lized Au NPs to a wine red colour. The colour changes to a blue
when melamine is present. This colorimetric sensor successfully
detects melamine at concentrations of 2.5 ppb within 1 min and
the colour change can be seen with the naked eye. The Au NP-based
sensor has provided a potentially powerful tool for routine
sensitive and selective detection of melamine. For other NP
sensors, the NPs need to be functionalized by some specific ligand
for later recognition in reaction with the analyte. Usually, the
unique reaction between ligand and analyte can be made specific
for target detection. Han et al. (2010) demonstrated a selective
assay for melamine in infant formula at the 0.1 mg/g level based on
silver NPs (SNPs). The stable p-nitroaniline-modified SNPs were
synthesized to detect melamine based on the electron donor–
acceptor interaction which induced the SNPs to change colour from
yellow to blue. If a recognition reaction with high affinity is chosen,
this type of NP-based sensor can be very sensitive.
Other types of NPs that have received extensive attention
include quantum dots (QDs) and magnetic NPs (MNPs). Peng et al.
(2009) established a very sensitive and multiplex chemical-residue
sensor based on multi-coloured QDs with an LOD of 0.06 ng/g. Ma
et al. (2009) successfully developed a stable, highly sensitive,
small-molecule sensor based on the relaxation of MNPs with an
LOD 0.6 ng/g. These detection methods have provided powerful
candidates as sensor technologies for rapid and sensitive detection
of melamine and may find widespread applications.
Recent research has reported that Fe3O4 MNPs exhibit an
intrinsic enzyme mimetic activity which could be used to detect
hydrogen peroxide (Gao et al., 2007). Based on this characteristic,
Wei and Wang (2008) studied the catalytic effect of Fe3O4 MNPs on
the reaction between 2, 20 -azino-bis (3-ethylbenzo-thiazoline-6-
sulfonic acid) diammonium salt (ABTS) and H2O2, and established a
colorimetric method for the determination of H2O2. The LOD of
H2O2 was as low as 3  106 M, which is quite sensitive. Xu et al.
(2013) successfully determined the presence of melamine in dairy
products using a Fe3O4 MNPs-H2O2-ABTS detection system, which
proved to be accurate, reliable, sensitive and convenient.
Concentrations lower than 2.5 ppm (the safety limit in the USA
and EU) of melamine in real samples can be detected exactly with
recovery in the range of 98–115% using a 721-A spectrophotome-
33
ter. The whole process is achieved in less than 1 h from the
beginning of sampling to the final step of obtaining the results from
the spectrophotometer.
7.4. Electrochemical biosensor
An electrochemical biosensor is a biosensor with an electro-
chemical transducer and is considered to be a chemically modified
electrode (CME) as electronic conducting, semiconducting or ionic
conducting material is coated with a biochemical film. Electro-
chemical sensors have a number of advantages over other
techniques due to their fast response, low cost, simple operation
and high sensitivity (Shaikh et al., 2013; Ahammad et al., 2011).
Electrochemical accumulation is employed to provide concentra-
tions required for analysis by flameless atomic absorption
spectrometry (Strelec et al., 2007), anodic stripping voltammetry
(Nasraoui et al., 2009) and inductively coupled plasmas mass
spectroscopy (Pretty et al., 1998). Xu et al. (2013) proposed two
steps for the sensor construction process, which are the
accumulation of melamine on a glassy carbon electrode (GCE)
by a cyclic voltammetric method and chemical coupling of
horseradish peroxidase (HRP) with the accumulated melamine
through the linkage of glutaraldehyde. The coupled HRP catalyzes
the oxidation of guaiacol to generate an amber-coloured product.
Quantitative analysis of melamine is performed by measuring the
absorption intensities of the coloured product. Under optimal
conditions, this method has shown a wide linearity in the
concentration range from 1.0  1011 to 1.0  108 M for mela-
mine detection.
Akter et al. (2013) used ferricyanide as a redox indicator and a
indium tin oxide (ITO) electrode modified using gold nanoparticles
(Au NPs) as base materials. Melamine was attached to the ITO/Au
NP electrode through a strong interaction between the –NH2 group
of melamine and the Au NPs. As the melamine is attached to the
electrode, the cathodic peak current of ferricyanide slowly
decreases. This decrease is directly related to the concentration
of melamine that has built up at the electrode. The melamine is
detected based on the competitive adsorptive behaviour of the
modified electrode. The calculated detection limit is 1.0 nM
(0.13 ppb) for melamine which is significantly lower than the
infant formula limit of 1 ppm. Thus, this method successfully
establishes a highly sensitive and simple electrochemical method
for the detection of melamine by using an Au NP-modified ITO
electrode.
Cao et al. (2009) developed the surface electrochemical method
based on an oligonucleotide (d(T)20) film modified electrode and
used to determine melamine (Fig. 4). The interactions between
oligonucleotides and melamine, which lead to increases in the
peak currents in ferricyanide at the oligonucleotide modified gold
electrode (AuE), were used to electrochemically sense melamine.
Due to the complementary triamino triazine unit, melamine can be
immobilized onto the oligonucleotides modified electrode via
electrostatic interaction and hydrogen-bonding (Strekowski and
Wilson, 2007). The morphological differences between melamine
and melamine interacted with oligonucleotides are then observed
by AFM. The electrochemical probe of [Fe(CN)6]3/4 is used to
investigate the interaction between melamine and oligonucleo-
tides since melamine is non-electroactive over the potential range
studied. The peak currents of the electrochemical probe were
evaluated by differential pulse stripping voltammetry (DPSV) and
were found to be linear for concentrations of melamine in the
range of 3.9  108 to 3.3  106 M with a linear coefficiency of
0.990. The detection limit was 9.6  109 M. Electrochemical
impedance spectrometry is a useful method to study the interfacial
properties of modified electrodes (Mehdinia et al., 2009; Keighley
et al., 2008). The immobilization of materials on the electrode
34 K. Rovina, S. Siddiquee / Journal of Food Composition and Analysis 43 (2015) 25–38

Fig. 4. Schematic representation of surface oligonucleotide (d(T)20) film modified electrode (Cao et al., 2009).

surface alters the interfacial electron transfer features at the
electrode surface. Hence, this method has developed into a rapid,
simple, reliable and successful technique for the determination of
melamine in milk products, with a recovery rate of 95%.
Liao et al. (2011) have developed a simple electrochemical
method, which does not require any expensive and complex
instruments for selective and quantitative recognition of mela-
mine in dairy products and pet foods. In this method, a screen
printed carbon electrode (SPCE) is used to detect the presence of
melamine. The formation of a polymerfilm from melamine on a
preanodized SPCE is identified by SEM and XPS. The as-formed
polymer was found to be electroactive with a reversible redox
peak, and hence square-wave voltammetry (SWV) was applied to
further increase the detection sensitivity to meet the detection
limit for application in real sample analysis. Simply, with a
medium exchange procedure, melamine is selectively detected
within a detection limit (S/N = 3) of 0.8 mM (98.3 ppb) by SWV.
Concentrations lower than 1 ppm of melamine in real samples
were detected, and the recovery was 98.7–100.9%. Using external
calibration and standard addition techniques, the recovery tests
have verified that the analysis can be done in a single-run
measurement.
Melamine as an aromatic polyamine molecule can interact
with polyhydroxides or polyphenol molecules, such as bismuth
oxides and bismuthyl chloride molecules through hydrogen bond
formation. An electrode with electrochemically deposited bis-
muth has been developed for convenient use in electrochemical
analysis (Serrano et al., 2009; Torma et al., 2009). The deposited
bismuth hydroxides or bismuthyl chloride may be favourable for
the extraction and electrochemical detection of melamine. Zhu
et al. (2011) have electrochemically modified graphite-epoxy
composite electrodes using bismuthyl chloride in situ. The
bismuthyl chloride layer serves as a solid phase micro extractant
and extracts melamine from an aqueous solution with the help of
electrochemistry. The adsorption of melamine on bismuthyl
chloride follows the Freundlich adsorption model, and results in a
decrease in the reduction current of bismuthyl chloride. This
process is used to determine melamine content in the range of
104  1012 M with LOD of 2.5  1012 M and relative standard
deviation of 2.7%. This method offers a new way for the

Table 3
List of recent advances in melamine detection techniques.

Method LOD References

Chemosensor based on MIP film 5 nM Pietrzyk et al. (2009)

Potentiometric sensor based on a MIP 6.0 mM Liang et al. (2009)
Colorimetric sensor based on unmodified Gold NPs 0.4 mg/mL Li et al. (2010)
25 ppb (5 min) Chi et al. (2010)
Colorimetric sensor based on MTT-stabilized Gold NPs 2.5 ppb (1 min) Ai et al. (2009)
Colorimetric sensor based on silver NPs 0.1 mg/g Han and Li (2010)
Colorimetric sensor based on multi-colour QDs 0.6 ng/g Peng et al. (2009)
Colorimetric sensor based on magnetic NPs 0.6 ng/g Ma et al. (2009)
Colorimetric sensor based on Fe3O4 MNPs 3  106 M Gao et al. (2007)
Electrochemical sensor based on para-aminobenzoic acid 0.36 mM Ting et al. (2011)
Glassy carbon electrode by chemical coupling of horseradish peroxidase 1.0  1011 M Xu et al. (2013)
Indium tin oxide electrode modified by gold NPs 0.13 ppb Akter et al. (2013)
Graphite-epoxy composite electrode by using bismuthyl chloride 2.5 T 10S12 M Zhu et al. (2011)
Screen printed carbon electrode 98.3 ppb Liao et al. (2011)
Gold electrode modified by oligonucleotide (d(T)20) film 9.6  109 M Cao et al. (2009)
Glassy carbon electrode by chemical coupling of horseradish peroxidase 1.0  1011 M Xu et al. (2013)
Indium tin oxide electrode modified by gold NPs 0.13 ppb Akter et al. (2013)
Screen printed carbon electrode 98.3 ppb Liao et al. (2011)
Gold electrode modified by oligonucleotide (d(T)20) film 9.6  109 M Cao et al. (2009)
Optical biosensor based on polyclonal antibody 0.5 mg/mL Fodey et al. (2011)
Chemiluminescenc based on Luminal–H2O2 0.12 mg/mL Zeng et al. (2011)
Chemiluminescenc based on Luminol–K3Fe(CN)6 3.54 ng mL1 (urine) Tang et al. (2011)
6.58 ng mL1 (plasma)
Fluorescence based on a polyclonal antibody 9.3 ng mL1 Wang et al. (2011)
Fluorescence based on Au NPs 0.02 mg/L Zhang et al. (2012)
Colorimetric aptasensor based on AuNPs 0.5 mg/L Yun et al. (2014)
Aptamers (poly-T10) based on Au NPs 41.7 nM Huang et al. (2011)
Aptamer probe based on AgNPs 3.1 mg/L Liang et al. (2011)
 K. Rovina, S. Siddiquee / Journal of Food Composition and Analysis 43 (2015) 25–38
electrochemical detection of electrochemically inactive species
(Zhu et al., 2011).
7.5. Optical based biosensor
Over the past decades, the optical biosensor has rapidly
advanced and has been applied in a number of important areas
including food safety, security, life science, environmental
monitoring and medicine (Bhatta et al., 2010, 2012; Md Muslim
et al., 2012).
Surface plasmon resonance (SPR) biosensors use surface
plasmon waves (electromagnetic wave) to detect changes when
the target analyte interacts with a biorecognition element on the
sensor. In principle, when the SPR biosensor is exposed to any
changes, it will induce changes in the refractive index which is
used to measure or observe the reaction (Perumal and Hashim,
2013). Fodey et al. (2011) successfully developed a rapid and
robust optical biosensor inhibition immunoassay method for the
analysis of infant formula and infant liquid milk samples. The study
focused on a polyclonal antibody to melamine, which was
produced using a structural mimic, 6-hydrazino-1,3,5-triazine-
2,4-diamine (HTD), which negated the need for hapten derivatiza-
tion. Instead a suitable bifunctional cross-linker was attached to
the carrier protein before reaction with the hapten. The resulting
antibody was then incorporated into a SPR optical biosensor
immunoassay. The sensitivity of the assay was given as an IC50, and
calculated to be 67.9 ng mL1 in buffer. The antibody did not cross-
react with any of the by-products of melamine manufacture;
however, significant cross-reactivity was observed with the
insecticide cyromazine of which melamine is a metabolite. When
a sample matrix was applied to the assay, a detection limit of
<0.5 mg/mL was determined in both infant formula and infant
liquid milk.
Some of the recent advances in melamine detection techniques
are summarized in Table 3.
8. Conclusion
Since 2008, after the melamine issues in China, many
substantial studies on analytical chemistry, analytical methods,
toxicology, exposure and establishment of TDI recommendations
for melamine in infant formula and milk products have been
conducted. This review shows that many methods have been
developed for determining the presence of melamine and its
analogues in various matrices. The different methods each have
their own advantages and disadvantages. The analytical methods
were developed and used to analyze the level of melamine in food
samples. However, they require high instrumentation costs,
extensive sample preparation, highly skilled personnel and are
time consuming. Immunoassay methods are also widely used to
detect melamine but require labour intensive operations including
incubation, washing and enzymatic reactions during the signal
generation process.
Compared to these existing methods, recent advances in
melamine detection techniques have various advantages such as
simplicity, low cost, rapidity, effectiveness and high sensitivity.
One of the best known of these new methods is the use of MIPs,
which have high selectivity for target molecules, high affinity and
robustness of recognition. Due to their stability, low cost and ease
of preparation, MIPs have gained wide acceptance as molecular
recognition materials in developing sensors. NPs have been also
been used for the determination of melamine due to their unique
characteristics, such as biostability, biofunctionalization and
spectral properties, which are not found in bulk-sized materials.
They also have large surface area, good environmental acceptabil-
ity, electrochemical activity and high electron communication
35
features, as well as being non-toxic and inexpensive. With recent
developments in nanotechnology, new methods for designing
colorimetric assays are emerging. The major advantage of
colorimetric biosensors is that they can be easily observed by
the naked eye, and therefore sophisticated instruments are not
required. The development of electrochemical sensors based on
modified gold electrodes provides a very simple, low cost, accurate,
stable, convenient and sensitive method for the determination of
melamine. Electrochemical biosensors will probably have a major
impact on quality control in food processing in the near future,
improving product quality and safety with minimal investment.
This detailed study of melamine detection opens up new directions
for research in the field of biosensors. The future of biosensors will
probably see the development of powerful analytical devices,
combinations of multiple techniques and application of new
materials.
Acknowledgement
This work was supported by grants from the Ministry of
Science, Technology and Innovation, MOSTI (No. SCF0090-IND-
2013).
References
Ahammad, A.J.S., Rahman, M.M., Xu, G.R., Kim, S., Lee, J.J., 2011. Highly sensitive and
simultaneous determination of hydroquinone and catechol at poly(thionine)
modified glassy carbon electrode. Electrochem. Acta 56, 5266–5271.
Ai, K., Liu, Y., Lu, L., 2009. Hydrogen-bonding recognition-induced colour change of
gold nanoparticles for visual detection of melamine in raw milk and infant
formula. J. Am. Chem. Soc. 131, 9496–9497.
Akter, H., Shaikh, A.A., Taslima, R., Chowdhury, Rahman, M.S., Bakshi, P.K., Saleh
Ahammad, A.J., 2013. Gold nanoparticle-modified indium tin oxide electrode
for highly sensitive electrochemical detection of melamine. ECS Electrochem.
Lett. 2, 13–15.
Andersen, W.C., Turnipseed, S.B., Karbiwnyk, C.M., Clark, S.B., Madson, M.R., Gie-
seker, C.M., 2008. Determination and confirmation of melamine residues in
catfish, trout, tilapia, salmon, and shrimp by liquid chromatography with
tandem mass spectrometry. J. Agric. Food Chem. 56, 4340–4347.
Batista, A.D., Nascimento, C.F., Melchert, W.R., Rocha, F.R.P., 2014. Rocha expanding
the separation capability of sequential injection chromatography: determina-
tion of melamine in milk exploiting micellar medium and on-line sample
preparation. Microchem. J. 117, 106–110.
Baynes, R.E., Barlow, B., Mason, S.E., Riviere, J.E., 2010. Disposition of melamine
residues in blood and milk from dairy goats exposed to an oral bolus of
melamine. Food Chem. Toxicol. 48, 2542–2546.
Beltran-Martinavarro, B., Peris-Vicente, J., Carda-Broch, S., Esteve-Romero, J., 2014.
Development and validation of a micellar liquid chromatography based method
to quantify melamine in swine kidney. Food Control 46, 168–173.
Beltran-Martinavarro, B., Peris-Vicente, J., Marco-Peiro, S., Esteve-Romero, J., Ram-
bla-Alegre, M., Carda-Broch, S., 2012. Use of micellar mobile phases for the
chromatographic determination of melamine in dietetic supplements. Analyst
137, 269–274.
Bhatta, D., Stadden, E., Hashem, E., Sparrow, I.J.G., Emmerson, G.D., 2010. Multi-
purpose optical biosensors for real-time detection of bacteria, viruses and
toxins. Sens. Actuators B: Chem. 149, 233–238.
Bhatta, D., Villalba, M.M., Johnson, C.L., Emmerson, G.D., Ferris, N.P., King, D.P., Lowe,
C.R., 2012. Rapid detection of foot-and mouth disease virus with optical
microchip sensors. Procedia Chem. 6, 2–10.
Bizzari, S., Yokose, K., 2008. Melamine. In: Chemical Economics HandbookSRI
Consulting, Incorporation, Menlo Park, CA.
Brown, C.A., Jeong, K.S., Poppenga, R.H., Puschner, B., Miller, D.M., Ellis, A.E., 2007.
Outbreaks of renal failure associated with melamine and cyanuric acid in dogs
and cats in 2004 and 2007. J. Vet. Diagn. Invest. 19, 525–531.
Cai, W., Fan, Y.Y., Jiang, Z.L., Yao, J.E., 2010. A highly sensitive and selective
resonance scattering spectral assay for potassium ion based on aptamer and
nanosilver aggregation reactions. Talanta 81, 1810–1815.
Cao, Q., Zhao, H., He, Y., Ding, N., Wang, J., 2010. Electrochemical sensing of
melamine with 3,4-dihydroxyphenylacetic acid as recognition element. Anal.
Chim. Acta 675, 24–28.
Cao, Q., Zhao, H., Zeng, L., Wang, J., Wang, R., Qiu, X., He, Y., 2009. Electrochemical
determination of melamine using oligonucleotides modified gold electrodes.
Talanta 80, 484–488.
Chen, D.L., Meena, Sharma, S.K., McLaughlin, L.W., 2004. Formation and stability of a
Janus-Wedge type of DNA triplex. J. Am. Chem. Soc. 126, 70–71.
Chen, W., Jiang, Y., Ji, B.Q., Zhu, C.Q., Liu, L.Q., Peng, C.F., Jin, M.K., 2009.
Automated and ultrasensitive detection of methyl-3-quinoxaline-2-carboxylic
36 K. Rovina, S. Siddiquee / Journal of Food Composition and Analysis 43 (2015) 25–38
acid by using gold nanoparticles probes SIA-rt-PCR. Biosensor Bioelectr. 24,
2858–2863.
Chen, Z.G., Liu, G.L., Chen, M.H., Peng, Y.R., Wu, M.Y., 2009a. Determination of
nanograms of proteins based on decreased resonance light scattering of zwit-
terionic gemini surfactant. Anal. Biochem. 384, 337–342.
Chi, H., Liu, B., Guan, G., Zhang, Z., Han, M.Y., 2010. A simple, reliable and sensitive
colorimetric visualization of melamine in milk by unmodified gold nanopar-
ticles. J. Anal. 135, 1070–1075.
Chu, P.W.S., Chan, K.M., Cheung, S.T.C., Wong, Y.C., 2010. Review of analytical
techniques used in proficiency-testing programs for melamine in animal feed
and milk. Trends Anal. Chem. 29, 1014–1026.
Citartan, M., Gopinath, S.C.B., Tominaga, J., Tan, S.C., Tang, T.H., 2012. Assays for
aptamer-based platforms. Biosens. Bioelectron. 34, 1–11.
Cook, H.A., Klampfl, C.W., Buchberger, W., 2005. Analysis of melamine resins by
capillary zone electrophoresis with electrospray ionization-mass spectrometric
detection. Electrophoresis 26, 1576–1583.
De Fatima Pocas, M., Hogg, T., 2007. Exposure assessment of chemicals from
packaging materials in foods: a review. Trends Food Sci. Technol. 18, 219–230.
Desmarchelier, A., Cuadra, M.G., Delatour, T., Mottier, P., 2009. Simultaneous
quantitative determination of melamine and cyanuric acid in cow’s milk and
milk-based infant formula by liquid chromatography–electrospray ionization
tandem mass spectrometry. J. Agric. Food Chem. 57, 7186–7193.
Ding, T., Xu, J., Li, J., Shen, C., Wu, B., Chen, H., Li, S., 2008. Determination of melamine
residue in plant origin protein powders using high performance liquid chroma-
tography-diode array detection and high performance liquid chromatography–
electrospray ionization tandem mass spectrometry. J. Chromatogr. 26, 6–9.
Ehling, S., Tefera, S., Ho, I.P., 2007. High-performance liquid chromatographic
method for the simultaneous detection of the adulteration of cereal flours with
melamine and related triazine by-products ammeline, ammelide, and cyanuric
acid. Food Addit. Contam. 24, 1319–1325.
Ellington, A.D., Szostak, J.W., 1990. In vitro selection of RNA molecules that bind
specific ligands. Nature 346, 818–822.
Farre, M., Kantiani, L., Perez, S., Barcelo, D., 2009. Sensors and biosensors in support
of EU Directives. TrAC Trends Anal. Chem. 28, 170–185.
Feng, J.W., Cai, Q.R., Liu, X.C., Yu, Y.G., Peng, Y.F., Zhang, Y., 2008. Determination of
melamine and cyromazine in milk and dairy products by LC–MS/MS. J. Food Sci.
Technol. 24, 1058–1060.
Filazi, A., Sireli, U.T., Ekici, H., Can, H.Y., Karagoz, A., 2012. Determination of
melamine in milk and dairy products by high performance liquid chromatog-
raphy. J. Dairy Sci. 95, 602–608.
Filigenzi, M.S., Puschner, B., Aston, L.R., Poppenga, R.H., 2008. Diagnostic determi-
nation of melamine and related compounds in kidney tissue by liquid chro-
matography/tandem mass spectrometry. J. Agric. Food Chem. 56, 7593–7599.
Filigenzi, M.S., Tor, E.R., Poppenga, R.H., Aston, L.A., Puschner, B., 2007. The deter-
mination of melamine in muscle tissue by liquid chromatography/tandem mass
spectrometry. Rapid Commun. Mass Spectrom. 21, 4027–4032.
Finete, V.L.M., Gouvea, M.M., Marques, F.F.C., Netto, A.D.P., 2015. Validation of a
method of high performance liquid chromatography with fluorescence detec-
tion for melamine determination in UHT whole bovine milk. Food Control 51,
402–407.
Finete, V.L.M., Gouvea, M.M., Marques, F.F.C., Netto, A.D.P., 2014. Characterization of
newfound natural luminescent properties of melamine, and development and
validation of a method of high performance liquid chromatography with
fluorescence detection for its determination in kitchen plastic ware. Talanta
123, 128–134.
Fodey, T.L., Thompson, C.S., Traynor, I.M., Haughey, S.A., Kennedy, D.G., Crooks,
S.R.H., 2011. Development of an optical biosensor based immunoassay to screen
infant formula milk samples for adulteration with melamine. Anal. Chem. 83,
5012–5016.
Food and Drug Administration (FDA), 2008. Melamine Pet Food Recall in 2007,
Guidance for Industry Safety Testing of Drug Metabolites. Department of Health
and Human Services. Available from: http://www.fda.gov/animalveterinary/
safetyhealth/recallswithdrawals/ucm129575.htm [accessed December, 2013]
Food and Drug Administration (FDA), 2009. Analytical Methods for Melamine and
Triazine Analogs Available from: http://www.fda.gov/AnimalVeterinary/
ScienceResearch/ToolsResources/ucm135002.htm [accessed December 2013]
Gao, L.Z., Zhuang, J., Nie, L., Zhang, J.B., Zhang, Y., 2007. Intrinsic peroxidase-like
activity of ferromagnetic nanoparticles. Nat. Nanotechnol. 2, 577–583.
Garber, E.A.E., Brewer, V.A., 2010. Enzyme-linked immunosorbent assay detection
of melamine in infant formula and wheat food products. J. Food Process. 73,
701–707.
Guo, L., Zhong, J., Wu, J., Fu, F., Chen, G., Zheng, X., Lin, S., 2010. Visual detection of
melamine in milk products by label-free gold nanoparticles. Talanta 82, 1654–1658.
Han, C., Wu, Y., Zhou, Y., Gong, Y., Liu, C., Wang, L., Shen, Y., 2009. Microwave-
assisted extraction of melamine residues from pet food and analysis by ion-
exchange LC–DAD. Chromatographia 70, 927–931.
Han, C.P., Li, H.B., 2010. Visual detection of melamine in infant formula at 0.1 ppm
level based on silver nanoparticles. Analyst 135, 583–588.
Hau, A.K., Kwan, T.H., Li, P.K., 2009. Melamine toxicity and the kidney. J. Am. Soc.
Nephrol. 20, 245–250.
Hong, P., Minwei, Z., Hongkun, L., Shugui, L., Quansi, C., Chunyan, S., Tiehua, Z., 2012.
Visual detection of melamine in raw milk by label-free silver nanoparticles.
Food Control 23, 191–197.
Hua, K., Wei, C., Wenjing, Y., Liuang, X., Yingyue, Z., Liqiang, I., Huaqin, C., Chifang, P.,
Libing, W., Kotov, A.N., Chuanlai, X., 2011. Crown ether assembly of gold
nanoparticles: melamine sensor. Biosensors Bioelectr. 26, 2032–2037.
Huang, G.M., Ouyang, Z., Cooks, R.G., 2009. High-throughput trace melamine
analysis in complex mixtures. Chem. Commun. Cambr. Engl. 5, 556–558.
Huang, H., Li, L., Zhou, G.H., Liu, Z.H., Ma, Q., Feng, Y.Q., Zeng, G.P., Tinnefeldc, P., He,
Z.K., 2011. Visual detection of melamine in milk samples based on label-free
and labelled gold nanoparticles. Talanta 85, 1013–1019.
Ibáñez, M., Sancho, J.V., Hernández, F., 2009. Determination of melamine in milk-
based products and other food and beverage products by ion-pair liquid
chromatography–tandem mass spectrometry. Anal. Chim. Acta 649, 91–97.
Keighley, S.D., Li, P., Estrela, P., Migliorato, P., 2008. Optimization of DNA immobili-
zation on gold electrodes for label-free detection by electrochemical impedance
spectroscopy. Biosens. Bioelectr. 23, 1291–1297.
Kim, B., Perkins, L.B., Bushway, R.J., Nesbit, S., Fan, T., Sheridan, R., 2008. Determi-
nation of melamine in pet food by enzyme immunoassay, high-performance
liquid chromatography with diode array detection, and ultra-performance
liquid chromatography with tandem mass spectrometry. J. AOAC Int. 91,
408–413.
Kim, C.W., Yun, J.W., Bae, I.H., Lee, J.S., Kang, H.J., Joo, K.M., Jeong, H.J., Chung, J.H.,
Park, Y.H., Lim, K.M., 2010. Determination of spatial distribution of melamine–
cyanuric acid crystals in rat kidney tissue by histology and imaging matrix-
assisted laser desorption/ionization quadrupole time-of-flight mass spectrom-
etry. Chem. Res. Toxicol. 23, 220–227.
Lachenmeier, D.W., Humpfer, E., Fang, F., Schutz, B., Dvorteak, P., Sproll, C., Spraul,
M., 2009. NMR-spectroscopy for nontargeted screening and simultaneous
quantification of health-relevant compounds in foods: the example of mela-
mine. J. Agric. Food Chem. 57, 7194–7199.
Langman, C.B., Alon, U., Ingelfinger, J., Englund, M., Saland, J., Somers, M.J.G.,
Stapleton, F.B., Sibú, N.O., Cochat, P., Wong, W., Eke, F.U., Satlin, L., Salusky, I.,
2009. A position statement on kidney disease from powdered infant formula-
based melamine exposure in Chinese infants. Pediatr. Nephrol. 24,
1263–1266.
Lee, J., Jeong, E.J., Kim, J., 2011. Selective and sensitive detection of melamine by
intra/inter liposomal interaction of polydiacetylene liposomes. Chem. Com-
mun. 47, 358–360.
Lee, J.H., Wang, Z.D., Liu, J.W., Lu, Y.J., 2008. Highly sensitive and selective colori-
metric sensors for uranyl (UO22+): development and comparison of labelled
and label-free DNAzyme-gold nanoparticle systems. J. Am. Chem. Soc. 130,
14217–14226.
Lee, S.Y., Ganbold, E.O., Choo, J., Joo, S.W., 2010. Detection of melamine in powdered
milk using surface-enhanced Raman scattering with no pretreatment. Anal.
Lett. 43, 2135–2141.
Lehn, J.M., Mascal, M., Decian, A., Fisher, J., 1990. J. Chem. Soc. 479–481.
Li, J., Qi, H.Y., Shi, Y.P., 2009. Determination of metoprolol tartrate in tablets and
human urine using flow-injection chemiluminescence method. J. Pharm.
Biomed. Anal. 42, 384–388.
Li, L., Li, B.X., Cheng, D., Mao, L.H., 2010. Visual detection of melamine in raw milk
using gold nanoparticles as colorimetric probe. Food Chem. 1216, 895–900.
Liang, R.N., Zhang, R.M., Qin, W., 2009. Potentiometric sensor based on molecularly
imprinted polymer for determination of melamine in milk. Sens. Actuators B:
Chem. 141, 544–550.
Liang, X.S., Wei, H.P., Cui, Z.Q., Deng, J.Y., Zhang, Z.P., You, X.Y., Zhang, X.E., 2011.
Colorimetric detection of melamine in complex matrices based on cysteamine
modified gold nanoparticles. Analyst 136, 179–183.
Liao, C.W., Chen, Y.R., Chang, J.L., Zen, J.M., 2011. Single-run electrochemical
determination of melamine in dairy products and pet foods. J. Agric. Food
Chem. 59, 9782–9787.
Lin, C.X., Xie, M.Y., Chen, J.J.L., Liu, Y., Yan, H., 2006. Rolling-circle amplification of a
DNA nanojunction. Angew. Chem. Int. Ed. 45, 7537–7539.
Lin, M., He, L., Awika, J., Yang, L., Ledoux, D.R., Li, H., Mustapha, A., 2008. Detection of
melamine in gluten, chicken feed and processed foods using surface enhanced
Raman spectroscopy and HPLC. J. Food Sci. 73, 129–134.
Liu, J.W., Cao, Z.H., Lu, Y., 2009. Functional nucleic acid sensors. Chem. Rev. 109,
1948–1998.
Liu, J.W., Lu, Y.J., 2004. Accelerated colour change of gold nanoparticles assembled
by DNAzymes for simple and fast colorimetric Pb2+ detection. J. Am. Chem. Soc.
126, 12298–12305.
Liu, Y., Todd, E.E.D., Zhang, Q., Shi, J.R., Liu, X.J., 2012. Recent developments in the
detection of melamine. J. Zhejiang Univ. Sci. 13, 525–532.
Lv, X.W., Wang, J., Wu, L., Qiu, J., Li, J.G., Wu, Z.L., Qin, Y.C., 2010. Tissue deposition
and residue depletion in lambs exposed to melamine and cyanuric acid-
contaminated diets. J. Agric. Food Chem. 58, 943–948.
Ma, W., Chen, W., Qiao, R.R., Liu, C.Y., Yang, C.H., Li, Z.K., Xu, D.H., Peng, C.F., Jin, Z.Y.,
Xu, C.L., Zhu, S.F., Wang, L.B., 2009. Rapid and sensitive detection of microcystin
by immunosensor based on nuclear magnetic resonance. Biosensor Bioelectr.
25, 240–243.
Marco-Peiro, S., Beltran-Martinavarro, B., Rambla-Alegre, M., Peris-Vicente, J.,
Esteve-Romero, J., 2012. Validation of an analytical methodology to quantify
melamine in body fluids using micellar liquid chromatography. Talanta 88,
617–622.
Matte, D., Solastiouk, B., Merlin, A., Deglise, X., 1990. Kinetic study of the N-
chlorination of cyanuric acid in the aqueous phase. Can. J. Chem. 68, 307–313.
Mauer, L.J., Chernyshova, A.A., Hiatt, A., Deering, A., Davis, R., 2009. Melamine
detection in infant formula powder using near- and mid-infrared spectroscopy.
J. Agric. Food Chem. 57, 3974–3980.
Md Muslim, N.Z., Ahmad, M., Heng, L.Y., Saad, B., 2012. Optical biosensor test strip
for the screening and direct determination of L-glutamate in food samples. Sens.
Actuators: B Chem. 161, 493–497.
 K. Rovina, S. Siddiquee / Journal of Food Composition and Analysis 43 (2015) 25–38
Mecker, L.C., Tyner, K.M., Kauffman, J.F., Arzhantsev, S., Mans, D.J., Gryniewicz
Ruzicka, C.M., 2012. Selective melamine detection in multiple sample matrices
with a portable Raman instrument using surface enhanced Raman spectrosco-
py-active gold nanoparticles. Anal. Chim. Acta 733, 48–55.
Mehdinia, A., Kazemi, S.H., Bathaie, S.Z., Alizadeh, A., Shamsipur, M., Mousavi, M.F.,
2009. Electrochemical DNA nano-biosensor for the study of spermidine–DNA
interaction. J. Pharm. Biomed. Anal. 49, 587–593.
Mfiligenzi, S., Puschner, B., Aston, L.S., 2008. Diagnostic determination of melamine
and related compounds in kidney tissue by liquid chromatography/tandem
mass spectrometry. J. Agric. Food Chem. 56, 7593–7599.
Miao, H., Fan, S., Wu, Y.N., Zhang, L., Zhou, P.P., Li, J.G., Chen, H.J., Zhao, Y.F., 2009.
Simultaneous determination of melamine, ammelide, ammeline, and cyanuric
acid in milk and milk products by gas chromatography–tandem mass spec-
trometry. Biomed. Environ. Sci. 22, 87–94.
Muñiz-Valencia, R., Ceballos-Magaña, S.G., Rosales-Martinez, D., Gonzalo-Lum-
breras, R., Santos-Montes, A., Cubedo-Fernandez-Trapiella, A., Izquierdo-Hor-
nillos, R.C., 2008. Method development and validation for melamine and its
derivatives in rice concentrates by liquid chromatography: application to
animal feed sample. Anal. Bioanal. Chem. 392, 523–531.
Nasraoui, R., Floner, D., Geneste, F., 2009. Analytical performances of a flow
electrochemical sensor for preconcentration and stripping voltammetry of
metal ions. J. Electroanal. Chem. 629, 30–34.
National Toxicology Program (NTP), 1983. Carcinogenesis Bioassay of Melamine,
pp. 81–86.
Newton, G.L., Utley, P.R., 1978. Melamine as a dietary nitrogen source for ruminants.
J. Anim. Sci. 47, 1338–1344.
Panuwet, P., Nguyen, J.V., Wade, E.L., D0 Souza, P.E., Ryan, P.B., Barr, D.B., 2012.
Quantification of melamine in human urine using cation-exchange based high
performance liquid chromatography tandem mass spectrometry. J. Chroma-
togr. B 887, 48–54.
Peng, C.F., Li, Z.K., Zhua, Y.Y., Chen, W., Yuan, Y., Liu, L.Q., Li, Q.S., Xu, D.H., Qiao, R.R.,
Wang, L.B., Zhu, S.F., Jin, Z.Y., Xu, C.L., 2009. Simultaneous and sensitive
determination of multiplex chemical residues based on multicolor quantum
dot probes. Biosens. Bioelectr. 24, 3657–3662.
Perumal, V., Hashim, U., 2013. pH Measurement using in house fabricated inter-
digitated capacitive transducer. J. Econ. Financ. Admin. Sci. 12, 1–15.
Pietrzyk, A., Kutner, W., Chitta, R., Zandler, M.E., D’Souza, F., Sannicolo, F., Mussini,
P.R., 2009. Melamine acoustic chemosensor based on molecularly imprinted
polymer film. Anal. Chem. 81, 10061–10070.
Ping, H., Zhang, M.W., Li, H.K., Li, S.G., Chen, Q.S., Sun, C.Y., Zhang, T.H., 2012. Visual
detection of melamine in raw milk by label-free silver nanoparticles. Food
Control 23, 191–197.
Pretty, J.R., Duckworth, D.C., Berkel, G.J.V., 1998. Electrochemical sample pretreat-
ment coupled on-line with ICP-MS: analysis of uranium using an anodically
conditioned glassy carbon working electrode. Anal. Chem. 70, 1141–1148.
Qi, W.J., Wu, D., Ling, J., Huang, C.Z., 2010. Visual and light scattering spectrometric
detections of melamine with polythymine-stabilized gold nanoparticles
through specific triple hydrogen-bonding recognition. Chem. Commun. 46,
4893–4895.
Rambla-Alegre, M., Peris-Vicente, J., Marco-Peiró, S., Beltrán-Martinavarro, B.,
Esteve-Romero, J., 2010. Development of an analytical methodology to quantify
melamine in milk using micellar liquid chromatography and validation accord-
ing to EU Regulation 2002/654/EC. Talanta 81, 894–900.
Satzger, R.D., 2008. Characterization of a pet food adulteration problem by utilizing
a multidisciplinary analytical approach. In: Proceedings of the 235th National
Meeting of the American Chemical Society. American Chemical Society, New
Orleans, Washington, DC.
Serrano, N., Martin, N., Diaz-Cruz, J., Arino, C., Esteban, M., 2009. Bismuth film
electrode in metal complexation studies: stripping analysis of the Pb(II)-, Cd(II)-
, and Zn(II)-binding with phthalate. Electroanalysis 21, 431–438.
Shaikh, A.A., Saha, S.K., Bakshi, P.K., Hussain, A., Ahammad, A.J.S., 2013. Poly(brilliant
cresyl blue)-modified electrde for highly sensitive and simultaneous determi-
nation of hydroquinone and catecho. J. Electrochem. Soc. 160, 37–42.
Shelton, D.R., Karns, J.S., McCarty, G.W., Durham, D.R., 1997. Metabolism of mela-
mine by klebsiella terragena. Appl. Environ. Microbiol. 63, 2832–2835.
Sherrington, D.C., Taskinen, K.A., 2001. Self-assembly in synthetic macromolec-
ular systems via multiple hydrogen bonding interactions. Chem. Soc. Rev. 30,
83–93.
Song, S., Wang, L., Li, J., Zhao, J., Fan, C., 2008. Aptamer-based biosensors. Trends
Anal. Chem. 27, 108–117.
Strekowski, L., Wilson, B., 2007. Noncovalent interactions with DNA: an overview.
Mutat. Res. 623, 3–13.
Strelec, M., Cacho, F., Manova, A., Beinrohr, E., 2007. Determination of As(III) and
total as in water by graphite furnace atomic absorption spectrometry after
electrochemical preconcentration on a gold-plated porous glassy carbon elec-
trode. Chem. Pap. 61, 452–456.
Sun, F.X., Ma, W., Xu, L.G., Zhu, Y.Y., Liu, L.Q., Peng, C.F., Wang, L.B., Kuang, H., Xu, C.L.,
2010b. Analytical methods and recent developments in the detection of mela-
mine. TrAC Trends Anal. Chem. 29, 1239–1249.
Sun, H.W., Wang, L.X., Ai, L.F., Liang, S.X., 2010a. A sensitive and validated method
for determination of melamine residue in liquid milk by reversed phase high-
performance liquid chromatography with solid-phase extraction. Food Control
21, 686–691.
Sun, P., Wang, J.Q., Shen, J.S., Wei, H.Y., 2011. Residues of melamine and cyanuric
acid in milk and tissues of dairy cows fed different doses of melamine. J. Dairy
Sci. 94, 3575–3582.
37
Tang, H.W., Ng, K.M., Chui, S.S.Y., Che, C.M., Lam, C.W., Yuen, K.Y., Siu, T.S., Lan, L.C.L.,
2009. Analysis of melamine cyanurate in urine using matrix-assisted laser
desorption/ionization mass spectrometry. Anal. Chem. 81, 3676–3682.
Tang, X.S., Shi, X.Y., Tang, Y.H., Yue, Z.J., He, Q.Q., 2011. Chemiluminescence
determination of melamine with Luminol–K3Fe(CN)6 system. J. Pharm. Anal.
2, 104–107.
Ting, Y., Deng, J., Lin, X., Ding, L., Li, Y., Li, H., Ting, X., 2011. Electrochemical sensor
based on a poly(para-aminobenzoic acid) film modified glassy carbon
electrode for the determination of melamine in milk. Electrochim. Acta 56,
4595–4602.
Tittlemier, S.A., Lau, B.P.Y., Menard, C., Corrigan, C., Sparling, M., Gaertner, D.,
Pepper, K., Feeley, M., 2009. Melamine in infant formula sold in Canada:
occurrence and risk assessment. J. Agric. Food Chem. 57, 5340–5344.
Torma, F., Grun, A., Bitter, I., Toth, K., 2009. Calixarene/Nafion-modified bismuth-
film electrodes for adsorptive stripping voltammetric determination of lead.
Electroanalysis 21, 1961–1969.
US Food and Drug Administration (USFDA), 2007. Food and Drug Administration.
Center for Food Safety and Nutrition.
Varelis, P., Jeskelis, R., 2008. Preparation of [13C3]-melamine and [13C3]-cyanuric
acid and their application to the analysis of melamine and cyanuric acid in meat
and pet food using liquid chromatography–tandem mass spectrometry. Food
Addit. Contam. 25, 1208–1215.
Venkatasami, G., Sowa, R.J.J., 2010. A rapid, acetonitrile-free, HPLC method for
determination of melamine in infant formula. Anal. Chim. Acta 665, 227–230.
Wang, Q., Haughey, S.A., Sun, Y.M., Eremin, S.A., Li, Z.F., Liu, H., Xu, Z.L., Shen, Y.D., Lei, H.T.,
2011. Development of a fluorescence polarization immunoassay for the detection of
melamine in milk and milk powder. Anal. Bioanal. Chem. 399, 2275–2284.
Wei, F., Lam, R., Cheng, S., Lu, S., Ho, D., Li, N., 2010. Rapid detection of melamine in
whole milk mediated by unmodified gold nanoparticles. Appl. Phys. Lett. 96,
133–142.
Wei, H., Wang, E.K., 2008. Fe3O4 magnetic nanoparticles as peroxidase mimetics and
their applications in H2O2 and glucose detection. Anal. Chem. 80, 2250–2254.
Wen, G.Q., Liang, A.H., Fan, Y.Y., Jiang, Z.L., Jiang, C.N., 2010. A simple and rapid
resonance scattering spectral method for detection of trace Hg2+ using aptamer-
nanogold as probe. Plasmonics 5, 1–6.
Whitesides, G.M., Mathias, J.P., Seto, C.T., 1991. Molecular self-assembly and
nanochemistry: a chemical strategy for the synthesis of nanostructures. J.
Sci. 254, 1312–1319.
World Health Organization (WHO), 2004. Geneva.
World Health Organization (WHO), 2008a. Geneva.
World Health Organization (WHO), 2008b. Geneva.
World Health Organization (WHO), 2009. Geneva.
Wu, Y., Zhan, S., Wang, F., He, L., Zhi, W., Zhou, P., 2012. Cationic polymers and
aptamers mediated aggregation of gold nanoparticles for the colorimetric detec-
tion of arsenic(III) in aqueous solution. Chem. Commun. 48 (37), 4459–4461.
Wu, Y., Zhang, Y., 2013. Analytical chemistry, toxicology, epidemiology and health
impact assessment of melamine in infant formula: recent progress and devel-
opments. Food Chem. Toxicol. 56, 325–335.
Wu, Y.T., Huang, C.M., Lina, C.C., Ho, W.A., Lin, L.C., Chiu, T.F., Tarn, D.C., Lin, C.H.,
Tsai, T.H., 2009. Determination of melamine in rat plasma, liver, kidney, spleen,
bladder and brain by liquid chromatography–tandem mass spectrometry. J.
Chromatogr. A 1216, 7595–7601.
Xia, X., Ding, S.Y., Li, X.W., Gong, X., Zhang, S.X., Jiang, H.Y., Li, J.C., Shen, J.Z., 2009.
Validation of a confirmatory method for the determination of melamine in egg
by gas chromatography–mass spectrometry and ultra-performance liquid chro-
matography–tandem mass spectrometry. Anal. Chim. Acta 651, 196–200.
Xing, H., Wu, Y., Zhan, S., Zhou, P., 2013. A rapid colorimetric detection of melamine in
raw milk by unmodified gold nanoparticles. Food Anal. Methods 6, 1441–1447.
Xu, Q., Wei, H.P., Du, S., Li, H.B., Ji, Z.P., Hu, X.Y., 2013. Detection of subnanomolar
melamine based on electrochemical accumulation coupled with enzyme col-
orimetric assay. J. Agric. Food Chem. 61, 1810–1817.
Xu, X.M., Ren, Y.P., Zhu, Y., Cai, Z.X., Han, J.L., Huang, B.F., Zhua, Y., 2009. Direct
determination of melamine in dairy products by gas chromatography/mass
spectrometry with coupled column separation. Anal. Chim. Acta 650, 39–43.
Yang, S.P., Ding, J.H., Zheng, J., Hu, B., Li, J.Q., Chen, H.W., Zhou, Z.Q., Qiao, X.L., 2009.
Detection of melamine in milk products by surface desorption atmospheric
pressure chemical ionization mass spectrometry. Anal. Chem. 81, 2426–2436.
Yin, W., Liu, J., Zhang, T., Li, W., Liu, W., Meng, M., He, F., Wan, Y., Feng, C., Wang, S.,
Lu, X., Xi, R.J., 2010. Preparation of monoclonal antibody for melamine and
development of an indirect competitive ELISA for melamine detection in raw
milk, milk powder, and animal feeds. J. Agric. Food Chem. 58, 8152–8157.
Yokley, R.A., Mayer, L.C., Rezaaiyan, R., Manuli, M.E., Cheung, M.W., 2000. Analytical
method for the determination of cyromazine and melamine residues in soil
using LC-UV and GC-MSD. J. Agric. Food Chem. 48, 3352–3358.
Yun, W., Li, H., Chen, S.Q., Tu, D.W., Xie, W.Y., Huang, Y., 2014. Aptamer-based rapid
visual biosensing of melamine in whole milk. Eur. Food Res. Technol. 238, 989–995.
Zeng, H.J., Yang, R., Wang, Q.W., Li, J.J., Qu, L.B., 2011. Determination of melamine by
flow injection analysis based on chemiluminescence system. Food Chem. 127,
842–846.
Zhang, J., Lewin, M., Pearce, E., Zammarano, M., Gilman, J.W., 2008. Flame retarding
polyamide 6 with melamine cyanurate and layered silicates. Polym. Adv.
Technol. 19, 928–936.
Zhang, M., Cao, X., Li, H., Guan, F., Guo, J., Shen, F., Zhang, L., 2012. Sensitive
fluorescent detection of melamine in raw milk based on the inner filter effect
of Au nanoparticles on the fluorescence of CdTe quantum dots. Food Chem. 135,
1894–1900.
38 K. Rovina, S. Siddiquee / Journal of Food Composition and Analysis 43 (2015) 25–38

Zheng, X.L., Yu, B.S., Li, K.X., Dai, Y.N., 2012. Determination of melamine in dairy
products by HILIC-UV with NH2 column. Food Control 23, 245–250.
Zhou, Q., Liu, N., Qie, Z., Wang, Y., Ning, B., Gao, Z., 2011. Development of gold
nanoparticle-based rapid detection kit for melamine in milk products. J. Agric.
Food Chem. 59, 12006–12011.
Zhu, X., Wang, S., Liu, Q., Xu, Q., Xu, S., Chen, H.J., 2009. Determination of residues of
cyromazine and its metabolite, melamine, in animal-derived food by gas
chromatography–mass spectrometry with derivatization. J. Agric. Food Chem.
57, 11075–11080.
Zhu, Y., Zhang, Y., Li, J., Han, Y., Dong, G., Zhang, H., Al, E.T., 2011. Determination of
melamine in fresh milk by electrochemistry with solid phase microextraction at
bismuthyl chloride modified graphite epoxy composite electrode. Am. J. Anal.
Chem. 2, 612–618.