Catalog

021-2012-Anh..pdf ······································································································································ 1
Abstract ············································································································································· 1
Introduction ········································································································································ 1
Materials and Methods ······················································································································ 2
Results and Discussion ····················································································································· 2
Conclusions ······································································································································· 6
Acknowledgements ··························································································································· 7
References ········································································································································ 7
022-2012-Anh..pdf ······································································································································ 9
023-2012-Viet.pdf ····································································································································· 15
024-2012-Viet..pdf ···································································································································· 23
025-2012-Viet..pdf ···································································································································· 29
026-2012-Viet..pdf ···································································································································· 37
027-2012-Viet..pdf ···································································································································· 45
028-2013-Anh..pdf ···································································································································· 53
029-2013-Anh..pdf ···································································································································· 63
030-2013-Anh..pdf ···································································································································· 69
031-2013-Viet..pdf ···································································································································· 75
032-2013-Viet..pdf ···································································································································· 87
033-2013-Anh..pdf ···································································································································· 99
034-2014-Viet..pdf ·································································································································· 111
035-2014-Viet..pdf ·································································································································· 119
036-2014.-Anh.pdf ·································································································································· 129
037-2015-Anh..pdf ·································································································································· 135
038-2015-Anh.pdf ··································································································································· 143
039-2016-Viet..pdf ·································································································································· 151
039-2016-Viet.pdf ··································································································································· 161
040-2016-Viet.pdf ··································································································································· 167
 South African Journal of Animal Science 2012, 42 (No. 3)

Analysis of troponin I gene polymorphisms and meat quality in Mongcai pigs

Nguyen Trong Ngu# & Nguyen Thi Hong Nhan

College of Agriculture and Applied Biology, Cantho University, 3/2 Street, Cantho City, Vietnam

Copyright resides with the authors in terms of the Creative Commons Attribution 2.5 South African Licence.
See: http://creativecommons.org/licenses/by/2.5/za
Condition of use: The user may copy, distribute, transmit and adapt the work, but must recognise the authors and the South African
Journal of Animal Science.

________________________________________________________________________________
Abstract
Troponin I is one of myofibrillar proteins required for the calcium regulation of skeletal muscle
contraction. The expression of both genes, TNNI1 and TNNI2, in troponin is muscle fibre specific and may
affect meat quality traits. In this study, the PCR-RFLP method was applied to genotype 120 Mongcai pigs at
three single-nucleotide polymorphisms (SNPs), namely T5174C, C8350A for TNNI1 (EU743939) and
C1167T for TNNI2 (EU696779). The two SNPs, T5174C and C1167T, were significantly associated with
drip loss48 (measured after 48 h) and compression force, while the second TNNI1 SNP (C8350A) did not
show any association with meat quality traits. The results also revealed a relationship between the proportion
of IIx muscle fibre and TNNI2. Additional analysis showed a significant association of the TNNI2 SNP
(C1167T) with blood glucose. Animals carrying the CT genotype had the highest glucose concentration
(93.7 mg/dL). The results demonstrate that TNNI1 and TNNI2 are likely to play a relatively important role in
the development of pork quality in Mongcai pigs.
________________________________________________________________________________
Keywords: TNNI1, TNNI2, drip loss, meat colour, pork, indigenous Vietnamese pigs
#
Corresponding author: ntngu@ctu.edu.vn

Introduction
Meat quality, a major contributor to the degree of satisfaction of consumers, is affected by several
external and internal factors such as stress and types of muscle fibres, which are often linked to the genetic
architecture of the animal. Increased demands of consumers have gradually shifted the emphasis of pig
breeding programmes and selection criteria to improved meat quality, rather than on focusing only on lean
carcasses and a high growth rate (Fiedler et al., 2003). Local pig breeds in Vietnam seem to be advantageous
as they have poorer growth rates, but better meat quality compared with modern pig populations (Warriss
et al., 1996). However, because meat quality can only be measured late in an animal’s life, alternative
selection criteria including the use of molecular markers have been explored and many candidate genes and
other genetic markers have already been identified (Brym & Kaminski, 2006).
The contractile protein, troponin, containing the three subunits, troponin I (TnI), troponin C (TnC) and
troponin T (TnT), plays a role in the concentration of Ca2+, and is responsible for striated muscle contraction
(Xu et al., 2010a). Each troponin has isoforms that are encoded by different genes. The troponin I genes,
TNNI1 and TNNI2, are expressed exclusively in muscles of slow- and fast-twitch fibres, respectively
(Mullen & Barton, 2000). Both genes have been investigated as candidate genes for meat quality traits in a
Large White x Meishan resource population (Yang et al., 2010). In that study the authors found associations
between the T5174C SNP (TNNI1 gene) and intramuscular fat content, meat colour and marbling score, and
between the T1167C SNP (TNNI2 gene) and pH and marbling score of the longissimus dorsi muscle.
Although some studies have focused on TNNI gene variants, few studies have been published on their
association with economically important traits such as meat quality in indigenous pigs. The objective of this
study was to analyse the effects of three SNPs in the TNNI1 and TNNI2 genes with meat characteristics in
Mongcai, one of the Vietnamese native pig breeds.

URL: http://www.sasas.co.za
ISSN 0375-1589 (print), ISSN 222-4062 (online)
Publisher: South African Society for Animal Science http://dx.doi.org/10.4314/sajas.v42i3.11
Ngu et al., 2012. S. Afr. J. Anim Sci. vol. 42 289

Materials and Methods

A total of 120 Mongcai (MC) castrated males that had been reared on a state farm in the Quangninh
Province of Vietnam, were slaughtered at 202 ± 18 days of age at a body weight of 28.6 ± 6.2 kg. During the
feeding periods, animals were fed a diet containing 172 g crude protein (CP)/kg and an energy content of
13.2 MJ ME/kg dry matter. They were fasted for 12 h and then slaughtered, following the standard
commercial procedure, under the supervision of the veterinary service. Longissimus dorsi (LD) muscle
samples (from the seventh thoracic vertebra to the last lumbar) were collected. A 2 g sample was kept in
RNAlater (Qiagen) reagent for RNA isolation; a second sample was stored at –20 ºC for DNA extraction and
the remaining samples were used for meat quality evaluation.
At 24 h post mortem, meat colour, including L* (lightness), a* (redness) and b* (yellowness), was
determined using a Minolta Chroma Meter (CR310, Minolta, Japan) on the cut surface. Muscle pH was
measured at 45 min (pH45 min) and 24 h (pH24) post mortem with a Delta-320 portable pH meter (Richmond
Scientific Ltd.). Drip loss was calculated as the weight loss of a meat sample collected at 45 min post mortem
(40 ± 5 g), placed in an inflated bag at 4 ºC for 24 h (drip loss24) and 48 h (drip loss48) (Honikel, 1998). To
obtain cooking loss, a loin cube (90 ± 5 g) was taken and stored at 4 ºC for 24 h, and subsequently bagged in
thin-walled plastic and placed in a water bath at 75 ºC for 30 min. The bag was then cooled under cold water
for 30 min and cooking loss was expressed as the difference between the original weight and the cooked
weight (Renaudeau & Mourot, 2007). For compression force values, samples were thawed at 4 ºC and cut
into 10 x 10 mm cross-sections (with the fibre direction) and six samples for each loin were measured using
a TA – XT2i Texture Analyzer (Stable Micro Systems Ltd.) (Florowski et al., 2006). Blood collection was
done during exsanguination to measure glucose concentrations by Glucose SD CodeFree (Standard
Diagnostics Inc, Korea). The chemical composition of LD muscle such as dry matter, protein, ether extract
and ash content was estimated by following protocols 950.46; 981.10; 960.39 and 920.153, respectively, of
the AOAC (1998).
The total DNA of 120 samples was extracted according to the protocol described previously (Ngu,
2006). A DNA concentration of 50 ng/μL was used for further analyses. Primers and PCR conditions were
adapted from Xu et al. (2010b). The PCR product was sequenced for confirmation of specificity and
segregation of polymorphisms in the population. PCR-RFLP (restriction fragment length polymorphism) was
applied using three restriction enzymes, XbaI, MspI and SmaI, to genotype animals at the three SNPs,
T5174C, C8350A (TNNI1) and C1167T (TNNI2), respectively (Xu et al., 2010b). In each PCR-RFLP
reaction, a mix containing 1 unit of enzyme, 1 µL of 10x restriction buffer and 1 µg of PCR product was
incubated at 37 ºC for 15 min to ensure complete digestion. The digested product was checked by
electrophoresis on a 2% agarose gel at 80 V for 1 hour.
Total RNA was isolated from individual LD samples of MC pigs, using the TRIzol® Reagent
(Invitrogen, Karlsruhe, Germany) according to the manufacturer’s protocol. Subsequently, cDNA was
synthesized according to the instruction of the High Capacity RNA to cDNA Kit (Applied Biosystems). A
real-time RT-PCR approach was applied, using five primer pairs from an earlier study (Wimmers et al.,
2008) and the expression level of each fibre was determined based on the 2-ΔΔCt method described by Livak
& Schmittgen (2001). From this expression level, type IIb was assumed to be 1, and the relative ratios of
types I, IIa and IIx to IIb were calculated as the corresponding expression of type I, IIa and IIx fibres. The
muscle fibre percentage was then calculated from these proportions for each muscle type (Li et al., 2009). In
total, 30 MC pigs were used for muscle fibre typing.
The chi-square test was applied for testing if markers were in Hardy-Weinberg equilibrium (Rodriguez
et al., 2009). Analysis of variance was performed using a general linear model in Minitab (version 13.20) to
investigate the effect of genotypes on meat quality traits. Factors found to affect the traits such as genotype,
boar, sow and slaughter weight were used in the model. A P-value less than 0.05 was deemed the significant
threshold using the Tukey option in the least square procedure.

Results and Discussion

Animals were genotyped at two loci in the TNNI1 gene and one in the TNNI2 gene, and the PCR
product sizes were 190, 320 and 425 bp, respectively. All three SNPs, T5174C (TNNI1_XbaI), C8350A
(TNNI1_MspI) and C1167T (TNNI2_SmaI) were segregated in the animals from the MC population (Figure
1).
290 Ngu et al., 2012. S. Afr. J. Anim Sci. vol. 42

CT TT CC TT M CC AC CC AA M
CT TT CC TT M
425 bp
320 bp 288 bp
190 bp 277 bp 137 bp
111 bp
79 bp 93 bp
(a) (b) (c)
Figure 1 Agarose gel electrophoresis of PCR-RFLP: (a) TNNI1_XbaI, (b) TNNI1_MspI and
(c) TNNI2_SmaI, M: 100 bp Fermentas Marker.

Digestion of the TNNI1 PCR product with XbaI produced three fragments (Figure 1a), two of which
were 111 and 79 bp, where the presence of the base C was recognised by the enzyme. The 190 bp product
showed that alleles with the alternative base T were not cut. The corresponding genotype frequencies were
0.15, 0.49 and 0.36 for CC, CT and TT, respectively (Table 1) and the animals were in Hardy-Weinberg
equilibrium (P >0.05) at the TNNI1_XbaI locus. Similarly, alleles of animals carrying the base C at the
second TNNI1 SNP (TNNI1_MspI) were cut by the enzyme, resulting in two bands of 277 and 93 bp length,
while alleles carrying A at the enzyme recognition site showed only one 320 bp fragment on agarose gel
(Figure 1b). The frequencies of AA, AC and CC genotypes were 0.52, 0.25 and 0.23, respectively.
Genotyping of individuals at the TNNI2 (TNNI2_SmaI) locus distinguished between three genotypes with
visualised fragment sizes of 425 bp (TT), 288 and 137 bp (CC) and 425, 288 and 137 bp (CT) (Figure 1c). In
addition, it was found that the animals chosen for this study were not in Hardy-Weinberg equilibrium at both
loci (P <0.001). The current findings corroborate the results of Xu et al. (2010b), who detected two SNPs in
the TNNI1 gene in indigenous Meishan pigs with higher frequencies of T (T5174C) and A (C8350A) alleles
(0.86 and 0.76, respectively) while studies using commercial pigs, revealed a higher percentage of animals
carrying the C allele (Xu et al., 2010b).

Table 1 Genotype and allele frequencies of three SNPs in MC pigs

SNPs Observed genotypes1 Total Allelic frequencies Χ (HW) P (HW)

TNNI1_XbaI CC CT TT C T
T5174C 0.15 (18) 0.49 (59) 0.36 (43) 120 0.40 0.60 0.094 0.954

TNNI1_MspI AA AC CC A C
C8350A 0.52 (57) 0.25 (27) 0.23 (25) 109 0.65 0.35 22.850 0.000

TNNI2_SmaI CC CT TT C T
C1167T 0.57 (69) 0.27 (32) 0.16 (19) 120 0.71 0.29 15.091 0.000
1
Data presented as frequency followed by individual number (in parenthesis).

The TNNI1_XbaI genotypes showed an association (P <0.05) with drip loss48, compression force and
crude protein content whereas no significant association was found for TNNI1_MspI (Table 2). Animals
carrying the CC genotype at locus TNNI1_XbaI exhibited the highest drip loss percentage at 48 h post
mortem (3.36%) followed by TT and CT (2.83% and 2.43%, respectively). An association (P <0.05) was
also found for compression force; meat from TT animals appeared to be tender with a lower compression
force (4.70 kg). Also the CP values were higher in the MC loin muscle of pigs with TT genotypes compared
Ngu et al., 2012. S. Afr. J. Anim Sci. vol. 42 291

to CC animals. No statistical association could be shown for the second TNNI1 locus, TNNI1_MspI (Table
2).

Table 2 Association of TNNI1 SNPs with meat quality traits (LSM ± SE)

TNNI1_XbaI TNNI1_MspI
Trait
CC (n = 18) CT (n = 59) TT (n = 43) AA (n = 57) AC (n = 27) CC (n = 25)

pH45 min 6.57 ± 0.06 6.61 ± 0.04 6.68 ± 0.04 6.68 ± 0.04 6.60 ± 0.04 6.58 ± 0.06
pH24 6.16 ± 0.06 6.19 ± 0.04 6.23 ± 0.04 6.20 ± 0.04 6.21 ± 0.05 6.28 ± 0.06
Drip loss24 (%) 2.27 ± 0.25 1.81 ± 0.15 1.96 ± 0.17 1.85 ± 0.17 2.26 ± 0.22 1.88 ± 0.25
Drip loss48 (%) 3.36a ± 0.30 2.43b ± 0.18 2.83ab ± 0.20 2.66 ± 0.20 3.15 ± 0.26 2.74 ± 0.29
Cooking loss (%) 22.82 ± 1.34 22.56 ± 0.81 23.56 ± 0.88 22.47 ± 0.82 23.71 ± 1.10 22.22 ± 1.21
Compression force (kg) 5.23ab ± 0.48 5.74a ± 0.29 4.70b ± 0.32 5.35 ± 0.33 5.11 ± 0.43 5.70 ± 0.49
Meat colour
L* (lightness) 49.66 ± 0.48 49.32 ± 0.29 49.06 ± 0.32 49.03 ± 0.30 49.32 ± 0.40 49.12 ± 0.44
a* (redness) 5.34 ± 0.84 5.62 ± 0.51 5.85 ± 0.56 6.19 ± 0.52 5.39 ± 0.69 4.88 ± 0.77
b* (yellowness) 9.10 ± 0.42 9.04 ± 0.26 8.44 ± 0.28 8.67 ± 0.27 8.56 ± 0.36 9.43 ± 0.40
Nutritional value
Dry matter (%) 25.6 ± 0.41 25.6 ± 0.25 25.8 ± 0.27 25.9 ± 0.26 25.2 ± 0.34 25.4 ± 0.39
Crude protein (%) 21.4b ± 0.30 22.0ab ± 0.18 22.4a ± 0.20 21.9 ± 0.21 22.3 ± 0.27 22.0 ± 0.31
Ether extract (%) 2.57 ± 0.16 2.60 ± 0.10 2.50 ± 0.11 2.61 ± 0.11 2.46 ± 0.14 2.49 ± 0.16
Ash (%) 1.03 ± 0.11 1.00 ± 0.07 1.05 ± 0.07 1.11 ± 0.07 0.95 ± 0.09 1.00 ± 0.10
a, b
Row means with different superscripts differ significantly at P <0.05.

An association was additionally observed between the TNNI2 (TNNI2_SmaI) locus and drip loss48 (P
= 0.002). This locus also showed some effect (P = 0.057) on drip loss at 24 h (Table 3).
Many factors, such as genetics, carcass handling, temperature management post mortem, nutrition and
meat processing have been investigated as factors influencing drip loss, with the physiological mechanism
mainly centred on proteins (specially myofibrillar protein) and structures binding and entrapping water
(Huff-Lonergan & Lonergan, 2005; Jennen et al., 2007). In the present study, both TNNI1_XbaI and
TNNI2_SmaI loci were associated with drip loss48 but it seems not likely that the effect of the genes
originates from their impact on muscle fibre type composition, as suggested by Ryu & Kim (2005). These
authors suggested that increased IIb fibre content together with decreased type I and IIa fibre content were
linked to higher drip loss, and therefore leading to poorer meat quality (Ryu & Kim, 2005). In the present
study, variation of drip loss and type IIx fibre muscle of the TNNI2_SmaI polymorphism appeared to have a
negative relationship, especially in heterozygous animals (CT). This was partly in line with the outputs of
Chang et al. (2003), who presented both negative and positive correlations of the IIx fibre with drip loss in
traditional breeds of Berkshire and Tamworth, respectively. Different pig breeds have their own biochemical
and biophysical properties and because IIx is an intermediate fibre, its characteristics are more prone to IIa,
or IIb fibres are dependent on the metabolic condition of the breed (Chang et al., 2003). Additionally, Yang
et al. (2010) could not find any significant difference of the genotypes in relation to drip loss or water
holding capacity while our results, in the contrary, showed the effects of TNNI1 and TNNI2 on pH, meat
colour and intramuscular fat, of which heterozygous pigs had an inferior meat quality in terms of lower meat
pH and intramuscular fat content. The lack of consistency on the association may be that these SNPs are not
causative mutations and that the effects are breed-specific for the traits analysed.
292 Ngu et al., 2012. S. Afr. J. Anim Sci. vol. 42

Table 3 Association of TNNI2 SNP with meat quality traits (LSM ± SE)

TNNI2_SmaI
Trait P
CC (n = 69) CT (n = 32) TT (n = 19)

pH45 min 6.62 ± 0.04 6.61 ± 0.05 6.67 ± 0.07 0.774

pH24 6.22 ± 0.03 6.13 ± 0.04 6.22 ± 0.06 0.180
Drip loss24 (%) 2.02 ± 0.15 1.56 ± 0.19 2.19 ± 0.26 0.057
Drip loss48 (%) 2.80a ± 0.18 2.12b ± 0.23 3.36a ± 0.31 0.002
Cooking loss (%) 23.73 ± 0.81 22.10 ± 1.02 22.27 ± 1.36 0.325
Compression force (kg) 5.20 ± 0.31 5.36 ± 0.38 5.25 ± 0.51 0.935
Meat colour
L* (lightness) 49.20 ± 0.29 49.54 ± 0.37 49.15 ± 0.49 0.675
a* (redness) 5.29 ± 0.51 5.84 ± 0.64 6.36 ± 0.86 0.515
b* (yellowness) 8.97 ± 0.26 8.79 ± 0.32 8.50 ± 0.44 0.642
Chemical composition
Dry matter (%) 25.6 ± 0.25 26.1 ± 0.31 25.2 ± 0.42 0.244
Crude protein (%) 21.9 ± 0.20 22.3 ± 0.25 22.0 ± 0.34 0.398
Ether extract (%) 2.56 ± 0.10 2.54 ± 0.13 2.56 ± 0.17 0.989
Ash (%) 1.03 ± 0.06 0.93 ± 0.08 1.16 ± 0.11 0.210
a, b
Row means with different superscripts differ significantly at P <0.05.

Table 4 Relationship between three SNPs and muscle fibre type composition (LSM ± SE)

Muscle fibre TNNI1_XbaI TNNI1_MspI TNNI2_SmaI

composition CC CT TT AA AC CC CC CT TT
(%) (n = 5) (n = 13) (n = 12) (n = 16) (n = 8) (n = 2) (n = 16) (n = 8) (n = 6)

22.7 23.2 23.4 23.8 22.9 23.1 24.5 22.3 21.9

Type I
(± 3.0) (± 4.4) (± 4.1) (± 3.9) (± 4.5) (± 6.2) (± 3.5) (± 4.4) (± 4.6)

27.9 27.3 25.4 25.4 27.3 30.4 27.7 25.3 26.4

Type IIa
(± 4.3) (± 3.7) (± 5.5) (± 5.2) (± 2.8) (± 0.3) (± 3.9) (± 3.2) (± 7.3)

38.0 38.3 39.1 38.5 39.4 37.2 36.4b 41.0a 39.5ab

Type IIx
(± 3.2) (± 4.3) (± 5.2) (± 4.6) (± 5.2) (± 6.2) (± 3.0) (± 4.0) (± 5.8)

11.3 11.2 12.1 12.3 10.4 9.3 11.4 11.4 12.3

Type IIb
(± 1.6) (± 2.5) (± 3.4) (± 3.1) (± 1.7) (± 0.3) (± 2.9) (± 2.1) (± 3.4)
a, b
Row means with different superscripts differ significantly at P <0.05.

Four out of eight isoforms known in mammals have been identified in porcine muscle according to
their specific expression of the myosin heavy chain (Chang & Fernandes, 1997). Based on their metabolic
and myosin adenosine triphosphatase (mATPase) activity, these fibres are categorized as slow-oxidative and
fast-glycolytic or slow/I and IIb fibres, standing for extreme metabolic profiles. The IIa and IIx fibres are
defined as intermediates with the transition that IIa fibres are more similar to slow/I type and IIx fibres are
more in relation to IIb fibres (Pette & Staron, 2000; Chang et al., 2003). Expression and sequence of
troponin I appeared to be linked to different muscle fibre isoforms, since Furukawa & Peter (1971) stated
that troponin activity in skeletal muscle of guinea pigs is related to three histochemical fibres in such a way
that intermediate and red fibres have lower troponin activities compared to white fibres. To verify this
Ngu et al., 2012. S. Afr. J. Anim Sci. vol. 42 293

phenomenon, an additional analysis on the relationship between genotypes and muscle fibre composition
was done in 30 MC animals. However, no significant association could be shown between the TNNI1
genotypes and fibre type composition, whereas at the TNNI2_SmaI locus, heterozygous animals produced
more IIx fibres (41.0%) compared to the homozygous TT (39.5%) and CC (36.4%) animals (Table 4).
The texture of meat is usually evaluated by shear force and compression force; both traits display
sensory quality. In the current study, it was observed that the compression force necessary to cut the meat
was lowest in animals carrying the TT genotype at the TNNI1_XbaI locus. Generally, the texture of meat
depends on the intramuscular fat; a higher fat content is usually correlated with greater tenderness or lower
compression force (Florowski et al., 2006). The TNNI2 locus showed significant association with the
amount of IIx fibre but no effect on meat tenderness measured by compression force value could be shown.
The results from the association study for the two significant loci TNN1_XbaI and TNNI2_SmaI supported
previous findings of low or unclear phenotypic correlations between muscle fibres and compression force
(Wojtysiak & Migdal, 2007). Although muscle fibre type composition has been considered as a useful
parameter to partly explain the variation of meat quality traits, the direct effect remained unclear and it could
be the case in the present study that the association of genotypes of TNNI1 and TNNI2 genes with drip loss
and compression force may derive from other meat characteristics including sarcoplasmic protein, muscle
enzymes and connective tissue (Do et al., 2008) rather than the percentages of muscle fibre in LD muscle.
Nevertheless, these associations implied that MC pigs carrying the T allele at the TNNI1_XbaI locus are
likely to have a better meat quality.
In this study a significant effect on blood glucose could only be shown for the TNNI2_SmaI locus;
heterozygous MC pigs had the highest blood glucose concentrations (93.7 mg/dL) (Figure 2).

120
*
100
Glucose((mg/dL)
g )

80

60

40

20

0
CC
CC CT
CT TT
TT AA
A A AC
AC CC
CC CC
CC CT
CT TT
TT
TNNI1_XbaI
TNNI1_XbaI TNNI1_MspI
TNNI1_MspI TNNI2_SmaI
TNNI2_SmaI

Figure 2 Effects of SNPs on blood glucose (n = 89).* Significant difference at P <0.05.

A higher proportion of IIb fibre has been shown to be related to greater glycolytic activity and as a
consequence higher glucose concentrations can be expected (Karlsson et al., 1999). Choe et al. (2009) later
confirmed this by classifying white fibre (IIx and IIb) by histochemical analysis and reporting a correlation
between blood glucose levels and area percentages of these fibres. Also, in MC pigs (Table 4), heterozygous
animals at the TNNI2_SmaI locus had a higher percentage of IIx and IIb fibres (52.4%) and higher blood
glucose levels, suggesting that blood glucose could be a potential bio-marker for the prediction of muscle
fibre composition.

Conclusions
Among the three loci examined, TNNI1_XbaI and TNNI2_SmaI SNPs provide some evidence on the
potential use as markers for meat quality traits such as drip loss and compression force in Mongcai pigs.
However, as suggested by Xu et al. (2010b) and Yang et al. (2010) further studies are needed to investigate
the effect of these SNPs also in combination with surrounding genes, for instance, the IGF2 (Insulin-like
Growth Factor 2) mutation.
294 Ngu et al., 2012. S. Afr. J. Anim Sci. vol. 42

Acknowledgements
This project was supported financially by Vietnam's National Foundation for Science and Technology
Development (NAFOSTED), Grant No. 106.06.62.09.

References
AOAC, 1998. Official Methods of Analysis (16th ed.). Association of Official Analytical Chemists, Inc.,
Arlington, Virginia, USA.
Brym, P. & Kaminski, S., 2006. Database of SNPs in candidate genes potentially associated with yield and
quality of pork. Anim. Sci. Pap. Rep. 24, 239-257.
Chang, K.C., da Costa, N., Blackley, R., Southwood, O., Evans, G., Plastow, G., Wood, J.D. & Richardson,
R.I., 2003. Relationships of myosin heavy chain fiber types to meat quality traits in traditional and
modern pigs. Meat Sci. 64, 93-103.
Chang, K.C. & Fernandes, K., 1997. Developmental expression and 5' end cDNA cloning of the porcine 2x
and 2b myosin heavy chain genes. DNA Cell Biol. 16, 1429-1437.
Choe, J.H., Choi, Y.M., Lee, S.H., Nam, Y.J., Jung, Y.C., Park, H.C., Kim, Y.Y. & Kim, B.C., 2009. The
relation of blood glucose level to muscle fiber characteristics and pork quality traits. Meat Sci. 83,
62-67.
Do, K.T., Ha, Y., Mote, B.E., Rothschild, M.F., Choi, B.H., Lee, S.S., Kim, T.H., Cho, B.W. & Kim, K.S.,
2008. Investigation of single nucleotide polymorphisms in porcine chromosome 2 quantitative trait
loci for meat quality traits. Asian-Aust. J. Anim. Sci. 21, 155-160.
Fiedler, I., Nurnberg, K., Hardge, T., Nurnberg, G. & Ender, K., 2003. Phenotypic variations of muscle fiber
and intramuscular fat traits in longissimus muscle of F2 population Duroc x Berlin Miniature Pig and
relationships to meat quality. Meat Sci. 63, 131-139.
Florowski, T., Pisula, A., Adamczak, L., Buczynski, J.T. & Orzechowska, B., 2006. Technological
parameters of meat in pigs of two Polish local breeds–Zlotnicka Spotted and Pulawska. Anim. Sci.
Pap. Rep. 24, 217-224.
Furukawa, T. & Peter, J.B., 1971. Troponin activity of different types of muscle fibers. Exp. Neurol. 31,
214-222.
Honikel, K.O., 1998. Reference methods for the assessment of physical characteristics of meat. Meat Sci. 49,
447-457.
Huff-Lonergan, E. & Lonergan, S.M., 2005. Mechanisms of water-holding capacity of meat: The role of post
mortem biochemical and structural changes. Meat Sci. 71, 194-204.
Jennen, D.G.J., Brings, A.D., Liu, G., Juengst, H., Tholen, E., Jonas, E., Tesfaye, D., Schellander, K. &
Phatsara, C., 2007. Genetic aspects concerning drip loss and water-holding capacity of porcine meat. J.
Anim. Breed. Genet. 124, 2-11.
Karlsson, A.H., Klont, R.E. & Fernandez, X., 1999. Skeletal muscle fibers as factors for pork quality. Livest.
Prod. Sci. 60, 255-269.
Li, X., Yang, X., Shan, B., Shi, J., Xia, D., Wegner, J. & Zhao, R., 2009. Meat quality is associated with
muscle metabolic status but not contractile myofiber type composition in premature pigs. Meat Sci.
81, 218-223.
Livak, K.J. & Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative
PCR and the 2-ΔΔCt method. Methods 25, 402-408.
Mullen, A.J. & Barton, P.J.R., 2000. Structural characterization of the human fast skeletal muscle troponin I
gene (TNNI2). Gene 242, 313-320.
Ngu, N.T., 2006. Transcript abundance of myosin heavy chain isoforms and identification of candidate genes
for body composition and meat quality in pigs. Doctorial thesis, University of Bonn, Bonn, Germany,
http://hss.ulb.uni-bonn.de/diss_online/landwfak/2006/ngu_nguyen/.
Pette, D. & Staron, R.S., 2000. Myosin isoforms, muscle fiber types, and transitions. Microsc. Res. Tech. 50,
500-509.
Renaudeau, D. & Mourot, J., 2007. A comparison of carcass and meat quality characteristics of Creole and
Large White pigs slaughtered at 90 kg BW. Meat Sci. 76, 165-171.
Rodriguez, S., Gaunt, T.R. & Day, I.N.M., 2009. Hardy-Weinberg equilibrium testing of biological
ascertainment for Mendelian randomization studies. Am. J. Epidemiol. 169, 505-514.
Ngu et al., 2012. S. Afr. J. Anim Sci. vol. 42 295

Ryu, Y.C. & Kim, B.C., 2005. The relationship between muscle fiber characteristics, post mortem metabolic
rate, and meat quality of pig longissimus dorsi muscle. Meat Sci. 71, 351-357.
Warriss, P.D., Kestin, S.C., Brown, S.N. & Nute, G.R., 1996. The quality of pork from traditional pig breeds.
Meat Focus International 5.
Wimmers, K., Ngu, N.T., Jennen, D.G.J., Tesfaye, D., Murani, E., Schellander, K. & Ponsuksili, S., 2008.
Relationship between myosin heavy chain isoform expression and muscling in several diverse pig
breeds. J. Anim. Sci. 86, 795-803.
Wojtysiak, D. & Migdal, W., 2007. Differences in muscle fiber composition and tenderness of m.
longissimus lumborum between heterozygous and homozygous negative Polish Landrace pigs for the
RYR1. Arch. Tierz, Special Issue, 186-193.
Xu, Z.Y., Yang, H., Li, Y., Xiong, Y.Z. & Zuo, B., 2010a. Temporal expression of TnI fast and slow
isoforms in biceps femoris and masseter muscle during pig growth. Animal 4, 1541-1546.
Xu, Z.Y., Yang, H., Xiong, Y.Z., Deng, C.Y., Li, F.E., Lei, M.G. & Zuo, B., 2010b. Identification of three
novel SNPs and association with carcass traits in porcine TNNI1 and TNNI2. Mol. Biol. Rep. 37,
3609-3613.
Yang, H., Xu, Z.Y., Lei, M.G., Li, F.E., Deng, C.Y., Xiong, Y.Z. & Zuo, B., 2010. Association of 3
polymorphisms in porcine troponin I genes (TNNI1 and TNNI2) with meat quality traits. J. Appl.
Genet. 51, 51-57.
African Journal of Biotechnology Vol. 11(73), pp. 13782-13787, 11 September, 2012
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB12.2022
ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Effects of calpastain (CAST) polymorphisms on carcass

and meat quality traits in Mongcai pigs
Nguyen Trong Ngu1*, Nguyen Thiet2, Le Trung Kien1, Chau Thanh Vu1, Nguyen Thi Hong
Nhan1, Pham Ngoc Du1, Nguyen Thi Kim Khang1 and Tran Nhan Dung3
1
College of Agriculture and Applied Biology, Cantho University, Vietnam.
2
College of Rural Development, Cantho University, Vietnam.
3
Biotechnology Research and Development Institute, Cantho University, Vietnam.
Accepted 1 August, 2012

Calpastain (CAST) activity plays a major role in muscle growth and proteolytic changes post-mortem
and the CAST gene has been considered as a candidate gene for carcass and pork quality
characteristics. The aim of this study was to analyze the association of two polymorphisms namely
CAST_HinfI (allele A and B) and CAST_MspI (allele C and D) with carcass and meat quality traits in
Mongcai, a Vietnamese indigenous pig breed. Polymerase chain reaction-restriction fragment length
polymorphism (PCR-RFLP) was used to genotype the animals at these loci. Results indicate that the
CAST_HinfI single nucleotide polymorphism (SNP) had a low frequency of allele A as compared to allele
B, while the C and D allele distribution was almost the same for the CAST_MspI SNP. In the association
analysis, significant effects on dressing percentage of carcass were detected. The CAST_HinfI locus
was associated with the pH24, while the CAST_MspI position was in association with pH45 min, drip loss48
and redness color. Additional analysis showed a variation in muscle fiber type composition with higher
proportion of IIx fiber in pigs with AB genotype (P < 0.05). Three constructed haplotypes namely AB/CD,
AB/DD and BB/CC also had significant effects on carcass, type IIa and IIb fiber percentages.

Key words: Association, carcass, pork quality, Vietnamese local pig.

INTRODUCTION

Calpastatin (CAST) is a specific inhibitor of calpain, a
2+
Ca activated protease family and is considered to be
responsible for the initiation of myofibrillar protein
degradation in living muscle (Goll et al., 1992). Genes
coding for calpastatin and calpain are therefore
suggested as candidate genes for growth and meat
quality of skeletal muscle. In this perspective, Kurył et al.
(2003) characterized the polymorphisms of CAST using
three restriction enzymes (HinfI, MspI and RsaI) in
*Corresponding author. E-mail: ntngu@ctu.edu.vn. Tel: 84-710-
3831166. Fax: 84-710-3830814
Abbreviations: CAST, Calpastain; pH45 min, pH at 45 min post-
mortem; pH24, pH at 24 h post-mortem; Drip loss24, Drip loss 24
h post-mortem; Drip loss48, Drip loss 48 h post-mortem; SNP,
single nucleotide polymorphism.
several pig breeds. The results showed that pigs with
different genotypes had various back fat and weight and
that there was an association between eye muscle area
and the CAST genotype. This was further supported by
Krzęcio et al. (2005), who demonstrated the effect of
CAST_MspI on drip loss and nutritional value of the
meat, that is, protein content. In the Jinhua x Pietrain F2
population, the three genotypes at these loci were proven
to associate with loin area and pH45 min value as well as
the percentage of intramuscular connective tissue (Wu et
al., 2007). Moreover, the association of CAST_HinfI locus
with pork quality traits including pH, drip loss and meat
color was reported in a cross of commercial Pietrain-
based breed. Although, there has been extensive
research on the effect of this gene on carcass and meat
quality in different pig breeds, there is still limited
information with regards to the Vietnamese native pigs,
especially the Mongcai (MC) breed. This study aimed to

examine the distribution of genotypes from the CAST_
MspI and CAST_HinfI loci and investigated the
association of these polymorphisms with carcass and
meat quality in MC pigs.
MATERIALS AND METHODS
Animals and sampling
This study was carried out on castrated male MC pigs that were
reared at a state farm in Quangninh province, Vietnam. All animals
were fed under similar conditions and they were slaughtered at 197
± 17 days of age with the slaughter weight of 28.5 ± 6.0 kg. The
carcasses were assessed following the standard commercial
procedures. Hot carcass weight was recorded and dressing
percentage was defined as the ratio of carcass weight to live
weight. In addition, Longissimus dorsi (LD) muscle samples (from
the seventh thoracic vertebra to the last lumbar) were collected and
divided into three parts: a small sample was kept in RNAlater
(Qiagen) reagent for RNA isolation, a second sample was stored at
-20°C for DNA extraction and the remaining samples were vacuum-
packed.
Meat quality trait measurements
Meat color classified as lightness (L*), redness (a*) and yellowness
(b*), were determined on a fresh cut surface 24 h post-mortem by
using a Minolta Chromameter (CR310, Minolta, Japan). Muscle pH
was measured at 45 min (pH45 min) and 24 h (pH24) post-mortem
with a Delta-320 pH meter (Mettler Toledo, USA). Drip loss was
calculated as the weight loss of a meat sample (40 ± 5 g) placed in
a bag at 4°C for 24 (drip loss24) and 48 h (drip loss48) (Rehfeldt et
al., 2008).
Muscle fiber composition
Total RNA was isolated from individual LD samples of MC pigs
using TRIzol® Reagent (Invitrogen, Karlsruhe, Germany) according
to the manufacturer’s protocol. Subsequently, cDNA was
synthesized following the instruction for the High Capacity RNA to
cDNA Kit (Applied Biosystems). A real-time RT-PCR approach was
applied using five primer pairs from an earlier study (Wimmers et
al., 2008) and the expression level of each fiber was determined
base on the 2-ΔΔCt method described by Livak and Schmittgen
(2001). From this expression level, type IIb was assumed as 1, and
the relative ratios of type I, IIa or IIx to IIb were calculated as the
corresponding expression of type I, IIa and IIx fibers. The muscle
fiber percentage was then calculated from these proportions for
each muscle type (Li et al., 2009). In total, there were 30 MC pigs
used for muscle fiber typing.
Genotyping
Total DNA was extracted using phenol-chloroform extraction. A
working solution of DNA was prepared by diluting DNA in 1x TA
buffer to the concentration of 50 ng/µl. The primer sequence and
PCR conditions to amplify the product of the CAST gene (GenBank
Accession No. EU137105.1) were applied following the method
detailed by Ernst et al. (1998). For genotyping, genetic variants
were identified by the PCR-RFLP method using two restriction
Ngu et al. 13783
enzymes namely HinfI and MspI (MBI, Fermentas). In each PCR-
RFLP reaction, a mixture containing 1 unit of enzyme, 1 µl of 10 x
restriction buffer and 1 µg of PCR product was incubated at 37°C
for 15 min to ensure complete digestion. The digested products
were checked by electrophoresis on a 2% agarose gel at 80 V for 1
h. From the two detected SNPs, a construction of haplotype using
Merlin software (Abecasis et al., 2002) was performed and these
haplotypes together with two SNPs were analyzed in the
association study.
Statistical analysis
Analysis of variance was performed by using a general linear model
in Minitab (version 13.20) to investigate the effect of genotypes on
carcass and meat quality traits. Factors found to affect the traits
such as genotype, boar and mother were used in the model and
body weight at slaughter was added as a covariate. A P-value less
than 0.05 was used as significant threshold using the Tukey’s
option in the least squares procedure. Data were presented as least
square means ± standard error.
RESULTS
The primer pair amplified a 1421-bp fragment of the
CAST gene. The product was digested with HinfI and
MspI restriction enzymes and PCR-RFLP patterns are
shown in Figures 1 and 2, respectively. Genotype and
allele frequencies for the two SNPs are listed in Table 1.
The CAST_HinfI SNP showed a higher frequency of
allele B than allele A and as a result, very few AA animals
were observed in the population. At the CAST_MspI
locus, the frequency of CC and DD genotypes was
slightly different.
Table 2 presents the effects of CAST_HinfI, CAST_
MspI and the constructed haplotypes on carcass and
meat quality characteristics of LD muscle. The dressing
percentage was significantly (P < 0.05) affected by the
CAST_HinfI SNP with a lower value in BB animals. With
meat traits, the pH45 min showed similar values but pH24
appeared to be higher in BB pigs (P < 0.05). None of the
significant effects of genotype were found for other meat
quality parameters. In addition, hot carcass and the
dressing percentage of MC pigs were associated (P <
0.05) with genotypes at CAST_MspI locus and the
highest values were observed in CD and DD animals.
This SNP significantly affected pH45 min. drip loss48 (P <
0.05) and meat redness color (P < 0.01). Similarly, the
haplotypes showed significant effects on carcass and
redness color of the meat.
The association of two SNPs and haplotypes with
muscle fiber content is shown in Table 3. The
percentages of all fibers were almost the same among
genotypes at both loci with the exception of the
intermediate (type IIx) fiber proportion that was higher (P
< 0.05) in pigs of AB genotype. Furthermore, the CAST
haplotypes were associated with type IIa and IIb fibers (P
< 0.05) with the highest proportion in BB/CC and AB/DD
haplotypes, respectively.
13784 Afr. J. Biotechnol.

Figure 1. Agarose gel electrophoresis of CAST gene after HinfI digestion. AA genotype shows
five fragments (660, 376, 211, 174 and 163 bp), AB genotype shows six fragments (660, 497,
376, 211, 174 and 163 bp) and BB genotype shows five fragments (497, 376, 211, 174 and 163
bp). The separation of 174 and 163 bp bands cannot be seen on the gel. M: 100 bp DNA ladder,
Fermentas.

Figure 2. Agarose gel electrophoresis of CAST gene after MspI digestion. CC genotype shows
four fragments (650, 496, 276 and 275 bp), CD genotype shows five fragments (650, 496, 374,
276 and 275 bp) and DD genotype shows four fragments (496, 374, 276 and 275 bp). The
separation of 276 and 275 bp bands cannot be seen on the gel. M: 100 bp DNA ladder,
Fermentas.

Table 1. Genotype and allele frequencies of two SNPs in MC population.

SNPs Genotype frequency Allele frequency

AA AB BB A B
CAST_HinfI (n = 101)
0.04 0.70 0.26 0.39 0.61

CC CD DD C D
CAST_MspI (n = 109)
0.25 0.57 0.18 0.53 0.47
 Ngu et al. 13785

Table 2. Association of the CAST SNPs and haplotypes with carcass and meat quality traits.

CAST_HinfI genotypes CAST_MspI genotypes CAST haplotypes

Trait AA AB BB CC CD DD AB/CD AB/DD BB/CC
P P P
(n = 4) (n = 71) (n = 26) (n = 27) (n = 62) (n = 20) (n = 40) (n = 14) (n = 16)
Carcass
b ab a b a b
Hot carcass (%) 79.4±2.5 79.2±0.6 78.3±0.9 0.510 77.5±1.0 78.8±0.6 81.5±1.2 0.022 78.3±0.8 82.1±1.3 78.0±1.1 0.015
ab a b b a a b a b
Dressing (%) 68.4±1.8 68.5±0.4 66.5±0.7 0.033 66.9±0.9 69.1±0.5 70.7±1.2 0.011 67.7±0.6 70.6±1.0 66.5±0.9 0.015

Meat quality traits

a b a
pH45 min 6.83±0.11 6.62±0.03 6.66±0.04 0.155 6.71±0.04 6.60±0.02 6.74±0.05 0.025 6.58±0.04 6.71±0.06 6.63±0.06 0.190
ab b a
pH24 6.22±0.09 6.11±0.02 6.20±0.04 0.045 6.20±0.04 6.13±0.03 6.16±0.04 0.331 6.10±0.03 6.15±0.06 6.20±0.05 0.211
Drip loss24 (%) 2.10±0.39 1.82±0.09 1.83±0.14 0.783 1.97±0.18 1.92±0.12 1.61±0.21 0.365 1.87±0.12 1.32±0.20 1.85±0.18 0.062
a a b
Drip loss48 (%) 2.49±0.53 2.66±0.12 2.82±0.21 0.732 2.83±0.20 2.75±0.13 2.09±0.23 0.032 2.89±0.18 2.25±0.29 2.82±0.26 0.163
L* (Lightness) 50.5±0.8 49.4±0.2 49.2±0.3 0.307 49.3±0.3 49.2±0.2 49.7±0.4 0.499 49.2±0.3 49.6±0.5 49.2±0.4 0.728
b b a b a b
a* (Redness) 5.6±1.5 5.9±0.4 5.6±0.6 0.684 4.9±0.5 5.4±0.3 8.0±0.6 0.001 5.4±0.5 8.8±0.8 4.1±0.7 0.001
b* (Yellowness) 8.6±0.7 8.6±0.2 9.1±0.3 0.356 9.1±0.3 8.5±0.2 8.4±0.3 0.119 8.3±0.2 8.5±0.4 8.9±0.3 0.243

Table 3. Association of the CAST SNPs and haplotypes with muscle fiber type composition.

Muscle fiber CAST_HinfI genotypes CAST_MspI genotypes CAST haplotypes

type AB (n = 5) BB (n = 25) P CC (n = 5) CD (n = 17) DD (n = 8) P AB/CD (n = 17) AB/DD (n = 9) BB/CC (n = 4) P
Type I 21.6±2.2 24.5±2.9 0.160 24.3±3.2 21.1±2.3 23.0±2.7 0.294 20.2±1.3 24.3±1.7 22.9±2.4 0.168
ab b a
Type IIa 26.4±2.4 29.5±3.3 0.213 29.9±2.6 28.1±2.6 24.1±3.0 0.135 27.4±1.1 24.7±1.3 32.0±1.8 0.024
Type IIx 40.1±2.3 34.8±3.1 0.023 35.1±3.5 39.6±2.5 39.8±2.9 0.238 41.2±1.5 37.8±1.7 35.2±2.4 0.055
ab a b
Type IIb 11.9±1.8 11.2±2.4 0.645 10.7±2.6 11.2±2.0 13.1±2.2 0.347 11.2±0.6 13.2±0.7 9.9±1.0 0.044

DISCUSSION
In MC pigs, there are three possible genotypes at
both loci, which are similar to other breeds, such
as Yorkshire and Large White (Ernst et al., 1998),
Stamboek and Złotnicka Spotted pigs (Kurył et al.,
2003). In comparison with other indigenous pigs,
for example, the Meishan breed, only one
genotype (BB and DD for HinfI and MspI,
respectively) was found in the population and
hence this breed was considered to be
conservative for the loci examined (Wang et al.,
2007).
In the present work, all tested animals were free
T
of RYR1 allele. Therefore, it excluded the effect
of gene interaction on carcass and meat quality
traits analyzed. In the association analysis, both
loci were significantly associated with the dressing
percentage of carcass. The results are in
agreement with the study of Koćwin-Podsiadła et
al. (2004) that used these SNPs for pig selection
and found the increased ham in those bearing BB
or improved loin muscle weight in animals of CC
genotype for CAST_HinfI and CAST_MspI, res-
pectively. In our work, a higher value in CC
animals for dressing percentage and carcass, two
factors showing a positive correlation with ham
13786 Afr. J. Biotechnol.
weight, was detected. However, this relationship was not
confirmed in data presented by Judyma (2010) and no
association was found between the CAST_HinfI locus
with carcass traits. Also, in Stamboek pigs, the
CAST_HinfI did not show a relationship with carcass
traits, whereas the CAST_MspI polymorphism had an
effect on loin eye area (Kurył et al., 2003).
Judyma (2010) pointed out the significant effect of
CAST_HinfI on pH24 with higher value in AB pigs;
however in this report, the homozygous animals (BB) had
higher pH24. Previously, Kapelański et al. (2004) also
demonstrated an effect of this locus on LD muscle at 45
min post-mortem following a trend that pH45 min measured
in rare AA animal group was usually higher than that of
the others. Such an association was not confirmed in our
study due to limited number of animals tested but it
appeared that this SNP, corresponding with that reported
by Đurkin et al. (2009), had no influence on pH45 min.
Of the investigated traits related to sensory meat
quality, the significant influence of CAST was found on
drip loss, of which allele D did show a trend of decreasing
drip loss48. In a research on Italian Duroc x (LxLW) pigs,
Gandolfi et al. (2011) also indicated the relationship of
this locus with drip loss with the greater drip loss reported
in CD and DD animals. The relationship between specific
genotype with drip loss could be explained by the activity
of calpain upon the effect of pH based on the hypothesis
that higher drip loss of meat might be a result of fast pH
drop leading to early activation of calpain (Gandolfi et al.,
2011). Consequently, heterozygous pigs at the
CAST_MspI locus (CD) had the lowest pH45 min and
highest drip loss percentage, while the homozygous DD
animals had the lowest drip loss meat, which could be
more favorable for meat selection.
For meat color trait, Pietrain-based pigs carrying AB
genotype displayed a less intensity of redness (a*) and
yellowness (b*) color as compared to BB meat
(Rybarczyk et al., 2010). These results were confirmed
by the present data that the SNP was highly associated
with meat color of MC pigs with redder meat in DD
animals. Nevertheless, it should be mentioned here that
there was a weak link between meat color, particularly
redness value and the expression of muscle fiber in MC
pigs. It can be explained by the fact that depending on
each breed, there is a negative, positive or no correlation
between these two factors in LW, Duroc and traditional
breeds (Berkshire, Tamworth), respectively (Chang et al.,
2003). With regards to the effects of CAST gene on
muscle fiber types, limited number of comparable reports
are available for the two SNPs. However, Klosowska et
al. (2005) concluded on significant associations between
CAST_RsaI, another locus in intron 6 of the gene with
diameters of fibers and the proportion of fast-twitch fibers
in a bundle. Additionally, in F2 Jinhua x Pietrain crossbred
pigs, different genotype patterns of CAST polymorphisms
(MspI, HinfI and RsaI) are statistically related to loin
muscle area (Wu et al., 2007), of which BB/DD/FF pigs
provided higher muscle area than those of AB/CD/EF
individuals. This difference is probably from the
discrepancy between the IIb fiber content of the two
animal groups as mentioned by Wimmers et al. (2008). In
the present study, pigs of AB/DD haplotype showed a
higher proportion of IIb fiber than those from other two
haplotypes. Moreover, individuals being DD homozygous
at the CAST_MspI locus tended to have increase in the
percentage of IIb fiber; thus, it may be inferred that the D
allele could be profitable in producing meat with
increasing eye muscle area in MC pigs. This finding
confirmed the report of Kurył et al. (2003) that genotype
DD was the most advantagous for improved eye-muscle
area in Stamboek fatteners.
In summary, two analyzed SNPs of the CAST gene are
associated with some traits of interest such as dressing
percentage, pH, drip loss and redness color. The effect of
haplotype on muscle fiber type composition is interesting
but this should be analyzed in a larger number of animals
or in another indigenous pig breed for confirmation. The
results provide further evidence on the use of this gene
for improving carcass and meat quality characteristics in
MC pigs.
ACKNOWLEDGEMENT
This project was financially supported by the Vietnam's
National Foundation for Science and Technology
Development (NAFOSTED), Grant No. 106.06.62.09.
REFERENCES
Abecasis GR, Cherny SS, Cookson WO, Cardon LR (2002). Merlin-
rapid analysis of dense genetic maps using sparse gene flow trees.
Nat. Genet. 30:97-101.
Chang KC, da Costa N, Blackley R, Southwood O, Evans G, Plastow G,
Wood JD, Richardson RI (2003). Relationships of myosin heavy
chain fibre types to meat quality traits in traditional and modern pigs.
Meat Sci. 64(1):93-103.
Đurkin I, Margeta V, Margeta P, Kralik G, Kušec G (2009). Preliminary
investigations on relationship between polymorphism at CAST locus
and the quality of pork. Poljoprivreda 15(2):53-58.
Ernst C, Robic A, Yerle M, Wang L, Rothschild M (1998). Mapping of
calpastatin and three microsatellites to porcine chromosome 2q2.1-
q2.4. Anim. Genet. 29(3):212-215.
Gandolfi G, Pomponio L, Ertbjerg P, Karlsson A, Costa LN, Lametsch
R, Russo V, Davoli R (2011). Investigation on CAST, CAPN1 and
CAPN3 porcine gene polymorphisms and expression in relation to
post-mortem calpain activity in muscle and meat quality. Meat Sci.
88(4):694-700.
Goll DE, Thompson VF, Taylor RG, Christiansen JA (1992). Role of the
calpain system in muscle growth. Biochimie 74(3):225-237.
Judyma D (2010). The effect of calpastatin polymorphism (CAST/HinfI
and CAST/Hpy188I) and its interaction with RYR1 genotypes on
carcass and pork quality of crossbred pigs. Anim. Sci. Pap. Rep.
28(3):253-260.
Kapelański W, Grajewska JK, Bocian M, Jankowiak JW (2004).
Calpastatin (CAST) gene polymorphism and selected meat quality
traits in pigs. Anim. Sci. Pap. Rep. 22(4):435-441.
Klosowska D, Kuryl J, Elminowska-Wenda G, Kapelanski W, Walasik K,
Pierzchala M, Cieslak D, Bogucka J (2005). An association between
genotypes at the porcine loci MSTN (GDF8) and CAST and

microstructural characteristics of m. longissimus lumborum: a
preliminary study. Arch. Tierz. 48(1):50-59.
Koćwin-Podsiadła M, Kurył J, Krzęcio E, Antosik K, Zybert A,
Sieczkowska H (2004). An association between genotype at the
CAST (Calpastatin) locus and carcass quality traits in porkers free of
RYR1T allele. Anim. Sci. Pap. Rep. 22(4):497-505.
Krzęcio E, Kurył J, Koćwin‐Podsiadła M, Monin G (2005). Association
of calpastatin (CAST/MspI) polymorphism with meat quality
parameters of fatteners and its interaction with RYR1 genotypes. J.
Anim. Breed. Genet. 122(4):251-258.
Kurył J, Kapelański W, Pierzchała M, Grajewska S, Bocian M (2003).
Preliminary observations on the effect of calpastatin gene (CAST)
polymorphism on carcass traits in pigs. Anim. Sci. Pap. Rep.
21(2):87-95.
Li X, Yang X, Shan B, Shi J, Xia D, Wegner J, Zhao R (2009). Meat
quality is associated with muscle metabolic status but not contractile
myofiber type composition in premature pigs. Meat Sci. 81:218-223.
Livak KJ, Schmittgen TD (2001). Analysis of relative gene expression
data using real-time quantitative PCR and the 2-ΔΔCt method. Methods
25(4):402-408.
Rehfeldt C, Tuchscherer A, Hartung M, Kuhn G (2008). A second look
at the influence of birth weight on carcass and meat quality in pigs.
Meat Sci. 78:170-175.
Ngu et al. 13787
Rybarczyk A, Kmiec M, Szaruga R, Napierala F, Terman A (2010). The
effect of Calpastatin polymorphism and its interaction with RYR1
genotypes on carcass and meat quality of crossbred pigs. Agric.
Food Sci. 19(4):294-301.
Wang Q, Pan Y, Sun L (2007). Polymorphisms of the CAST gene in the
Meishan and five other pig populations in China: short
communication. S. Afr. J. Anim. Sci. 37(1):27-30.
Wimmers K, Ngu NT, Jennen DGJ, Tesfaye D, Murani E, Schellander
K, Ponsuksili S (2008). Relationship between myosin heavy chain
isoform expression and muscling in several diverse pig breeds. J.
Anim. Sci. 86(4):795-803.
Wu J, Liu Y, Xu N (2007). Histological characteristics of longissimus
dorsi muscle and their correlation with restriction fragment
polymorphisms of calpastatin gene in F2 Jinhua × Pietrain crossbred
pigs. Animal 1(9):1237-1242.
CSIRO PUBLISHING
Animal Production Science, 2013, 53, 1065–1074
http://dx.doi.org/10.1071/AN12301

Efficacy, persistence and presence of Synergistes jonesii

in cattle grazing leucaena in Queensland: on-farm observations
pre- and post-inoculation

S. R. Graham A, S. A. Dalzell A, Nguyen Trong Ngu C, C. K. Davis B, D. Greenway A,

C. S. McSweeney B and H. M. Shelton A,D
A
School of Agriculture and Food Sciences, The University of Queensland, Brisbane, Qld 4072, Australia.
B
CSIRO Livestock Industries, Brisbane, Qld 4072, Australia.
C
College of Agriculture and Applied Biology, Cantho University, Campus II, 3/2 Street, Cantho City, Vietnam.
D
Corresponding author. Email: m.shelton@uq.edu.au

Abstract. A study of eight commercial cattle herds grazing leucaena (Leucaena leucocephala subsp. glabrata) pastures
was undertaken to determine (1) the efficacy of in vitro Synergistes jonesii inoculum (produced in an anaerobic fermenter) in
degrading the dihydroxypyridone (DHP) isomers produced during digestion of leucaena forage; and (2) the persistence of the
inoculum in the rumen of cattle following a period grazing non-leucaena pastures.
Cattle were introduced to the leucaena pastures for an initial period varying from 17 to 71 days. Fourteen to fifteen animals
were then sampled for (1) urine and blood plasma to determine toxicity status as indicated by concentration of DHP; (2) faeces
for estimation of diet composition; and (3) rumen fluid for detection of S. jonesii by nested polymerase PCR analysis. After a
further 42–56 days, animals were resampled as before to confirm toxicity status and inoculated with the in vitro S. jonesii
inoculum; the herds were then sampled a third time (42–60 days after inoculation) to test the effectiveness of the inoculum in
degrading DHP.
Five of the herds were then removed from leucaena pastures for periods ranging from 80 to 120 days and returned to
leucaena pastures for 21 days to check persistence of the inoculum as indicated by retention of capacity to degrade DHP.
The data indicated (1) a very slow build up of capacity to degrade DHP isomers on some properties before inoculation; (2)
frequent occurrence of high levels of 2,3-DHP in urine indicating partial toxin degradation, both before and after inoculation;
(3) a low incidence of detection of S. jonesii in rumen fluid after inoculation based on nested PCR analysis; (4) failure of
inoculation to degrade DHP on one of two properties tested; and (5) loss of capacity to degrade DHP on some properties after
<4 months on alternative non-leucaena pastures.
It was concluded that while most herds showed some capability to degrade DHP due to some residual capability from
previous exposure, they did not achieve the same rapid and complete DHP degradation reported in the 1980s. Nevertheless, it
was concluded that the in vitro inoculum was at least partially effective and should continue to be used by graziers until
improved sources of inoculum and/or inoculation methodologies are demonstrated.

Additional keyword: mimosine.

Received 23 August 2012, accepted 17 December 2012, published online 17 April 2013

Introduction (DHP) cause several adverse impacts including suppression

Leucaena (Leucaena leucocephala subsp. glabrata) is a highly
productive tropical leguminous fodder tree. It is long-lived and
drought tolerant and is recognised for its excellent nutritional
characteristics. These productive traits consistently deliver
excellent liveweight gains, superior to most other tropical
forage systems (Shelton and Dalzell 2007). However, leucaena
does contain the toxic non-protein amino acid mimosine, which
is degraded by the rumen bacterium Synergistes jonesii (Allison
et al. 1992) into harmless by-products (Jones 1981; Jones and
Lowry 1984). When S. jonesii is not present in the rumen,
mimosine and its primary rumen derivative dihydroxypyridone
of liveweight gain (Jones et al. 1976; Jones and Jones 1984;
Quirk et al. 1988).
When S. jonesii was introduced into Australian ruminants in
the 1980s, it enabled inoculated animals to consume high dietary
intakes of leucaena and achieve almost complete degradation
of DHP, and therefore display superior productivity (Jones and
Megarrity 1986; Quirk et al. 1988; Pratchett et al. 1991). When
introduced to a herd, its ease of transmission led scientists and
graziers to believe that a ‘once off’ introduction of S. jonesii to a
cattle herd would provide long-term protection against leucaena
toxicity.

Journal compilation  CSIRO 2013 www.publish.csiro.au/journals/an

1066 Animal Production Science
However, in 2004, extensive herd testing across Queensland
(44 herds) indicated that ~50% of herds grazing leucaena may
be suffering sub-clinical toxicity as indicated by high levels
of 3,4-DHP or 2,3-DHP or both in urine (Dalzell et al. 2012).
Of particular concern was the occurrence of high DHP
concentrations in herds that had been previously inoculated
with an in vitro S. jonesii inoculum produced in an anaerobic
fermenter (Klieve et al. 2002). The longevity and efficacy of the
in vitro inoculum containing S. jonesii is poorly understood and
may be inferior to the in vivo inoculum used throughout northern
Australia before 1995 (Jones et al. 2009).
The aim of this study was to investigate the efficacy and
persistence of the in vitro inoculum in commercial cattle herds.
Such information is vital to ensure the future management of
S. jonesii and the continuing high productivity of cattle grazing
leucaena pastures.
Materials and methods
Location and property selection
Eight commercial cattle properties with dry-land leucaena-grass
pasture used for breeding, backgrounding and fattening, and
thought to be experiencing subclinical toxicity, were selected
in southern Queensland (Table 1). Although three of the
properties had been inoculated in the previous 5 years by oral
drenching with in vitro inoculum from the same source as used
in this study (properties 4, 6 and 8) and one had acquired and
retained what they believed to be S. jonesii carrier animals
(property 7), all property owners believed their herds were
experiencing subclinical toxicity based on either lack of
inoculation history or disappointing animal performance.
Animal ethics approval was received for the project (SLAFS/
SAS/944/08/MLA).
Fifteen animals that had grazed leucaena for 17–71 days were
selected from each property (except property 2 where 14 animals
were selected) so that their toxicity status could be monitored.
Herds were categorised as potentially experiencing subclinical
toxicity when excreting DHP in urine at mean concentrations
exceeding a threshold of 100 mg/mL. This level was chosen
following the survey results reported by Dalzell et al. (2012).
Property 6 was included since there were some animals among
the 15 sampled excreting high concentrations of DHP (>200 mg/
mL), even though the average herd urinary DHP concentration
was <100 mg/mL. At the conclusion of Phase 1 of trial, an
additional 10 animals were selected at each property along
with the other 15 animals for rumen fluid sampling to test for
the presence of S. jonesii (except property 2 where no additional
animals were sampled).
Treatments, animal management and measurements
The experiment was conducted between January and November
2009 in two phases. Phase 1 tested the efficacy (or effectiveness)
of inoculation. Treatments were plus/minus inoculation with
in vitro S. jonesii culture using the recommended procedure
for oral drenching with thawed in vitro culture obtained from
Department of Agriculture, Fisheries and Forestry laboratories at
Yeerongpilly (Klieve et al. 2002). Phase 2 tested the persistence
of inoculum when cattle were exposed to a period off leucaena
pastures.
S. R. Graham et al.
Cattle management
Animals were mustered immediately before sampling (see next
section for sampling times). Urine (DHP), blood (DHP), faecal
(% leucaena in diet) and rumen fluid samples were collected from
the same subset of 14–15 animals on each occasion. Rumen fluid
samples were collected from all 25 trial animals except property 2
(24 animals on property 1) at the completion of the trial. If an
animal became agitated during the sample collection process it
was released to minimise stress and risk of injury.
For properties 1, 2 and 7 (Table 1), one leucaena paddock was
grazed for the entire trial. For properties 3, 4, 6 and 8, new
leucaena paddocks of similar condition and type were grazed as
forage availability in the original paddock declined. For property
5, a rotational grazing system was employed comprising four
similar leucaena paddocks where animals were moved as pasture
availability and quality declined. Paddock stocking rates were
determined by the collaborating graziers and ranged from
0.43 AE/ha to 3.33 AE/ha, where an AE was equivalent to a
400 kg steer.
During Phase 2, five groups of eight animals (properties 1, 4, 5
and 8) were moved to alternative leucaena-free diets for periods
ranging from 80 to 120 days (Table 1). Cattle grazed either grass
or oats (Avena sativa). On property 5, two herds of eight pregnant
heifers grazed alternative pastures – either oats/grass pasture or a
native grass pasture. Populations of S. jonesii in rumen fluid were
monitored weekly initially and then less frequently. At the
conclusion of the leucaena-free diet period, animals were re-
introduced to leucaena pastures for a 3-week period to assess the
retention of capacity to degrade DHP isomers and then resampled.
They were kept apart from the original herds.
Sampling times
Phase 1 – efficacy of inoculation (2 April–17 July 2009).
S1: The initial sampling during Phase 1 was conducted after
17–71 days grazing leucaena to determine if animals were
experiencing subclinical toxicity as predicted.
S2: A second sampling was conducted 42–56 days after S1
and 10% of all herds were inoculated with in vitro S. jonesii at
this time, including two animals of each subset of 15.
S3: A third sampling was conducted 42–60 days after
inoculation to measure success of inoculation at S2.
Phase 2 – persistence of inoculum (7 May–5 October 2009).
S4: Sampling during Phase 2 was limited to rumen fluid
samples and comprised sequential samples taken on 6–8
occasions over 80–120 days to monitor the decline in
populations of S. jonesii after removal from leucaena pasture
(Table 1).
S5: A fifth and final sampling (urine, blood, rumen fluid) was
conducted to measure persistence of inoculum 21 days after
animals were returned to leucaena pastures.
Urine, blood and faeces collection and analyses
Urine samples were acidified at a ratio of 9.5 mL urine : 0.5 mL
of concentrated hydrochloric acid (32% HCl) to prevent
microbial degradation of DHP. Samples were stored on ice in
the field and later refrigerated before analysis. Urine was
analysed using high performance liquid chromatography to
determine concentrations of mimosine, 3,4-DHP and 2,3-DHP
Efficacy and persistence of in vitro S. jonesii inoculum Animal Production Science 1067

Table 1. Description of properties, pastures, cattle and sampling regime used to study the efficacy and persistence of an in vitro S. jonesii inoculum

Property ID Location Breed and class Starting Leucaena pasture Non-leucaena Days grazing Duration Previous
of animal liveweightA pasture leucaena at off leucaena inoculation
(kg ± s.e.) S1 S2, S3 (days) history
1 Millmerran Angus M/FB 251 ± 2.4 <3 years and vigorous Oats (Taipan) 45 111 No
weaners – minimal grass
87
129
2 Millmerran Angus/Wagyu 241 ± 4.9 <3 years and vigorous n.a. 53 n.a. No
· M/F – minimal grass
weaners
95
137
3 Millmerran Brahman and 333 ± 3.7 <3 years and vigorous n.a. 30 n.a. No
Santa · – minimal grass
heifers
72
114
4 Goondiwindi Brahman · 285 ± 7.4 <5 years, vigorous with Native grass 17 120 Yes (oral
steers established grass – (blue grass) drench)
buffel, blue grass
and bambatsi
73
121
5 Dalby Angus 450 ± 7.5 <5 years, vigorous with Oats (Reil) or 71 112 NoC
pregnant established buffel, couch and
heifers grass, Rhodes and Rhodes grass
purple pigeon
119
175
6 Wandoan Charbray and 370 ± 8.0 <5 years, vigorous with n.a. 54 n.a. Yes (oral
Brahman · established buffel drench)
steers grass
110
160
7 Wallumbilla Santa · and 406 ± 10.9 <5 years, vigorous with n.a. – n.a. Yes (‘carrier’
Charbray established buffel animals)
steers grass
77
122
8 Murgon Droughtmaster 340 ± 11.6 <5 years, vigorous with Oats (Culgoa II) 35 80 Yes (oral
and Braford established grass – green panic and drench)
steers green panic and Rhodes grass
Rhodes grass
83
143
A
Mean liveweight  standard error at S1. Liveweights on property #7 were measured by the grazier on 6 January 2009.
B
M/F = male/female.
C
No attempt to introduce S. jonesii, although a bull was purchased (for breeding purposes) from a recently inoculated property.

using the modified method of Dalzell et al. (2012) adapted from
Tangendjaja and Wills (1980).
Paired blood samples were taken from the animals via the tail
bleed method, kept out of direct sunlight and stored on ice in
the field. Samples were spun down in an Eppendorf 5810R
refrigerated centrifuge (Eppendorf North America, Inc.,
Westbury, NY, USA) within 48 h of initial collection at 2910
rpm for 15 min before transferring separated plasma into
polypropylene tubes and freezing at 80C. Homogenised
thawed samples were transferred into Eppendorf tubes, diluted
with 0.25 mL of trichloroacetic acid (20%) and centrifuged at
3000 rpm for 5 min at room temperature; supernatant was then
extracted and diluted and hydrolysed with 4.5 M HCl in a water
bath at 90C for 60 min to release DHP conjugated with
glucuronides.
Faecal samples were collected using the rectal grab method,
kept cool and stored out of direct sunlight, and oven-dried at
65C. Dried samples were ground to particle size <0.1 mm and
were sent for delta carbon analysis at The Australian National
University, Canberra using a micromass IsoChrom connected to
an EQ-1110 Elemental CHN-O Analyser. The method for the
determination of the proportion of C3 (leucaena) and C4 (tropical
1068 Animal Production Science
grass) material was based on the work of Jones et al. (1979) and
calibrated with faecal samples from cattle fed 100% buffel grass
and 100% leucaena diets.
Rumen fluid, collection and analysis for S. jonesii
using a nested PCR assay
A nested PCR approach was used to detect the presence of
S. jonesii in rumen fluid and was based on a similar approach
that was developed to survey the presence of another Synergistes
sp. in the rumen (Davis et al. 2012). Briefly, rumen fluid samples
were collected from restrained animals via an orogastric stomach
tube and a subsample of rumen fluid was stored on ice before
freezing at 80C. Rumen fluid samples were thawed,
subsamples (1.5 mL) transferred into a 96 deep well plate,
sealed with tape, centrifuged at 6000 rpm for 20 min at 4C
(Centrifuge 5417; Eppendorf, Hamburg, Germany), the
supernatant decanted and the plate inverted then spun briefly
at 800 rpm. DNA was then isolated from the pellet in each well
using the ‘bead beating’ method of Denman et al. (2008). The
isolated DNA was diluted to 1 : 3; 1 : 10 and 1 : 30 before analysis
using a nested PCR test that was specific for S. jonesii in rumen
fluid samples. The following primers were analysed using primer
express and were compared with sequences available from NCBI
to confirm specificity. The initial amplification was performed
using the 60F-CAT (GCAAGTCGAACGGGGATCAT)/1275R
(CCATTGTAGCACGTGTGTAGCC) primer pair. PCR was
also performed using the addition of 1.5 mM MgCl2 and
Platinum Taq (Invitrogen, Carsbad, CA, USA) and the
following conditions: one cycle at 94C for 3 min and 25
cycles of 94C for 20 s, 63C for 30 s and 70C for 45 s. The
PCR product was purified using the pre-sequencing cleanup
protocol. For every 2 mL of PCR product, a volume of 1 mL
was added. Specifically this volume contained 0.25 mL of Calf
Intestinal Alkaline Phosphatase (10 U/mL), 0.125 mL of 2 · Exol
(10 U/mL) and 0.625 mL of 5 · CS buffer (400 mM Tris-HCl pH
9.0, 10 mM MgCl2). The sample was incubated at 37C for 20 min
and then at 80C for 20 min to destroy enzyme activity and
facilitate its use as a template for the second PCR. The primer
pair 193F (TAAAAGGAGCGATCCGGTAACA)/1039R (CCA
TGCAGCACCTGTTCTAC) was incorporated for the second
round of amplification. Similar PCR conditions described
previously were employed and applied with the increase of
cycles to 35 at 94C for 20 s, 63C for 30 s and 70C for 45 s.
All PCR products were analysed by running 2% agarose gels
containing ethidium bromide and visualising for a single specific
band product.
Statistical analyses
Data were analysed using Microsoft Excel and Minitab 15
(2007, Minitab Inc., State College, PA, USA). The mean
urinary concentrations of 3,4-DHP, 2,3-DHP and total DHP
were analysed in both a raw and log-transformed state. A
boxplot technique was used on transformed data to show
median, 25 and 75% quartiles, with whiskers showing lowest
and highest values with asterisks indicating outliers.
One-way ANOVA tests, one and two sample t-tests on log-
transformed total DHP data and descriptive statistics on raw data
were used to compare sample periods. One tail t-tests were used
S. R. Graham et al.
to test whether DHP was > or <100 mg/mL. Power and sample size
analysis (one sample t-test) tests set at the universal power (0.8)
were used to determine the number of samples required to
accurately determine herd toxicity status. Descriptive statistics
were used to summarise blood 3,4-DHP and 2,3-DHP toxin levels
for each period. Delta carbon dietary composition data were
presented as a percentage of leucaena in diet with summary
statistics tabulated.
Results
Pasture and diet composition
Leucaena on-offer varied among properties. At the time of the first
sampling (S1), average dietary leucaena levels on seven of the
properties (property 7 not measured) ranged from 30 to 69%
(Table 2). At the time of inoculation (S2), dietary leucaena on six
properties ranged from 35 to 74% but had dropped to low levels of
18 and 14% on properties 4 and 7, respectively. Six to eight
weeks following inoculation (S3), leucaena diet selection levels
generally remained sufficient (26–70% of diet) to test the efficacy
of inoculation on all properties, with the exception of property 7,
which continued to demonstrate low levels of leucaena in diet
(14%). When the cattle in the five herds that were moved to non-
leucaena pastures (Phase 2 trial to study persistence of S. jonesii)
were returned to leucaena paddocks for 21 days, diets contained
29–64% leucaena.
Urinary DHP concentrations
Urinary concentrations of DHP were highly variable within
herds (Figs 1 and 2). Coefficients of variation ranged from 39
to 351% for 3,4-DHP and from 52 to 283% for 2,3-DHP; standard
deviations for total DHP increased linearly with mean DHP
concentration (Fig. 2). Consequently, total DHP data were log-
transformed and one tail t-tests used to determine whether average
herd urinary DHP excretion was significantly greater than the
subclinical toxicity threshold level of 100 mg/mL. Untransformed
data are presented in Table 2.
At the initial sampling, DHP excretions were significantly
greater than the threshold concentration on all properties
except 6. Property 7 was not sampled. Unexpectedly, at S2
(before inoculation), urine DHP concentrations had dropped
below the threshold level on all properties except 2 and 3
where 3,4-DHP remained high although 2,3-DHP levels had
declined. This meant that only these two properties could be
used to test the efficacy of the inoculum at S3. After inoculation,
DHP concentrations at S3 fell below 100 mg/mL on property 3
but not on property 2 (Fig. 1 and Table 2).
Among properties that showed high levels of DHP, the
percentage of 2,3-DHP varied from 0 to 99%. There were no
trends with sampling time but some properties had consistently
higher levels of 2,3-DHP than others e.g. property 5.
When the five cattle herds, all with low DHP levels at S2, were
removed from leucaena pastures for periods of 80–120 days, and
then returned to leucaena pastures for 3 weeks (Table 1), two
herds (properties 1 and 8) showed high DHP levels above the
threshold level while three herds (properties 4 and 5), were below
the threshold level (Fig. 1 and Table 2). This finding demonstrated
that herds can lose ‘protection’ against DHP toxicity even after
80–111 days off leucaena. The dominant isomer in both urine and
Efficacy and persistence of in vitro S. jonesii inoculum Animal Production Science 1069

Table 2. Summary statistics for concentrations (mg/mL) of 3,4-DHP and 2,3-DHP in the urine of animals grazing leucaena at four sample times
(S1 = preconditioning grazing; S2 = at inoculation with S. jonesii; and S3 = post-inoculation with S. jonesii; S5 = after 3 weeks grazing after
period off leucaena)
*, Mean herd total DHP concentration > threshold concentration of 100 mg/mL (P > 0.05); – no samples collected: n.d., not detectable; n.s., not significant

Property ID Sample Mean Mean 3,4-DHP Mean 2,3-DHP Total DHP Sig. >100 mg/mL
period % leucaena (mg/mL ± s.e.) (mg/mL ± s.e.) (mg/mL ± s.e.) (P value <0.05)
in diet (±s.e.)
1 S1 66 ± 1 775 ± 139 27 ± 4 802 ± 140 *
S2 35 ± 2 32 ± 7 1±1 34 ± 8 n.s.
S3 31 ± 2 45 ± 14 2±1 47 ± 16 n.s.
S5 64 ± 0.5 950 ± 132 183 ± 55 1134 ± 179 *
2 S1 30 ± 3 491 ± 78 224 ± 66 716 ± 113 *
S2 69 ± 1 521 ± 148 19 ± 6 540 ± 152 *
S3 69 ± 2 310 ± 56 44 ± 13 354 ± 60 *
3 S1 55 ± 1 664 ± 133 294 ± 75 958 ± 193 *
S2 55 ± 1 686 ± 68 41 ± 8 727 ± 73 *
S3 58 ± 1 56 ± 10 2±1 58 ± 10 n.s.
4 S1 41 ± 1 376 ± 69 272 ± 53 648 ± 111 *
S2 18 ± 1 78 ± 18 39 ± 7 116 ± 23 n.s.
S3 26 ± 1 n.d. n.d. n.d. n.s.
S5 29 ± 1 2±2 n.d. 2±2 n.s.
5 S1 63 ± 2 8±3 1036 ± 309 1045 ± 310 *
S2 70 ± 1 16 ± 3 146 ± 43 162 ± 44 n.s.
S3 70 ± 2 13 ± 2 55 ± 29 68 ± 29 n.s.
S5 33 ± 11 and 42 ± 2 n.d. and 10 ± 2 27 ± 14 and 65 ± 18 27 ± 14 and 75 ± 19 n.s.
6 S1 36 ± 2 27 ± 25 43 ± 15 70 ± 31 n.s.
S2 74 ± 1 10 ± 2 30 ± 12 40 ± 13 n.s.
S3 51 ± 2 9±1 122 ± 31 131 ± 31 n.s.
7 S1 – – – – –
S2 14 ± 1 47 ± 32 87 ± 22 134 ± 45 n.s.
S3 14 ± 1 11 ± 7 1±1 11 ± 7 n.s.
8 S1 69 ± 2 217 ± 45 n.d. 217 ± 45 *
S2 72 ± 2 37 ± 21 1±1 37 ± 21 n.s.
S3 41 ± 2 6±4 1±1 7±4 n.s.
S5 45 ± 3 118 ± 36 490 ± 126 609 ± 139 *

8
600
7
Ln total DHP (µg/mL)

6 500
5
Standard deviation

400 y = 0.646x + 22.59

4
R 2 = 0.87
3 300
2
200
1

0 100
1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3
1 2 3 4 5 6 7 8 0
Collection property 0 100 200 300 400 500 600 700 800 900
Mean DHP concentration (µg/mL)
Fig. 1. Log-transformed total DHP (3,4-DHP and 2,3-DHP) urinary
concentrations plotted at each sample date within properties #1–8 Fig. 2. Average herd total DHP concentration in urine plotted against herd
(* describes outliers). standard deviation in urine concentration.
1070 Animal Production Science
blood samples from cattle on property 1 was 3,4-DHP, while on
property 8 it was 2,3-DHP.
Urinary DHP concentrations were poorly related to dietary
leucaena content as determined by faecal analysis.
Blood plasma DHP concentrations
Concentrations of DHP in blood serum were low at S1, S2 and S3
(data not presented) and showed no significant correlation to
corresponding urine samples. Concentrations ranged from non-
detectable to 20.2 mg/mL for 3,4-DHP and from non-detectable to
16.2 mg/mL for 2,3-DHP. At the conclusion of the final 3-week
leucaena grazing period at S5, mean serum total DHP
concentrations of 13 mg/mL were observed for all five herds.
Nested PCR analysis and effectiveness of the in vitro
S. jonesii inoculum
Phase 1 – nested PCR analysis performed on 360 rumen fluid
samples collected during testing the efficacy of inoculation trial
revealed that 22 (6.1%) tested at S1–S3 had detectable levels of
S. jonesii. Only 2 of the 28 animals sampled after inoculation were
positive to S. jonesii at S3. The remaining samples either did not
have S. jonesii or numbers were below the level of detection by the
nested PCR (<104–105 cells/mL).
Phase 2 – after the five herds were removed from the leucaena
pastures in the persistence of S. jonesii trial, only 6 of the 376
rumen fluid samples collected during S4 (cattle grazing non-
leucaena pastures) and at S5 (cattle grazing leucaena pastures) had
detectable levels of S. jonesii. All six samples were collected
during the first 21 days of leucaena-free grazing period. There was
no continuity in the detection of S. jonesii in individual animals
among sampling times after first detection. Of the 15 animals
inoculated at S2 only three tested positive to S. jonesii and only
one of these at more than one sampling time (property 5, oats
herd).
Discussion
The results obtained in this study were in strong contrast to the
findings of the original research on the efficacy of inoculation with
S. jonesii. In that seminal work in Indonesia and northern
Australia >25 years ago, there was rapid and almost total
degradation of both DHP isomers following inoculation even
in animals consuming high leucaena diets, as indicated by very
low concentrations of DHP in urine (50 mg/mL) (Jones and
Lowry 1984; Jones and Megarrity 1986). These early studies
showed that DHP was almost completely degraded within a
few days of inoculation (Jones and Lowry 1984; Jones et al.
1985b). Jones (1994) reported that inoculation of goats in
Indonesia resulted in ‘DHP levels declining to virtually zero
after 5 days’. Other work has shown that animals inoculated with
DHP degrading bacteria are able to effectively degrade DHP
isomers within 2–4 weeks of the animal first grazing leucaena
(Pratchett et al. 1991). Indeed, multiple urine sampling of a
cattle herd inoculated with the original rumen fluid inoculum
in 1986 indicate that the animals have retained complete
protection (P Larsen, pers. comm.). These early workers also
demonstrated the longevity of S. jonesii in the rumen even
with periods off leucaena of up to 9 months (Jones et al.
S. R. Graham et al.
1985b). A recent study of a closed breeding cattle herd at the
CSIRO research property at Lansdown, inoculated >25 years
ago using rumen fluid as the inoculum, showed that cattle
have retained protection against leucaena toxicity (Jones et al.
2009).
Our findings differed from this early work in several
significant ways, namely: (1) there was a slow, rather than
rapid, ‘build up’ of DHP degradation capacity over
8–12 weeks regardless of inoculation history; (2) urine
frequently had high levels of 2,3-DHP, an isomer observed to
be transitory in the early work; (3) inoculation with the in vitro
inoculum did not result in a reduction in urinary DHP on one of
the two properties tested; and (4) two of five herds lost their
protected status after only 80–111 days off leucaena pastures.
Percentage leucaena in diet and urine sampling protocol
The percentages of leucaena in the diet were considered adequate
(mean 26–74%) to facilitate the intake of sufficient quantities of
mimosine to induce DHP toxicity in unprotected animals (Lowry
et al. 1983; Jones 1994), except for properties 4 and 7 at S2.
Similar diet selection levels of 30–60% leucaena have been
reported in cattle herds grazing leucaena pastures in south-east
Queensland during the summer–autumn period (Jones et al. 1979;
Jones and Jones 1984; Galgal 2002).
This study employed a urine sampling technique, which
requires animals to be grazing leucaena immediately before
sampling and emphasises immediate sampling of cattle upon
being yarded as urinary DHP concentrations are closely related
to recent leucaena intake (Ghosh et al. 2007). Joseph O’Reagain
(unpubl. data) observed that mimosine and 3,4-DHP first
appeared in urine 9 h after animals first consumed leucaena,
and that 3,4-DHP concentrations declined rapidly within 24 h to
50 mg/mL after animals stopped consuming a 60% leucaena
ration. Nevertheless there was great variability in urinary DHP
concentrations within herds at all samplings. This is most likely
influenced by a range of factors, namely: (1) the percentage of
leucaena in diet, (2) hydration state of the animal; (3) the time
between leucaena consumption and sampling; (4) the number and
efficiency of DHP degrading bacteria in the rumen; and (5) rate
of metabolism. All these factors may vary greatly among animals
within the same herd.
Interestingly, there was no relationship between % leucaena in
diet and urinary DHP levels. This contrasted with the findings
of Ghosh et al. (2007) who reported data from controlled
feeding trials where total urine volume was collected which
showed a close association between intake of leucaena (and
therefore mimosine) and urinary concentrations of DHP. Jones
and Hegarty (1984) also showed a linear relationship between
mimosine intake and DHP excretion. However, in those studies,
there was no evidence that DHP degrading bacteria were present.
In the present study, the presence of DHP degrading bacteria,
though inefficient in their capacity to completely degrade DHP,
ensured variability in DHP concentrations in urine.
Protection status of herds before inoculation and success
of inoculation
Our data showed high urinary DHP excretion levels at the initial
sampling which indicated that six of the seven herds sampled
Efficacy and persistence of in vitro S. jonesii inoculum
were exhibiting subclinical toxicity (DHP >100 mg/mL)
(Dalzell et al. 2012). These herds had been grazing leucaena
for 17–71 days. Accordingly, at that time we concluded that
herds on all six properties were not protected by S. jonesii.
However, quite unexpectedly, only two of the properties
continued to show high excretion of DHP at S2 just before
inoculation indicating that degradation was occurring, but had
taken periods varying up to 72–119 days for DHP degrading
capacity to become effective. During this time, only two
properties (1 and 7) showed signs of hair loss (switch of tail),
but animals recovered rapidly with no further clinical symptoms
of toxicity observed. Results may have been compromised on
property 8 by the early removal (>12 h before urine sampling) of
animals from leucaena pasture the evening before sample
collection at S2.
The low urinary DHP concentrations detected on all
properties, except 2 and 3, at the second sampling meant that
the effectiveness of the in vitro S. jonesii inoculum (via reduced
excretion of DHP compounds) could only be tested on these
two properties. Following inoculation, animals on property 3
excreted DHP isomers at concentrations significantly below the
threshold at S3 demonstrating that S. jonesii was effective.
Conversely, on property 2 high levels of 3,4-DHP continued
to be excreted indicating that the inoculation was not effective.
This was a clear indication that inoculation carried out rigorously
using recommended practice might not result in effective
degradation of DHP.
Detection of S. jonesii using PCR
The nested PCR analysis was able to detect the presence of
S. jonesii in only 6% of the samples tested at S1, S2 and S3,
presumably due to the bacteria being present in populations
below the sensitivity of this method (<104–105 cells/mL). Due
to the low sensitivity of the PCR analysis, and the likelihood that
the levels of S. jonesii detected in rumen fluid were on the
boundary of assay detection limits, the random detection of
S. jonesii observed is unlikely to be related to treatment
effects. There appeared to be a low population of S. jonesii on
four properties (#1, #4, #5 and #6) before inoculation, which
were effective in degrading the DHP isomers when tested
10–17 weeks later.
It is known that the rumen environment can affect PCR
detection sensitivity e.g. levels of carbohydrates, tannins and
phenolics can interfere with DNA amplification. This might
explain why some animals tested positive for S. jonesii on
some occasions but tested negative on subsequent occasions.
There are no published data reporting abundance of S. jonesii
measured in vivo in rumen fluid with which to compare the results
observed in this trial. The data indicate that DHP was being
degraded by either low abundance populations of S. jonesii or
other unidentified organisms.
When the five herds were returned to leucaena grazing,
the 3 weeks on leucaena should have been sufficient for any
residual populations of S. jonesii to increase in number in the
rumen. However, S. jonesii was not detected despite three
herds demonstrating DHP degrading capabilities. Molecular
techniques which are more sensitive than the nested PCR test
adopted in the trial (by 100–1000 times) are required to monitor
Animal Production Science 1071
ruminal populations of S. jonesii at the low levels that appear to
be present in rumen fluid.
Presence of 2,3-DHP in urine samples
The detection of the compound 2,3-DHP in the urine of all
herds before inoculation, including those herds previously
inoculated, contrasts the findings of Jones et al. (2009) but
confirms other work (Dalzell et al. 2012; Phaikaew et al.
2012). Of the eight herds, four were excreting high levels of
2,3-DHP at S1 (>100 mg/mL). The presence of this isomer,
particularly on property 5, where cattle had been grazing
leucaena for 10 weeks before S1, indicated that it may not be a
transitory breakdown product of S. jonesii as previously reported
(Ford et al. 1984). At the first sampling on property 5, mean
2,3-DHP concentrations were >1000 mg/mL, with concentrations
ranging from non-detectable to 4408 mg/mL. These results are in
accord with those of Ghosh et al. (2007) who found that
uninoculated animals excreted toxin concentrations which
peaked at 45  2.1 mg/mL mimosine, 979  44.0 mg/mL
3,4-DHP and 2045  192 mg/mL 2,3-DHP. In the earlier
leucaena toxicity study of Queensland cattle herds, Dalzell
et al. (2012) reported that 14 of the 44 herds tested excreted
high levels of 2,3-DHP (>200 mg/mL). Although these were ‘one
off’ tests, they were conducted on herds that had been grazing
leucaena for long periods and had not been recently inoculated
with S. jonesii. Recent studies of goat herds in Thailand on long-
term 100% leucaena diets also showed very high levels of
2,3-DHP in urine (>1000 mg/mL) (Phaikaew et al. 2012).
The factors contributing to the accumulation of 2,3-DHP
remain unclear. The efficiency and capability of DHP
degradation is highly variable even between phylogenetically
identical S. jonesii strains and is likely to be influenced by
environmental conditions. For example, when in vitro
S. jonesii cultures were deprived of 2,3-DHP for periods of
2 months there was a temporary or permanent loss in 2,3-
DHP degradation activity (Dominguez-Bello et al. 1997; Rincon
et al. 2000). In another study, one in four in vitro cultures of
rumen fluid containing S. jonesii could not degrade 2,3-DHP
after 6 days of transportation under anaerobic conditions (Jones
et al. 1985a).
Recent in vitro degradation studies indicate that capacity to
degrade the DHP isomers varies with S. jonesii strain
(C. S. McSweeney, unpubl. data). Absence of strains that
specifically degrade 2,3-DHP might explain the build up of
this isomer. There are other known 2,3-DHP degrading
bacteria, other than S. jonesii, which colonise the rumen
(Hammond et al. 1989b; Allison et al. 1990; Dominguez-
Bello and Stewart 1991). However, the presence of these
bacteria in the rumen of Australian cattle has not been explored.
Therefore, the accumulation of 2,3-DHP observed in this
study may be due to (1) absence of S. jonesii strains that
effectively degrade 2,3-DHP; (2) the environmental conditions
of the rumen under which S. jonesii is growing limiting
the efficiency of 2,3-DHP degradation; or (3) the natural
occurrence of both isomers of DHP when mimosine is
degraded by plant enzymes and non-specific rumen microbes.
There is currently little evidence for argument (2) and no
evidence for argument (3).
1072 Animal Production Science
It is generally considered that both isomers are harmful.
Infusion of 2,3-DHP into the rumen of sheep had an
immediate deleterious impact on intake (McSweeney et al.
1984) and can be fatal (Puchala et al. 1995). Other studies
have shown that high levels of 2,3-DHP in serum can reduce
milk production in dairy cows (Ghosh et al. 2007).
Further studies investigating the toxicity implications of the
presence of 2,3-DHP in ruminants and the capacity of rumen
microbes to degrade both DHP isomers in vivo are required to
understand degradation pathways and to determine how 2,3-DHP
toxicity impacts animal production.
DHP in blood
The herds on all properties had undetectable or very low DHP
levels in blood confirming findings from other work (Hegarty
et al. 1964b; Lowry et al. 1985) that DHP is quickly eliminated
from blood to accumulate in the urine. Blood DHP levels
observed in this trial were much lower than those reported by
Ghosh et al. (2007) (155–12 982 mg/mL for 3,4-DHP and
70–2716 mg/mL for 2,3-DHP), and by Gupta and Atreja
(1998) who reported 3,4-DHP levels that ranged from 97 to
402 mg/mL. The reasons for this may relate to method of
measurement and analysis or to the capacity of animals in the
present study to eliminate the toxins via the kidneys more quickly.
This capacity is reported to be regulated by the form of the toxin.
DHP chelated with metal ions (Puchala et al. 1995) or conjugated
with sugar molecules (Hegarty et al. 1964a; Elliott et al. 1985)
may be voided more readily from the bloodstream.
Duration and diet off leucaena
Herds at properties 1 and 8 excreted large amounts of DHP when
returned to leucaena pastures after 111 and 80 days off leucaena,
respectively, and this demonstrated that these herds lost
‘protection’ against toxicity, at least on a temporary basis. This
finding confirms the observations made by graziers that cattle can
perform poorly until re-inoculated when returned to leucaena
after periods of leucaena-free grazing. Interestingly, the herds that
grazed alternative pastures for the longest duration retained DHP
degrading capability when reintroduced to leucaena pastures e.g.
cattle on property 4 (grazing predominantly native blue grass
pasture for 120 days). Both herds on property 5 (grazing either
introduced grasses or oats/grass mixture for 112 days) also
retained DHP degrading ability. This finding contrasts
previous studies of Jones et al. (1985b) and Hammond et al.
(1989a) who reported that S. jonesii retained DHP degrading
ability in vivo following 6–9 months without leucaena feeding
although populations of S. jonesii appeared to decline with the
length of time off leucaena.
While the duration off leucaena might be an important
contributor to maintenance of capacity to degrade DHP, the
physical and chemical properties of the alternative diets may
influence the persistence or efficacy of S. jonesii. The two herds
that lost degradation capability grazed fresh oats or oats/grass as
the alternative pasture. However, the herd grazing an oats/grass
mixture on property 5 retained degradation capabilities indicating
that any particular effect of oats-based diets on the persistence of
S. jonesii in the rumen may be variable.
S. R. Graham et al.
500
Standard deviation = 100
Standard deviation = 200
Standard deviation = 300
400
Standard deviation = 400
Sample size (n)
Standard deviation = 500
300
200
100
0
50 100 150 200 300 400 500
µg/mL above threshold concentration of 100 µg/mL
Fig. 3. Sample size required to detect average herd urine total DHP
concentrations >100 mg/mL at a range of standard deviations.
Nevertheless, sudden dietary changes can dramatically change
rumen pH level resulting in an imbalance of microbial
populations and fermentation (Eadie and Mann 1970).
S. jonesii populations demonstrate optimal DHP degradation
and performance at a pH range of 6.0–6.8; at lower and higher
pH levels DHP degradation activity is inhibited (Allison et al.
1990). Highly degradable diets, such as lush actively growing
forages with a high leaf to stem ratio, can lower (Calsamiglia et al.
2008) or raise (Arelovich et al. 2003) the pH of the rumen.
Unfortunately, as previously described, the nested PCR could
not consistently detect S. jonesii DNA, even when DHP
degradation was occurring efficiently and thus it was not
possible to assess the rate of decline of rumen S. jonesii
population numbers when leucaena was removed from the diet.
Variability in urinary DHP concentrations
A strong positive relationship was observed between the herd
mean DHP concentration and standard deviation (Fig. 2). Given
the very high variability of urinary DHP concentrations among
animals within a herd, a strategy for collection of an appropriate
number of urine samples is required to detect statistically
significant differences relative to the toxicity threshold of 100
mg/mL DHP. Since most unprotected herds consuming high
dietary percentages of leucaena normally exhibit urinary
concentrations of DHP >500 mg/mL, 10 samples would be
required to demonstrate significant difference (Fig. 3).
Practically, it will not be possible to demonstrate significant
differences from 100 mg/mL for urine sample DHP
concentrations below 250 mg/mL as greater than 15 samples
would be required.
Conclusions
Our findings showed that efficacy of the in vitro S jonesii
inoculum to degrade mimosine and DHP in ruminants
consuming leucaena contrasted previous reports (Jones and
Megarrity 1986; Quirk et al. 1988; Pratchett et al. 1991) in
several ways:
*
Degradation of DHP isomers did not occur rapidly and
completely despite dosing animals with 10 times the volume
of inoculum compared to previous work.
Efficacy and persistence of in vitro S. jonesii inoculum
*
There appeared to be a residual population of DHP degraders in
some herds that colonised the rumen slowly and required
many weeks to develop the capability to effectively degrade
DHP. However, it is not known if these degraders were
S. jonesii or some other species.
*
High concentrations of 2,3-DHP, an isomer previously thought
to be a transitory product of 3,4-DHP degradation, were often
present even after long periods of leucaena grazing. Further
work is required to demonstrate the impact of high levels of 2,3-
DHP on animal performance.
*
Even with rigorous inoculation procedures successful
inoculation may not be achieved with the current in vitro
inoculum.
*
Some herds were found to lose protection after even relatively
short periods on very different leucaena-free diets e.g. oats.
The nested PCR analysis indicated that S. jonesii numbers
were relatively low as the DNA sequence of the type strain was
detected in only a small number of cattle including those directly
inoculated. Improved molecular procedures will be required to
detect low levels of S. jonesii in order to directly monitor
populations in vivo.
The results of this study point to a change in the efficacy of the
inoculum perhaps arising from repeated growth of cultures in the
fermenter, inoculated with frozen starter cultures from previous
fermenter runs as described by Klieve et al. (2002). Field studies
described in this work ultimately provide the most reliable assay
of efficacy; however in vitro tests of rates and extent of DHP
metabolism might be useful for quality control with the fermenter
cultures and provide insights into any changes in metabolism that
might arise. Klieve et al. (2002) measured loss of mimosine/DHP
(using a non-specific colourimetric assay) during 8 days’
incubation with fermenter liquor. A similar test of the
inoculum might provide useful information, but more
definitive tests using mimosine, 2,3-DHP and 3,4-DHP, singly
or other culture tests (Allison et al. 1990) could provide insight
into changes in the inoculum.
At a practical level, graziers are concerned about the protection
status of their herds, especially the long-term effectiveness of the
inoculum following seasonal grazing of non-leucaena pastures.
They require an efficient system of inoculation and access to
testing of herd toxicity status as reoccurrences of toxicity will
have deleterious impacts on beef production and animal health.
The original method was based on direct injection of 10 mL of
strained rumen fluid into the rumen via a rumen injection gun
giving minimal exposure to oxygen and temperature changes
(Jones et al. 1985b). The current method involves drenching of
100 mL of a thawed in vitro fermented product (Klieve et al.
2002). These inoculation methods should be compared and
evaluated in more detail. It is recommended that graziers (1)
test their herds annually using colourimetric urine DHP analysis,
for presence/absence of effective populations of S. jonesii,
particularly at the start of the season when there is an
abundance of lush leucaena forage available; (2) retest herds
4–6 weeks after inoculating with S. jonesii to confirm effective
inoculation; and (3) minimise time animals spend off leucaena
pastures, with a preference to maintaining ‘carrier’ animals on
leucaena year-round to promote retention of S. jonesii within
herds.
Animal Production Science 1073
Acknowledgements
We express our deep appreciation to the graziers, their families and managers
who generously donated their time and resources to this research: Craig
Antonio, Jonathon Schmidt, Michael Machin, Grant Shelton, Patrick Nason,
Luke Hopkins, Andrew Richardson and Andrew Swan. We also thank Peter
Isherwood, Graham Kerven, David Appleton, Stephen Appleton and Dr
Jennifer Waanders for assistance with laboratory analyses at the University
of Queensland; Dr Olena Kravchuk (UQ) for statistical advice; and Hilary
Stuart-Williams (The Australian National University) for carbon isotopes
faecal analysis. This work received financial support from Meat and Livestock
Australia.
References
Allison MJ, Hammond AC, Jones RJ (1990) Detection of ruminal
bacteria that degrade toxic dihydroxypyridine compounds produced
from mimosine. Applied and Environmental Microbiology 56,
590–594.
Allison MJ, Mayberry WR, Mcsweeney CS, Stahl DA (1992) Synergistes
jonesii, gen. nov., sp. nov.: a rumen bacterium that degrades toxic
pyridinediols. Systematic and Applied Microbiology 15, 522–529.
doi:10.1016/S0723-2020(11)80111-6
Arelovich HM, Arzadún MJ, Laborde HE, Vásquez MG (2003) Peformance
of beef cattle grazing oats supplemented with energy, escape protein or
high quality hay. Animal Feed Science and Technology 105, 29–42.
doi:10.1016/S0377-8401(03)00045-2
Calsamiglia S, Cardozo PW, Ferret A, Bach A (2008) Changes in
rumen microbial fermentation are due to a combined effect of type of
diet and pH. Journal of Animal Science 86, 702–711. doi:10.2527/
jas.2007-0146
Dalzell SA, Burnett DJ, Dowsett JE, Forbes VE, Shelton HM (2012)
Prevalence of mimosine and DHP toxicity in cattle grazing Leucaena
leucocephala pastures in Queensland, Australia. Animal Production
Science 52, 365–372. doi:10.1071/AN11236
Davis CK, Webb R, Sly LI, Denman SE, McSweeney CS (2012) Isolation and
survey of novel fluoroacetate-degrading bacteria belonging to the phylum
Synergistetes. FEMS Microbiology Ecology 80, 671–684. doi:10.1111/
j.1574-6941.2012.01338.x
Denman SE, Nicholson MJ, Brookman JL, Theodorou MK, McSweeney CS
(2008) Detection and monitoring of anaerobic rumen fungi using an
ARISA method. Letters in Applied Microbiology 47, 492–499.
doi:10.1111/j.1472-765X.2008.02449.x
Dominguez-Bello MG, Stewart CS (1991) Characteristics of a rumen
clostridium capable of degrading mimosine, 3-hydroxy-4 (1H) and 2,3
dihydroxy pyridine. Systematic and Applied Microbiology 14, 67–71.
doi:10.1016/S0723-2020(11)80363-2
Dominguez-Bello MG, Lovera M, Rincon MT (1997) Characteristics of
dihydroxypyridine-degrading activity in the rumen bacterium
Synergistes jonesii. FEMS Microbiology Ecology 23, 361–365.
doi:10.1016/S0168-6496(97)00047-0
Eadie JM, Mann SO (1970) Development of rumen microbial population: high
starch diet and instability. In ‘Physiology of digestion and metabolism in
the ruminant’. (Ed. AT Phillipson) pp. 335–347. (Oreil Press: New Castle
Upon Tyne, UK)
Elliott R, Norton BW, Milton JTB, Ford CW (1985) Effects of molasses on
mimosine metabolism in goats fed fresh and dried leucaena with barley
straw. Australian Journal of Agricultural Research 36, 867–875.
doi:10.1071/AR9850867
Ford CW, Megarrity RG, Meehan GV (1984) 2,3-DHP, a novel mimosine
metabolite Leucaena Research Reports 5, 2
Galgal K (2002) Forage and animal production from selected new
Leucaena accessions. PhD Thesis, The University of Queensland,
Brisbane.
1074 Animal Production Science
Ghosh MK, Atreja PP, Buragohain R, Bandyopadhyay S (2007)
Influence of short-term Leucaena leucocephala feeding on milk
yield and its composition, thyroid hormones, enzyme activity,
and secretion of mimosine and its metabolites in milk cattle. The
Journal of Agricultural Science 145, 407–414. doi:10.1017/S0021
859607007113
Gupta HK, Atreja PP (1998) Influence of gradual adaptation of cattle to
Leucaena leucocephala leaf meal on biodegradation of mimosine and 3-
hydroxy-4(1H)-pyridone (3,4 DHP) in rumen, their levels in blood, fate
and influence of absorbed DHP on thyroid hormones and liver enzymes.
Animal Feed Science and Technology 74, 29–43. doi:10.1016/S0377-
8401(98)00167-9
Hammond AC, Allison MJ, Williams MJ (1989a) Persistence of DHP-
degrading ruminal bacteria between growing seasons in sub-tropical
Florida. Leucaena Research Reports 15, 66–68.
Hammond AC, Allison MJ, Williams MJ, Prine GM, Bates DB (1989b)
Prevention of leucaena toxicosis of cattle in Florida by ruminal inoculation
with 3-hydroxy-4(1H)-pyridone-degrading bacteria. American Journal of
Veterinary Research 50, 2176–2180.
Hegarty MP, Court RD, Thorne PM (1964a) The determination of mimosine
and 3,4-dihydroxypyridine in biological material. Australian Journal of
Agricultural Research 15, 168–179. doi:10.1071/AR9640168
Hegarty MP, Schinckel PG, Court RD (1964b) Reaction of sheep to the
consumption of Leucaena glauca Benth. and to its toxic principle
mimosine. Australian Journal of Agricultural Research 15, 153–167.
doi:10.1071/AR9640153
Jones RJ (1981) Does ruminal metabolism of mimosine explain the absence of
Leucaena toxicity in Hawaii? Australian Veterinary Journal 57, 55–56.
doi:10.1111/j.1751-0813.1981.tb07097.x
Jones RJ (1994) Management of anti-nutritive factors – with special reference
to leucaena. In ‘Forage tree legumes in tropical agriculture’. (Eds RC
Gutteridge, HM Shelton) pp. 216–231. (CAB International: Wallingford,
UK)
Jones RJ, Hegarty MP (1984) The effect of different proportions of
Leucaena leucocephala in the diet of cattle on growth, feed intake,
thyroid function and urinary excretion of 3-Hydroxy-4(1H)-pyridone.
Australian Journal of Agricultural Research 35, 317–325. doi:10.1071/
AR9840317
Jones RM, Jones RJ (1984) The effect of Leucaena leucocephala on
liveweight gain, thyroid size and thyroxine levels of steers in south-
eastern Queensland. Australian Journal of Experimental Agriculture and
Animal Husbandry 24, 4–9. doi:10.1071/EA9840004
Jones RJ, Lowry JB (1984) Australian goats detoxify the goitrogen 3-
hydroxy-4 pryridone (DHP) after rumen infusion from an Indonesian
goat. Experientia 40, 1435–1436. doi:10.1007/BF01951931
Jones RJ, Megarrity RG (1986) Successful transfer of DHP degrading bacteria
from Hawaiian goats to Australian ruminants to overcome the toxicity of
leucaena. Australian Veterinary Journal 63, 259–262. doi:10.1111/
j.1751-0813.1986.tb02990.x
Jones RJ, Blunt CG, Holmes JHG (1976) Enlarged thyroid glands in cattle
grazing leucaena pastures. Tropical Grasslands 10, 113–116.
Jones RJ, Ludlow MM, Troughton JH, Blunt CG (1979) Estimation of the
proportion of C3 and C4 plant species in the diet of animals from the ration
of natural 12C and 13C isotopes in the faeces. Journal of Agricultural
Science (Cambridge) 92, 91–100. doi:10.1017/S0021859600060536
www.publish.csiro.au/journals/an
S. R. Graham et al.
Jones RJ, Ford CW, Megarrity MP (1985a) Conversion of 3,4-DHP to 2,3-
DHP by rumen bacteria. Leucaena Research Reports 6, 3–4.
Jones RJ, Lowry JB, Megarrity RG (1985b) Transfer of DHP-degrading
bacteria from adapted to unadapted ruminants. Leucaena Research Report
6, 5–6.
Jones RJ, Coates DB, Palmer B (2009) Survival of the rumen bacterium
Synergistes jonesii in a herd of Droughtmaster cattle in north Queensland.
Animal Production Science 49, 643–645. doi:10.1071/EA08274
Klieve AV, Ouwerkerk D, Turner A, Roberton R (2002) The production and
storage of a fermentor-grown bacterial culture containing Synergistes
jonesii, for protecting cattle against mimosine and 3-hydroxy-4(1H)-
pyridone toxicity from feeding on Leucaena leucocephala. Australian
Journal of Agricultural Research 53, 1–5. doi:10.1071/AR00121
Lowry JB, Tangendjaja M, Tangendjaja B (1983) Autolysis of mimosine to 3-
hydroxy-4–1(H)pyridone in green tissues of Leucaena leucocephala.
Journal of the Science of Food and Agriculture 34, 529–533.
doi:10.1002/jsfa.2740340602
Lowry JB, Tangendjaja B, Cook NW (1985) Measurement of mimosine and
its metabolites in biological materials. Journal of the Science of Food and
Agriculture 36, 799–807. doi:10.1002/jsfa.2740360907
McSweeney CS, Bamualim A, Murray RM (1984) Ruminal motility in sheep
intoxicated with 2,3-dihydroxypyridine. Australian Veterinary Journal
61, 271–272. doi:10.1111/j.1751-0813.1984.tb15548.x
Phaikaew C, Suksaran W, Ted-arsen J, Nakamanee G, Saichuer A, Seejundee
S, Kotprom S, Shelton HM (2012) Incidence of subclinical toxicity in
goats and dairy cows consuming leucaena (Leucaena leucocephala) in
Thailand. Animal Production Science 52, 283–286. doi:10.1071/
AN11239
Pratchett DP, Jones RJ, Syrch FX (1991) Use of DHP-degrading rumen
bacteria to overcome toxicity in cattle grazing irrigated leucaena pasture.
Tropical Grasslands 25, 268–274.
Puchala R, Sahlu T, Davis JJ, Hart SP (1995) Influence of mineral
supplementation on 2,3-dihydroxypyridine toxicity in Angora goats.
Animal Feed Science 55, 253–262. doi:10.1016/0377-8401(95)00794-N
Quirk MF, Bushell JJ, Jones RJ, Megarrity RG, Butler KL (1988) Live-weight
gains on leucaena and native grass pastures after dosing cattle with rumen
bacteria capable of degrading DHP, a ruminal metabolite from leucaena.
Journal of Agricultural Science (Cambridge) 111, 165–170. doi:10.1017/
S0021859600082976
Rincon MT, Dominguez-Bello MG, Lovera M, Romero MR (2000)
Degradation of toxic pyridine diols derived from mimosine by rumen
bacteria: I. Microbiological aspects. Revista Cientifica, Facultad de
Ciencias Veterinarias Universidad del Zulia 10, 222–232.
Shelton M, Dalzell S (2007) Production, economic and environmental benefits
of leucaena pastures. Tropical Grasslands 41, 174–190.
Tangendjaja B, Wills RBH (1980) Analysis of mimosine and 3-hydroxy-4
(1H)-pyridone by high-performance liquid chromatography. Journal
of Chromatography. A 202, 317–318. doi:10.1016/S0021-9673(00)
81746-X
 Original Article

Effects of Myogenic Factor 5 (MYF5) Gene on Carcass and Meat

Quality of Mong Cai Pigs

Nguyen Thi Kim Khang Nguyen Trong Ngu*

Abstract

The aim of this study was to analyze the impact of Myogenic Factor 5 gene (MYF5) on carcass and meat
quality of Mong Cai pigs. PCR-RFLP was applied to genotype 100 animals at three loci defined as MYF5/Hin1II,
MYF5/HaeIII and MYF5/MspI. Results showed that MC pigs had two genotypes at each locus namely CD and DD,
EF and EE, and GH and HH for the MYF5/Hin1II, MYF5/HaeIII and MYF5/MspI loci, respectively. The frequencies
of DD, EE and HH were predominant (0.78-0.94) in the population. In addition, association analysis of three loci
revealed that animals carrying CD genotype provided higher dressing percentage (70.30 vs. 67.32%) and loin weight
(841 vs. 787 g) than those of DD genotype; however, these DD pigs had lower compression force value (4.91 vs. 5.79
kg). The other two polymorphisms were completely linked and no significant association was found with carcass and
meat quality traits. Furthermore, the constructed haplotypes were identified to associate with hot carcass and
dressing weight, of which the highest values were in CDEEHH pigs. These results suggested that the MYF5/Hin1II
polymorphism was valuable for some carcass traits and compression force, but on the basis of this polymorphism, a
simultaneous selection for these traits in MC pig remained a difficult task.

Keywords: carcass, pork quality, Vietnamese pigs

College of Agriculture and Applied Biology, Can Tho University, 3/2 Street, Can Tho City, Viet Nam
*Corresponding author: E-mail: ntngu@ctu.edu.vn

Thai J Vet Med. 2013. 43(2): 213-218.

214 Nguyen TKK & Nguyen TN / Thai J Vet Med. 2013. 43(2): 213-218.

บทคัดย่อ
ผลของยีน Myogenic Factor 5 (MYF5) ต่อคุณภาพซากและเนื้อของสุกรพันธุ์ Mong Cai

Nguyen Thi Kim Khang Nguyen Trong Ngu *

จุดมุ่งหมายของการศึกษานี้เพื่อวิเคราะห์ผลกระทบของยีน Myogenic Factor 5 (MYF5) ต่อคุณภาพซากและคุณภาพเนื้อสุกร

Mong Cai โดยใช้เทคนิค PCR-RFLP ในวิเคราะห์สายพันธุ์สัตว์จํานวน 100 ตัว โดยกําหนดตําแหน่งทั้งหมดสามตําแหน่ง ได้แก่
MYF5/Hin1II MYF5/HaeIII และ MYF5/MspI ผลการศึกษาพบว่าสุกร Mong Cai มีสองยีนในแต่ละที่คือ CD และ DD, EF และ EE และ
GH และ HH สําหรับตําแหน่ง MYF5/Hin1II, MYF5/HaeIII และ MYF5/MspI ตามลําดับ โดยพบความถี่ของ DD, EE และ HH เป็นหลัก
(0.78-0.94) จากกลุ่มประชากร นอกจากนี้การวิเคราะห์ความสัมพันธ์ของตําแหน่งทั้งสามแสดงให้เห็นว่าสุกรที่มีจีโนไทป์ชนิด CD มี
เปอร์เซ็นต์ซากสุกร (70.30 เทียบกับ 67.32%) และน้ําหนักเนื้อสันหลัง (841 เทียบกับ 787 กรัม) สูงกว่าของจีโนไทป์ DD อย่างไรก็ตามสุกร
ที่มีจีโนไทป์ชนิด DD มีค่าแรงกด (compression force value) ที่ต่ํากว่า (4.91 เทียบกับ 5.79 กก.) สําหรับความหลากหลายอีกสอง
ประเภทนั้นมีการเชื่อมโยงกันและไม่มีความสัมพันธ์อย่างมีนัยสําคัญคุณภาพซากและคุณภาพเนื้อสุกร นอกจากนี้พบ haplotype ที่สัมพันธ์
กับน้ําหนักซากอุ่นและเปอร์เซ็นต์ซากสุกร ซึ่งมีค่าสูงสุดในสุกรกลุ่ม CDEEHH ผลการศึกษานี้ชี้ให้เห็นว่าความหลากหลายของ MYF5/Hin1II
มีความสําคัญต่อคุณภาพซากบางประการและต่อค่าแรงกด แต่เมื่อคํานึงถึงความหลากหลายเหล่านี้การคัดเลือกเพื่อให้เกิดลักษณะร่วมกันใน
สุกร Mong Cai นั้นยังคงเป็นงานที่ยาก

คําสําคัญ: คุณภาพซาก คุณภาพเนือ้ หมู สุกรเวียดนาม

College of Agriculture and Applied Biology, Can Tho University, 3/2 Street, Can Tho City, Viet Nam
*ผู้รับผิดชอบบทความ E-mail: ntngu@ctu.edu.vn

Introduction a popular local pig breed in the Central coastline, the

Myogenic factor 5 (MYF5), a product of the
MYF5 gene belonging to the MyoD family, plays an
important role in the control of myogenesis and is
responsible for the primary muscle fiber formation to
their postnatal maturation and function (Hughes and
Schiaffino, 1999). The MYF5 is related to the primary
muscle cell migration and proliferation, especially for
the satellite cell proliferation in the postnatal process
of muscle regeneration (Pierzchała et al., 2008). This
gene has been mapped to the porcine chromosome 5
(Soumillion et al., 1997), which contains three exons
and two introns (te Pas et al., 1999). The expression
and effects of MYF5 are different depending on
breeds and it has been considered a candidate gene
for meat production and meat quality (te Pas, 2004;
Carmo et al., 2005). Because of its function involved in
myoblasts proliferation, MYF5 gene was found to
affect the proportion muscle fibers and the metabolic
properties of muscle (Kłosowska et al., 2004). In cattle,
MYF5 has been evidenced to influence the expression
of muscle fiber types (Muroya et al., 2002) and thereby
some meat quality traits (Ujan et al., 2011), while in
pigs many studies have described the effect of MYF5
gene on carcass traits (te Pas et al., 1999; Cieślak et al.,
2002; Liu et al., 2007a) but little is reported on its
association with meat quality, especially in
indigenous pig breeds. In Vietnam, Mong Cai (MC) is
Red River delta and other Northern provinces.
Although it has slow growth rate, it has favored
characteristics of good adaptation to poor-quality feed
and superior meat quality traits (Ngu, 2006). The aim
of this study was to reveal the association of MYF5
polymorphisms with carcass characteristics and meat
quality traits obtained in MC pigs.
Materials and Methods
Animals and Sampling: This study was carried out on
a hundred MC castrated male pigs, reared at a state
farm in Quang Ninh province of Vietnam, at the body
weight of 28.8±5.9 kg and at the age of 198±17.9 days.
The pigs were fasted 12 hours before slaughtering
following a commercial standard procedure and
under the supervision of the veterinary service. Hot
carcass weights were recorded and used for dressing
percentage calculation. Longissimus dorsi (LD)
muscle samples were collected for DNA extraction
and meat quality evaluation. Meat color was
determined using a Minolta Chromameter (CR310,
Minolta, Japan) on a cut surface 24 hour post-mortem.
Muscle pH was measured at 45 min (pH45 min) and 24
hour (pH24) with a Delta-320 portable pH meter
(Richmond Scientific Ltd.). Drip loss was calculated as
the weight loss of a meat sample in an inflated bag at
40C for 24 hours (DL24) and 48 hours (DL48) (Honikel,
Nguyen TKK & Nguyen TN / Thai J Vet Med. 2013. 43(2): 213-218.
1998). For compression force values, samples were
thawed at 40C and cut into 10 x 10 mm cross-sections
and six samples for each loin were measured using a
TA–XT2i Texture Analyzer (Stable Micro Systems
Ltd) (Florowski et al., 2006). Meat chemical
compositions such as the percentage of dry matter
(DM), crude protein (CP) and ether extract (EE) of LD
muscle were analyzed using standard AOAC
methods (AOAC, 1998).
Genotyping: Total DNA was extracted using phenol-
chloroform method. Primer sequences, restriction
enzymes and PCR condition of the MYF5 gene
(GenBank Acc. No.Y17154) were detailed by Liu et al.
(2008). In brief, fragments were amplified in 20 µl
reaction volume containing 25 ng genomic DNA as
template, 0.25 μM dNTP, 0.25 μM of each primer, and
1 U Taq polymerase and PCR buffer. The reaction
started with 4 min of initial denaturation at 940C,
followed by 35 cycles of amplification with
denaturation at 940C for 45 sec, annealing at 570C
(MYF5-p1) or 630C (MYF5-p2) for 45 sec, extension at
720C for 60 sec, and a final elongation at 720C for 10
min. The PCR products of the MYF5-p1 and MYF5-p2
primers were subsequently used for genotyping by
PCR-RFLP (Restriction Fragment Length
Polymorphism) method. The three polymorphic sites,
namely A1205C (exon 1), G2368A and A2165G (intron
1, exon 2, intron 2), were recognized by Hin1II, HaeIII
and MspI, respectively. A total volume of 10 µl
including 8.5 µl PCR product, 0.5 µl restriction
enzyme and 1 µl reaction buffer was incubated at 370C
for 4 hours. The digested products were checked and
genotypes were directly determined by
electrophoresis on a 2% agarose gel at 80 volt for 30
min. From the detected SNPs, a construction of
haplotype using Merlin software (Abecasis et al.,
2002) was performed and these haplotypes together
with the SNPs were analyzed in the association study.
Statistical analysis: Association analysis between
MYF5 genotypes and traits of interest was performed
using least squares method of the GLM procedure in
Minitab version 13.20 with the following model: Yijk
= µ + Gi + Cj + eijk, where Yijk was the observation of
traits, µ was the overall mean of each trait, Gi was the
genotype effect, Cj was the covariate (body weight at
slaughter) and eijk was the random error. The
difference between genotypes was tested using
Turkey pair wise comparison at the 5% significance
Figure 1 Agarose gel electrophoresis of PCR-RFLP at MYF5/Hin1II, MYF5/HaeIII and MYF5/MspI loci. M: 100 bp DNA ladder,
Fermentas.
215
level. Data were presented as Least square
means±standard error.
Results
Genotype and allele frequency: The PCR-RFLP data
allowed identifying different genotypes at three
polymorphic positions of the MYF5 gene. The
electrophoresis results obtained from restriction
enzyme fragments were: 243+210+33 bp for
MYF5/Hin1II CD genotype; 210+33 bp for
MYF5/Hin1II DD genotype; 1016+193 bp for
MYF5/HaeIII EE genotype; 1016+777+239+193 bp for
MYF5/HaeIII EF genotype; 575+461+173 bp for
MYF5/MspI HH genotype and 1036+575+461+173 bp
for MYF5/MspI GH genotype (Fig 1). The frequencies
of genotypes and haplotypes of the SNPs (Single
Nucleotide Polymorphism) are presented in Table 1.
There was a similar trend of genotype distribution at
all loci, in which the majority of animals carried DD,
EE and HH genotypes (> 78%); however, there were
only 2 genotypes found at each locus. The
MYF5/HaeIII and MYF5/MspI were completely
linked; their genotype frequencies for both mutations
had the same values. Additionally, the most common
haplotype was DDEEHH, followed by CDEEHH and
DDEFGH.
Effects of polymorphisms on carcass and meat
quality traits: Association analysis of the
MYF5/Hin1II genotypes showed significant impacts
of CD and DD genotypes on dressing percentage and
loin weight (p < 0.05) (Table 2). Moreover, the pH45
min value was detected to be higher in DD compared
to CD pigs (p < 0.05). The DD genotype had
significantly lower compression force value than CD
genotype (p < 0.05). For the other two SNPs,
significant associations between MYF5/HaeIII and
MYF5/MspI genotypes with carcass and meat quality
traits were not detected (data not shown). In addition,
MYF5 haplotypes were significantly associated with
hot carcass and dressing percentage (p < 0.05) with
highest values in animals carrying CDEEHH
haplotype, whereas no differences were apparent for
other meat quality traits (Table 3). There was also a
trend of increased loin weight in CDEEHH pigs with
the significance of p = 0.052. At all loci examined,
statistical effects of either genotypes or haplotypes on
meat chemical composition (Table 2 and Table 3) were
not established (p > 0.05).
216 Nguyen TKK & Nguyen TN / Thai J Vet Med. 2013. 43(2): 213-218.

Table 1 Genotype and haplotype frequencies of MYF5 gene in MC pigs

MYF5/Hin1II MYF5/HaeIII MYF5/MspI MYF5 haplotype

Item
CD DD EF EE GH HH DDEEHH CDEEHH DDEFGH
No. of pigs 22 78 6 94 6 94 73 21 5
Frequency 0.22 0.78 0.06 0.94 0.06 0.94 0.74 0.21 0.05

Table 2 Association of MYF5/Hin1II genotypes and meat quality traits in MC pigs

Genotype
Traits p-value
CD (n = 22) DD (n = 78)
Carcass
Dressing percentage (%) 70.30 ± 0.97 67.32 ± 0.53 0.009
Loin weight (g) 841.4 ± 22.23 786.9 ± 12.11 0.039
Meat quality
pH45 min 6.53 ± 0.05 6.65 ± 0.02 0.018
pH24 6.09 ± 0.04 6.12 ± 0.02 0.530
Drip loss24 (%) 1.98 ± 0.16 1.79 ± 0.09 0.499
Drip loss48 (%) 2.87 ± 0.20 2.58 ± 0.11 0.237
Cooking loss (%) 23.35 ± 0.89 22.21 ± 0.49 0.264
Compression force (kg) 5.79 ± 0.37 4.91 ± 0.19 0.034
Meat color
L* (Lightness) 48.94 ± 0.34 49.29 ± 0.19 0.353
a* (Redness) 4.97 ± 0.60 5.59 ± 0.32 0.369
b* (Yellowness) 8.79 ± 0.31 8.92 ± 0.17 0.997
Meat chemical composition (%)
Dry matter 25.45 ± 0.30 25.63 ± 0.16 0.946
Crude protein 21.99 ± 0.22 22.09 ± 0.12 0.612
Ether extract 2.42 ± 0.11 2.58 ± 0.06 0.148
Ash 0.94 ± 0.08 1.01 ± 0.04 0.238

Table 3 Association of MYF5 haplotypes and carcass and meat quality traits in MC pigs

Haplotype
Traits p-value
DDEEHH (n = 74) CDEEHH (n = 21) DDEFGH (n = 5)
Carcass
Dressing percentage (%) 67.44 ± 0.53b 70.64 ± 0.97a 68.01 ± 2.02ab 0.016
Loin weight (g) 792.0 ± 12.17 847.9 ± 22.39 753.4 ± 46.78 0.052
Meat quality
pH45 min 6.63 ± 0.03 6.55 ± 0.04 6.69 ± 0.10 0.261
pH24 6.09 ± 0.02 6.10 ± 0.04 6.15 ± 0.09 0.423
Drip loss24 (%) 1.83 ± 0.11 2.12 ± 0.21 1.73 ± 0.44 0.433
Drip loss48 (%) 2.57 ± 0.13 2.94 ± 0.23 2.55 ± 0.50 0.388
Cooking loss (%) 22.40 ± 0.51 22.41 ± 0.96 21.57 ± 1.99 0.920
Compression force (kg) 4.95 ± 0.20 5.17 ± 0.38 5.50 ± 0.79 0.715
Meat color
L* (Lightness) 49.37 ± 0.19 48.87 ± 0.34 48.62 ± 0.71 0.287
a* (Redness) 5.72 ± 0.33 4.89 ± 0.60 7.76 ± 1.26 0.110
b* (Yellowness) 8.94 ± 0.17 8.71 ± 0.32 8.80 ± 0.66 0.804
Meat chemical composition (%)
Dry matter 25.43 ± 0.17 25.49 ± 0.30 25.25 ± 0.63 0.937
Crude protein 21.94 ± 0.12 22.27 ± 0.22 21.92 ± 0.46 0.404
Ether extract 2.52 ± 0.06 2.37 ± 0.12 2.70 ± 0.24 0.367
Ash 1.04 ± 0.05 0.86 ± 0.08 1.01 ± 0.17 0.173
a, b Values in the same row with different superscripts are significantly different (p < 0.05)

Discussion and compression force.

Our study confirms the findings in many pig
breeds that the presence of homozygous genotypes
CC, FF and GG was very rare and by investigating the
association of three SNPs on carcass and meat quality
traits, only the MYF5/Hin1II was observed to
influence dressing percentage, loin weight, meat pH
In the current study, the MYF5/Hin1II
polymorphism provided two genotypes with the
majority being the DD animals. This partly supported
the report of Liu et al. (2007b) that in a commercial
population of Yorkshire, Landrace and their cross,
this locus was polymorphic for the D allele whereas
Nguyen TKK & Nguyen TN / Thai J Vet Med. 2013. 43(2): 213-218.
three genotypes were detected in the Meishan,
Yorkshire and Meishan x Yorkshire cross. At the
MYF5/MspI locus, the GG genotype could not be
found and the HH genotype was predominant in both
Large White and Landrace breeds (Verner et al., 2007).
In the LW x Meishan F2 population, a small number
(5.1%) of GG animals was also described by Liu et al.
(2007a). This was later validated by Liu et al. (2008),
who found no GG genotype in the Large White and
Landrace, whereas in the Meishan breed the GG and
GH frequencies were 0.18 and 0.38, respectively,
which was higher than those of MC pigs (0 and 0.06,
respectively). Thus, irrespective of breed, the G allele
was in low frequency across populations.
The first polymorphism in exon 1 of the
MYF5 gene resulted in amino acid substitution (Met
Æ Leu), which may be responsible for changing the
functional properties of the protein and affecting
muscle maturity (Liu et al., 2008). In the present
study, the analysis of MYF5/Hin1II polymorphism
with carcass traits indicated that pigs with genotype
DD had significantly lower dressing percentage and
loin weight as compared to those with genotype CD.
In the Large White x Meishan F2 population, Liu et al.
(2007b) observed significant associations between this
locus with fat deposition traits and carcass length, in
which the difference mainly between the CC and DD
animals implied that allele “C” was closely related to
higher back fat and buttock fat thickness content.
Although CC animals were not available in this study,
it could be that the impacts were breed-specific due to
different genetic backgrounds and selection pressure
or it might originate from the difference in muscle
fiber type proportion, where higher percentages of IIx
and IIa were found in MC pigs compared to IIb fibers
(data not shown). It also suggested that this mutation
could not be causal for the differences in carcass traits
being investigated. The haplotype analysis, of which
the lowest carcass values in pigs bearing DDEEHH
variants, additionally confirmed the data.
The MYF5 gene was reported to have a
relationship with the expression of fast-twitch
oxidative fiber (Kłosowska et al., 2004) and thus it is
likely to have further impact on metabolic activity of
the muscle and meat quality. Regarding to this point,
for the MYF5/Hin1II SNP, Liu et al. (2008)
demonstrated changes of intramuscular fat and meat
moisture content with the substitution of amino acid
caused by this polymorphism. However, these
outcomes were not confirmed in this study, showing
only significant effects on pH45 min and compression
force of the meat. In the present work, although there
was a discrepancy of compression force values
between two genotype groups, the intramuscular fat
reflected by EE value was similar. According to the
observations of Florowski et al. (2006) on a Polish
indigenous pig breed, the relationship between
compression force and intramuscular fat content was
negative (-0.36), and thus higher fat deposition would
be expected in homozygous DD pigs. The non-
significant difference was probably because of the
limited animals examined, especially the imbalance
among the genotypes. In combination with the results
of the association with carcass, it can be stated that a
217
simultaneous selection for both better carcass and
meat quality in MC pig based on this polymorphism
would be a difficult task to accomplish. As there were
only a few animals bearing the EF and GH genotype,
a wider study with larger numbers and in other
native breeds would be of interest for analysis.
In conclusion, among the investigated MYF5
polymorphisms, the MYF5/Hin1II locus is of valuable
SNP that has certain impacts on pH45 min, meat
compression force in LD muscle, dressing percentage
and loin weight. Further studies are needed to
confirm the association in other native populations
before applying this gene as a genetic marker for pig
breeding selection.
Acknowledgements
This project was financially supported by the
Vietnam's National Foundation for Science and
Technology Development (NAFOSTED), Grant No.
106.06.62.09.
References
Abecasis GR, Cherny SS, Cookson WO and Cardon
LR 2002. Merlin-rapid analysis of dense genetic
maps using sparse gene flow trees. Nat Genet.
30: 97-101.
AOAC 1998. Official Methods of Analysis. 16th ed.
Association of Official Analytical Chemists.
Washington D.C.
Carmo FMS, Guimarães SEF, Lopes PS, Pires AV,
Guimarães MFM, Silva MVGB and Schierholt
AS 2005. Association of MYF5 gene allelic
variants with production traits in pigs. Genet
Mol Biol. 28: 363-369.
Cieślak D, Kurył J, Kapelański W, Pierzchała M,
Grajewska S and Bocian M 2002. A relationship
between genotypes at MYOG, MYF3 and
MYF5 loci and carcass meat and fat deposition
traits in pigs. Anim Sci Pap Rep. 20: 77-92.
Florowski T, Pisula A, Adamczak L, Buczyński JT and
Orzechowska B 2006. Technological
parameters of meat in pigs of two Polish local
breeds – Zlotnicka Spotted and Pulawska.
Anim Sci Pap Rep. 24: 217-224.
Honikel KO 1998. Reference methods for the
assessment of physical characteristics of meat.
Meat Sci. 49: 447-457.
Hughes SM and Schiaffino S 1999. Control of muscle
fibre size: A crucial factor in ageing. Acta
Physiol Scand. 167: 307-312.
Kłosowska D, Kurył J, Elminowska-Wenda G,
Kapelański W, Walasik K, Pierzchała M,
Cieślak D and Bogucka J 2004. A relationship
between the PCR-RFLP polymorphism in
porcine MYOG, MYOD1 and MYF5 genes and
microstructural characteristics of m.
longissimus lumborum in Pietrain x (Polish
Large White x Polish Landrace) crosses. Czech
J Anim Sci. 49: 99-107.
Liu M, Peng J, Xu DQ, Zheng R, Li FE, Li JL, Zuo B,
Lei MG, Xiong YZ, Deng CY and Jiang SW
2007a. Association analyses of polymorphisms
218 Nguyen TKK & Nguyen TN / Thai J Vet Med. 2013. 43(2): 213-218.

in porcine MYF5 and MYOD1 genes with

carcass traits. Aust J Agr Res. 58: 1040-1045.
Liu M, Peng J, Xu DQ, Zheng R, Li FE, Li JL, Zuo B,
Lei MG, Xiong YZ, Deng CY and Jiang SW
2007b. Association of MYF5 gene
polymorphisms with meat quality traits in
different domestic pig (Sus scrofa) populations.
Genet Mol Biol. 30: 370-374.
Liu M, Peng J, Xu DQ, Zheng R, Li FE, Li JL, Zuo B,
Lei MG, Xiong YZ and Deng CY 2008.
Association of MYF5 and MYOD1 gene
polymorphisms and meat quality traits in
Large White x Meishan F2 pig populations.
Biochem Genet. 46: 720-732.
Muroya S, Nakajima I and Chikuni K 2002. Related
expression of MYOD and MYF5 with myosin
heavy isoform types in bovine adult skeletal
muscle. Zoolog Sci. 19(7): 755-761.
Ngu NT 2006. Transcript abundance of myosin heavy
chain isoforms and identification of candidate
genes for body composition and meat quality
in pigs, Ph.D. Thesis, University of Bonn,
Bonn, Germany.
Pierzchała M, Wyszyńska-Koko J, Urbański P and
Rózycki M 2008. The analysis of MYF5, MYF6,
GHR and IGFR1 expression profile in muscle
and liver in growing pigs of different breeds,
regarding to their muscle and carcass quality.
Arch Anim Breed. Special Issue: 76-77.
Soumillion A, Rettenberger A, Vergouwe MN, Erkens
JHF, Lenstra JA and te Pas MFW 1997.
Assignment of the porcine loci for MYOD1 to
chromosome 2 and MYF5 to chromosome 5.
Anim Genet. 28: 37-38.
Te Pas MFW 2004. Candidate genes for meat
production and meat quality - the MRF genes.
Anim Sci Pap Rep. 22: 115-118.
Te Pas MFW, Harders FL, Soumillion A, Born L, Buist
W and Meuwissen THE 1999. Genetic variation
at the porcine MYF-5 gene locus. Lack of
association with meat production traits.
Mamm Genome 10: 123-127.
Ujan JA, Zan LS, Ujan SA and Wang HB 2011.
Association between polymorphism of MYF5
gene with meat quality traits in indigenous
Chinese cattle breeds. International Conference
on Asia Agriculture and Animal, IPCBEE 13:
50-55.
Verner J, Humpolicek P and Knoll A 2007. Impact of
MYOD family genes on pork traits in Large
White and Landrace pigs. J Anim Breed Genet.
124: 81-85.
International Journal of Animal and Veterinary Advances 5(4): 156-159, 2013
ISSN: 2041-2894; e-ISSN: 2041-2908
© Maxwell Scientific Organization, 2013
Submitted: February 16, 2013 Accepted: March 11, 2013 Published: August 20, 2013

Analysis on the Relationship between an Intronic Polymorphism in Troponin C Gene

(TNNC1) with Pork Quality Traits
1
Nguyen Trong Ngu, 2Nguyen Hong Xuan and 3Vu Chi Cuong
1
College of Agriculture and Applied Biology, Can Tho University, Viet Nam
2
Can Tho University of Technology, Viet Nam
3
National Institute of Animal Husbandry, Viet Nam

Abstract: The objective of this study was to investigate the distribution of genotype and analyze the effect of the
intronic polymorphism (g.C716G) of TNNC1 gene on meat quality traits of Mong Cai (MC) pig. In total, 118
animals were used for phenotype record and genotyping by PCR-RFLP method. Results showed that the presence of
allele “G” was more than twice as frequent as allele “C” at the polymorphic site (0.70vs. 0.30) and the frequency of
CC genotype was very low (0.07) compared to CG (0.47) and GG (0.46) genotypes. The pH value at 45 min post-
mortem was different (p<0.01) among three genotype groups with the lowest found in pigs bearing CC genotype
(6.43). Significantly higher compression force value (6.16 kg) found in CC pigs implied that loins from these
animals were less tender than those from CG animals. Other parameters of meat quality including drip loss and meat
color were not affected by this polymorphism. Moreover, in the analysis of thirty MC pigs, although the relationship
between genotypes and muscle fiber type composition was unclear, there was a trend of increasing IIa fiber and
decreasing IIb fiber percentage in pigs with GG genotype (p = 0.059 and p = 0.082, respectively). In conclusion, the
SNP examined in TNNC1 gene may be of interest in selection for meat tenderness in MC pigs; however as this is
not a causative polymorphism, further studies on the association of TNNC1 with meat quality traits regarding to the
interaction with other functional genes in surrounding regions are recommended.

Keywords: Association, meat quality, mong cai pigs, muscle fiber type

INTRODUCTION is well resistant to diseases. Specially, this breed has

Troponin, the central regulatory protein of striated
muscle contraction, is a component of thin filaments
together with actin and tropomyosin (Hooper and
Thuma, 2005). The contractile protein troponin,
containing the three subunits troponin I, troponin T and
troponin C, plays a role for the concentration of Ca2+
and is responsible for striated muscle contraction (Xu
et al., 2010). Each troponin has isoforms encoded by
different genes which are expressed exclusively in
different muscle fiber types (Mullen and Barton, 2000).
Troponin C (TNNC1) is considered as a temporary
bridge contributing to the formation of muscle growth
and its expression may influence meat quality traits
(Kim et al., 2005). Previously, Furukawa and Peter
(1971) stated that troponin activity in skeletal muscle of
guinea pig is related to three histochemical fibers in
such a way that intermediate and red fibers have lower
troponin activities than white fibers. Thus, the
expression of TNNC1 appeared to have a link with
different muscle fiber isoforms and thereby it may have
certain effects on meat quality traits. In Viet Nam,
Mong Cai is a native pig breed being able to adapt to
severe environmental condition, low nutrition diet and
been known for its superior meat quality, which is an
important characteristic to producers, consumers and
processing industry. The objective of this study was to
examine the distribution of genotype and analyze the
effect of the intronic g.C716G SNP of TNNC1 gene on
quality traits and muscle fiber type composition in the
loin of MC pigs.
MATERIALS AND METHODS
Animals and sampling: The study was carried out on
the castrated male MC pigs that were reared at a state
farm in Quang Ninh province, Viet Nam. All animals
were fed under similar conditions and they were
slaughtered at 197±17 days of age with the live weight
of 28.5±6.0 kg. The pigs were fasted 12 h before
slaughtering followed a commercial standard procedure
and under the supervision of the veterinary service.
Longissimus dorsi (LD) muscle samples were collected
for further measurements and analysis.
Meat quality measurements and muscle fiber
typing: Meat color, classified as lightness (L*), redness
(a*) and yellowness (b*), were determined on a fresh

Corresponding Author: Nguyen Trong Ngu, College of Agriculture and Applied Biology, Can Tho University, Viet Nam
156
 Int. J. Anim. Veter. Adv., 5(4): 156-159, 2013

cut surface 24 h post-mortem by using a Minolta

Chromameter (CR310, Minolta, Japan). Muscle pH was
measured at 45 min (pH 45 min ) and 24 h (pH 24 ) post-
mortem with a Delta-320 pH meter (Mettler Toledo,
USA). Drip loss was calculated as the weight loss of a
meat sample (40±5 g) placed in a bag at 4°C for 24
(drip loss 24 ) and 48 h (drip loss 48 ) (Rehfeldt et al.,
2008). To obtain cooking loss, a loin cube (90±5 g) was
taken and stored at 4°C for 24 h and subsequently it
was bagged in thin-walled plastic and placed in a water
bath at 75°C for 30 min. The bag was subsequently
cooled under cold water for 30 min and the cooking
loss was expressed as the difference of original and
cooked weight (Renaudeau and Mourot, 2007). For
compression force values, samples were thawed at 4°C
and cut into 10×10 mm cross-sections (with the fiber
direction) and six samples for each loin were measured
using a TA-XT2i Texture Analyzer (Stable Micro
Systems Ltd.) (Florowski et al., 2006). Chemical
composition of LD muscle including dry matter,
protein, ether extract and ash content was estimated
followed the protocols of AOAC (1998). Muscle fiber
typing using real-time RT-PCR has been detailed in
Ngu et al. (2012). In total, there were 30 MC pigs used
for muscle fiber typing.

TNNC1 genotyping: The forward and reverse primer

pair used to amplify the 449-bp fragment was 5’- Fig. 1: Sequencing chromatogram showing a mutation (C/G)
GAGGCTCTGTTGCTGTTTCC-3’ and 5’-GAGC AG identified in three individuals
CTGTCCATGTCAGA-3’ (Ngu, 2006). DNA samples
from LD muscle were extracted using phenol/
chloroform and samples were genotyped by PCR-RFLP
(Restriction Fragment Length Polymorphism) technique
with the presence of AvaII enzyme. A digestion
reaction containing 1 unit of enzyme, 1 µL of 10x
restriction buffer and 1 µg of DNA was incubated at
37°C in 15 min for complete digestion. The digested
product was checked by electrophoresis on 2% agarose
gel.
Fig. 2: Electrophoresis on 2% agarose gel of PCR product
Statistical analysis: The relationship between TNNC1 after digestion with AVaII. M: 100 bp DNA ladder,
genotypes with traits of interest was performed using Fermentas
the least squares method of the GLM procedure in
Minitab version 13.20. Factors found to affect the traits with AvaII restriction enzyme resulted in three
such as genotype, boar and sow were used in the model genotypes of CC (449 bp), CG (449, 337 and 112 bp)
and body weight at slaughter was added as a covariate. and GG (337 and 112 bp) (Fig. 2). At this SNP, the
The difference between genotypes was tested using presence of allele “G” was more than twice as frequent
Tukey pair wise comparison at the 5% significance as allele “C” (0.70 vs. 0.30); as a result, the distribution
level. Data were presented as Least square of CC genotype was very low (0.07) compared to CG
means±Standard error. (0.47) and GG (0.46) genotypes (Fig. 3).

RESULTS Relationship between SNP marker and pork quality

Genotyping and frequency: In MC pig, a SNP
(g.C716G) was detected in the intronic region of the
TNNC1 gene (GenBank accession No. AY958072)
(Fig. 1). The amplified PCR product of 449 bp digested
157
parameters: Regarding to meat quality traits, results
from Table 1 indicated that the investigated SNP had a
significant effect on pH 45 min (p<0.01), in which the
lowest value was on CC genotype (6.43). Different
genotypes also had a relationship with compression
 Int. J. Anim. Veter. Adv., 5(4): 156-159, 2013

Table 1: Relationship between TNNC1 genotypes with quality and chemical composition of pork loin
Genotype
------------------------------------------------------------------------------------------------
Traits CC (n = 8) CG (n = 57) GG (n = 53) P
Meat quality
b a
pH 45 min 6.43±0.08 6.65±0.03 6.69±0.03a 0.003
pH 24 6.17±0.07 6.17±0.03 6.18±0.03 0.956
Drip loss 24 (%) 2.00±0.32 1.77±0.11 1.99±0.12 0.389
Drip loss 48 (%) 2.96±0.40 2.53±0.14 2.91±0.15 0.148
Cooking loss 23.7±1.6 23.0±0.6 22.1±0.6 0.481
Compression force (kg) 6.16±0.60a 4.64±0.22b 5.12±0.24ab 0.042
Meat color
L* (lightness) 50.2±0.5 49.2±0.2 49.3±0.2 0.215
a* (redness) 4.2±1.0 6.3±0.4 5.4±0.4 0.068
b* (yellowness) 9.2±0.5 8.6±0.2 8.8±0.2 0.557
Meat chemical composition (%)
Dry matter 24.9±0.4 25.7±0.2 25.3±0.2 0.060
Crude protein 22.6±0.4 22.2±1.1 21.9±1.0 0.083
Ether extract 2.49±0.17 2.52±0.07 2.59±0.07 0.682
Ash 0.96±0.13 1.08±0.05 1.01±0.05 0.550
a,b
: Values in the same row with different superscripts are significantly different (p<0.05)

Table 2: Relationship between TNNC1 genotypes with muscle fiber are limited. Instead, most of researchers discussed
types of pork loin
about the role of this gene in clinical setting such as
Genotype
----------------------------------------------- heart failure (Adamcova et al., 2006). In the present
Muscle fiber (%) CC CG (n = 15) GG (n = 14) P study, the detected SNP of TNNC1 is located in the
Type I - 23.1±1.4 21.3±1.4 0.294 intronic region and the relationship of such SNP with
Type IIa - 25.0±1.6 28.8±1.6 0.059 observed traits may be explained by the influence of
Type IIx - 39.1±1.7 39.1±1.7 0.989
Type IIb - 12.8±1.0 10.8±0.9 0.082
intron on mRNA metabolism including initial
-: not available transcription, editing and polydenylation of the pre-
mRNA, translation and decay of the mRNA product
(Le Hir et al., 2003). Moreover, there are an increasing
number of reports for the role of introns in regulating
the expression level of a gene or tissue-specific
expression pattern (Greenwood and Kelsoe, 2003;
Pagani and Baralle, 2004).
With regards to the distribution of genotype in MC
pigs, our study confirmed the previous finding that the
number of pigs carrying CC genotype appeared at low
frequency (8%) in the population of F2 DUPI (Duroc x
Pietrain) while the presence of other two genotypes
were almost in similarity (Ngu, 2006). In the
Fig. 3: Genotype and allele frequencies of the C/G SNP in association analysis with meat quality traits, the current
MC population data additionally agree with those reported by Ngu
(2006) that meat color, shear force, drip loss and
force; meat from pigs bearing CC genotype was less cooking loss were not affected by the allele
tender than that from CG and GG genotypes (p<0.05). substitution; in that study, only conductivity was found
None of significant effects of genotype were found for to associate with the changing of genotype.
other meat quality parameters. In addition, meat color The TNNC1 gene was mapped on SSC 13 where
was almost the same among three genotype groups
QTL (Quantitative Trait Loci) scan showed evidence of
except for redness (a*) value, where the significant
level was slightly larger (0.068) than the detected significance at 5% chromosome-wide level with pH 1
threshold. There was also a trend of difference by and pH 24 in LD muscle (Wimmers et al., 2006). It has
genotypes in crude protein content (p = 0.083). Finally, been suggested by Metzger (1996) that TnC isoforms
the substitution of C/G allele did not lead to a change in may have an effect in conferring pH sensitivity of Ca2+-
muscle fiber type composition though the percentages activated contraction in mammalian fast and slow
of IIa and IIb fiber tended to be higher in GG and CG muscle fibers. It could be hypothesized in this study
genotypes, respectively (p = 0.059) (Table 2). that the extent of acidic-pH-mediated reduction in Ca2+
binding to regulatory binding sites on TnC is dependent
DISCUSSION on the proportion of muscle fiber; however as these
data were not available due to low numbers of pigs
The documentations on the SNP as well as bearing CC genotype, a conclusive statement for this
association of TNNC1 with performance traits in pigs difference is open to debate. In addition, significantly
158
 Int. J. Anim. Veter. Adv., 5(4): 156-159, 2013
higher compression force value found in CC pigs
implied that loins from these animals were less tender
than those from CG animals. A lower pH 45 min value in
combination with higher compression force made pigs
with CC genotype less favorable in breeding selection
for meat quality.
Also in our research, thirty pigs were randomly
selected for the examination of muscle fiber proportion
but out of these there was only one pig with CC
genotype, therefore the comparison was drawn only
between CG and GG carriers. The result indicated a
trend of increasing IIa fiber and decreasing IIb fiber
percentage in pigs with GG genotype. Henckel et al.
(1997) reported the frequency of IIb fiber and
intramuscular fat content are positively correlated and
thus flavor and tenderness seemed to have a negative
relationship with IIa but positive correlation with IIb
fibers. Our results confirmed this statement and it is
likely that desirable meat in terms of pH 45 min and
tenderness in pigs carrying CG genotype could be
expected in selection. However, as this is not a
causative polymorphism, further studies on the
relationship of TNNC1 with meat quality traits with
regards to the interaction with other functional genes,
i.e., pituitary-specific transcription factor (PIT1) are
recommended.
ACKNOWLEDGMENT
This study was financially supported by the
Vietnam’s National Foundation for Science and
Technology Development (NAFOSTED), Grant No.
106.06.62.09.
REFERENCES
Adamcova, M., M. Sterba, T. Simunek, A. Potacova, O.
Popelova and V. Gersl, 2006. Myocardial
regulatory proteins and heart failure. Eur. J. Heart
Fail., 8: 333-342.
AOAC, 1998. Official Methods of Analysis. 16th Edn.,
Association of Official Analytical Chemists,
Washington, D.C.
Florowski, T., A. Pisula, L. Adamczak, J.T. Buczynski
and B. Orzechowska, 2006. Technological
parameters of meat in pigs of two polish local
breeds–zlotnicka spotted and pulawska. Anim. Sci.
Pap. Rep., 24: 217-224.
Furukawa, T. and J.B. Peter, 1971. Troponin activity of
different types of muscle fibers. Exp. Neurol., 31:
214-222.
Greenwood, T.A. and J.R. Kelsoe, 2003. Promoter and
intronic variants affect the transcriptional
regulation of the human dopamine transporter
gene. Genomics, 82: 511-520.
159
Henckel, P., N. Oksbjerg, E. Erlandsen, P. Barton-Gade
and C. Bejerholm, 1997. Histo-and biochemical
characteristics of the Longissimus dorsi muscle in
pigs and their relationships to performance and
meat quality. Meat Sci., 47: 311-321.
Hooper, S.L. and J.B. Thuma, 2005. Invertebrate
muscles: Muscle specific genes and proteins.
Physiol. Rev., 85: 1001-1060.
Kim, C.W., K.T. Chang, Y.H. Hong, E.J. Kwon, W.Y.
Jung, K.K. Cho, K.H. Chung, B.W. Kim, J.G. Lee,
J.S. Yeo, Y.S. Kang and Y.K. Joo, 2005. Screening
of specific genes expressed in the swine tissues and
development of a functional cDNA chip. Asian
Aust. J. Anim., 18: 933-941.
Le Hir, H., A. Nott and M.J. Moore, 2003. How introns
influence and enhance eukaryotic gene expression.
Trends Biochem. Sci., 28: 215-220.
Metzger, J.M., 1996. Effects of troponin C isoforms on
pH sensitivity of contraction in mammalian fast
and slow skeletal muscle fibers. J. Physiol-London,
492: 163-172.
Mullen, A.J. and P.J.R. Barton, 2000. Structural
characterization of the human fast skeletal muscle
troponin I gene (TNNI2). Gene, 242: 313-320.
Ngu, N.T., 2006. Transcript abundance of myosin
heavy chain isoforms and identification of
candidate genes for body composition and meat
quality in pigs. Ph.D. Thesis, University of Bonn,
Bonn, Germany.
Ngu, N.T., N. Thiet, L.T. Kien, C.T. Vu, N.T.H. Nhan,
P.N. Du, N.T.K. Khang and T.N. Dung, 2012.
Effects of calpastain (CAST) polymorphisms on
carcass and meat quality traits in Mong Cai pigs.
Afr. J. Biotechnol., 11(73): 13782-13787.
Pagani, F. and F.E. Baralle, 2004. Genomic variants in
exons and introns: Identifying the splicing spoilers.
Nat. Rev. Genet., 5: 389-396.
Rehfeldt, C., A. Tuchscherer, M. Hartung and G. Kuhn,
2008. A second look at the influence of birth
weight on carcass and meat quality in pigs. Meat
Sci., 78: 170-175.
Renaudeau, D. and J. Mourot, 2007. A comparison of
carcass and meat quality characteristics of Creole
and large white pigs slaughtered at 90 kg body
weight. Meat Sci., 76: 165-171.
Wimmers, K., I. Fiedler, T. Hardge, E. Muráni, K.
Schellander and S. Ponsuksili, 2006. QTL for
microstructural and biophysical muscle properties
and body composition in pigs. BMC Genet., 7: 15.
Xu, Z.Y., H. Yang, Y. Li, Y.Z. Xiong and B. Zuo,
2010. Temporal expression of TnI fast and slow
isoforms in biceps femoris and masseter muscle
during pig growth. Animal, 4: 1541-1546.



34568456 9
!"#$%&'()*+,-./012340/-051 ¹
%#6789
012 :;1<2:=1>2?4@1<A2B<@CD12EF12?4@1<A2?4G12?4@1<2?>H1<A2I>JK2EF12L0M0A
NB<@CD12+O@2PQR1<SA2?4G12TR12+U2VU2EQR1<2W@XY2?@Z1[2
)\]^'_#`a#b9#*(6c8$^d"e# ¹º
f6ghiij(klimii
En2B<oY2TR1A2pJY>2qJ1>2:0r@A2B<@CD12EF12?sKA2:U,2:,512?451<A
B<@CD12?>t2+u0A2pv02?4o1<2w0D12VU2?4G12I>QR1<2x>y1>
`a#b(\]czka#9{| ȼ
B<@CD12:}Y2?4o1<A2I>JK2EF12x>@1<A2B<@CD12?>t2?>~C2B<>5A2
PQR1<2?>t2p€.A2:1<2?>t2W@C‚12VU2:;1<2?>t2E@0
{ƒ„ƒ^%a*(„(\]†g‡ ¼»
+,U1<2?@Z12?>U1>A2B<@CD12W@XY2:J.A2wQR1<2ˆ@‰12?@CŠ1A2B<@CD12:=1>2?@Z1A
B<@CD12:}Y2?>‹5A2B<@CD12EF12+0Œ@2VU2I>v1<2:}Y2?01
Ž!^'z^9j(‘„bz^#’9#'('#“#9# º»
'a%”#”
I>v1<2:}Y2?01A2+,U1<2EF12P€YA2P‚2EF12?>•YA2B<@C‚1–2EF12W@C‚—.A2
:;1<2:=1>2?}A2I>JK2W@51<2B<oY2VU2I>JK2B<oY2?>JY>
˜#!c„\™#7š9›kœž„\™c9a'Ÿ#› œj(‘„b#7š9# ½¹
c(#7^¡e”$9#9#^¢9e”$„a%#z^£"Ÿ)#^a„™
&g#b9¤
:U,2?>t2I>QR1<A2B01>2?>t2P/1A2?4G12W@XY2E0Œ.A2P‚2EF12+@C‚1A2
?4G12E0Œ.2I>QR1<A2B01>2?>t2+@Cr122VU2En2x>y2xQR1<[
¥„\™e”$„a(#j#`¡"##¦ca^%^§^¢9)* ¾¼
^a^!^`¡"_`!^9)¨`©dª«9„¬6#«­{ª
B<@CD12?4o1<2B<O2VU2B<@CD12?>t2+1<2B>‰1
$#„#7`^¢9'9e”$z^®«j]#`cƒ^¢9„™ ¿¼
š{!#j(¯ac`”#c«
?4G12ˆ@‰12+,U1A2I>JK2?>t2I>QR1<2q50A2L051<2?>t2?>51>2B>U1A
PQR1<2B>‰12?@Z1A2?4t1>2+1<2TR12VU2B<@CD12VF12+U
Ž!^'„a(#ca°™")e\¦)¨`©d­{ª ÀÁ
B<@CD12EF12p5A2I>JK2w,±12P‰1A2B<@CD12?4o1<2p=1>A
P‚2W@51<2B5KA2?4G12?>t2?>@2?>²C2VU2P‚2³1>2W@´1>
µ#bc%^¶„\™j(jb”#9a(^"¡^!^”"¡„7 À¿
«c7c\·
?4G12?>t2q502I>QR1<A2PJ02qJ1>2?,U12VU2B<@CD12?>t2+,U1<2³1>
¥9« {‡ª¬ez^®«„#7`j]#‘„b%^^¢9„™ š ¾
{!#j(¯ac`”#c«
?4G12ˆ@‰12+,U1A2B<@CD12EF12xQ¸1<A2?4t1>2+1<2TR12VU2B<@CD12EF12+U
 NGUYỄN TRỌNG NGỮ - ðịnh lượng một số loài vi khuẩn phân giải xơ trong dạ cỏ …

ðỊNH LƯỢNG MỘT SỐ LOÀI VI KHUẨN PHÂN GIẢI XƠ TRONG DỊCH DẠ CỎ CỦA
BÒ CHO ĂN CÁC KHẨU PHẦN KHÁC NHAU BẰNG KỸ THUẬT REAL-TIME PCR
Nguyễn Trọng Ngữ và Nguyễn Thị Hồng Nhân
Khoa Nông Nghiệp & Sinh Học Ứng Dụng, Trường ðại học Cần Thơ
Tác giả liên hệ: Nguyễn Trọng Ngữ, Tel: 0989828295, E-mail: ntngu@ctu.edu.vn
ABSTRACT
Quantification of cellulolytic bacteria in the rumen of cattle fed on different diets using real-time PCR
In this study, real-time PCR technique was used to quantify rumen cellulolytic bacteria species in sixteen Sindhi x
Yellow cattle allocated in a two by two factorial design (absence or presence of protozoa; 0.5% or 2% concentrate
supplement). Natural grass and rice straw were used as basal diet and a single dose of soybean oil was given to cattle
at 6 ml/kg live weight to eliminate rumen protozoa. Rumen samples were collected after 5, 30, 60 and 90 days of
defaunation and a similar sampling routine was done in cattle under undefaunated treatments. It was found that,
rumen protozoa reduced at day 5 and gradually recovered until day 90; in contrast, at day 5, an increased number of
total bacteria (2.89 x 1010 copies/ml) and Ruminococcus flavefaciens (10.4 x 105copies/ml) was noted. The number of
other bacteria species such as Fibrobacter succinogenes and Ruminococcus albus had a tendency to improve but no
significant difference was detected (P>0.05). In addition, the presence of bacteria in rumen of cattle fed low
concentrate supplementation was found to be higher than that in high concentrate supplementation, especially at day
60 and day 90 post defaunation. It can be concluded that real-time PCR can be applied to evaluate changes of rumen
cellulolytic bacteria and a combination of single oil dosing with 0.5% concentrate supplement is beneficial for cattle
consuming low quality diets in terms of increasing rumen cellulolytic bacteria.
ðẶT VẤN ðỀ
Theo Preston và Leng (1987), hệ vi sinh vật (VSV) dạ cỏ của gia súc nhai lại rất phức tạp bao
gồm ba nhóm chính là vi khuẩn, protozoa và nấm với hàng trăm loài khác nhau. Giữa các nhóm
này có mối quan hệ tương hỗ với nhau, trong ñó cấu trúc khẩu phần ăn có ảnh hưởng lớn ñến sự
tương tác của hệ VSV dạ cỏ. Thông thường, khẩu phần giàu dinh dưỡng sẽ không gây sự cạnh
tranh giữa các nhóm VSV, mặt cộng sinh có lợi có xu thế biểu hiện rõ; ngược lại, khẩu phần
nghèo dinh dưỡng sẽ gây ra sự cạnh tranh gay gắt giữa các nhóm, ức chế lẫn nhau, tạo khuynh
hướng bất lợi cho quá trình lên men thức ăn nói chung. Cho ñến nay ñã có nhiều công trình trong
nước sử dụng phương pháp ñếm truyền thống dưới kính hiển vi ñể ñánh giá tác ñộng của khẩu
phần và kỹ thuật loại bỏ protozoa ñến hệ vi khuẩn trong dạ cỏ của bò (Nhan và cs., 2003; Nhan
và cs., 2007; Nhan và cs., 2008; Trach và Thom., 2004). Tuy nhiên, các nghiên cứu trên ñều
dừng lại ở việc xác ñịnh số lượng VSV ở dạng tổng mà chưa quan tâm nhiều ñến sự thay ñổi về
số lượng của từng loài vi khuẩn, ñặc biệt là các loài phân giải xơ trong dạ cỏ. Chính vì vậy, việc
tìm kiếm một phương pháp khác hiện ñại hơn ñể ñịnh lượng VSV dạ cỏ là ñiều cần thiết, trong
ñó kỹ thuật real-time PCR ñã ñược chứng minh là phù hợp và ñã ñược sử dụng rộng rãi trên thế
giới (Kobayashi, 2006; McSweeney và Denman, 2007; Wanapat và Cherdthong, 2009) nhưng
cho ñến nay những báo cáo tương tự về việc ứng dụng kỹ thuật này trong nghiên cứu gia súc
nhai lại ở Việt Nam vẫn còn hạn chế. Trong nghiên cứu hiện tại, real-time PCR ñược sử dụng
ñể xác ñịnh số lượng của ba loài vi khuẩn phân giải xơ trong dạ cỏ của bò khi tiêu thụ các khẩu
phần khác nhau, kết quả thí nghiệm sẽ ñược tham khảo ñể ñiều chỉnh khẩu phần ăn cho bò
nhằm nâng cao hiệu quả chăn nuôi - ñặc biệt là trong giai ñoạn nuôi bò vỗ béo.

63
 VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi. Số 41 - Tháng 4/2013

VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU

ðịa ñiểm và thời gian thí nghiệm
ðề tài ñược thực hiện tại Trường ðại Học Cần Thơ và tỉnh An Giang từ tháng 9 ñến tháng 12
năm 2011.
Bố trí thí nghiệm
Thí nghiệm ñược tiến hành trên 16 bò lai Sind khối lượng từ 140-160 kg ñược chọn nuôi cá thể
và bố trí theo thể thức thừa số 2 nhân tố: uống và không uống dầu nành và 2 mức ñộ bổ sung thức
ăn hỗn hợp (TĂHH).
Mỗi nghiệm thức bao gồm 4 gia súc với cách bố trí thí nghiệm như sau:
Nghiệm thức 1: Khẩu phần cơ bản + 0,5% TĂHH + dầu nành
Nghiệm thức 2: Khẩu phần cơ bản + 2% TĂHH + dầu nành
Nghiệm thức 3: Khẩu phần cơ bản + 0,5% TĂHH + không dầu nành
Nghiệm thức 4: Khẩu phần cơ bản + 2% TĂHH + không dầu nành
Dầu nành: tất cả bò ñược làm quen với khẩu phần trong 21 ngày, sau ñó bò ở nghiệm thức 1 và 3
ñược cho uống dầu nành, uống một lần với liều lượng là 6 ml/kg khối lượng cơ thể ñể khử
protozoa.
Khẩu phần cơ bản là cỏ tự nhiên ñược cung cấp 2 lần trong ngày dựa trên mức ăn vào trong giai
ñoạn làm quen khẩu phần thí nghiệm. Rơm ñược ăn tự do vào buổi tối. TĂHH ñược cung cấp 2
lần trong ngày, mức ñộ bổ sung ñược tính trên khối lượng cơ thể. Thành phần TĂHH bao gồm
42% cám, 10% bột bắp, 25% khoai mì, 10% ñậu nành, 10% mật ñường, 2% urêa và 1% muối với
giá trị dinh dưỡng cuối cùng là 83,6% vật chất khô và 13,7% ñạm thô. Trong suốt thời gian thí
nghiệm, gia súc ñược nuôi nhốt hoàn toàn trong ô chuồng cá thể, khối liếm ñược gia súc tiếp cận
một cách tự do.
Phương pháp lấy mẫu và thu thập số liệu
Mẫu dịch dạ cỏ ñược thu thập tại các thời ñiểm 5, 30, 60 và 90 ngày sau khi uống dầu. Lấy dịch
dạ cỏ bằng ống thông thực quản lúc 6 giờ sáng trước khi cho bò ăn. ðối với những bò không
uống dầu, các thời ñiểm và qui trình lấy mẫu cũng ñược tiến hành tương tự. Dịch dạ cỏ sau ñó
ñược dùng ñể xác ñịnh các chỉ tiêu như pH, số lượng protozoa và số lượng vi khuẩn.
ðo pH: hút khoảng 20 - 30 ml dịch dạ cỏ cho vào bình tam giác, dùng pH kế Sibata ñể ño.
ðếm protozoa theo phương pháp truyền thống: lắc ñều dịch dạ cỏ trong bình tam giác, hút dịch
dạ cỏ cho vào 2 lọ penicillin, mỗi lọ 1 ml, pha với 4 ml dung dịch blue methylene. Sử dụng buồng
ñếm Malassez có ñộ dày 0,2 mm ñể ñếm, sử dụng vật kính 10 (Dehority, 1984).
ðịnh lượng vi khuẩn bằng kỹ thuật real-time PCR:
Tách chiết và tinh sạch ADN vi sinh vật từ dịch dạ cỏ: dịch dạ cỏ ñược xử lý ñể tách ADN theo
phương pháp dựa vào CTAB do Minas và cs. (2011) phát triển.

64
 NGUYỄN TRỌNG NGỮ - ðịnh lượng một số loài vi khuẩn phân giải xơ trong dạ cỏ …

Cặp mồi khuếch ñại vi khuẩn tổng số ñược dùng theo báo cáo của Denman và McSweeney
(2006); các cặp mồi ñặc hiệu cho những loài vi khuẩn phân giải xơ bao gồm Fibrobacter
succinogenes, Ruminococcus albus và Ruminococcus flavefaciens ñược sử dụng theo ñề nghị của
Koike và Kobayashi (2001).
Xây dựng ñường chuẩn: sử dụng các plasmid ADN ñược pha loãng ở các nồng ñộ từ 1010 ñến
101 bản sao/ml.
Thực hiện phản ứng real-time PCR: phản ứng khuếch ñại ñoạn gen ñặc hiệu ñược thực hiện trên
máy real-time PCR (Applied Biosystems). Hỗn hợp phản ứng bao gồm SYBR Green I Dye kit,
mồi xuôi, mồi ngược, nước cất tinh khiết và ADN. Chu trình nhiệt ñược ñiều chỉnh theo ñề nghị
trong nghiên cứu của Wanapat và Cherdthong (2009) và Skillman và cs. (2006).
Xử lý số liệu
Số liệu ñược xử lý theo mô hình tuyến tính tổng quát (General Linear Model) và ñược thực hiện
trên phần mềm Minitab 13.2. Sự khác biệt ý nghĩa của các giá trị trung bình trong và giữa các
nghiệm thức ñược xác ñịnh theo Tukey, với alpha < 0,05.
KẾT QUẢ VÀ THẢO LUẬN
pH dịch dạ cỏ
Bảng 1. Sự thay ñổi pH dịch dạ cỏ của bò thí nghiệm qua các thời ñiểm

Nhân tố Thời ñiểm lấy mẫu

Dầu nành TĂHH 5 ngày 30 ngày 60 ngày 90 ngày
Có - 6,65 6,91 6,59 6,88
Không - 6,44 6,82 6,53 6,69
SEM 0,09 0,06 0,05 0,21
P (Dầu nành) 0,10 0,34 0,39 0,53
- 0,5% 6,75 7,09 6,61 6,99
- 2,0% 6,34 6,64 6,50 6,57
SEM 0,09 0,06 0,05 0,21
P (TĂHH) 0,005 0,001 0,15 0,19
Có 0,5% 6,81 6,84b 6,4b 6,68
Có 2,0% 6,50 6,97b 6,78a 7,08
Không 0,5% 6,69 7,33a 6,83a 7,30
Không 2,0% 6,19 6,31c 6,22b 6,07
SEM 0,12 0,08 0,07 0,30
P (Dầu nành* TĂHH) 0,45 0,001 0,001 0,02
a,b
Các giá trị trong cùng một cột mang ít nhất một chữ ký hiệu chung thì không khác biệt ở P=0,05

65
 VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi. Số 41 - Tháng 4/2013

Sự thay ñổi pH dịch dạ cỏ ở thời ñiểm sau uống dầu ñược trình bày qua Bảng 1, các giá trị pH
của dịch dạ cỏ dao ñộng trong khoảng 6,07-7,33. Có sự khác biệt về pH ở khẩu phần bổ sung
TĂHH vào thời ñiểm 5 và 30 ngày sau khi uống dầu, trong ñó pH thấp hơn ở khẩu phần bổ sung
2% TĂHH (P<0,01).
Ở các khẩu phần có bổ sung mức cao TĂHH kết hợp với uống dầu hoặc không uống dầu ñều có
giá trị pH cao hơn khẩu phần bổ sung mức thấp TĂHH cũng như bò ñược uống dầu hay không
uống dầu qua các thời ñiểm thí nghiệm. Tuy nhiên, việc cho bò uống dầu ở mức 6 ml/kg khối
lượng không làm ảnh hưởng nhiều ñến giá trị pH so với bò không uống dầu. Giá trị pH thu ñược
trong thí nghiệm phù hợp với ñề nghị của Van Soest (1994) cho rằng pH dịch dạ cỏ trong khoảng
6,7 ± 0,5 là thích hợp ñể duy trì phân giải xơ và tổng hợp protein vi khuẩn. Theo Wanapat và
Khampa (2006), pH dịch dạ cỏ chỉ khác biệt giữa các khẩu phần và không bị ảnh hưởng khi bò
ñược cho uống dầu cọ. Khi nuôi gia súc nhai lại với khẩu phần cơ bản là cỏ khô thì pH dịch dạ cỏ
thường ñược duy trì ở mức ñộ tương ñối ổn ñịnh trong khoảng 6,7-7,2 (Preston và Leng, 1987).
Kết quả thí nghiệm của Âu Thị Ánh Nguyệt (2001) khi bò ăn cỏ tươi thì pH dịch dạ cỏ cũng dao
ñộng từ 6,8-7,0.
Protozoa dịch dạ cỏ
Có nhiều phương pháp ñể loại bỏ protozoa trong dịch dạ cỏ của bò như (i) tách con ra khỏi mẹ
sau khi sinh và không cho chúng tiếp xúc với ñộng vật nhai lại khác (Akkada và El-Shazly,
1964); (ii) làm rỗng dạ cỏ và xử lý chất chứa ñựng trong dạ cỏ trước khi chúng ñược thay thế
(Jouany và Senaud, 1979) và (iii) ñưa hóa chất vào dạ cỏ của ñộng vật trưởng thành bằng ống
thông thực quản hoặc bằng ống xuyên dạ cỏ, trong ñó những thí nghiệm cho thấy các loại dầu
nành (Van Nevel và Demeyer, 1995), dầu phộng (Nhan và cs., 2001), hạt dầu hướng dương (Ivan
và cs., 2001), dầu dừa (Machmuller et al., 2003) và dầu cọ (Wanapat và Khampa, 2006) có thể
xem như là tác nhân khử protozoa một cách hiệu quả.
Trong nghiên cứu hiện tại, dầu nành ñược dùng ñể loại bỏ protozoa và sự thay ñổi số lượng
protozoa trong dịch dạ cỏ bò ñược trình bày qua Bảng 2. Sau khi bò uống dầu 5 ngày, số lượng
protozoa giảm một cách ñáng kể (4,86 x 105/ml so với 0,88 x 105/ml) (P<0,01). Ở giai ñoạn tiếp
theo, protozoa hồi phục dần và không có sự khác biệt giữa 2 nghiệm thức dầu và không dầu vào
thời ñiểm 60 ngày. Bên cạnh ñó, bò ăn khẩu phần cao và thấp TĂHH không có sự khác biệt lớn
về sự hiện diện của protozoa trong dạ cỏ, và chỉ khác biệt có ý nghĩa ở giai ñoạn 5 ngày sau uống
dầu (P<0,05). Sự khác biệt tương tự cũng ñược tìm thấy trong phân tích tương tác của 2 nhân tố
dầu nành và TĂHH.
Có nhiều yếu tố ảnh hưởng ñến sự tập trung và thành phần của protozoa trong dạ cỏ của bò,
những yếu tố này bao gồm thành phần của thức ăn, pH dạ cỏ, tần suất và mức ñộ cho ăn. Một số
nghiên cứu trước ñây cho thấy khi khẩu phần chứa từ 40-60% TĂHH sẽ thúc ñẩy sự phát triển
mạnh về số lượng và tính ña dạng loài của protozoa (Dehority và Orpin, 1988). Kết quả này ủng
hộ các công bố trước ñây cho rằng sự tập trung của protozoa sẽ nhiều hơn khi gia tăng mức ñộ bổ
sung TĂHH trong khẩu phần (Varel và Dehority, 1989; De Smet và cs., 1992).

66
 NGUYỄN TRỌNG NGỮ - ðịnh lượng một số loài vi khuẩn phân giải xơ trong dạ cỏ …

Bảng 2. Số lượng protozoa (x 105/ml) qua các thời ñiểm thí nghiệm

Nhân tố Thời ñiểm sau uống dầu

Dầu nành TĂHH 5 ngày 30 ngày 60 ngày 90 ngày
Có - 0,88 2,24 4,40 7,54
Không - 4,86 5,76 5,23 7,34
SEM 0,28 0,79 0,53 1,36
P (Dầu nành) 0,001 0,013 0,302 0,920
- 0,5% 3,50 4,71 4,72 5,93
- 2,0% 2,24 3,29 4,91 8,96
SEM 0,28 0,79 0,53 1,36
P (TĂHH) 0,014 0,239 0,802 0,154
b
Có 0,5% 0,93 2,47 4,17 5,21
Có 2,0% 0,83b 2,01 4,63 9,88
Không 0,5% 3,55b 4,11 5,23 6,65
Không 2,0% 6,17a 7,40 5,20 8,04
SEM 0,40 1,11 0,76 1,92
P (Dầu nành* TĂHH) 0,010 0,132 0,737 0,418
a,b
Các giá trị trong cùng một cột mang ít nhất một chữ ký hiệu chung thì không khác biệt ở P=0,05
Số lượng vi khuẩn dịch dạ cỏ
Vi khuẩn tổng số:
Sự thay ñổi về số lượng vi khuẩn tổng số trong dạ cỏ ñược trình bày qua Bảng 3. Một cách tổng
quát, ở thời ñiểm 5 ngày sau khi uống dầu số lượng vi khuẩn tăng một cách có ý nghĩa (P<0,01) ở
nghiệm thức có uống dầu (2,89 x 1010/ml so với 1,81 x 1010/ml). Ở những giai ñoạn tiếp theo, số
lượng vi khuẩn tổng vẫn có khuynh hướng cao hơn ở nghiệm thức có uống dầu, tuy nhiên sự khác
biệt này không có ý nghĩa thống kê (P>0,05). Bên cạnh ñó, khẩu phần cũng có những tác ñộng
nhất ñịnh trên số lượng vi khuẩn tổng, theo ñó bò ăn khẩu phần thấp TĂHH có số lượng vi khuẩn
tổng cao hơn bò ở khẩu phần cao TĂHH, ñặc biệt là ở giai ñoạn 60 ngày và 90 ngày của thí
nghiệm (P<0,05). Dầu và khẩu phần chỉ tương tác có ý nghĩa ñến số lượng vi khuẩn tổng ở thời
ñiểm 5 ngày sau uống dầu. Sự gia tăng số lượng vi khuẩn tổng trong thí nghiệm hiện tại cũng phù
hợp với nhiều nhận ñịnh trước ñây cho rằng protozoa tiêu thụ vi khuẩn như là một nguồn nitơ và
acid nucleic (Eadie và Gill, 1971; Kurihara và cs., 1978). Tuy nhiên, sự tiêu thụ vi khuẩn bởi
protozoa không phải là ngẫu nhiên, các loài vi khuẩn dạ cỏ có thể ñược ñiều chỉnh thông qua sự
khử protozoa (Itabashi và Katada, 1976). Vì vậy, thay ñổi về tiêu hóa và lên men trong dạ cỏ từ

67
 VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi. Số 41 - Tháng 4/2013

việc khử protozoa có thể ñược giải thích là do thay ñổi về phân bố loài vi khuẩn trong dạ cỏ và
những ảnh hưởng trực tiếp do sự vắng mặt của protozoa.
Bảng 3. Số lượng vi khuẩn tổng số (x 1010/ml) qua các thời ñiểm

Nhân tố Thời ñiểm lấy mẫu

Dầu nành TĂHH 5 ngày 30 ngày 60 ngày 90 ngày
Có - 2,89 1,79 3,12 2,18
Không - 1,81 1,39 2,25 2,16
SEM 0,20 0,35 0,43 0,57
P (Dầu nành) 0,005 0,451 0,188 0,972
- 0,5% 2,62 1,98 3,49 3,34
- 2,0% 2,08 1,21 1,88 1,00
SEM 0,20 0,35 0,43 0,57
P (TĂHH) 0,089 0,160 0,029 0,019
a
Có 0,5% 2,78 2,35 4,54 3,26
a
Có 2,0% 3,00 1,23 1,70 1,11
a
Không 0,5% 2,47 1,61 2,44 3,43
b
Không 2,0% 1,15 1,18 2,06 0,89
SEM 0,28 0,50 0,60 0,80
P (Dầu nành* TĂHH) 0,026 0,506 0,076 0,814

Vi khuẩn Fibrobacter succinogenes:

Bảng 4 trình bày sự thay ñổi số lượng vi khuẩn F. succinogenes tại các thời ñiểm thí nghiệm. Ở
30 ngày ñầu của thí nghiệm, cả 2 nhân tố dầu và khẩu phần không có tác ñộng ñáng kể nào ñến
sự hiện diện của loài vi khuẩn phân giải xơ này nhưng ñến thời ñiểm 60 và 90 ngày, bò ăn khẩu
phần TĂHH thấp có số lượng vi khuẩn F. succinogenes cao hơn bò trong nghiệm thức còn lại
(P<0,05).
Vi khuẩn Ruminococcus albus:
Sự thay ñổi về số lượng vi khuẩn R. albus trong dịch dạ cỏ của bò qua các khẩu phần ñược thể
hiện qua Bảng 5. Bò uống dầu nành không có sự khác biệt về số lượng loài R. albus qua các thời
ñiểm, trong khi ñó khẩu phần thấp TĂHH dẫn ñến việc gia tăng loài này nhưng sự gia tăng này
không mang tính ñồng bộ và chỉ xảy ra ở thời ñiểm 30 ngày sau uống dầu (11,60 x 106/ml so với
0,40 x 106/ml). Cũng tại thời ñiểm này, số lượng loài R. albus cũng bị ảnh hưởng bởi sự tương tác

68
 NGUYỄN TRỌNG NGỮ - ðịnh lượng một số loài vi khuẩn phân giải xơ trong dạ cỏ …

của 2 nhân tố thí nghiệm, theo ñó số lượng cao nhất ở khẩu phần có cho uống dầu và mức TĂHH
thấp (1,70 x 106/ml).
Vi khuẩn Ruminococcus flavefaciens:
ðối với loài vi khuẩn R. flavefaciens, ảnh hưởng của dầu nành thể hiện rõ rệt ở thời ñiểm 5 ngày
với số lượng cao hơn ở bò có uống dầu (10,37 x 105/ml so với 3,77 x 105/ml) (Bảng 6). Tại thời
ñiểm này, các tỷ lệ khác nhau của TĂHH cũng có vai trò làm thay ñổi sự hiện diện của loài vi
khuẩn R. flavefaciens (P<0,01). Ngoài ra, các yếu tố tương tác không mang lại sự khác biệt về số
lượng vi khuẩn R. flavefaciens tại tất cả các thời ñiểm khảo sát.
Bảng 4. Số lượng vi khuẩn F. succinogenes (x 107/ml) qua các thời ñiểm
Nhân tố Thời ñiểm lấy mẫu
Dầu nành TĂHH 5 ngày 30 ngày 60 ngày 90 ngày
Có - 13,02 3,67 7,61 1,83
Không - 8,72 2,23 4,73 2,83
SEM 3,05 0,95 2,57 0,66
P (Dầu nành) 0,348 0,315 0,451 0,319
- 0,5% 12,70 3,04 10,82 3,44
- 2,0% 9,03 2,86 1,52 1,22
SEM 3,05 0,95 2,57 0,66
P (TĂHH) 0,419 0,897 0,034 0,046
Có 0,5% 13,10 5,10 12,90 1,71ab
Có 2,0% 12,93 2,23 2,32 1,95ab
Không 0,5% 12,30 0,97 8,74 5,16a
Không 2,0% 5,14 3,49 0,72 0,49b
SEM 4,31 1,34 3,63 0,94
P (Dầu nành* TĂHH) 0,440 0,080 0,734 0,031
Bảng 5. Số lượng vi khuẩn R. albus (x 106/ml) qua các thời ñiểm
Nhân tố Thời ñiểm lấy mẫu
Dầu nành TĂHH 5 ngày 30 ngày 60 ngày 90 ngày
Có - 6,33 0,94 2,55 0,063
Không - 3,61 0,61 2,57 0,082
SEM 1,88 0,18 0,60 0,024
P (Dầu nành) 0,339 0,234 0,982 0,615
- 0,5% 3,79 11,60 1,72 0,063
- 2,0% 6,15 0,40 3,40 0,082
SEM 1,88 0,18 0,60 0,024
P (TĂHH) 0,402 0,018 0,083 0,605

69
 VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi. Số 41 - Tháng 4/2013

Có 0,5% 2,13b 1,70a 1,40 0,020

Có 2,0% 10,53a 0,19b 3,70 0,11
Không 0,5% 5,45b 0,62b 2,04 0,11
Không 2,0% 1,77b 0,60b 3,10 0,06
SEM 2,67 0,26 0,85 0,034
P (Dầu nành* TĂHH) 0,054 0,020 0,487 0,083

Bảng 6. Số lượng vi khuẩn R. flavefaciens (x 105/ml) qua các thời ñiểm

Nhân tố Thời ñiểm lấy mẫu
Dầu nành TĂHH 5 ngày 30 ngày 60 ngày 90 ngày
Có - 10,37 1,44 5,91 9,15
Không - 3,77 3,86 7,83 8,80
SEM 1,40 1,49 2,50 1,88
P (Dầu nành) 0,010 0,282 0,601 0,897
- 0,5% 10,48 3,83 5,70 14,44
- 2,0% 3,66 1,47 8,05 3,50
SEM 1,40 1,49 3,53 1,88
P (TĂHH) 0,009 0,295 0,524 0,003
Có 0,5% 15,13 2,68 5,32 15,07
Có 2,0% 5,62 0,20 6,50 3,24
Không 0,5% 5,83 4,98 6,07 13,83
Không 2,0% 1,71 2,75 9,60 3,77
SEM 1,98 2,10 6,18 3,08
P (Dầu nành* TĂHH) 0,210 0,953 0,564 0,748
Mặc dù ñã có nhiều nghiên cứu trong hơn 50 năm qua, nhưng cơ chế tác ñộng về sự vắng mặt của
protozoa trên khả năng phân giải xơ vẫn chưa ñược sáng tỏ. Một cách chung nhất, loại bỏ
protozoa làm tăng số lượng vi khuẩn và có sự dịch chuyển về số lượng của các nhóm vi khuẩn,
bao gồm các loài phân giải xơ (Williams và Withers, 1993). Thêm vào ñó, cũng có nhiều bằng
chứng cho thấy hoạt ñộng polysaccharide hóa cũng ñược cải thiện trên dạ cỏ của thú không có
protozoa (Santra và Karim, 2002). Mục tiêu của thí nghiệm hiện tại là xem việc loại bỏ protozoa
có ảnh hưởng như thế nào ñến sự hiện diện của một số vi khuẩn ñược xem là các loài phân giải
xơ chính như: F. succinogenes, R. albus và R. flavefaciens. Kết quả cho thấy, sự hiện diện của
các loài này không phải lúc nào cũng tuân theo một qui luật nhất ñịnh. ðiều này phù hợp với
nhận ñịnh của Mosoni và cs. (2011) cho rằng rất có thể có nhiều loài vi sinh vật phân giải xơ khác
nữa trong dạ cỏ chưa ñược biết ñến. Trước ñó, Cai và cs. (2010) ñã xác ñịnh một loài vi khuẩn
mới (loài Cellulosilyticum ruminicola) có tiềm năng phân giải xơ cao trong dạ cỏ của nhóm bò

70
 NGUYỄN TRỌNG NGỮ - ðịnh lượng một số loài vi khuẩn phân giải xơ trong dạ cỏ …

Tây tạng. ðây có thể là hướng nghiên cứu trong tương lai cùng với hướng nghiên cứu về các loài
vi khuẩn chức năng khác ñáp ứng với sự loại bỏ protozoa.
KẾT LUẬN VÀ ðỀ NGHỊ
Có thể xác ñịnh ñược sự thay ñổi của các nhóm VSV trong hệ VSV dạ cỏ của bò tiêu thụ các loại
khẩu phần khác nhau bằng kỹ thuật real-time PCR.
Bò uống dầu có sự gia tăng số lượng của hầu hết các loài vi khuẩn khảo sát, ñặc biệt là loài R.
flavefaciens ở thời ñiểm 5 ngày. Bên cạnh ñó, bò ăn khẩu phần 0,5% TĂHH có số lượng vi khuẩn
nhiều hơn nhóm bò trong nghiệm thức 2,0% TĂHH, ngoại trừ loài R. albus có xu hướng tăng
giảm không rõ ràng.
Xét về số lượng một số loài vi khuẩn phân giải xơ trong dạ cỏ, việc kết hợp cho bò uống dầu và
bổ sung 0,5% TĂHH trong khẩu phần mang lại hiệu quả cao nhất.
TÀI LIỆU THAM KHẢO
Âu Thị Ánh Nguyệt. 2001. So sánh tác dụng của xác mì, xác mì có xử lý với cỏ tươi và rơm có hoặc không xử lý urê ñối với
môi trường dạ cỏ của bò. Luận văn thạc sĩ chăn nuôi, ðại Học Cần Thơ.
Akkada, A. R. A. El-Shazly, K. 1964. Effect of absence of ciliate protozoa from the rumen on microbial activity and growth of
lambs. Appl. Microbiol. 12: 384-390.
Cai, S., Li, J., Hu, F. Z., Zhang, K., Luo, Y., Janto, B., Boissy, R., Ehrlich, G. and Dong, X. 2010. Cellulosilyticum ruminicola,
a newly described rumen bacterium that possesses redundant fibrolytic-protein-encoding genes and degrades
lignocellulose with multiple carbohydrate-borne fibrolytic enzymes. Appl. Environ. Microbiol. 76: 3818-3824.
De Smet S., Demeyer D. and Van Nevel, C. 1992. Effect of defaunation and hay: concentrate ratio on fermentation, fibre
digestion and passage in the rumen of sheep. Anim. Feed Sci. Technol. 37: 333-344.
Dehority, B. A. and Orpin, C. 1988. Development of, and natural fluctuations in, rumen microbial populations. In The Rumen
Microbial Ecosystem 2nd edn. (Eds P. N. Hobson and C. S. Stewart), London Blackie Academic and Professional, pp
151-183.
Dehority, B. A. 1984. Evaluation of subsampling and fixation procedurês used for counting rumen protozoa. Appl. Environ.
Microbiol. 48: 182-185.
Denman, S. E. and McSweeney, C. S. 2006. Development of a real-time PCR assay for monitoring anaerobic fungal and
cellulolytic bacterial populations within the rumen. FEMS Microbiol. Ecol. 58: 572-582.
Eadie, J. M. and Gill, J. 1971. The effect of the absence of rumen ciliate protozoa on growing lambs fed on a roughage-
concentrate diet. Br. J. Nutr. 26: 155-167.
Itabashi, H. and Katada, A. 1976. Studies on nutritional significance of rumen ciliate protozoa in cattle, 2: Influence of
protozoa on amino acid concentrations in some rumen fractions and blood plasma. Bulletin of the Tohoku National
Agricultural Experiment Station.
Ivan, M., Mir, P., Koenig, K., Rode, L., Neill, L., Entz, T. and Mir, Z. 2001. Effects of dietary sunflower seed oil on rumen
protozoa population and tissue concentration of conjugated linoleic acid in sheep. Small Ruminant Res. 41: 215-227.
Jouany, J. and Senaud, J. 1979. Role of rumen protozoa in the digestion of food cellulosic materials. Ann. Rech. Vet. 10: 261-
263.
Kobayashi, Y. 2006. Inclusion of novel bacteria in rumen microbiology: need for basic and applied science. Anim. Sci. J. 77:
375-385.

71
 VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi. Số 41 - Tháng 4/2013

Koike, S. and Kobayashi, Y. 2001. Development and use of competitive PCR assays for the rumen cellulolytic bacteria:
Fibrobacter succinogenes, Ruminococcus albus and Ruminococcus flavefaciens. FEMS Microbiol. Lett. 204: 361-
366.
Kurihara, Y., Takechi, T. and Shibata, F. 1978. Relationship between bacteria and ciliate protozoa in the rumen of sheep fed
on purified diet. J. Agr. Sci. 90: 373-381.
Machmuller, A., Soliva, C. R. and Kreuzer, M. 2003. Effect of coconut oil and defaunation treatment on methanogenesis in
sheep. Reprod. Nutr. Dev. 43: 41-56.
McSweeney, C. S. and Denman, S. E. 2007. Effect of sulfur supplements on cellulolytic rumen micro-organisms and
microbial protein synthesis in cattle fed a high fibre diet. J. Appl. Microbiol. 103: 1757-1765.
Minas, K., McEwan, N. R., Newbold, C. J. and Scott, K. P. 2011. Optimization of a high‐throughput CTAB‐based
protocol for the extraction of qPCR‐grade DNA from rumen fluid, plant and bacterial pure culture. FEMS
Microbiol. Lett. 325: 162-169.
Mosoni, P., Martin, C., Forano, E. and Morgavi, D. 2011. Long-term defaunation increases the abundance of cellulolytic
ruminococci and methanogens but does not affect the bacterial and methanogen diversity in the rumen of sheep. J.
Anim. Sci. 89: 783-791.
Nhan, N. T. H., Ngu, N. T., Thiet, N., Preston, T. R. and Leng, R. A. 2007. Determination of the optimum level of a soybean
oil drench with respect to the rumen ecosystem, feed intake and digestibility in cattle. Livestock Research for Rural
Development 19, Article # 117, http://www.lrrd.org/lrrd19/18/ nhan19117.htm.
Nhan, N. T. H., Ngu, N. T., Preston, T. R. and Leng, R. A. 2008. Effects of drenching soybean oil and fish oil on intake,
digestibility and performance of cattle fattening in the Mekong Delta, Vietnam. Livestock Research for Rural
Development 20, Article #113, http://www.lrrd.org/lrrd20/7/nhan20113.htm.
Nhan, N. T. H., Hon, N. V., Ngu, N. T., Hong, N. T. T., Preston, T. R. and Leng, R. 2003. Effect of drenching with cooking
oil on performance of local" Yellow" cattle fed rice straw and cassava foliage. Livestock Research for Rural
Development 15, http://www.lrrd.org/lrrd15/7/nhan157.htm.
Nhan, N. T. H., Hon, N. V., Ngu, N. T., Von, N. T., Preston, T. and Leng, R. 2001. Practical application of defaunation of
cattle on farms in Vietnam: response of young cattle fed rice straw and grass to a single drench of groundnut oil.
Asian Australas. J. Anim. Sci. 14: 485-490.
Preston, T. R. and Leng, R. A. 1987. Matching ruminant production systems with available resources in the tropics and
subtropics, Penambul Books Ltd: Armidale NSW, Australia.
Santra, A. and Karim, S. 2002. Influence of ciliate protozoa on biochemical changes and hydrolytic enzyme profile in the
rumen ecosystem. J. Appl. Microbiol. 92: 801-811.
Skillman, L. C., Toovey, A. F., Williams, A. J. and Wright, A. D. G. 2006. Development and validation of a real-time PCR
method to quantify rumen protozoa and examination of variability between Entodinium populations in sheep offered
a hay-based diet. Appl. Environ. Microbiol. 72: 200-206.
Trach, N. X. and Thom, M. T. 2004. Responses of growing beef cattle to a feeding regime combining road side grazing and
rice straw feeding supplemented with urea and brewers' grains following an oil drench. Livestock Research for Rural
Development 16, http://www.lrrd.org/lrrd16/7/trach16053.htm.
Van Nevel, C. and Demeyer, D. 1995. Lipolysis and biohydrogenation of soybean oil in the rumen in vitro: inhibition by
antimicrobials. J. Dairy Sci. 78: 2797-2806.
Varel, V. H. and Dehority, B. A. 1989. Ruminal cellulolytic bacteria and protozoa from bison, cattle-bison hybrids, and cattle
fed three alfalfa-corn diets. Appl. Environ. Microbiol. 55: 148-153.
Wanapat, M. and Cherdthong, A. 2009. Use of real-time PCR technique in studying rumen cellulolytic bacteria population as
affected by level of roughage in swamp buffalo. Curr. Microbiol. 58: 294-299.

72
 ISSN: 2276-7770 Impact Factor 2012 (UJRI): 0.7904 ICV 2012: 6.15

Single Nucleotide
Polymorphisms in Gh,
Ghr, Ghsr and Insulin
Candidate Genes in
Chicken Breeds of
Vietnam
By

Do Vo Anh Khoa
Nguyen Thi Kim Khang
Nguyen Trong Ngu
Joseph Matey
Huynh Thi Phuong Loan
Nguyen Thi Dieu Thuy
Greener Journal of Agricultural Science ISSN: 2276-7770 Vol. 3 (10), pp. 716-724, October 2013.

Research Article

Single Nucleotide Polymorphisms in Gh, Ghr, Ghsr

and Insulin Candidate Genes in Chicken Breeds of
Vietnam
1*
Do Vo Anh Khoa, 2Nguyen Thi Kim Khang, 2Nguyen Trong Ngu,
3
Joseph Matey, 4Huynh Thi Phuong Loan, 5Nguyen Thi Dieu Thuy
1
Department of Animal Sciences, College of Agriculture and Applied Biology, Can Tho University, Vietnam.
2
Department of Agricultural Breeding and Genetics, College of Agriculture and Applied Biology, Can Tho University,
Vietnam.
3
Laboratory for Animal Production and Animal Product Quality, Ghent University, Belgium.
4
Department of Food Technology, College of Agriculture and Applied Biology, Can Tho University, Vietnam.
5
Institute of Biotechnology, Academy of Science and Technology, Vietnam.

*Corresponding Author’s Email: dvakhoa@ctu.edu.vn, Tel: +84-918026653, Fax: +84-7103-830814

ABSTRACT

The aim of this study is to evaluate genetic potential in chicken breeds raised in Vietnam. They include local chicken
breeds (Noi and Tau Vang giving good health and meat quality traits but they are not intensively studied yet) and a
commercial breed (Cobb 500 giving high growth performance and meat yield in industrial poultry production system in
the world, including Vietnam). Therefore, candidate genes GH, GHR, GHSR and insulin related to these traits were
investigated for identifying their single nucleotide polymorphisms by using PCR-RFLP method across different
populations of chicken. The results provide basic foundation to continuously study the effects of genetic
polymorphisms in the candidate genes on performance and meat quality traits of local Vietnamese chickens.

Keywords: Genetic variation, Candidate genes, Chicken, Vietnam.

INTRODUCTION

Most economic traits in farm animals show continuous variation and the fundamental genetic nature is very complex
(Li et al., 2010). The application of genetic selection methods in the poultry industry has resulted in increased growth
rate and carcass quality (Zhou et al., 2005). However, as a consequence, there has been incidence of health related
problems such as obesity, sudden death syndrome, immunosuppression and leg problems (Kadlec et al., 2011).
Molecular markers related with one or more sets of traits may be helpful to concurrently improve production and
health (Zhou et al., 2005). The use of molecular marker-assisted selection has proven to be efficient and lead to the
improvement in production performance in animals (Li et al., 2008). Single nucleotide polymorphisms (SNPs), a type
of DNA polymorphism which is bi-allelic but extensively distributed along the chicken genome has gained interest
recently and the reason for this has been indicated by Beuzen et al. (2000).
The genes of somatotropic axis play a crucial role in chicken growth and development (Nie et al., 2005). The
axis consists of essential components such as growth hormone (GH), insulin-like growth factors (IGF –I and II), their
associated carrier proteins and receptors and other hormones such as insulin, leptin and thyroid hormones (Kadlec
et al., 2011; Nie et al., 2005). Studies have shown that variation exists among these genes and this could function as
candidates for the evaluation of their effects on chicken growth and development (Lei et al., 2007). Results from
previous researches have revealed that SNPs of the somatotropic axis genes affect growth traits considerably (Nie et
al., 2005; Qui et al., 2006; Lei et al., 2005).
The purpose of this study was to identify SNPs in insulin, GH, growth hormone receptor (GHR) and growth
hormone secretagogue receptor (GHSR) genes in local chicken breeds of Vietnam.

www.gjournals.org 716
Greener Journal of Agricultural Science ISSN: 2276-7770 Vol. 3 (10), pp. 716-724, October 2013.

MATERIALS AND METHODS

1.1. Chicken Populations

This study used the three populations of chicken: Tau Vang with two different strains (CTU-LA01, n=84 and CTU-
BT01, n=68), Noi (n=38) and Cobb 500 (n=32). The Tau Vang and Noi chicken represent Vietnamese local breeds
with the characteristics of slow growth rate, low reproduction performance, high immune response and good meat
quality traits, while the Cobb 500 with fast growth rate and improved feed conversion efficiency is a commercial
breed commonly raised at industrial chicken farms in Vietnam nowadays.

2.2. DNA extraction

Genomic DNA samples were extracted from thigh/breast muscle tissues of all chickens from the three different
populations using Phenol-chloroform extraction technique (Wickramaratne et al., 2010) with minor modifications.
Briefly, muscle samples from chicken were chopped into smaller pieces to aid in the digestion process. Then, 700 µl
of digestion buffer, 70 µl of Sodium dodecyl sulfate (SDS) 10% and 18 µl of Proteinase K were pipetted into the 2ml
Eppendorf tubes. In addition, 60-100mg of chopped muscle sample was added to the solution in the tube and the
content was mixed on a vortex mixer and incubated overnight at 37oC. 700µl of phenol: chloroform (1:1v/v) was
added the next day, mixed and centrifuged at 10.000 X g for 10 minute. Supernatant was recovered into a new clean
tube. 700µl of Isopropanol and 70µl of Sodium Acetate (3M NaOAc) was added and centrifuged at 10.000 X g for 5
minutes. The supernatant was discarded after centrifugation and 1ml of 70% Ethanol was added to the tube to wash
the DNA pellet. It was then centrifuged at 10.000 X g for 5 minutes. The supernatant was discarded and DNA pellet
was air-dried, after which 500µl of TE 1x buffer (pH8.0) was added and mixed gently by hand to dissolve the DNA
and incubated at 37oC for 12 – 24 hours and to be measured for the DNA concentration. A dilution of the stock DNA
was done to the working concentration of 50ng/µl to be used for polymerase chain reaction (PCR) analysis.

2.3 Establishment of a PCR-RFLP assay

Polymerase chain reaction was performed in a total volume of 10 µL, containing 1 µL Buffer, 1µL MgCl2, 0.20 µL Taq
polymerase, 0.25µL dNTP, 0.25µL of allele specific primer and 2µL of DNA. The PCR conditions were 94oC for 3 min
to activate DNA polymerase, followed by 35 cycles of 94oC for 30s, annealing temperatures ranged between 58oC
and 62oC for 30s, 72oC for 30s and a final extension of 72oC for 5min, and 4oC preservation. The PCR products were
amplified by electrophoresis with 2% agarose gel at 110V, 400mA for 15min after which banding pattern was
observed under UV light. Then, the products were digested overnight in an incubator at 37oC with 10 µl of restriction
enzyme. The digestion products were electrophoresed at 80 Volt for 30 min on 3% agarose gel. The PCR-RFLP
(restricted fragment length polymorphism) fragment sizes were determined by visualizing the banding pattern under
ultraviolet light.
This study was subjected to screen SNPs at loci G662A (intron 1, MspI), T3094C (intron 4, MspI) and
C3199T (intron 4, MspI) in GH gene (Nie et al., 2005), G565A (Eco72I, intron 5) in GHR gene (Nie et al., 2005),
G656A (exon 1, MspI) and C3678T (Bsp119I, exon 2) in GHSR gene (Nie et al., 2005), and C1549T (intron 2, MspI),
T3737C (intron 2, MspI), and A3971G (3’ UTR, MspI) in insulin gene (Nie et al., 2005) in three different populations
of chicken.

www.gjournals.org 717
Greener Journal of Agricultural Science ISSN: 2276-7770 Vol. 3 (10), pp. 716-724, October 2013.

Table 1. Details of primers used for the SNP identification.

Primer/locus Sequence (5’-3’) GenBank Length Annealing temperature Restriction
o
(bp) ( C) enzyme
GH1 Fw: aacatcctccccaacctttc AY461843 466 60 Mspl
Re: ccctgtcaaggttaggctca

GH2,3 Fw: gcactgagggacgtggttat AY461843 563 60 MspI

Re:ggcctctgagatcatggaac

GHR Fw: aacatctgcagagtcgggata AJ506750 707 60 Eco72I

Re: ccatgggatcccagtttgact

GHSR1 Fw: gtcgcctgcgtcctcctctt AB095994 533 59 Mspl

Re: acgggcaggaaaaagaagatg

GHSR2 Fw: tgttgaaaaagagagaatgct AB095994 598 60 Bsp119l

Re: ccacacgtctccttttatattc

Insulin1 Fw: tgttctgcatttggcccatac AY438372 529 60 Mspl

Re: cagaatgtcagctttttgtcc

Insulin2 Fw: ctccatgtggcttccctgta AY438372 571 60 Mspl

Re: ggcttcttggctagttgcagt

Insulin3 Fw: ggtatctgaaaagcgggtctc AY438372 281 60 Mspl

Re: aatgctttgaaggtgcgatag

2.4 Genotype analysis

Allelic and genotypic frequencies of the candidate genes in two local chicken breeds in Vietnam and a commercial
breed were analyzed. The Hardy-Weinberg equilibrium (HWE) was estimated using SNPStats (Solé et al., 2006)
(http://bioinfo.iconcologia.net/index.php).

RESULTS

Single nucleotide polymorphisms with various genotype and allele frequencies were identified at nucleotides
C1549T, T3737C, and A3971G in the insulin gene, at nucleotides G662A, T3094C, and C3199T in the GH gene, at
nucleotides G656A and C3678T in the GHSR gene as well as at nucleotide G565A in the GHR gene in the different
populations of chicken (Table 2).

www.gjournals.org 718
Greener Journal of Agricultural Science ISSN: 2276-7770 Vol. 3 (10), pp. 716-724, October 2013.

M AA AA AA AG AG GG AG AA AA AA GG

240
GH gene:
226 G662A
125
115

M TT CT CT CT TT CT CT TT CT TT CT CC TT
CC TT TT TT TT CT CT TT CT TT TT TT CT
563bp GH gene:
357bp
311bp T3094C and
252bp C3199T
206bp

M AG AA AG AG AA AA AA AA AG GG GG GG

707bp GHR gene:

589bp
G565A

118bp

M AG GG AG GG GG GG GG GG GG GG GG AG

460bp GHSR gene:

355bp
G656A

105bp
73bp

M CT CC CC CC CC CC CC CT CC

598bp
GHSR gene:
426bp
C3678T
172bp

M CT CT CT CT CT CC CT CT CC TT TT CT

529bp Insulin gene:

448bp C1549T

81bp

www.gjournals.org 719
Greener Journal of Agricultural Science ISSN: 2276-7770 Vol. 3 (10), pp. 716-724, October 2013.

M TT TT TT CC CT CC TT

372bp Insulin gene:

234bp T3737C
138bp

AA AA AA AA AG GG AG AG AG AG
Insulin gene:
281bp A3971G (3’
233bp
UTR)

48bp

Figure 1: Digestion of restriction enzymes at loci of the candidate genes

At GH1, three genotypes AA, AG and GG were detected. The AA genotype frequency of the Cobb 500 breed was
higher (0.56) compared to the other local breeds. However, the CTU-BT01 strain of the Tau breed had the highest
frequency for genotype AG (0.53). The highest frequency for GG was observed in the Noi breed (0.34).
At the loci GH2 and GH3, the genotypes CC, CT and TT were observed. The Noi breed did not show any
genotype frequency for the CC genotype but showed a highest genotype frequency for the TT genotype relative to
the breeds for the GH2 locus. However, all breeds showed more than 50% genotype frequency for the TT genotype.
At the GH3 locus, high genotype frequencies for the homologous genotype TT was observed for all breeds with Cobb
500 showing 100% frequency but no frequency for the CC and CT genotype. At the GHR locus, genotypes AA, AG
and GG were observed with genotype AA recording high genotype frequencies for all the breeds. The highest
frequency (100%) was observed for the Noi breed but there were no genotype frequencies for AG and GG. The
genotype frequencies for the AA genotype were higher in the local breeds than in the commercial breed.
At the GHSR locus, two groups GHSR1 and GHSR2 with genotypes AA, AG and GG; and CC, CT and TT
were found, respectively. At the GHSR1 locus, genotype AA showed approximately no genotype frequency and high
genotype frequency was observed for all the breeds in relation to GG genotype. The Cobb 500 breed recorded the
highest of 100%. No genotype frequency was observed for the TT genotype across the entire breed at GHSR2 locus.
The genotype frequency of CC genotype was higher in the local breeds than that in the commercial Cobb 500 breed.
The insulin gene recorded similar genotypes CC, CT and TT at insulin 1 and 2 loci but AA, AG and GG at
insulin 3 locus. At insulin 1 locus, the genotype CC recorded lower genotype frequencies in all breeds but there was
no significant difference between the genotype frequencies of CT and TT. In the Insulin 2, there were also low
frequencies for CC with the Cobb 500 breed recording no frequency for that genotype. A high frequency for TT was
observed in all breeds. The Cobb breed showed the highest frequency (0.64) for the AG genotype while Noi breed
showed the least frequency (0.33) at the insulin 3 locus. The genotype frequencies in the local breeds were higher
for the AA and AG genotypes compared to the Cobb 500 breed.

www.gjournals.org 720
Greener Journal of Agricultural Science ISSN: 2276-7770 Vol. 3 (10), pp. 716-724, October 2013.

Table 2. Allele and genotype frequencies within GH, GHSR and insulin genes in two local chicken breeds in Vietnam
and a commercial breed.

www.gjournals.org 721
Greener Journal of Agricultural Science ISSN: 2276-7770 Vol. 3 (10), pp. 716-724, October 2013.

Table: Continues

NS means there is no significant difference between the observed and expected genotype frequencies under the
Hardy-Weinberg equilibrium. *p<0.05, **p<0.01, ***p<0.001

DISCUSSION

Improving economic traits in chicken has increasingly become of interest and the identification and utilization of QTLs
provide the potential for genetic improvement in selection programmes without slaughtering. Recent advances in
molecular genetics have led to the discovery of genes, or markers associated with genes that affect meat quality
(Gao et al., 2007). Genetic diversity in local or domestic breeds of animals allows breeders and researchers to
develop new characteristics in response to changes in environment, diseases or market conditions and maintain
genetic diversity as well as improve productivity.
Recently DNA polymorphism in chickens and other types of animals in relation to different genes and their
effects has been studied.
The chicken GH gene has numerous SNPs, some of which have been linked to body weight and skeletal
growth in domestic fowls (Harvey, 2013), growth and carcass quality (Lei et al., 2007; Nie et al., 2005); egg
production (Feng et al., 1997) and disease resistance (Kuhnlein et al., 1997). DNA polymorphisms in the GH gene
have been studied in recent years in various animals and results have shown a close association with carcass
characteristics. Lei et al. (2007), observed a significant association with abdominal fat pad weight, abdominal fat pad
ratio and crude fiber content of the breast muscle in SNP substitution from G to A in the chicken growth hormone
(cGH) gene while Mehdi et al. (2012), observed a significant effect on body weight traits with SNP at G662A.
In the chicken GH gene, several SNPs in introns have been identified and reported to be associated with
growth, egg production and disease resistance (Feng et al., 1997, Qui et al., 2006, Nie et al., 2005a, Lei et al., 2007).
In this study, three SNPs (G662A, T3094C, and C3199T) were detected. Mehdi et al. (2012) observed that SNP at
G662A had a significant effect on body weight traits.
In a study conducted by Qui et al. (2006), four SNPs were detected (A428G, C1594T, A3971G and T3737C)
for the insulin gene. It was observed that both C1594T and A3971G were significantly associated with body weight
while T3737C genotypes were significantly associated with small intestine length. In this study, however, only three
SNPs (C1594T, A3971G and T3737C) were detected. Insulin plays an important role in cellular glucose uptake ,
www.gjournals.org 722
Greener Journal of Agricultural Science ISSN: 2276-7770 Vol. 3 (10), pp. 716-724, October 2013.

regulating carbohydrate, lipid and protein metabolism as well as promoting cell division and growth (Wilcox, 2005). In
view of this insulin, it has been considered as a candidate gene in genetic analysis of complex traits such as growth
rate, body composition and fat deposition (Qui et al., 2006). In a study conducted by Qui et al. (2006), SNPs C1594T
and A3971G were found to be significantly associated with body weight trait while T3737C genotypes were
significantly associated with small intestine length. Lei et al. (2007), also observed an association of the insulin gene
with muscle fibre density. In this study, however, three SNPs (C1594T, A3971G and T3737C) were detected.
The GHR gene was found in a research conducted by Lei et al. (2007) to be significantly associated with
crude fat content of the breast muscle, abnormal fat pad weight and ratio. It was also observed that the GHSR gene
was linked with fat traits and the INS gene was found to be linked with muscle fibre density. SNPs in the GHR gene
have been studied in relation to growth rate and fat deposition (Geng et al., 2008) and rate of growth in fast growing
broiler strains and slow growing layer fowl (Zhao et al., 2004); milk production and composition in Holsteins cattle
(Aggrey et al., 1999) and carcass weight and weight gain in beef cattle (Curi et al., 2006). Polymorphisms in the
chicken GHR gene have been found to be significantly associated with crude fat content of the breast muscle,
abnormal fat pad weight and ratio (Lei et al., 2007); egg production and body weight (Feng et al., 1997).
Fang et al. (2010) detected a polymorphism in the GHSR gene in chicken, the dominant homologous
genotype CC in the population was found to be associated with growth. In this result the CC genotype was dominant
at the GHSR 2 locus and hence it can be associated with growth traits. The GHSR is involved in several
physiological functions such as pituitary growth hormone secretion, food intake and energy expenditure (Shuto et al.,
2002). Polymorphisms in the GHSR gene have been found to be associated with growth traits in cattle (Zhang et al.,
2009); fat traits in chicken (Lei et al., 2007); body weight and leg muscle weight traits in chicken (Fang et al., 2010).
In conclusion, single nucleotide polymorphisms of the GH, GHR, GHSR and insulin genes existing in the
various chicken breeds are containing great genetic potential resources for improving growth rate and meat quality
traits because of their valuable characteristics on each breed group, in which Vietnamese local breeds such as Tau
Vang and Noi developing in the backyard chicken systems are one of the good chicken production models ensuring
animal welfare in Vietnam. These results indicated genetic contribution ability of the Vietnamese breeds to meat
quality traits in the future as well.

ACKNOWLEDGEMENT

This work was supported by the grant of Can Tho University (project T2013-45) and GreenFeed Viet Nam Joint
Stock Company (www.greenfeed.com.vn).

REFERENCES

Aggrey, S. E., Yao, J., Sabour, M. P., Lin, Y., Zadworny, D., Hayes, J. F. and Kuhnlein, U., 1999. Markers within the
Regulatory Region of the Growth Hormone Receptor Gene and Their Association with Milk-related Traits in
Holsteins. J. Hered. 90: 148-151
Beuzen, N. D., Stear, M. J. and Chang, K. C., 2000 Molecular Markers and their use in Animal Breeding. Vet. J.
160: 42–52
Curi, R. A., Palmieri, D. A., Suguisawa, L., Ferraz, A. L. J., Oliveira, H. N., Furlan, L. R., Silveira, A. C. and Lopes, C.
R., 2006. Effects of GHR Gene Polymorphisms on Growth and Carcass Traits in Zebu Crossbred Beef Cattle.
Livest. Sci. 101: 94-100
Fang, M., Nie, Q., Luo, C., Zhang, D. and Zhang, X., 2010. Association of GHSR Gene Polymorphsim with Chicken
Growth and Carcass Traits. Mol. Biol. Rep. 37:423-428
Feng, X. P., Kuhnlein, U., Aggrey, S. E., Gavora, J. S., and Zadworny, D., 1997. Trait Association of Genetic Markers
in the Growth Hormone and the Growth Hormone Receptor Gene I a White Leghorn Strain. Poult. Sci 76:1170-
1175
Gao, Y., Zhang, R., Hu, X., and Li, N., 2007. Application of Genomic Technology to the Improvement of Meat Quality
of Farm animals. Meat Sci. 77:36-45
Geng, L.Y., Zhang, C.S. and Du, L.X., 2008. Identification of SNPs Located in Putative Microrna Target Region of Six
Functional Genes in Chickens through Bioinformatics Analysis. Yi Chuan 30: 1026–1032
Harvey, S., 2013. Growth Hormone and Growth? General and Comparative Endocrinology
http://dx.doi.org/10.1016/j.ygcen.2013.01.008
Kadlec, J., Hosnedlová, B., Rehout, V., Čítek, J., Večerek, L., Hanusová. L. 2011. Insulin-Like Growth Factor-I Gene
Polymorphism and its Association with Growth and Slaughter Characteristics in Broiler Chickens. J Agrobiol
28(2): 157–163
www.gjournals.org 723
Greener Journal of Agricultural Science ISSN: 2276-7770 Vol. 3 (10), pp. 716-724, October 2013.

Kuhnlein, U., Ni L., Weigend S., Gavora J. S., Fairfull W., and Zadworny D., 1997. DNA Polymorphisms in the
Chicken Growth Hormone Gene: Response to Selection for Disease Resistance and Association with Egg
Production. Anim Genet. 28:116–123
Lei, M. M., Nie, Q. H., Peng, X., Zhang, D. X., Zhang, X. Q. 2005 Single Nucleotide Polymorphisms of the
Chicken Insulin-Like Factor Binding Protein 2 Gene Associated with Chicken Growth and Carcass Traits. Poult
Sci. 84:1191–1198.
Lei, M., Luo, C., Peng, X., Fang, M., Nie, Q., Zhang, D., Yang, G. and Zhang X., 2007. Polymorphism of Growth-
Correlated Genes Associated with Fatness and Muscle Fiber Traits in Chickens. Poult Sci 86: 835-842
Li, H., Zhu, W., Chen, K., Wu, X., Tang, Q. and Gao, Y., 2008. Associations between GHR and IGF-1 Gene
Polymorphisms, and Reproductive Traits in Wenchang Chickens. Turk. J. Vet. Anim. Sci. 32:281-285
Li, H., Zhu, W., Chen, K., Song, W., Shu, J. and Han, W., 2010. Effects of the Polymorphisms of GHR Gene and
IGF-1 Gene on Egg Quality in Wenchang Chicken. Res. J. Poult. Sci. 3:19-22
Mehdi, A. and Reza, F. A., 2012. Single Nucleotide Polymorphisms in Intron 1 of Growth Hormone Gene and It’s
Association with Economic Important Traits in Iranian Fars Native Fowl. Annals Biol Res 3: 4028-4032
Nie, Q., Sun, B., Zhang, D., Luo, C., Ishag, N. A., Lei, M., Yang, G.And X. Zhang, 2005.
High Diversity of the Chicken Growth Hormone Gene and Effects on Growth and Carcass Traits. J. Hered 96(6):
698-703
Nie, Q., Lei, M., Ouyang, J., Zeng, H., Tang, G., and Zhang, X., 2005a. Identification and characterization of single
nucleotide polymorphisms in 12 chicken growth-correlated genes by denaturing high performance liquid
chromatography. Genet. Sel. Evol. 37:339-360
Qui, F. F., Nie, Q. H., Luo, C. L., Zhang, D. X., Lin, S. M., and Zhang, X. Q., 2006 Association of Single Nucleotide
Polymorphisms of the Insulin Gene with Chicken Early Growth and Fat Deposition. Poult Sci 85:980–985
Shuto, Y., Shibasaki, T., Otagiri, A., Kuriyama, H., Ohata, H., Tamura, H., Kamegai, J., Sugihara, H., Oikawa, S. and
Wakabayashi, I., 2002. Hypothalamic Growth Hormone Secretagogue Receptor Regulates Growth Hormone
Secretion, Feeding, and Adiposity. J. Clin. Invest. 109:1429–1436
Wickramarante, S. H. G., Ulmek, B. R., Dixit, S. P., Kumar, S., and Vyas, M. K., 2010. Use of Growth Hormone Gene
Polymorphism in Selecting Osmanabadi and Sangamneri Goats. Tropical Agricultural Research 24:398-411.
Wilcox, G., 2005. Insulin and Insulin Resistance. Clin. Biochem. Rev. 26: 19-39
Zhao, R., Muehbauer, E., Decuypere, E. and Grossmann, R., 2004. Effect of Genotype-Nutrition Interaction on
Growth and Somatotropic Gene Expression in the Chicken. Gen. Comp. Endocrinol. 136, 2–11.
Zhou, H., Mitchell, A. D., McMurtry, J. P., Ashwell, C. M. and Lamont, S., 2005. Insulin-Like Growth Factor-1 Gene
Polymorphism Association with Chicken Body Composition, Skeleton Integrity and Metabolic Traits in Chickens.
Poult Sci. 84:212-219
Solé, X., Guinó, E., Valls, J., Iniesta, R. and Moreno, V., 2006. SNPStats: a web tool for the analysis of association
studies. Bioinformatics 22:1928-1929

www.gjournals.org 724
 môc lôc
 La hoµng ch©u, nguyÔn b¸ phó, nguyÔn b¶o vÖ. §¸nh 5 -10
T¹p chÝ
gi¸ n¨ng suÊt vµ chÊt l­îng tr¸i cña quýt ®­êng kh«ng hét ë
NÔNG NGHIỆP ®ång b»ng s«ng Cöu Long
& PHÁT TRIỂN NÔNG THÔN  NguyÔn b¸ phó, nguyÔn b¶o vÖ. Kh¶o s¸t ®Æc ®iÓm h×nh 11 -18
ISSN 1859 - 4581 th¸i thùc vËt cña cam sµnh kh«ng hét ®­îc ph¸t hiÖn ë ®ång
b»ng s«ng Cöu Long
N¨m thø m­êi bèn
 TrÇn thÞ ba, vâ thÞ bÝch thñy, lª thµnh trung. Kh¶o 19-26
Chuyên đề s¸t sù sinh tr­ëng vµ tÝnh thÈm mü cña rau hóng quÕ ( Ocium
Basilium) vµ tÝa t« ( Perilla Frutescens) trªn bèn lo¹i gi¸ thÓ víi
“CAAB 2014 – Hướng tới nền
ba lo¹i chËu trång
nông nghiệp công nghệ và xây 27-30
 L©m ngäc ph­¬ng, trÇn thanh truyÒn, ng«
dựng nông thôn mới”,
Tháng 12 - 2014 ph­¬ng ngäc. Nghiªn cøu nh©n gièng in vitro d­a hÊu tø
béi ( Citrullus Vulgaris Schrad.)
 Ng« ph­¬ng ngäc, l©m ngäc ph­¬ng. HiÖu qu¶ cña 31-34
Tæng biªn tËp conchixium trªn sù tø béi hãa c©y hoa c¸t t­êng ( Eestoma
Ts. Bïi huy hiÒn grandiflorum ( Raf.) Shinn) in vitro
§T: 04.38345457  Lª nguyÔn lan thanh, lª thÞ kiÒu loan, nguyÔn thÞ 35-43
h­¬ng lan. Kh¶o s¸t ¶nh h­ëng cña nång ®é BA, IBA vµ
NAA ®Õn kh¶ n¨ng nh©n nhanh chåi vµ ra rÔ cña ba gièng hoa
Phã tæng biªn tËp
®ång tiÒn nu«i cÊy m«
 Huúnh nguyÔn quang tuÊn, trÇn v¨n hai, trÞnh thÞ 44-49
Ph¹m Hµ Th¸i
§T: 04.37711070 xu©n. ¶nh h­ëng cña Tinopal unpa – Gx vµ axÝt boric trong
s¶n xuÊt chÕ phÈm Nucleopolyhedrovirus ®Ó phßng trõ s©u ¨n
t¹p Spodoptera Litura Fabricius ( Lepidoptera: Noctuidae)
 Lª minh t­êng. TuyÓn chän x¹ khuÈn Actinomyces sp cã 50-54
Toµ so¹n - TrÞ sù
kh¶ n¨ng ®èi kh¸ng víi vi khuÈn Xanthomonas oryzae PV.
Sè 10 NguyÔn C«ng Hoan
QuËn Ba §×nh - Hµ Néi Oryzae g©y bÖnh b¹c l¸ ( ch¸y b×a l¸) lóa ë §ång b»ng s«ng
§T: 04.37711072 Cöu Long
Fax: 04.37711073  TrÇn thÞ thu thñy, lª thÞ mai th¶o, tohru teraoka, 55-61
E-mail: tapchinongnghiep@vnn.vn tsutomu arie. Kh¶ n¨ng g©y bÖnh cña nÊm fusarium
moniliforme thu thËp t¹i ®ång b»ng s«ng Cöu Long trªn gièng lóa
Jasmine 85
 TrÇn vò phÕn, nguyÔn thÞ vµng, ®inh ngäc tróc. 62-69
Bé phËn th­êng trùc
135 Pasteur Kh¶ n¨ng phßng trõ sinh häc bÖnh b¹c l¸ lóa cña mét sè chñng
QuËn 3 - TP. Hå ChÝ Minh Bacillus ph©n lËp tõ tØnh HËu Giang trong ®iÒu kiÖn nhµ l­íi
§T/Fax: 08.38274089  Cao ngäc ®iÖp, trÇn xu©n linh, ng« thÞ cÈm tó. ¶nh 70-76
h­ëng cña ph©n h÷u c¬ - vi sinh vµ ph©n NPK ®Õn cÊy t¾c ( c©y
h¹nh) ( Citrus microcarpa ( Hask) Bunge) trång trªn ®Êt phï sa
thµnh phè CÇn Th¬ vµ tØnh HËu Giang
GiÊy phÐp sè: 77-84
 NguyÔn quèc kh­¬ng, ng« ngäc h­ng, nguyÔn kim
400/GP - BVHTT
Bé V¨n ho¸ - Th«ng tin cÊp ngµy 28 quyªn. Sö dông “kü thuËt l« khuyÕt “ trong ®¸nh gi¸ sinh tr­ëng
th¸ng 12 n¨m 2000. vµ ®¸p øng n¨ng suÊt mÝa gèc trªn ®Êt phï sa ë ®ång b»ng s«ng
Cöu Long
 NguyÔn quèc kh­¬ng, ng« ngäc h­ng. ¶nh h­ëng 85-92
cña biÖn ph¸p t­íi lªn ph¸t th¶i khÝ CH4, N2 O5 vµ n¨ng suÊt lóa
In t¹i C«ng ty Cæ phÇn KH&CN H¶i §¨ng trång trong nhµ l­íi
81/30/1 L¹c Long Qu©n, CÇu GiÊy, Hµ Néi
 NguyÔn kim quyªn, nguyÔn quèc kh­¬ng, ng« 93-102
ngäc h­ng. øng dông “ hÖ thèng chÈn ®o¸n vµ khuyÕn c¸o
tÝch hîp” ( DRIS) trong chÈn ®o¸n t×nh tr¹ng dinh d­ìng trung, vi
l­îng cho c©y mÝa trªn ®Êt phï sa
  NguyÔn quèc kh­¬ng, ng« ngäc h­ng. ¶nh h­ëng 103-114
T¹p chÝ cña c¸c liÒu l­îng kali vµ b· bïn mÝa ®Õn sinh tr­ëng, n¨ng
suÊt, ®é brix vµ hÊp thu kali cña c©y mÝa trªn ®Êt phï s ë
NÔNG NGHIỆP ®ång b»ng s«ng Cöu Long
& PHÁT TRIỂN NÔNG THÔN  ®ç vâ anh khoa, nguyÔn thÞ kim khang, nguyÔn 115-122
ISSN 1859 - 4581 thÞ hång anh, nguyÔn thÞ diÖu thóy. ¶nh h­ëng cña
kiÓu gien insulin C15549T lªn n¨ng suÊt quµy thÞt gµ tµu vµng
N¨m thø m­êi bèn
 ®ç vâ anh khoa, nguyÔn minh th«ng, nguyÔn thÞ 123-127
kim khang, nguyÔn thÞ hång anh. ¶nh h­ëng ®a h×nh di
Tr­êng ®¹i häc cÇn th¬ truyÒn gien hoãc m«n sinh tr­ëng lªn tiªu thô thøc ¨n vµ hÖ
sè chuyÓn hãa thøc ¨n ë gµ Tµu Vµng
 NguyÔn träng ng÷, trang thµnh gi¸, ch©u thµnh 128-133
Tæng biªn tËp
vò, l­u huúnh anh, nguyÔn thÞ hång anh, nguyÔn
Ts. Bïi huy hiÒn
§T: 04.38345457 thÞ hång anh, nguyÔn hång xu©n. ¶nh h­ëng cña
gien Neuropeptit Y ®Õn n¨ng suÊt sinh s¶n cña gµ nßi
 L­u h÷u m¹nh, mai nhùt minh, bïi t lª minh, 134-140
nguyÔn thanh l·m, nguyÔn nhùt xu©n dung.
Phã tæng biªn tËp
Ph¹m Hµ Th¸i §¸nh gi¸ møc ®é vÊy nhiÔm mét sè vi khuÈn nguy hiÓm trªn
§T: 04.37711070 thÞt gia cÇm sau giÕt mæ ë chî B¹ch §»ng, thµnh phè Trµ
Vinh, tØnh Trµ Vinh
 L­u h÷u m¹nh, ®inh nguyÔn ¸nh d­¬ng, nguyÔn 141-147
nhùt xu©n dung. Møc ®é vÊy nhiÔm mét sè vi khuÈn trªn
Toµ so¹n - TrÞ sù
Sè 10 NguyÔn C«ng Hoan thÞt bß t¹i c¬ së giÕt mæ vµ c¸c ®iÓm ph©n phèi ë thµnh phè
QuËn Ba §×nh - Hµ Néi CÇn Th¬
§T: 04.37711072  NguyÔn thÞ kim khang, nguyÔn minh th«ng, ®ç vâ 148-153
Fax: 04.37711073 anh khoa, ph¹m ®µo ng©n khoa, lª thanh ph­¬ng.
E-mail: tapchinongnghiep@vnn.vn
T¸c ®éng cña viÖc bæ sung mì c¸ tra vµ vitamin E lªn n¨ng suÊt
vµ chÊt l­îng trøng cña gµ Hisex Brown
 Lª thanh ph­¬ng, l­u h÷u m·nh, nguyÔn nhùt xu©n 154-161
Bé phËn th­êng trùc dung. ¶nh h­ëng nguån bæ sung dÇu trong khÈu phÇn lªn
135 Pasteur
QuËn 3 - TP. Hå ChÝ Minh
t­¬ng quan gi÷a biÓu hiÖn FADS1 vµ FADS2 víi hµm l­îng axit
§T/Fax: 08.38274089 bÐo omega 6 vµ 3 cña lßng ®á trøng gµ
 NguyÔn nhùt xu©n dung, l©m ngäc h©n, lª thanh 162-169
ph­¬ng, l­u h÷u m·nh, ng« thÞ minh s­¬ng. ¶nh
h­ëng bæ sung dÇu c¸m g¹o vµ bét tái trong khÈu phÇn lªn
GiÊy phÐp sè:
n¨ng suÊt, chÊt l­îng trøng cña gµ ®Î th­¬ng phÈm gièng
400/GP - BVHTT
Bé V¨n ho¸ - Th«ng tin cÊp ngµy 28 Hisex Brown
th¸ng 12 n¨m 2000.  NguyÔn minh ch¬n, lª quèc duy. Lycopen, β – Caroten, 170-175
vitamin C vµ Hy®rat – cacbon tæng sè trong xoµi, ®u ®ñ, d­a hÊu
vµ Lªkima
 Nhan minh trÝ. ¶nh h­ëng cña gièng vµ lo¹i g¹o ( tr¾ng trong 176- 184
In t¹i C«ng ty Cæ phÇn KH&CN H¶i §¨ng
81/30/1 L¹c Long Qu©n, CÇu GiÊy, Hµ Néi vµ b¹c bông) ®Õn tÝnh chÊt cña g¹o, bét g¹o vµ tinh bét g¹o
 Lª nguyÔn ®oµn duy, huúnh trÇn huyÒn trang, 185- 190
nguyÔn c«ng hµ. Kh¶o s¸t th«ng sè chÕt nhiÖt cña vi sinh
vËt hiÕu khÝ trong tiÕn tr×nh thanh trïng n­íc Ðp d©u H¹ Ch©u
 Tr­¬ng thÞ méng thu, ®ç thÞ thanh h­¬ng. nghiªn 191- 196
cøu s¶n xuÊt c¸ tra ( Pangasianodon hypophthalmus) gi¶ c¸ ngõ
 NguyÔn minh ch¬n, nguyÔn ph¹m tuÊn. nghiªn cøu 197- 202
trÝch ly amylaza vµ proteaza tõ rét gµ vµ ¶nh h­ëng cña mét sè
yÕu tè tíi ho¹t ®éng enzym
 KHOA HC CÔNG NGH

NH H$&NG CA GIEN NEUROPEPTIT Y

!+N NNG SUBT SINH SN CA GÀ NÒI
Nguyn
Nguyn Trng Ngl1, Trang Thành Giá1, Châu
Châu Thanh V
V1
LDu HuŸnh
HuŸnh Anh1, Nguyn
Nguyn Th Hrng Nhân1, Nguyn
Nguyn Hrng Xuân2
TÓM TT
TT
‹ gà, gien Neuropeptit Y (NPY) npm trên nhim skc thF s( 2, bao grm 4 exon và 3 intron, trong ó v trí a
hình NPY/DraI (thêm/m\t 4 nucleotit) DEc cho là có liên quan  n kh& n'ng sinh s&n. Thí nghi-m hi-n tSi
DEc ti n hành F xác nh tn s( xu\t hi-n c2a a hình này và phân tích &nh hD8ng c2a kiFu gien  n n'ng
su\t sinh s&n c2a gà Nòi. Tgng c$ng 147 gà Nòi, trong ó 130 mái và 17 tr(ng DEc sV dfng trong thí
nghi-m. Gà DEc nuôi theo phD"ng th[c cá thF F theo dõi các ch9 tiêu vL kh& n'ng ¤ tr[ng và \p n8 trong
20 tun ¤ (28-47 tun tugi). KiFu gien c2a gà thí nghi-m DEc xác nh bpng phD"ng pháp gi&i trình tR và
PCR-RFLP. K t qu& cho th\y, có 2 alen D và I trong qun thF gà thí nghi-m v*i tn s( kiFu gien DD, ID và II
ln lDEt là 0,36, 0,42 và 0,22. Các ch9 tiêu vL t‚ l- tr[ng không St, t‚ l- tr[ng có phôi và t‚ l- n8 không b
&nh hD8ng b8i kiFu gien. Tuy nhiên, gà mang kiFu gien DD có kh(i lDEng tr[ng (44,4 g/qu&) và n'ng su\t
tr[ng (50,9 qu&/20 tun ¤) cao h"n gà v*i kiFu gien II (42,1 g/qu& và 38,9 qu&/20 tun ¤) (P<0,05). Trong
quá trình chn lc, cn chú ý nâng cao tn s( xu\t hi-n c2a kiFu gien DD nhpm c&i thi-n n'ng su\t sinh s&n
c2a gà Nòi.
TI khóa: a hình, :9t biVn NPY/DraI, gà Nòi, gien Neuropeptit Y, n-ng suft sinh s,n.

1. T VN  1 môn kích thích hoSt $ng c2a burng tr[ng) tI gian
não (Contijoch et al., 1993) và do ó có vai trò thúc
Gà Nòi là gi(ng gà a phD"ng có nhiLu Du iFm
+y hoSt $ng sinh s&n và tugi trD8ng thành sinh dfc
nhD d nuôi, ít b-nh, ph+m ch\t tht th"m ngon, tht
(Kuenzel và Fraley, 1995). Gien NPY cng cho th\y
s'n chkc, da vàng, phù hEp v*i th hi u c2a ngDbi
có liên quan v*i n'ng su\t tr[ng 300 ngày (Li et al.,
tiêu dùng n$i a và có tiLm n'ng xu\t kh+u. Ngoài
2009) và tugi ¤ tr[ng u tiên (Dunn et al., 2004)
các Du iFm trên, gi(ng gà Nòi còn trn tSi các nhDEc
trên nhlng gi(ng gà khác nhau. Tuy nhiên,  n thbi
iFm nhD con gi(ng b lai tSp nhiLu, t'ng trD8ng
iFm hi-n tSi hu nhD chDa có công b( nào vL &nh
ch5m và kh& n'ng sinh s&n th\p. Theo k t qu& iLu
hD8ng c2a các gien [ng viên, bao grm c& gien NPY,
tra cho th\y, a s( các nông h$ Lu nuôi gà Nòi theo
trên tính trSng sinh s&n c2a gà a phD"ng 8 Vi-t
phD"ng th[c cg truyLn, gà m™ ¤ tR \p và nuôi con,
Nam. Trong nghiên c[u này, a hình NPY/DraI
n'ng su\t tr[ng trung bình 48,4 tr[ng/mái/n'm và
DEc sV dfng F phân tích m(i liên k t v*i các ch9
t‚ l- \p n8 kho&ng 81% (Nguyn V'n Quyên và Võ
tiêu sinh s&n c2a gà Nòi nhpm tìm ki m m$t ch9 th
V'n S"n, 2008a). Chính vì nhlng hSn ch này mà các
phân tV hi-u qu& phfc vf cho công tác gi(ng.
c" s8 ch'n nuôi qui mô cng nhD các nông h$ chDa
phát huy DEc h t tiLm n'ng c2a gi(ng. 2. V T LIU VÀ PHNG PHÁP NGHIÊN CU

Trong nh hD*ng [ng dfng di truyLn phân tV 2.1. B(

trong chn gi(ng, có nhiLu nghiên c[u t5p trung vào
vai trò c2a gien Neuropeptit Y (NPY)  n quá trình
sinh trD8ng, sinh s&n và hoSt $ng trao gi ch\t 8 gà.
Zhou et al. (2005) Da ra gi& thuy t vL vai trò c2a
gien NPY trong trao gi v5t ch\t và t'ng trng c2a
gà. Bên cSnh ó gien NPY DEc cho là có &nh hD8ng
 n sR ti t hoóc môn Gonadotropin (GnRH — hoóc
1
Khoa Nông nghiệp và Sinh học ứng dụng, Trường ðại
học Cần Thơ
2
Khoa CNSH và CNTP, Trường ðại học Kỹ thuật – Công
nghệ Cần Thơ
B( trí thí nghi-m
Thí nghi-m DEc ti n hành trên gi(ng gà Nòi
nuôi tSi TrSi thRc nghi-m xã Thu5n Ti n, huy-n Bình
Minh, t9nh Vxnh Long. Gà Nòi DEc nuôi trên churng
lrng theo phD"ng th[c cá thF, tgng c$ng có 130 gà
mái 8 giai oSn ¤ tr[ng (28-47 tun tugi) và 17 gà
tr(ng DEc dùng trong thí nghi-m. Công tác ph(i
gi(ng DEc ti n hành 2 ln trong ngày bpng cách Da
gà tr(ng vào ô churng c2a gà mái m$t cách luân
phiên và &m b&o t‚ l- tr(ng:mái là 1:8. Trong thbi
gian thí nghi-m gà DEc cho 'n kh+u phn có m[c
n'ng lDEng trao gi là 2850 Kcal/kg và m[c protein
thô là 17%. T\t c& gà Lu DEc tiêm phòng các b-nh

128 N¤NG NGHIÖP Vµ PH¸T TRIÓN N¤NG TH¤N - Th¸ng 12/2014

 KHOA HC CÔNG NGH

theo qui trình 8 giai oSn trD*c và trong thbi gian thí K t qu& gi&i trình tR cho th\y, tSi v trí nucleotit
nghi-m. 494  n 499 trD*c v trí mã hóa u tiên c2a gien
2.2. Thu th5p
th5p s( li-u NPY (Genbank: M87298) trn tSi $t bi n thêm/m\t
4 nucleotit (ATAA). TD"ng tR, s&n ph+m PCR sau khi
Các ch9 tiêu theo dõi và cách thu th5p s( li-u
2 v*i enzym DraI và i-n di trên gel 3% cho th\y có 2
DEc thRc hi-n theo Bùi Hlu oàn (2011), cf thF
alen I và D, tD"ng [ng v*i 3 kiFu gien II (252 bp), ID
nhD sau:
(252 bp, 167 bp và 81 bp) và DD (167 bp, 81 bp)
- Tgng s( tr[ng ¤ ra: thu tr[ng hàng ngày và (Hình 2) v*i các tn s( kiFu gien ln lDEt là II = 0,22;
ghi nh5n s( li-u trong thbi gian thí nghi-m. ID = 0,42 và DD = 0,36.
- Kh(i lDEng tr[ng: DEc xác nh bpng cân i-n
tV (sai s( 0,1 g).
- Ch9 s( hình dSng: o Dbng kính l*n (chiLu dài
tr[ng) và Dbng kính nhi (chiLu r$ng tr[ng) bpng
thD*c k™p có sai s( 0,1 mm, sau ó tính ch9 s( hình
dSng theo công th[c CSHD (%) = (Dbng kính
nhi/Dbng kính l*n)*100.
- T‚ l- tr[ng có phôi (%): là t‚ l- gila s( tr[ng có
phôi trên tgng s( tr[ng ¤ ra c2a m$t gà mái. Hình 1. V
V trí thêm/m\t 4 nucleotit (ATAA)
- T‚ l- n8/tr[ng có phôi (%): là t‚ l- gila s( gia trên gen NPY
cm n8 ra còn s(ng trên tgng s( tr[ng xác nh có
phôi c2a m$t gà mái.
2.3.
2.3. Xác nh
nh kiFu gien
- Tách ADN: muu lông gà DEc tách chi t và tinh
sSch theo qui trình DEc mô t& chi ti t b8i Nozawa et
al. (1999).
- Xác nh kiFu gien: sV dfng phD"ng pháp gi&i
trình tR và PCR-RFLP (Polymerase Chain Reaction —
Restriction Fragment Length Polymorphism — theo Hình 2. Các kiFu
kiFu gien c2a
c2a gà Nòi DEc
DEc xác nh trên
L ngh c2a Dunn et al. (2004). Trình tR mri xuôi và gel 3%
mri ngDEc ln lDEt là 5’- K t qu& phân tích trên phù hEp v*i nhlng công
TCTCAGAGCTCCAACGTATGA-3’ và 5’- b( trD*c ây, theo ó Ravikuma et al. (2008) khi
ATATTTCTGTGCCTGAACAACA-3’. ThRc hi-n ph&n nghiên c[u trên gà Rhode Island Red B và gà
[ng PCR v*i nhi-t $ bkt cXp c2a mri là 56oC. S&n Dahlam Red cng xác nh5n hai alen A và B v*i 2 kiFu
ph+m PCR DEc 2 v*i enzym gi*i hSn DraI 8 37oC gien AA và BB (tD"ng [ng v*i $t bi n DD và II), tuy
trong 16 gib, sau ó i-n di trên gel agaroza 3% 8 nhiên các tác gi& không phát hi-n kiFu gien AB. Báo
hi-u i-n th 80 V trong 30 phút. B'ng i-n di ADN cáo c2a Li et al. (2009) và Xu et al. (2011) trên m$t s(
DEc quan sát bpng máy chfp hình gel. gi(ng gà b&n a Trung Qu(c nhD Wengchang và
2.4. XV
XV lý s( li-u Ningdu Shanghuang cng cho rpng có hai alen I và
D tD"ng [ng v*i ba kiFu gien II, ID và DD trn tSi trên
S( li-u DEc phân tích theo mô hình tuy n tính
a hình này.
tgng quát (GLM) c2a phn mLm Minitab version
16.0: Yijk= µ + Ti + KGj + ξijk, (trong ó: Yijk - Tính trSng 3.2. šnh hD
hD8ng c2a a hình
hình NPY/Dra
DraI  n kh(i
NPY/DraI
quan sát; µ - Trung bình chung; Ti - šnh hD8ng c2a lDEng
lDEng tr[ng
gà tr(ng; KGj - šnh hD8ng c2a kiFu gien; ξijk - Sai s( Theo Bùi Hlu oàn et al. (2011) kh(i lDEng
nguu nhiên) tr[ng là m$t ch9 tiêu quan trng F ánh giá ch\t
3. KT QU VÀ THO LU N lDEng tr[ng và s&n lDEng tr[ng c2a gia cm. Kh(i
lDEng tr[ng phf thu$c vào nhiLu y u t(, trong ó 8
3.1. a hình
hình NPY/Dra
DraI trên gà Nòi
NPY/DraI
thí nghi-m hi-n tSi kiFu gien có &nh hD8ng  n kh(i

N¤NG NGHIÖP Vµ PH¸T TRIÓN N¤NG TH¤N - Th¸ng 12/2014 129

 KHOA HC CÔNG NGH

lDEng tr[ng (B&ng 1). SR khác bi-t có ý nghxa th(ng Fatemi et al. (2012) khi nghiên c[u trên gi(ng gà
kê DEc tìm th\y trong giai oSn 28-47 tun tugi v*i Mazandaran, theo ó các tác gi& không tìm th\y m(i
kh(i lDEng tr[ng th\p nh\t là gà có kiFu gien II (42,1 liên k t có ý nghxa gila a hình này v*i kh(i lDEng
g) và cao nh\t là gà mang kiFu gien DD (44,4 g) và tr[ng.
ID (44,5 g). K t qu& này khác v*i nghiên c[u c2a
B&ng 1. šnh hD
hD8ng c2a a hình
hình NPY/Dra
DraI  n kh(i lD
NPY/DraI lDEng tr[ng (g)
KiFu gien
Tun tugi P
DD (n=47) ID (n=55) II (n=28)
28-31 41,9±0,6 a
40,8±0,6 ab
38,9±0,8b 0,01
32-35 42,5±0,6 42,8±0,6 41,3±0,9 0,34
36-39 44,6±0,6 45,2±0,6 43,1±0,9 0,13
40-43 46,1±0,6 46,0±0,6 45,5±0,9 0,87
44-47 47,1±0,7a 47,4±0,7a 44,0±0,9b 0,007
28-47 44,4±0,5a 44,5±0,5a 42,1±0,7b 0,008
a, b
Các giá trg trong cùng m9t hàng mang chh cái khác nhau thì khác bit có ý ngh@a thng kê (P<0,05)
3.3. šnh hD
hD8ng c2a a hình
hình NPY/Dra
DraI  n t‚ l-
NPY/DraI l- bkt u ¤, t‚ l- tr[ng không St cao (dao $ng tI
tr[ng
tr[ng không St 20,5  n 43,8%) và có sR khác bi-t gila các kiFu gien
(P<0,05). Trong các giai oSn ti p theo t‚ l- này gi&m
Tr[ng không St bao grm các trDbng hEp nhD
dn, nhDng gà mang kiFu gien II có khuynh hD*ng
vi tr[ng mLm, tr[ng bi n dSng, có kích thD*c quá
¤ tr[ng không St cao h"n so v*i gà mang 2 kiFu
nhi hoXc quá l*n. T‚ l- tr[ng không St c2a gà Nòi
gien còn lSi (P=0,06).
DEc trình bày qua b&ng 2. ‹ giai oSn u khi gà
B&ng 2. šnh hD
hD8ng c2a a hình
hình NPY/Dra
DraI t‚
NPY/DraI t‚ l- tr[ng không St (%)
KiFu gien
Tun tugi P
DD (n=47) ID (n=55) II (n=28)
28-31 20,5±5,7b 33,4±5,7ab 43,8±7,8a 0,05
32-35 16,7±4,4 18,5±4,3 20,1±6,2 0,90
36-39 6,2±3,4b 7,5±3,3ab 21,8±4,7a 0,02
40-43 1,6±2,6 8,1±2,6 4,8±3,7 0,21
44-47 1,9±1,4 1,5± 1,3 5,9± 1,8 0,14
28-47 11,1±3,4 14,4±3,3 24,0±4,3 0,06
a, b
Các giá trg trong cùng m9t hàng mang chh cái khác nhau thì khác bit có ý ngh@a thng kê (P<0,05)
Theo Nguyn Duy Hoan et al. (1999) trong m$t B&ng 3 cho th\y kiFu gien không có m(i liên
àn gà sR chênh l-ch gila qu& tr[ng to nh\t và qu& quan v*i t‚ l- tr[ng có phôi 8 t\t c& các thbi iFm
tr[ng nhi nh\t vào kho&ng 15 g, nhlng qu& tr[ng khác nhau trong thí nghi-m (P>0,05). T‚ l- tr[ng có
không St không có kh& n'ng \p n8, do ó m$t àn phôi trung bình St tI 76,6  n 78,7% trong giai
gà có s( lDEng tr[ng không St nhiLu s˜ làm gi&m t‚ oSn 28-47 tun tugi. K t qu& này cng phù hEp v*i
l- \p n8 rng thbi gi&m tgng s&n lDEng tr[ng. NhiLu Xc iFm sinh lý sinh s&n c2a gà, các ch9 tiêu ch\t
nghiên c[u ch9 ra rpng tr[ng không St phf thu$c lDEng tr[ng và s[c ¤ tr[ng thDbng liên quan ch2
vào y u t( di truyLn rng thbi phf thu$c vào m[c $ y u 8 gà mái và ít phf thu$c vào con tr(ng, ngDEc
hoàn thi-n c2a (ng dun tr[ng, do ó 8 giai oSn u lSi các ch9 tiêu liên quan  n s[c sinh s&n phf thu$c
c2a quá trình ¤ tr[ng 8 gà, tr[ng không St chi m nhiLu vào vai trò c2a con tr(ng (Nguyn Th Mai et
t‚ l- cao (Nguyn Duy Hoan et al., 1999). iLu này al., 2009).
phù hEp v*i t‚ l- tr[ng không St 8 các giai oSn
khác nhau c2a gà Nòi thí nghi-m.
3.4. šnh hD
hD8ng c2a a hình
hình NPY/Dra
DraI  n t‚ l-
NPY/DraI
tr[ng
tr[ng có phôi

130 N¤NG NGHIÖP Vµ PH¸T TRIÓN N¤NG TH¤N - Th¸ng 12/2014

 KHOA HC CÔNG NGH

B&ng 3. šnh hD
hD8ng c2a a hình
hình NPY/Dra
DraI  n t‚ l- tr[ng có phôi
NPY/DraI
KiFu gien
Tun tugi P
DD (n=47) ID (n=55) II (n=28)
28-31 79,3±3,3 80,1±3,4 78,6±4,6 0,96
32-35 84,1±3,6 75,5±3,5 85,8±5,0 0,11
36-39 79,2±3,5 79,4±3,4 77,5±4,8 0,94
40-43 76,3±4,5 76,1±4,6 67,5±6,5 0,49
44-47 67,5±5,6 72,5±5,3 70,5±7,4 0,81
28-47 78,7±2,5 76,6±2,5 77,9±3,4 0,83
a, b
Các giá trg trong cùng m9t hàng mang chh cái khác nhau thì khác bit có ý ngh@a thng kê (P<0,05)
3.5. šnh hD
hD8ng c2a a hình
hình NPY/Dra
DraI  n t‚ l-
NPY/DraI trong giai oSn u th\p, sau ó DEc c&i thi-n dn
n8/tr[ng có phôi và gn nh. iLu này phù hEp v*i nh5n nh c2a
Nguyn Th Mai và Tôn Th\t S"n (2006) cho rpng,
‹ t\t c& các giai oSn thí nghi-m, kiFu gien
tugi gia cm không nhlng &nh hD8ng  n t‚ l- ¤
không &nh hD8ng  n kh& n'ng n8 tr[ng c2a gà Nòi
tr[ng mà còn &nh hD8ng  n t‚ l- tr[ng ch t phôi; t‚
(B&ng 4). Trung bình, t‚ l- n8 tr[ng c2a gà dao $ng
l- ch t phôi cao nh\t 8 nhlng tun u khi gà m*i
trong kho&ng 83,0  n 88,2%. Bên cSnh ó, m$t ghi
vào ¤ và th\p nh\t khi St 9nh cao t‚ l- ¤ 3-4 tun
nh5n khác trong nghiên c[u cng cho th\y t‚ l- n8
tùy theo gi(ng.
B&ng 4. šnh hD
hD8ng c2a a hình
hình NPY/Dra
DraI  n t‚ l- n8/tr[ng có phôi (%)
NPY/DraI
KiFu gien
Tun tugi P
DD (n=47) ID (n=55) II (n=28)
28-31 77,1±3,6 73,0±3,5 80,3±5,0 0,46
32-35 86,6±2,8 78,1±2,8 85,1±4,0 0,09
36-39 88,5±2,4 90,0±2,4 95,6±3,3 0,22
40-43 89,9±2,8 89,5±2,9 86,6±4,2 0,79
44-47 89,6±3,1 86,9±3,1 94,3±4,2 0,39
28-47 86,4±1,5 83,0±1,4 88,2±2,0 0,07
a, b
Các giá trg trong cùng m9t hàng mang chh cái khác nhau thì khác bit có ý ngh@a thng kê (P<0,05)
3.6. šnh hD
hD8ng c2a a hình
hình NPY/Dra
NPY/DraI
DraI  n n'ng
n'ng Trong thí nghi-m hi-n tSi, kiFu gien có tác $ng
su\t
su\t tr[ng và s( con sinh
sinh ra (P=0,04)  n n'ng su\t tr[ng c2a gà Nòi trong giai
oSn 20 tun ¤ (tun tugi 28-47) (BiFu r 1). Cf thF,
gà mái mang kiFu gien DD và ID cho n'ng su\t cao
h"n gà mang kiFu gien II, tD"ng [ng v*i s( tgng s(
tr[ng DEc ¤ ra ln lDEt là 50,9, 48,7 và 38,9 qu&.
Tuy nhiên, khi xét  n tgng s( gà con sinh ra, không
tìm th\y sR khác bi-t gila các kiFu gien mXc dù gà có
kiFu gien DD vun có khuynh hD*ng cho s( gà con
sinh ra cao nh\t.
N'ng su\t tr[ng là s( tr[ng DEc ¤ ra trong
m$t kho&ng thbi gian xác nh không kF  n chu kŸ
hay nhp ¤, n'ng su\t tr[ng tD"ng quan chXt ch˜ v*i
s[c ¤ tr[ng trong m$t n'm. Bpng cách nuôi truyLn
BiFu
BiFu r 1. šnh hD
hD8ng c2a kiFu gien  n n'ng
n'ng su\t
su\t
th(ng, gà Nòi có n'ng su\t tr[ng kho&ng 48
tr[ng
tr[ng (qu&) và s( gà con sinh ra (con)
qu&/n'm (Nguyn V'n Quyên và Võ V'n S"n,
2008b). Cng theo nhóm tác gi& này, m$t trong

130 N¤NG NGHIÖP Vµ PH¸T TRIÓN N¤NG TH¤N - Th¸ng 12/2014

 KHOA HC CÔNG NGH
nhlng cách ti p c5n F nâng cao s[c s&n xu\t tr[ng
c2a gà Nòi là áp dfng m[c n'ng lDEng trao gi và
protein phù hEp (2750 kcalME/kg và CP16%), khi ó
s&n lDEng tr[ng gà Nòi có thF St  n 96
qu&/mái/n'm. Thí nghi-m hi-n tSi DEc ti p c5n
theo hD*ng di truyLn phân tV, tuy nhiên do thbi gian
kéo dài c2a 2 thí nghi-m khác nhau, nên chDa thF
Da ra m$t k t lu5n chính xác vL hi-u qu& c2a 2
phD"ng pháp chn lc và nuôi dDjng này.
Trong m$t nghiên c[u khác trên gien NPY, Li et
al. (2009) trình bày &nh hD8ng c2a a hình
NPY/DraI  n tgng s( tr[ng 300 ngày (i v*i gà
Wengchang. Trong khi ó, theo báo cáo c2a Xu et al.
(2011) trên gi(ng gà Ningdu Shanghuang, a hình
này không liên quan  n tgng s( tr[ng 300 ngày.
Theo Nguyn Duy Hoan et al. (1999) kh(i lDEng
tr[ng tD"ng quan âm v*i s&n lDEng tr[ng, vì th r\t
khó nâng cao rng thbi hai ch9 tiêu này. Tuy nhiên,
nghiên c[u hi-n tSi ch9 ra rpng gà v*i kiFu gien DD
rng thbi có kh(i lDEng tr[ng và s&n lDEng tr[ng cao
h"n 8 gà mang kiFu gien ID và II, nên alen D trong
trDbng hEp này có thF xem là ch9 th phân tV tiLm
n'ng trong chn gi(ng nhpm nâng cao s&n lDEng
tr[ng 8 gà Nòi.
Các ch9 tiêu n'ng su\t sinh s&n tác $ng qua lSi
lun nhau &nh hD8ng  n s( lDEng gia cm con sinh
ra. Khi xem xét các y u t( tD"ng quan &nh hD8ng
 n s( con sinh ra, có thF nh5n th\y kiFu gien DD 8
a hình NPY/ DraI vDEt tr$i 8 các ch9 tiêu t‚ l- có
phôi, t‚ l- n8, tgng s( tr[ng rng thbi ch9 tiêu t‚ l-
tr[ng không St th\p h"n so v*i 2 kiFu gien còn lSi,
nên s( lDEng gà con sinh ra có khuynh hD*ng cao
h"n so v*i các kiFu gien khác tSi cùng m$t locus. F
khai thác kh& n'ng sinh s&n c2a gà Nòi có hi-u qu&,
bên cSnh vi-c nâng cao tn s( kiFu gien DD trong
qun thF gà Nòi, cn k t hEp t(t v*i công tác ch'm
sóc nuôi dDjng và công tác ph(i gi(ng F nâng cao
t‚ l- tr[ng có phôi. Bên cSnh ó, vì sinh s&n là tính
trSng a gien nên vi-c tìm ki m thêm các gien [ng
viên khác có liên quan  n tính trSng này 8 gà Nòi là
cn thi t nhpm nâng cao hi-u qu& chn lc.
4. KT LU N
a hình NPY/DraI &nh hD8ng  n kh(i lDEng
tr[ng và n'ng su\t tr[ng c2a gà Nòi trong 20 tun ¤
tr[ng (tun tugi 28-47), trong ó gà mang kiFu gien
DD có kh(i lDEng tr[ng và n'ng su\t tr[ng cao nh\t.
Trong quá trình chn lc, cn chú ý nâng cao tn s(
N¤NG NGHIÖP Vµ PH¸T TRIÓN N¤NG TH¤N - Th¸ng 12/2014
xu\t hi-n c2a kiFu gien này nhpm c&i thi-n n'ng su\t
sinh s&n c2a gà Nòi.
L#I CM N
Công trình :;<c hoàn thành vui s> tài tr< c0a B9
Giáo dmc và ào t.o, mã s :t tài B2013-16-27.
TÀI LIU THAM KHO
1. Bùi Hlu oàn, Nguyn Th Mai, Nguyn
Thanh S"n, Nguyn Hlu St (2011). Các ch9 tiêu
dùng trong nghiên c[u ch'n nuôi gia cm. Nhà xuft
b,n Nông nghip Hà N9i.
2. Contijoch, A. M., S. Malamed, J. K.
McDonald, J. P. Advis (1993). Noeropeptide Y
regulation of LHRH release at the median eminence:
immunocytochemical and physical evidence in hens.
Neuroendocrinology 57: 135-147.
3. Dunn, I. C., Y. W. Miao, A. Morris, M. N.
Romanov, P. W. Wilson, D. Waddington (2004). A
study of association between genetic markers in
candidate genes and reproduction traits in one
generation of a commercial broiler breeder hen
population. Heredity 92: 128-134.
4. Fatemi, S. A., H. Mehrabani-Yeganeh, A.
Nejati-Javaremi, S. H. Niknafs (2012). Asociation of
neuropeptide Y and gonadotrophin-releasing
hormone receptor gene SNPs with breeding value
for growth and egg production traits in Mazandaran
native chickens. Genet Mol. Res. 11(3): 2539-2547.
5. Nguyn Duy Hoan, Bùi [c Lng, Nguyn
Thanh S"n, oàn Xuân Trúc (1999). Ch'n nuôi gia
cm. Nhà xuft b,n Nông nghip Hà N9i.
6. Kuenzel, W. J., G. S. Fraley (1995).
Neuropeptide Y: its role in the neural regulation of
reproductive function and food intake in avian and
mammalian species. Poult Avian Biol. Rev. 6: 185—
209.
7. Li, H. F., W. Q. Zhu, K. W. Chen, X. Wu, Q.
P. Tang, Y. S. Gao, W. T. Song, H. L. Xu (2009).
Polymorphism in NPY and IGF-I genes associate
with reproductive traits in Wenchang chicken. Afr. J.
Biotechnol. 8(19): 4744-4748.
8. Nguyn Th Mai, Bùi Hlu oàn, Hoàng
Thanh (2009). Giáo trình ch'n nuôi gia cm. Nhà
xuft b,n Nông nghip Hà N9i.
9. Nguyn Th Mai, Tôn Th\t S"n (2006).
Nghiên c[u m$t s( y u t( &nh hDjng  n k t qu& \p
132
 KHOA HC CÔNG NGH

n8 c2a tr[ng gà nuôi theo phD"ng th[c công nghi-p.
T.p chí Khoa h"c Nông nghip 6: 65-70.
10. Nozawa, H., T. Yamamoto, R. Uchihi, T.
Yoshimoto, K. Tamaki, S. Hayashi, T. Ozawa, Y.
Katsumata (1999). Purification of nuclear DNA from
single hair shafts for DNA analysis in forensic
sciences. Legal Med. 1: 61-67.
11. Nguyn V'n Quyên và Võ V'n S"n (2008a).
K t qu& nghiên c[u Xc iFm sinh s&n c2a gi(ng gà
Nòi nuôi th& vDbn 8 các t9nh rng bpng sông CVu
Long. T.p chí Nông nghip và Phát tri1n Nông thôn 3:
46-48.
12. Nguyn V'n Quyên và Võ V'n S"n (2008b).
K t qu& nghiên c[u &nh hD8ng c2a các m[c n'ng
lDEng trao gi và protein thô lên t'ng trD8ng c2a gà nòi
nuôi tht th& vDbn 8 BSCL giai oSn 8-18 tun tugi.
T.p chí Nông nghip và Phát tri1n Nông thôn 5: 58-61.
13. Ravi Kumar, G. V. P. P. S., C. Amrita, G. S.
Brah, M. L. Chaudhary (2009). PCR-RFLP and
nucleotide sequencing of neuropeptide Y (NPY)
gene in egg type chickens. Indian J. Poultry Sci.
43(3): 263-266.
14. Xu, H. P., H. Zeng, D. X. Zhang, X. L. Jia, C.
L. Luo, M. X. Fang, Q. H. Nie, X. Q. Zhang (2011).
Polymorphisms associated with egg number at 300
days of age in chickens. Genet Mol. Res. 10(4): 2279-
2289.
15. Zhou, W., M. Murakami, S. Hasegawa, F.
Yoshizawa, K. Sugahara (2005). Neuropeptide Y
content in the hypothalamic paraventricular nucleus
responds to fasting and refeeding in broiler chickens.
Comp. Biochem. Physiol., Part A: Mol. Integr. Physiol.
141(2):146—152.

THE EFFECTS OF NEUROPEPTIDE Y GENE ON REPRODUCTIVE PERFORMANCE OF NOI CHICKENS

Nguyen Trong Ngu1, Trang Thanh Gia1, Chau Thanh Vu1
Luu Huynh Anh1, Nguyen Thi Hong Nhan1 and Nguyen Hong Xuan2
Summary
In chicken, the Neuropeptide Y (NPY) gene locates on chromosome 2 and consists of 4 exons and 3 introns,
in which the NPY/DraI Indel is considered to involve in reproductive performance. The current study was
conducted to determine the frequency of this polymorphism and analyze its impacts on reproduction traits
of Noi chicken. A total of 130 Noi laying hens and 17 Noi cockerels were used. Chickens were kept
individually to record egg production and hatching parameters in 20 weeks of laying (28-47 weeks of age).
The genotypes were accessed using sequencing and PCR-RFLP methods. It was shown that, at NPY/DraI
locus there were two alleles namely D and I with the frequencies of DD, ID and II genotypes being 0.36,
0.42 and 0.22, respectively. The rates of abnormal eggs, embryonated eggs and hatching eggs were not
affected by NPY/DraI genotypes. However, chickens baring DD genotype had higher egg weight (44.4
g/egg) and egg production (50.9 eggs/20 weeks of laying) compared to those with II genotype (42.1 g/egg
and 38.9 eggs/20 weeks of laying) (P<0.05). This genotype could be used in selection for improving
reproductive performance of Noi chicken.
Key words: Polymorphism, NPY/DraI mutation, Noi chicken, Neuropeptide Y gene, reproductive performance.
NgDbi
NgDbi ph&n bi-n: PGS.TS. Nguyn V'n
V'n [c
[c
Ngày nh5n
nh5n bài: 15/9/2014
Ngày thông qua ph&n
ph&n bi-n: 15/10/2014
Ngày duy-t
duy-t 'ng: 22/10/2014

N¤NG NGHIÖP Vµ PH¸T TRIÓN N¤NG TH¤N - Th¸ng 12/2014

133
 KHKT Ch¨n nu«i Sè 12 [189] 2014
DI TRUYỀN GIỐNG VẬT NUÔI
Tæng biªn tËp:
Đỗ Võ Anh Khoa. Ảnh hưởng đa hình A662G của Gen Hormon 2
TS. §oµn Xu©n Tróc tăng trưởng lên phẩm chất thịt gà Tàu Vàng
Phạm Thanh Hải, Đinh Thế Dũng và Bùi Xuân Phương. Đặc 8
điểm Gen D-Loop giống chó bản địa H’Mông cộc đuôi
Phã Tæng biªn tËp:
PGS.TS. §INH V¡N C¶I DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
GS.TSKH. L£ HåNG MËN Hồ Trung Thông, Hồ Lê Quỳnh Châu, Nguyễn Xuân An và Vũ
Chí Cương. Xác định hàm lượng protein và amino acids nội sinh
14
PGS.TS. NGUYÔN §¡NG VANG cơ bản ở gà Lương Phượng
Phùng Thế Hải, Trần Quốc Việt, Giang Thị Thanh Duyến, Lê Bá 20
Quế, Hà Minh Tuân, Đào Văn Lập và Nguyễn Thị Thu Hòa. Thực
Th− ký tßa so¹n: trạng về dinh dưỡng của bò đực giống Holstein friesian nuôi tại trạm
nghiên cứu và sản xuất tinh đông lạnh moncada
PGS.TS. NGUYÔN V¡N §øC Nguyễn Thị Phương Giang và Đặng Thúy Nhung. Bổ sung bột cánh 27
hoa cúc vạn thọ vào khẩu phần của gà đẻ trứng Isa Brown
Lê Thanh Phương, Lưu Hữu Mãnh và Nguyễn Nhựt Xuân Dung. 35
Uû viªn ban biªn tËp: Ảnh hưởng của việc bổ sung dầu cám gạo và dầu cá hồi trong khẩu
PGS.TS. NGUYÔN TÊN ANH phần lên năng suất sinh sản và thành phần acid béo, cholesterol của lòng
đỏ trứng giống gà Hisex Brown
PGS.TS. HOÀNG KIM GIAO Nguyễn Văn Hớn, Nguyễn Thị Hồng Nhân và Nguyễn Trọng Ngữ. 44
Ảnh hưởng của tỷ lệ chùm ngây (Moringa oleifera) trong khẩu phần đến
KS. Lª B¸ LÞCH tiêu hóa dưỡng chất của thỏ thịt lai
PGS.TS. Lª §øC NGOAN CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
Đặng Vũ Hòa, Vương Thị Lan Anh, Nguyễn Văn Duy, Đặng 51
Trợ lý biên tập: Thúy Nhung, Nguyễn Đức Trọng và Hoàng Văn Tiệu. Năng suất
sinh sản của vịt đốm nuôi tại Trung tâm Nghiên cứu Vịt Đại Xuyên
CAO THỊ KIM DUNG trong 3 năm từ 2011 đến 2013
Lê Bá Quế, Lê Văn Thông, Mai Văn Sánh, Nguyễn Hữu Đức, 59
Phạm Văn Tiềm, Phùng Thế Hải, Đinh Thị Thuận, Vũ Trung
Hiếu, Mai Thị Thanh Và Hà Minh Tuân. Khả năng sản xuất tinh
đông lạnh dạng cọng rạ của trâu Murrah tại Moncada
Nguyễn Văn Chào và Hồ Trung Thông. Đánh giá sự gia tăng mức độ 64
kháng kháng sinh của vi khuẩn Escherichia coli phân lập từ phân lợn
con nuôi trên địa bàn tỉnh Quảng Bình
Đỗ Thị Vân Giang. Tình hình nhiễm giun đũa (Ascaridia galli) ở gà 72
thả vườn tại một số xã, thị trấn của huyện Đồng Hỷ, Thái Nguyên
Giấy phép: Bộ Thông tin và Truyền thông Lê Xuân Tùng, Bùi Văn Hảo, Nguyễn Thị Quyên, Vũ Thị Thảo 77
Số 119/GP-BTTTT ngày 26/1/2010 và Nguyễn Hưng Quang. Bước đầu đánh giá khả năng sống và
sinh trưởng của 8 giống cỏ trồng tại khu vực thí nghiệm Trường
ISSN 1859 – 476X Đại học Tây Bắc
Nguyễn Thị Thúy Hằng, Nguyễn Văn Đại, Nguyễn Thị Liên và 84
Xuất bản: Hàng tháng Nguyễn Hữu Trà. Ảnh hưởng của mức phân đạm đến năng suất chất
lượng cỏ Panicum maximum cv hamill trồng tại Thái Nguyên
Toà soạn: CHÙM TIN KHOA HỌC CÔNG NGHỆ
Địa chỉ: Tầng 8, Tòa nhà Sunrise Tower, số 187, Ban Biên tập. Thông báo: Bài báo khoa học đăng trên tạp chí 90
Nguyễn Lương Bằng, Phường Quang KHKT Chăn nuôi đạt điểm tối đa
Trung, Quận Đống Đa, Hà Nội. Thông báo số 1 (Thông báo này thay cho thư mời) 91
Đoàn Xuân Trúc. Hội nghị khoa học chăn nuôi khu vực Á - Úc lần 92
Điện thoại: 04.36290621 thứ 16 thành công rực rỡ
Fax: 04.38691511 Tổng mục lục 95
Đăng ký mua tạp chí 98
E - mail: ahassociation06@vnn.vn
Phiếu đăng ký quảng cáo năm 2015 99
Website: www.hoichannuoi.vn Thư cảm ơn 100
Tài khoản:
Tên tài khoản: Hội Chăn nuôi Việt Nam
Số tài khoản: 1300 311 0000 40, tại Chi nhánh
Ngân hàng Nông nghiệp và Phát triển Nông thôn
Thăng Long - Số 4, Phạm Ngọc Thạch, Hà Nội.
In 1000 bản, khổ 19x27 tại Xưởng in NXB Nông
nghiệp. In xong và nộp lưu chiểu: tháng 12/2014.

KHKT Chăn nuôi Số 12 - 2014 1

DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI

7. Hargis P.S., M.E. Van Elswyk and B.M. Hargis
(1991), “Dietary modification of yolk lipid with
menhaden oil”. Poult. Sci., 70: 874-883.
8. Hendrix Genetics company (2011), Hisex
Product Performance. www.isapoultry.com.
9. Murata L.S., J. Ariki, C.R. Machado, L. Silva
and M.J.M. Rezende (2003), “Effect of oil
sources on blood lipid parameters of
commercial laying hens”. Brazilian Journal of
Poultry Science, 5: 203-206.
10. Pasin G., G.M. Smith and M. O’Mahony
(1998), “Rapid determination of total cholesterol
in egg yolk using commercial diagnostic
cholesterol reagent”. Chem., 61: 255-259.
11. Perica M.M. and I. Delas (2011), “Essential fatty
acids and psychiatric disorders”. Nutr. Clin.
Pract., 26(4): 409-425.
12. Robertson J.B., P.J. Van Soest (1981), The
detergent system of analysis and its application to
human food. In: James, W.P.T., Theander, O.
(Eds.) The Analysis of Dietary Fiber in Food.
Marcel Dekker, Inc., NY.
13. Sala-Vila A. and P.C. Calder (2011), “Update
on the relationship of fish intake with prostate,
breast, and colorectal cancers”. Crit. Rev. Food
Sci., 51(9): 855-871.
14. Saleh A.A. (2013), “Effects of fish oil on the
production performances, polyunsaturated fatty
acids and cholesterol levels of yolk in hens”.
Emir. J. Food Agric., 25(8): 605-612.
15. Schreiner M., H.W. Hulan, E. Razzazi-Fazeli, J.
Bohm, C. Iben (2004), “Feeding laying hens seal
blubber oil: Effects on egg yolk incorporation,
stereospecific distribution of omega-3 fatty acids,
and sensory aspects”. Poult Sci., 83: 462-473.
16. Sutton C.C., W.M. Muir and G.E. Mitchell
(1984), “Cholesterol metabolism in laying hen as
influenced by dietary cholesterol, caloric intake
and genotype”. Poultry Science, 63: 972-980.
17. Tu W.C., R.J. Cook-Johnson, M.J. James, B.S.
Műhlhäusler and R.A. Gibson (2010), “Omega-
3 long-chain fatty acid synthesis is regulated
more by substrate levels than gene expression”.
Prostaglandins Leukot. Essent. Fatty Acids, 83:
61-68.
18. Wang P.H., Ko Y.H., Chin H.J., Hsu C., Ding
S.T., Chen C.Y. (2009), “The effect of feed
restriction on expression of hepatic lipogenic
genes in broiler chickens and the function of
SREBP1”. Comparative Biochemistry and
Physiology, Part B, 153: 327-331.

ẢNH HƯỞNG CỦA TỶ LỆ CHÙM NGÂY (Moringa oleifera)

TRONG KHẨU PHẦN ĐẾN TIÊU HÓA DƯỠNG CHẤT
CỦA THỎ THỊT LAI
Nguyễn Văn Hớn 1∗, Nguyễn Thị Hồng Nhân1
và Nguyễn Trọng Ngữ1

Ngày nhận bài báo: 21/09/2014 - Ngày nhận bài phản biện: 27/09/2014
Ngày bài báo được chấp nhận đăng: 29/09/2014

TÓM TẮT
Thí nghiệm thực hiện tại Trại Nghiên Cứu và Thực Nghiệm Nông Nghiệp Trường Đại Học Cần
Thơ, từ tháng 7 đến tháng 9 năm 2014, được bố trí theo thể thức hoàn toàn ngẫu nhiên với 4 nghiệm
thức khẩu phần (CN0, CN30, CN70, CN1000) tương ứng với 4 mức độ (0, 30, 70 và 100% vật chất khô)

1 Trường Đại học Cần Thơ.

∗
Tác giả để liên hệ: TS. Nguyễn Văn Hớn, Giảng viên chính, Khoa Nông Nghiệp & Sinh học Ứng dụng-
Trường Đại học Cần Thơ. Điện thoại: 0949685989E-mail: nvhon@ctu.edu.vn

44 KHKT Chăn nuôi Số 12 - 2014

 DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI

Chùm ngây thay thế cỏ lông tây trong khẩu phần và được lặp lại 3 lần nhằm xác định mức sử dụng tối
ưu trong khẩu phần nuôi thỏ lai tăng trưởng. Mỗi đơn vị thí nghiệm là 4 thỏ có khối lượng 1,6±0,5
kg/con. Kết quả cho thấy sử dụng Chùm ngây nuôi thỏ có sự cải thiện về lượng thức ăn tiêu thụ, tỉ lệ
tiêu hóa dưỡng chất của khẩu phần và không có ảnh hưởng lên các chỉ tiêu sinh lý máu.
Từ khoá: Chùm ngây, tỉ lệ tiêu hóa, sinh lý máu, thỏ thịt lai

ABSTRACT

Effects of Moringa oleifera on digestibility of nutrients for crossbred rabbits

Nguyen Van Hon, Nguyen Thi Hong Nhan
and Nguyễn Trọng Ngữ

Fourty eight growing crossbred rabbits were arranged in a completely randomized design with 4
treatments as 4 diets in which Para grass was replaced by Moringa oleifera of 0, 30, 70 and 100% dry
matter basis (CN0, CN30, CN70, CN100) from July to September 2014 in Experimental Unit of Can Tho
University. A treatment have four rabbits (02 males, 02 females) with live weight average 1,6±0.5 kg and
were kept in one boxes in the eight weeks. The results found that there were significant improvements
in nutrient intake and digestibilities of growing rabbits (P<0.05) from CN70 and CN100 treatments.
There was no significant difference of hematological criteria among treatments.
Keywords: Moringa oleifera, nutrient digestibility, hematological criteria,growing rabbit.

1. ĐẶT VẤN ĐỀ 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN

Nguồn thức ăn xanh cho thỏ lai nuôi ở
hộ gia đình chủ yếu từ cỏ thiên nhiên và
Chùm ngây làm thức ăn cho thỏ đã có nhiều
nghiên cứu. Nghiên cứu của Bharali và ctv
(2003). khi sử dụng bột lá Chùm ngây thay
thế khô dầu phộng 0, 20, 40, 60, 80 và 100%
trong khẩu phần nuôi thỏ lai khai thác thịt.
Kết quả cho thấy bột lá Chùm ngây có thể
thay thế 60% khô dầu phộng. Riêng Chùm
Ngây còn có thêm tác dụng làm tăng sự thải
loại cholesterol qua phân.
Tuy đã có nhiều công trình nghiên cứu
về giá trị dinh dưỡng của Chùm ngây nhưng
đến nay vẫn còn rất ít các công trình nghiên
cứu sử dụng Chùm ngây như nguồn thức ăn
xanh cho gia súc như rau Muống, rau Lang.
Vì vậy, chúng tôi tiến hành khảo sát “ảnh
hưởng của Chùm ngây (Moringa oleifera)
trong khẩu phần đến tiêu hóa dưỡng chất
của thỏ thịt lai”.
CỨU
2.1. Địa điểm và thời gian tiến hành thí
nghiệm
Thí nghiệm được nghiên cứu ở trại
nghiện cứu và thực nghiệm nông nghiệp
Trường Đại học Cần Thơ từ tháng 7 đến
tháng 9 năm 2014.
2.2. Bố trí thí nghiệm
Ba mươi sáu thỏ thịt lai có khối lượng
1,6 ± 0,5 kg/con, được bố trí hoàn toàn ngẫu
nhiên với 04 nghiệm thức và 03 lần lặp lại.
Mỗi lần lặp lại nuôi 4 con thỏ (2 đực, 2 cái)
nuôi trong 01 ô chuồng với kích thước 60 x
50 x 40 cm. Thời gian thí nghiệm 03 tuần
trong đó 2 tuần nuôi thích nghi và 1 tuần lấy
số liệu tiêu hóa.
CN0: 0% Chùm ngây và 100% cỏ lông
tây (tính trên VCK)
CN30: 30% Chùm ngây và 70% cỏ lông
tây (tính trên VCK)

KHKT Chăn nuôi Số 12 - 2014 45

DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI

CN70: 70% Chùm ngây và 30% cỏ lông Thỏ được cách ly, theo dõi tình trạng
tây (tính trên VCK) sức khoẻ, được tiêm phòng những bệnh
CN100: 100% Chùm ngây (tính trên VCK) thường gặp ở thỏ như cầu trùng, ghẻ, tiêu
chảy... Chuồng được che chắn ánh nắng.
Chùm ngây được trồng tại trại nghiên
Lồng nuôi, máng ăn được phun xịt thuốc sát
cứu và thực nghiệm nông nghiệp của
khuẩn cẩn thận trước khi đưa vào thí
trường. Cỏ lông tây được cắt hằng ngày ở
nghiệm. Quy trình chăm sóc nuôi dưỡng
khu vực quanh trường. Tất cả thức ăn xanh
được thực hiện đồng đều trên các đơn vị thí
sẽ được cho ăn phần thân lá và ngọn. Thức
nghiệm. Quét dọn vệ sinh chuồng lồng và
ăn hỗn hợp viên Proconco C225 được bổ
nền chuồng sạch sẽ. Rửa máng đựng nước
sung 5-15g viên thức ăn/con/ngày tuỳ giai
và thay nước uống).
đoạn.
Bảng 1. Thành phần hóa học (%) thức ăn sử dụng trong thí nghiệm
Tính trên % DM
Chỉ tiêu DM
CP NDF ADF Ash
Chùm ngây 18,45 22,68 22,81 17,71 8,29
Cỏ lông tây 20,2 11,9 55,5 34,8 13,6
TA hỗn hợp 90,9 19,9 24,4 7,64 11,6

Ghi chú: DM vật chất khô, CP protein thô, CF xơ thô, NDF xơ trung tính, ADF xơ acid, Ash khoáng tổng số.

Bảng 2. Giá trị dinh dưỡng (%) của khẩu (2001) ADF, NDF theo qui trình Van Soest và
phần thí nghiệm Robertson (1991).
Khẩu phần thí nghiệm Mẫu phân của từng đơn vị thí nghiệm
Chỉ tiêu cũng được thu và cân khối lượng vào buổi
CN0 CN30 CN70 CN100
sáng và buổi chiều, được bảo quản bằng
CP 11,90 15,14 19,45 22,68
H2SO4 và được trữ lạnh ở nhiệt độ -20oC. Khi
NDF 55,5 45,69 32,62 22,81 phân tích mẫu được rã đông để xác định
hàm lượng CP tính trên phân tươi, các thành
2.3. Các chỉ tiêu theo dõi và phương pháp phần còn lại được sấy khô nghiền mịn phân
thu thập số liệu tích tương tự như mẫu thức ăn.
Xác định lượng thức ăn ăn vào: Thức ăn Chỉ tiêu sinh lý máu: Số lượng hồng cầu,
được cân vào buổi sáng và buổi chiều trước bạch cầu, tiểu cầu, công thức bạch cầu, hàm
khi cho thỏ ăn đảm bảo cho thỏ ăn dư so với lượng hemoglobin, tỷ lệ hồng cầu
nhu cầu rồi cân lại thức ăn thừa vào sáng (hematocrit)... Thỏ được bỏ đói 24 giờ, mỗi
hôm sau. Thức ăn ăn vào và thức ăn thừa nghiệm thức lấy máu 04 con (02 đực và 02
được xác định vật chất khô để tính tiêu tốn. cái). Các chỉ tiêu sinh lý máu được xác định
bằng máy phân tích máu tự động
Xác định tỷ lệ tiêu hoá toàn phần theo
CELLDYN-1700 của Đức. Máu thỏ được lấy
McDonald và ctv (2002): Để xác định tỷ lệ
tứ tĩnh mạch tai, lượng mẫu máu lấy là 1-2
tiêu hoá, cho ăn, thức ăn thừa, phân được
ml sau đó cho vào ống nghiệm có sẵn chất
lấy mẫu hằng ngày. Sau khi kết thúc thí
chống đông EDTA và phân tích tại trạm xá
nghiệm mẫu được phân tích xác định DM,
thú y của trường Đại học Cần Thơ.
OM, CP, khóang theo phương pháp AOAC

46 KHKT Chăn nuôi Số 12 - 2014

 DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
2.4. Xử lý số liệu
Số liệu được xử lý theo mô hình tuyến
tính tổng quát (General Linear Model) và
được thực hiện trên Minitab (Minitab
Release 13.2) (2000). Độ khác biệt ý nghĩa
của các giá trị trung bình trong và giữa các
nghiệm thức (NT) được xác định theo
Tukey, với alpha < 0,05.
3. KẾT QUẢ VÀ THẢO LUẬN
3.1. Lượng dưỡng chất ăn vào của thỏ thí
nghiệm
Bảng 3. Lượng dưỡng chất ăn vào (g/con/ngày) của thỏ trong thí nghiệm
Nghiệm thức
Khẩu phần
CN0 CN30
DM 98,13b 107,47a
CP 11,68d 16,27
NDF 54,46 a 49,11 b
Ghi chú: a, b các giá trị ở cùng hàng mang ít nhất một chữ ký hiệu chung không sai khác nhau ở P = 0,05.
Lượng ăn vào của vật chất khô, protein
thô, xơ trung tính của thỏ trong giai đoạn thí
nghiệm tiêu hoá khác biệt rất có ý nghĩa
thống kê ( P< 0,001). Lượng vật chất khô ăn
vào cao nhất ở khẩu phần có Chùm ngây
(107,47-112,89g/con/ngày). Kết quả này cao
hơn kết quả Nguyen Thi Kim Dong và ctv
(2006) là RM (79,5g/con/ngày) và RMLT
(82,3g/con/ngày), tuy nhiên kết quả này
tương đương so với báo cáo của Doan Thi
Gang và ctv (2006). Theo Doan Thi Gang và
ctv (2006) thì mức ăn vào của thỏ rất cao 119-
139g/con/ngày khi cho thỏ ăn khẩu phần rau
muống có hoặc không có kết hợp với cỏ
Guinea, rau Lang và phù hợp với kết quả
của Nguyễn Thị Xuân Linh (2008) với khả
năng DM ăn vào 100-139g/con/ngày khi cho
thỏ ăn khẩu phần rau Lang thay thế cỏ Lông
tây ở các mức độ khác nhau.
Lượng protein thô ăn vào ở khẩu phần
có Chùm ngây cao hơn so với nghiệm thức
KHKT Chăn nuôi Số 12 - 2014
Nhiều nghiên cứu cho thấy bổ sung các
loại cây thức ăn giàu đạm trong khẩu phần
nghèo dinh dưỡng sẽ làm tăng hiệu quả sử
dụng thức ăn và tăng năng suất trên gia súc.
Chùm ngây là 1 loại cây có thành phần đạm
trong lá tương đối cao (22,68%) và được ưa
chuộng của thỏ. Ưu điểm của loại cây này,
ngoài hàm lượng đạm cao, là rất dễ trồng
trong điều kiện khí hậu nhiệt đới, dễ thu
hoạch và không cần quá nhiều công chăm
sóc (Đặng Thùy Nhung, 2008).
SEM P
CN70 CN100
112,89a 110,56a 1,62 0,001
c 21,95 b 25,08 a 0,29 0,001
36,82 c 25,29 d 0,64 0,001
có ăn cỏ lông tây. Sự khác biệt này là do
Chùm ngây có hàm lượng protein thô cao,
do đó khi cho thỏ ăn khẩu phần 100% Chùm
ngây thì lượng đạm ăn vào cao. Kết quả này
phù hợp với kết quả của Doan Thi Gang và
ctv (2006) là 20,1 - 25,4 g/con/ngày và kết quả
của Pok Samkol và ctv, (2006) đưa ra khả
năng ăn vào của thỏ ở khẩu phần rau muống
được cho ăn với các mức độ khác nhau của
tấm là 19,9 - 22,9 g/con/ngày. Tỷ lệ tiêu hóa
của thỏ trưởng thành có mối liên hệ với
nguồn protein (Maertens và Groote, 1984).
Theo cách này protein đến từ thức ăn hỗn
hợp và hạt ngũ cốc thì tiêu hóa tốt (cao hơn
70%) trong khi đó protein ít nhiều có liên kết
với xơ thì có giá trị thấp hơn (55-70%) (Just
và ctv, 1985).
Hàm lượng NDF ăn vào của nghiệm
thức ăn cỏ lông tây cao hơn so với nghiệm
thức giảm cỏ lông tây. Điều này do hàm
lượng xơ trung tính cỏ lông tây cao (55,5%)
47
DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
dẫn đến lượng xơ trung tính tiêu thụ cao
hơn ở những khẩu phần có cỏ Lông tây.
3.2. Tỷ lệ tiêu hoá dưỡng chất của khẩu
phần thỏ thí nghiệm.
Bảng 4. Tỷ lệ tiêu hoá dưỡng chất (%) của khẩu phần thỏ trong thí nghiệm
Nghiệm thức
Dưỡng chất
CN0 CN30
DMD 64,98b 65,27b
OMD 66,89b 67,15b
CPD 64,69b 66,93b
NDFD 38,92b 42,65
Ghi chú: a, b các giá trị ở cùng hàng mang ít nhất một chữ ký hiệu chung không sai khác nhau ở P = 0,05.
Tỷ lệ tiêu hoá DM (DMD) đạt giá trị cao
nhất ở nghiệm thức CN70 và CN100 có sự
khác biệt với nghiệm thức có tỉ lệ cỏ lông tây
cao. Bởi vì Chùm ngây có hàm lượng xơ
trung tính thấp hơn khá nhiều so với cỏ
Lông tây. Kết quả này thấp hơn kết quả của
Pok Samkol và ctv, (2006) nuôi thỏ bằng rau
Muống cho tỷ lệ tiêu hoá DM 73,5-78,3%. Kết
quả này phù hợp với Đào Hùng (2006) giá trị
DMD ở RM là 79,8% và RMCLT là 62,8% và
kết quả của Nguyen Thi Kim Dong và ctv
(2006) khi nuôi thỏ bằng lá rau Muống thay
thế cỏ Lông tây có tỷ lệ tiêu hóa dao động
trong phạm vi 62,7-73%.
Tỷ lệ tiêu hóa OM (OMD) trong thí
nghiệm từ 66,89 đến 73,10% có sự khác biệt rõ
giữa nghiệm thức cho thỏ ăn Chùm ngây với
nghiệm thức có tỉ lệ cỏ lôn tây cao. Kết này
cũng phù hợp với Nguyen Thi Kim Dong và
ctv (2006) ở nghiệm thức RM và RMCLT là
80,6% và 63,3%. Theo Olabanji và ctv (2007) là
68,8-81,4% khi cho ăn các mức độ Dã qùy
khác nhau trong khẩu phần của thỏ.
Tỷ lệ tiêu hóa protein thô (CPD) khác
biệt có ý nghĩa thống kê (P=0,001) tuy nhiên
giữa các nghiệm thức CN70 và CN100 không
48
Thông thường, giữa tỷ lệ tiêu hóa và
lượng ăn vào có một mối liên quan nhất
định, và thông thường thì loại thức ăn nào
càng được tiêu hóa nhiều thì lượng ăn vào
của loại thức ăn đó bởi gia súc nhai lại sẽ
càng tăng.
SEM P
CN70 CN100
71,42a 70,53a 0,4 0,001
73,10 a 72,56a 0,52 0,001
69,85 a 71,11a 0,063 0,001
43,86a 45,44a 0,80 0,003
có sự khác biệt nhau. Với thí nghiệm CN70
và CN100 có tỷ lệ tiêu hoá CP lần lượt là
69,85% và 71,11%. Kết quả này thấp hơn với
kết quả Nguyen Thi Kim Dong và ctv (2006)
ở nghiệm thức RM và RMCLT là 86,0% và
79,9% và của Pok Samkol và ctv (2006) cho tỷ
lệ tiêu hoá CP từ 77,9 đến 80,1%.
Tỷ lệ tiêu hóa NDF thay đổi từ 38,92%
đến 45,44% và có sự khác biệt giữa các
nghiệm thức (P = 0,003), kết quả này thấp
hơn Nguyen Thi Kim Dong và ctv (2006) ở
nghiệm thức RM và RMCLT là 62,9% và
37,8%. Kết quả nầy cũng thấp hơn nghiên
cứu của Nguyễn Thị Xuân Linh (2008) với
khẩu phần bổ sung 40% và 60% rau muống
thay thế cỏ lông tây có tỷ lệ tiêu hoá NDF là
62,9% và 70,1%. Mức độ xơ cao trong khẩu
phần dẫn đến giảm thời gian lưu lại của thức
ăn trong đường tiêu hóa và làm tăng việc
sản xuất phân mềm bởi vì có sự gia tăng
họat động các vi khuẩn phân giải xơ vì vậy
làm giảm khả năng tiêu hóa của khẩu phần.
Kết quả cho thấy tỷ lệ tiêu hóa dưỡng
chất (%) của thỏ trong các nghiệm thức luôn
có khuynh hướng cao khi thỏ được bổ sung
thêm lá Chùm ngây vào khẩu phần.
KHKT Chăn nuôi Số 12 - 2014
 DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI

3.4. Các chỉ tiêu sinh lý máu thỏ thí nghiệm

Bảng 5. Các chỉ tiêu sinh lý máu của thỏ thí nghiệm
Nghiệm thức
Chỉ tiêu SEM P
CN0 CN30 CN70 CN100
RBC (1012/l) 4,88 4,88 4,97 5,06 0,24 0,62
HGB (g/l) 99,17 97,34 99,67 100,50 3,90 0,58
HCT (l/l) 0,32 0,32 0,33 0,33 0,02 0,69
MCV (fl) 65,99 64,79 66,57 65,40 1,15 0,38
MCHC (g/l) 303,58 303,10 305,95 308,40 2,52 0,32
RDW, % 14,65 14,42 14,22 14,84 0,52 0,37
WBC (10 /l)
9 8,75 8,94 9,47 9,12 1,41 0,53
LYM (109/l) 4,38 4,90 5,30 5,20 1,57 0,73

Ghi chú: RBC hồng cầu, HGB hemoglobin, HCT hematocri, MCV thể tích trung bình hồng cầu, MCHC nồng độ
huyết sắt tố trung bình của hồng cầu, RDW hồng cầu lưới, WBC bạch cầu, LYM lâm ba cầu,

Số lượng hồng cầu trung bình của thỏ là
4,0-6,5 x 1012/l (Trịnh Hữu Hằng và ctv, 2007).
Trong thí nghiệm của chúng tôi cho biết số
lượng hồng cầu thay đổi 4,88- 5,06 x 1012/l.
Hàm lượng hemoglobin ở trên các loài động
vật hữu nhũ dao động 65-136g/l (Nguyễn
Quang Mai và ctv, 2004). Trong thí nghiệm
này cho thấy hemoglobin của máu thỏ thay
đổi 99,17-100,5 g/l. Chỉ số hematocrit hầu hết
trên loài gia súc phải nhỏ hơn 50% vì nếu lớn
hơn sẽ có hiện tượng thiếu máu. Trong
nghiên cứu của chúng tôi cho thấy thỏ có chỉ
số hematocrit dao động 32-33%.
Nguyễn Quang Mai và ctv (2004) cho
biết số lượng bạch cầu trung bình của thỏ là
8 x 109/l và dao động trong phạm vi 6-12 x
109/l, lâm ba cầu chiếm 35-45%, bạch cầu
trung tính 45-55% và nhóm đơn cầu, bạch
cầu ưa axit và bạch cầu ưa bazơ 6-14%. Một
thí nghiệm của Ahamefule và ctv (2006)
được thực hiện tại Nigeria cho thấy tế bào
bạch cầu (WBC) của thỏ lai (Newzealand x
Chinchilla) thay đổi 5,8-7,3 x 109/l, trong đó
bạch cầu trung tính chiếm 37,5-43,3% và lâm
ba cầu chiếm 56,5-60,8%.
Kết quả nghiên cứu của chúng tôi có giá
trị WBC dao động 8,75- 9,47 x 109/l, lâm ba
cầu chiếm 48-62%, bạch cầu trung tính 29,5-
34,8%, nhóm bạch cầu MID (bao gồm đơn
cầu, bạch cầu ưa axit, bạch cầu bazơ và các
bạch cầu nguyên bào khác) 15,4-18,8%. Số
lượng tiểu cầu ước lượng được trên loài
động vật hữu nhũ thay đổi từ 100 x 109/l đến
600 x 109/l (Nguyễn Quang Mai và ctv, 2004).
Thỏ trong thí nghiệm nàu đều có các chỉ
số sinh lý máu bình thường chứng tỏ việc
cho thỏ ăn Chùm ngây không ảnh hưởng
đến sự phát triển và tăng trưởng bình
thường của thỏ.
4. KẾT LUẬN
Ở mức độ 70% Chùm ngây trong khẩu
phần nâng cao khả năng tiêu thụ thức ăn,
tăng tỉ lệ tiêu hoá dưỡng chất. Sử dụng lá
Chùm ngây không có sự khác biệt đáng kể
về các chỉ tiêu sinh lý máu của thỏ thịt lai.
Có thể sử dụng Chùm ngây làm thức
ăn nuôi thỏ để thay thế các loại thức ăn
khác ngày càng kham hiếm.
TÀI LIỆU THAM KHẢO
1. Ahamefule F.O., G.O. Eduok, A. Usman, K.U.
Amaefule, B.E. Obua and S.A. Oguike (2006),

KHKT Chăn nuôi Số 12 - 2014 49

DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
“Blood biochemistry and haematology of
weaner rabbits fed sundried, ensiled and
fermented cassava peel based diets”, Pakistan
Journal of Nutrition, 5(3): 248-253
2. AOAC (2001), Official methods of analysis,
Association of official Analytical chemists,
Washington D.C, Page: 255-275.
3. Bharali R., J. Tabassum, M.R.H. Azad (2003).
"Chemomodulatory effect of Moringa oleifera,
Lam, on hepatic carcinogen metabolizing
enzymes, antioxidant parameters and skin
papillomagenesis in mice". Asian Pac J Cancer
Prev., 4(2): 131-139.
4. Nguyen Thi Kim Dong, Nguyen Van Thu,
Brian Ogle and T.R. Preston (2006), “Effect of
suppplementation level of water spinach
(Ipomoea aquatica) leaves in diets based on
para grass (Brachiaria mutica) on intake,
nutrient utilization, growth rate and economic
of crossbred rabbits in the Mekong Delta of
Vietnam, Proceedings of SAREC/Sida, Workshop
on Forages for pigs and Rabbits in PhnomPenh,
Campuchia, 22-24 August 2006, Page: 169-175.
5. Doan Thi Gang, Khuc Thi Hue, Dinh Van Binh
and Nguyen Thi Mui (2006), Effect of Guinea
grass on feed intake, digestibility and growth
performance of rabbits fed a molasses block and either
water spinach (Ipomoea aquatica) or sweet potato
(Ipomoea batatus L) vines, Goat and rabbit
research Center, Son Tay, Ha Tay provine, from
http://www.mekan.org/proprf/kimd3.htm
6. Trịnh Hữu Hằng, Đỗ Công Huỳnh (2007), Sinh
lý người và động vật, tập 2, NXB Đại Học Quốc
Gia, Hà Nội. Trang: 65-93.
7. Đào Hùng (2006), Đặc điểm, tính năng sản xuất và
ảnh hưởng các mức độ đạm thô trên tăng trưởng,
khả năng ăn vào, tỷ lệ tiêu hóa và tích lũy đạm của
thỏ lai, Luận văn thạc sĩ ngành chăn nuôi, Khoa
Nông Nghiệp và Sinh Học Ứng Dụng, Trường
Đại học Cần Thơ.
8. Just A., H. Jorgensen and J.A. Femandenz
(1985), livestock production science, 12: 145-159.
9. Nguyễn Thị Xuân Linh (2008), Ảnh hưởng của
rau muống (Ipomoea aquatica) trong khẩu phần cơ
50
bản cỏ lông tây (Brachiaria Mutica) trên năng suất
thịt và sinh sản của thỏ thịt lai tại Đồng Bằng Sông
Cửu Long, Luận văn thạc sĩ ngành chăn nuôi,
Khoa Nông Nghiệp và Sinh Học Ứng Dụng,
Trường Đại học Cần Thơ.
10. Maertens L. and Groote G.De (1984),
Proceedings of the III World rabbit Science
Association Congress. Budapest (3), Page: 42-52.
11. Nguyễn Quang Mai, Trần Thị Loan và Mai
Văn Hưng (2004), Sinh lý học động vật và người,
NXB Khoa học kỹ thuật, Hà Nội
12. McDonald P., R.A. Edwards, J.F.D. Greenhagh
and C.A. Morgan (2002), Animal Nutrition (6th
edition), Longman Scientific and Technical, N.
Y., USA.
13. Minitab (2000), Minitab Reference Manual, PC
Version, Release 13.2. Minitab Inc., State
College, PA.
14. Đặng Thùy Nhung (2008), “Thành phần dinh
dưỡng của lá cây M.oleifera làm thức ăn gia
súc”. Tạp chí khoa học và phát triển. VI(1): 38-41.
15. Olabanji R.O., G.O. Farinu, J.A. Akinlade and
O.O. Ojebiyi (2007), “Growth performance,
organ characteristic and carcass quality of
weaner rabbits fed different levels of wild
sunflower (Tithonia diversifolia Hemsl A. Gray)
leaf-blood meal mixture”. Int. J. Agric. Res., 2:
1014-1021.
16. Pok Samkol, T.R. Preston and J. Ly (2006),
Effect of increasing offer level of water spinach
(Ipomoea aquatica) on intake, growth and
digestibility coefficients of rabbits, livestock
research for Rural Development, volume 18,
Article #22. Retrieved, from
http://www.cipav.org.co/Irrd18/02/samk18022.h
tm.
17. Van Soest P.J., J.B. Robertson and B.A. Lewis
(1991), “Carbohydrate methodology,
metabolism and nutritional implications in
dairy cattle: methods for diatary fibre, and
nonstarch polysaccharides in relation to animal
nutrition”, J. Dairy Sci., 74: 3585-3597.
KHKT Chăn nuôi Số 12 - 2014
G.J.B.A.H.S.,Vol.3(3):112-115 (July-September, 2014) ISSN: 2319 – 5584

DEVELOPMENT OF HYMENACHNE ACUTIGLUMA AND PASPALUM ATRATUM

PASTURE ON SEASONALLY WATERLOGGED SOIL AND ITS USE AS BASAL DIET
FOR DAIRY CATTLE UNDER HOUSEHOLD CONDITIONS
Nguyen Thi Hong Nhan1, Nguyen Van Hon1, Nguyen Thiet1, Lam Thai Hung2, Nguyen Hong Xuan3, &
Nguyen Trong Ngu1*
1
College of Agriculture and Applied Biology, Can Tho University, Vietnam
2
Cau Ngang Satellite, Tra Vinh University, Vietnam
3
Can Tho University of Technology, Vietnam
*Corresponding Author
Abstract
The first experiment was set up in a field of 500 m2 to determine the productivity and nutritional value of
Hymenachne acutigluma and Paspalum atratum grasses planted on waterlogged soil. Results showed that two kinds of
grasses were similar in biomass and nutritive values. The second experiment was conducted in an 800 m2 area, Paspalum
grass was planted at different spacings in wet land of approximately 20 cm in depth. No significant differences were
found on grass fresh and dry yield. The third study was carried out in dairy farms of Soctrang province for 64 days. Three
households were involved in the study, in each household five cows were kept individually and offered three treatments
with Paspalum grass fed ad lib supplemented with either concentrate or cottonseed cake or a combination of cottonseed
cake and Trichanthera foliage. Milk parameters and feed conversion to milk were not affected by treatments.
Key words: Hymenachne acutigluma, Paspalum atratum, plant spacing, lactating cows, Trichanthera supplementation.

1. Introduction
Many programs and policies have been made recently by local governments in the Mekong Delta to help farmers
alleviating their poverty; one of which was the practice of raising dairy cattle. When the dairy herd expanded, the demand
for feed resources increased and thus the introduction of grass as basal diet became essential. Recently, Hymenachne
acutigluma and Paspalum atratum have been proven to be appropriate under low fertility and acidic soils and specially
their ability to resist to waterlogged condition. In addition, they can be supplied as basal diet to dairy cattle but protein
addition source such as cottonseed cake is required for better performance of the animals. However, the use of cottonseed
cake is also limited because (i) a high level of gossypol contained in cottonseed cake may negatively influence milk
production (Rogers Glemn and Poore, 1995) and (ii) in many cases the use of cottonseed cake does not ensure net profits
to farmers due to its high cost. Hence, the search for alternative feeds for supplementation is still needed.
The multi-purpose tree Trichanthera gigantea, introduced into Vietnam from Colombia in 1991 has adapted readily
to a wide range of ecosystems throughout Vietnam (Ha and Phan, 1995; Nhan et al., 1996). The crude protein content of
the foliage (leaves and the thin stems consumed by the animals) varies from 18 to 20%. This kind of tree has been used to
partly replace the protein source for laying hens and duck ration with positive results obtained (Nhan et al., 1997). In
ruminant, the use of Trichanthera was also reported in lactating goats (Duyen et al., 1996), but so far data on the
supplementation of Trichanthera to dairy cattle diets has been insufficient. Therefore, the present research was done to (i)
examine the productivity, quality and persistence of Hymenachne acutigluma and Paspalum atratum on seasonally
waterlogged land, (ii) determine an optimal plant spacing (plant density) for Paspalum atratum production at
waterlogged condition and (iii) evaluate the effectiveness of Trichanthera and cottonseed cake supplementation on milk
production of dairy cattle consuming Paspalum atratum as a basal diet.

2. Materials and Methods

Trial 1 was conducted in Soctrang province where the system was expanded on former rice paddy land. The soil
was acidic (pH 4.0-4.5) and waterlogged for long periods during the wet season and then dried out in the dry season. The
land was first cleared from weeds, and then ploughed by tractor to a depth of 20-25 cm to loosen the soil. Weeds were
also removed twice during the establishment period.
The experiment was allocated in a completely randomized design consisting of two treatments and five replications
(equivalent to 10 plots). The plots were Hymenachne acutigluma and Paspalum atratum grass (Photo 1). The experiment
was set up in a field of 700 m2, of which 500 m2 were used for planting and 200 m2 as border areas. Hymenachne
acutigluma stems and Paspalum atratum tillers were planted at spacing of 50 x 50 cm. The first harvest was made at 90
days after planting and 45 days for the next cutting. At each harvest, four 0.25 m2 quadrates were cut 5 cm from ground
level in each plot. The fresh samples were weighed and a 200 g sub-sample from each plot was dried at 70oC for 48
hours. The dried samples were bulked across replicates and 3 samples per treatment were used for analysis.

Photo 1. Paspalum atratum (a) and Hymenachne acutigluma (b) grasses on seasonally waterlogged

112
G.J.B.A.H.S.,Vol.3(3):112-115 (July-September, 2014) ISSN: 2319 – 5584
After each sampling cut, the remaining forage in the plots was cut 5 cm above ground level before applying
fertilizer. All biomass from each plot were weighed to determine the fresh yield. The fresh biomass was sampled and
pooled from the 3 replicates (1.5 kg fresh weight each), and was placed in a porous paper bag for dry matter (DM)
determination and chemical analyses. A similar sample was collected to analyze on a DM basis. The content of crude
protein (CP) in the samples was determined according to the procedure of AOAC (1990).
Trial 2 was carried out in the same location to trial 1 but in the wet land of approximately 20 cm in deep water. A
randomized complete block design was used in this experiment. The grass was assigned to four blocks and there were
four treatments in each block which were randomly assigned. Thus, a total of 16 plots were used in a size about 800 m 2
with four treatments corresponding to with four plant spacings (20 x 50 cm; 30 x 50 cm; 40 x 50 cm; 50 x 50 cm).
Trial 3 was conducted in dairy farms in Soctrang province, where Khmer farmers have become familiar with the
practice of raising dairy cattle. Fifteen F1 (Holstein x Sindhi) lactating cows were allocated in a completely randomized
block design. Cows were allocated to treatments on the basis of milk yield, parity and days of lactation. There were three
households involved in the study to provide 5 replicates per treatment. In each family, five cows were housed in
individual stall and were offered three different treatments as follows:
Control: Paspalum grass ad lib + 0.4 kg concentrate/kg milk.
PC: Paspalum grass ad lib + 4 kg/day cottonseed cake.
PCT: Paspalum grass ad lib + 1 kg/day cottonseed cake + 1 kg Trichanthera (DM basis).
Before the experiments started, cows were drenched against internal parasites. The animals were housed in
individual shed separated from their calves and received free water and home-made mineral lick blocks at all time. They
were milked twice daily at 07:00 and 15:30 by hand milking followed by suckling residual milk of the calves. All
ingredients fed to cows were divided into three portions per day, grass and Trichanthera were mixed together to prevent
selection; molasses was mixed with urea and cottonseed cake was given as its normal form. During the first 15 days all
cows were fed the control diet. In the next 7 days the cows on treatments PC and PCT were adapted to the new diet. Milk
yield was measured on all diets for a further 6 weeks. The study lasted 64 days.
Collection parameters were feed intake, milk production and milk composition. Feed intake of grass and
Trichanthera were estimated daily by the difference between DM of amounts offered and refused. Milk production was
recorded daily as the sum of sucked and milked raw milk. Milk intake of the calves was determined by the weight-
suckle-weight technique every week (Williams et al., 1979). Milk sample was collected twice weekly at consecutive 5
a.m. and 15 p.m. milking and analyzed for total protein, butterfat lactose and total solids by the Milkotester machine.
Economic analysis was made using partial budget analysis based on increased costs and increased returns of the treated
animals.
Statistical analysis: the effects of treatments on milk yield and feed intake were subjected to ANOVA using the
General Linear Model procedure of Minitab 13.2. Covariance analysis was applied using initial milk yield on standard
diet as the covariant. When the F-test was significant, the Tukey's test for paired comparisons was used to compare
means.

3. Results and Discussion

There were no significant differences on biomass between treatments in both types of grass at different times of
cutting (Table 1). The average biomass of Paspalum atratum and Hymenachne acutigluma were 23.84 and 24.61
tonnes/ha/cutting in fresh in corresponding to 5.25 and 4.86 tonnes/ha/cutting in DM, respectively. Both of grasses were
well adapted to waterlogged soil and remained constant at production till the fourth cutting time. In our previous studies
(Nhan et al., 2009), the production of Paspalum atratum and Hymenachne acutigluma was 16.6 tonnes/ha/cutting in fresh
biomass, which was lower compared to the current research. This was because grass was influenced by flood for a longer
period and the first harvest was also shorter (60 vs. 90 days). However, the present finding was similar to the study of
Hare et al. (1999), who reported that Paspalum atratum grew well on wet and waterlogged acid soil and produced about
20 tonnes DM/ha during 6 wet months.
Table 1. Biomass of Paspalum atratum and Hymenachne acutigluma
Grass
Harvest time Paspalum Hymenachne SE P
atratum acutigluma
Fresh biomass, tonnes /ha
1st 24.10 24.08 0.95 0.99
2nd 23.57 24.33 1.09 0.64
3rd 24.09 25.48 1.32 0.84
4th 23.60 24.56 0.97 0.51
DM biomass, tonnes/ha
1st 5.00 4.52 0.19 0.14
2nd 5.53 5.00 0.27 0.22
3rd 5.25 5.00 0.22 0.46
4th 5.20 4.91 0.22 0.39
CP biomass, tonnes/ha
1st 0.436 0.460 0.03 0.57
2nd 0.483 0.456 0.02 0.39
3rd 0.492 0.488 0.03 0.90
4th 0.478 0.472 0.02 0.85
Hymenachne acutigluma was a native grass that has been used by farmers in fattening cattle (Nhan et al., 2005) and
planted for long time in the Mekong Delta but Paspalum atratum has just been fed to ruminants in a few years and it

113
G.J.B.A.H.S.,Vol.3(3):112-115 (July-September, 2014) ISSN: 2319 – 5584
appeared to be well suited for smallholder dairy farmers. From this point, the second experiment was done for evaluation
of plant spacing on Paspalum atratum production in waterlogged condition (Table 2).
There were influences of spacing on the first and second harvest but no changes in the third and fourth cutting
among treatments. In the first two harvests, biomass from spacing treatment of 20 x 50 cm was higher compared to
others, particularly that of treatment 50 x 50 cm. This could be explained by the difference in density or number of plants
per size as narrower spacing had more plants at the same plot in comparison with wider space. Nevertheless, this
tendency has changed in the third and fourth harvest, when high density of grass required more fertilization leading to
nitrogen deficiency and this phenomenon affected Paspalum production in the following years (Phaikaew et al., 2001). In
addition, Hare et al. (2004) showed that Jarra digit (Digitaria milanjiana cv.) swards planted in narrow rows produced
more DM twice as dense and had fewer weeds than swards planted in wide rows but at the second cut (6 months after
planting), row spacing had no influence on DM yield of Jarra digit.
Table 2. Biomass of Paspalum atratum grass at different spacings
Spacing (cm)
Harvest time SE P
20 x 50 30 x 50 40 x 50 50 x 50
Fresh biomass, tonnes /ha
1st 26.58a 21.13ab 16.64b 17.54b 1.85 0.01
nd a a ab
2 25.86 24.6 22.83 20.70b 0.77 0.003
3rd 26.11 25.66 24.91 22.07 1.33 0.19
4th 24.97 23.80 24.21 23.71 0.45 0.23
DM biomass, tonnes/ha
1st 6.29a 5.00ab 4.05ab 4.50b 0.44 0.02
nd ab a b
2 5.36 5.53 4.77 4.73b 0.17 0.01
3rd 5.18 5.64 5.20 4.61 0.27 0.12
4th 4.94 4.73 4.86 4.74 0.09 0.31
CP biomass, tonnes/ha
1st 0.574a 0.461ab 0.322b 0.364b 0.04 0.003
nd ab a b
2 0.584 0.650 0.531 0.538b 0.02 0.03
3rd 0.562 0.574 0.567 0.480 0.03 0.13
4th 0.454 0.459 0.458 0.438 0.09 0.30
In trial 3, DM intake was similar in all diets and tended to be higher in control treatment (Table 3). Similarly, there
were no influences on milk yield, milk composition and FCR among treatments (Table 3). However, PCT treatment had
higher profit compared to control and did not differ from that of PC. This difference was partly due to the replacement of
protein sources from Trichanthera foliage.
Table 3. Effects of different treatments on DM intake and milk parameters
Treatments
Parameters SE P
Control PC PCT
Dry matter intake, kg/d 11.10 10.95 10.55 0.18 0.11
*
Milk parameters
Milk yield, kg/d 10.88 10.85 10.19 0.21 0.06
Fat, % 4.30 4.31 4.06 0.09 0.13
Protein, % 3.68 3.42 3.34 0.13 0.21
Lactose, % 4.92 4.74 4.55 0.15 0.28
FCR, kg milk 1.03 1.01 1.04 0.02 0.62
Profit, VND/kg milk** 2900a 3300b 3400b 77.1 0.003
a,b
Means without common superscript along rows are significantly different at P<0.05
*
Covariance analysis were applied using initial milk yield on standard diet as the covariant
**
1USD is equivalent to 21,180 VND
PC: Paspalum grass ad lib + 4 kg/day cottonseed cake.
PCT: Paspalum grass ad lib + 1 kg/day cottonseed cake + 1 kg Trichanthera (DM basis).
Normally, plant protein is available in wide nature and transportation fee was free or only small amount of money
was needed. Thus, lower investment per kg milk as well as the increased benefit from buying their milk was attained. It
was also concluded by Topps (1997) that the most effective way to enhance energy intake and performance of animals
fed on crop residues was to provide them with good quality forages, including forage legumes.

4. Conclusions
Paspalum atratum and Hymenachne acutigluma were well-adapted in waterlogged condition and produced similar
production and plant spacing had no influence on Paspalum atratum production by cutting time.
Dairy cattle consuming Paspalum atratum solely supplemented with cottonseed cake or combined with
Trichanthera as a replacement of concentrate had similar milk production.

Acknowledgments
The authors would like to express sincere appreciation to the Swedish International Development Agency (Sida),
Department for Research Cooperation with Developing Countries (SAREC), through the MEKARN regional project for
funding this work and farmers of the Evergrowth dairy cooperative for their support.

114
G.J.B.A.H.S.,Vol.3(3):112-115 (July-September, 2014) ISSN: 2319 – 5584
5. References
AOAC (1990). Official methods of analysis. 15th ed. Association of Official Analytical Chemists, Arlington, VA.
Phaikaew, C., Khemsawat, C., Tudsri, S., Ishii, Y., Numaguchi, H. and Tsuzuki, E. (2001). Effects of plant spacing and sowing time
on seed yield and seed quality of Paspalum atratum in Thailand. Tropical Grasslands, 35: 129–138.
Hare, M.D., Booncharern, P., Tatsapong, P., Wongpichet, K., Kaewkunya, C. and Thummasaeng, K. (1999). Performance of Para
grass (Brachiaria mutica) and Ubon paspalum (Paspalum atratum) on seasonally wet soils in Thailand. Tropical Grassland, 33: 75–
81.
Hare, M.D., Tatsapong, P., Lunpha, A. and Wongpichet, K. (2004). Effect of plant spacing, cutting and nitrogen on establishment and
production of Digitaria milanjiana cv. Jarra in north-east Thailand. Tropical Grasslands, 38: 217 –226.
Ha, N.N. and Phan, P.T. (1995). Vegetative propagation capacities and effect of fertilization on biomass production of Trichanthera
gigantea. Livestock Research for Rural Development, 7(1).
Duyen, N.T., Bien, L.T., Mui, N.T., Binh, D.V. and Preston, T.R. (1996). Foliage of Trichanthera gigantea, Jackfruit (Artocarpus
heterophyllus) banana (Musa sp) as protein resources for lactating goats fed a basal diet of rice straw and sugar cane tops. Livestock
Research for Rural Development, 8(3): http://cipav.org.co/lrrd.
Nhan, N.T.H., Man, N.V. and Preston, T.R. (2009). Biomass yield of Hymenachne acutigluma and Paspalum atratum in association
with Sesbania sesban on seasonally waterlogged soils and their use as feeds for cattle in the Mekong Delta, Vietnam. Livestock
Research for Rural Development 21(8), http://www.lrrd.org/lrrd21/8/nhan21121.htm.
Nhan, N.T.H., Hon, N.V., Son, V.V., Preston, T.R. and Dolberg, F. (1996). Effect of shade on biomass production and composition of
the forage tree Trichanthera gigantea. Livestock Research for Rural Development, 8(2).
Nhan, N.T.H., Preston, T.R. and Dolberg, F. (1997). Use of Trichanthera gigantea leaf meal and fresh leaves as livestock feed.
Livestock Research for Rural Development, 9(1), http://www.cipav.org.co/lrrd/lrrd9/1/nhan91.htm.
Nhan, N.T.H., Son,V.V., Preston , T.R. and Leng, R.A. (2005). Effect of an oil drench on growth rate of cattle fattened on grass,
supplemented with molasses, rice bran or rice straw. Livestock – based sustainable farming systems in the lower Mekong basin, 65-
69.
Rogers, G.M. and Matthew, H.P. (1995). Optimal feeding management of Gossypol-containing diets for beef cattle. Journal of
Veterinary Medicine: 90:994, 996-1005.
Topps, J.H. (1997). Forage legumes as protein supplements to poor quality diets in the semi-arid tropics. In: Wallace, R.J and
Lahloukassi, A. (Eds.), Rumen Ecology Research Planning. Proceedings of workshop held at ILRI, 13-18 March 1995, Addis Ababa,
Ethiopia.
Williams, J.H., Anderson, D.C. and Kress, D.D. (1979). Milk production in Hereford cattle. 1. Effects of separation interval on weigh-
suckle-weigh milk production estimates. Journal of Animal Science, 49(6): 1438-1442.

115
Journal of Experimental Biology and Agricultural Sciences, December - 2015; Volume – 3(VI)

Journal of Experimental Biology and Agricultural Sciences

http://www.jebas.org

ISSN No. 2320 – 8694

EFFECTS OF GENETIC POLYMORPHISMS ON EGG PRODUCTION IN

INDIGENOUS NOI CHICKEN

Nguyen Trong Ngu1,*, Nguyen Hong Xuan2, Chau Thanh Vu1, Nguyen Trong An3, Tran Nhan Dung4
and Nguyen Thi Hong Nhan1
1
College of Agriculture and Applied Biology, Can Tho University, Can Tho, Vietnam
2
Faculty of Food Technology and Biotechnology, Can Tho University of Technology, Can Tho, Vietnam
3
National Chung Hsing University, 250 Kuo Kuang Rd., Taichung 402, Taiwan R.O.C.
4
Biotechnology Research and Development Institute, Can Tho University, Can Tho, Vietnam

Received – September 19, 2015; Revision – October 16, 2015; Accepted – November 18, 2015
Available Online – December 15, 2015

DOI: http://dx.doi.org/10.18006/2015.3(6).487.493

KEYWORDS
ABSTRACT
Candidate gene
The aim of this study was to evaluate the genetic potential of candidate genes involved in egg yield of
PCR-RFLP Noi chicken, a popular backyard chicken breed in the Mekong Delta of Vietnam with limited egg
production. A total of 130 hens were individually stalled for daily egg record in 20 weeks. Feather
Total egg number
samples were collected for DNA extraction and genotyping was carried out using PCR-RFLP method.
Five genes, namely DRD2 (Dopamine receptor 2), IGF-I (Insulin-like growth factor I), NPY
Noi chicken
(Neuropeptide Y), VIP (Vasoactive intestinal polypeptide) and VIPR-1 (Vasoactive intestinal peptide
receptor 1) were used in the present work. It was shown that allele frequencies of DRD2/BseGI,
VIP/VspI and VIPR-1/HhaI polymorphisms were of great discrepancy in Noi chicken population and
there were significant associations between genotypes and egg numbers (P<0.05). Furthermore,
chickens carrying DD (NPY/DraI), CC (VIPR-1/TaqI) and CC (VIPR-1/HhaI) genotypes had highest
egg production with 50.9, 49.8 and 50.4 eggs/hen/20 laying weeks, respectively. These results provide
an alternative for breeding selection of Noi chicken towards improving egg production.

All the article published by Journal of Experimental

* Corresponding author
Biology and Agricultural Sciences is licensed under a
E-mail: ntngu@ctu.edu.vn (Nguyen Trong Ngu) Creative Commons Attribution-NonCommercial 4.0
International License Based on a work at www.jebas.org.
Peer review under responsibility of Journal of Experimental Biology and
Agricultural Sciences.

Production and Hosting by Horizon Publisher

(http://publisher.jebas.org/index.html).
All_________________________________________________________
rights reserved.
Journal of Experimental Biology and Agricultural Sciences
http://www.jebas.org
488 Nguyen et al

1 Introduction It can be therefore remarked that exploiting candidate genes to

Indigenous Noi chicken of the Mekong Delta possesses several
desired characteristics including the ease of raising and high
resistance along with some drawbacks such as low productivity
and highly hybridized breeds (Quyen & Son, 2008). Enhancing
and stabilizing breeding quality are one of the methods used to
improve these indicators. Many candidate genes associated
with poultry productivity have been identified (Abdi et al.,
2014; Fatemi et al., 2012; Xu et al., 2011a; Xu et al., 2011b),
as a result of the unprecedented improvements of genetic
technology, especially molecular genetics.
Various researches based on the increasing egg productivity
have found that candidate genes such as DRD2 (Dopamine D2
Receptor), IGF-I (Insulin-like Growth Factor I), NPY
(Neuropeptide Y), VIP (Vasoactive intestinal peptide) and
VIPR-1 (Vasoactive intestinal peptide receptor 1) had
significant effects on egg productivity. Chaiseha et al. (2003)
cloned cDNA of the DRD2 gene in turkeys and pointed out the
associations between DRD2 gene and production and hatching
traits. Similarly, Xu et al. (2011a; 2011b) studied the
g.5841629T>C polymorphism on DRD2 gene and found a
significant association between first laying age and total egg
production in chickens at 300 days of age. For IGF-1 gene, Li
et al. (2009) suggested that IGF-1 genetic polymorphism at
position 5'UTR was related to egg production at 300 and 400
days of age and the number of continuous laying days. In
addition, Xu et al. (2011b) also demonstrated the relationship
between g.31394761C>T polymorphism of NPY gene and
first-laying age in Ningdu Sanhuang chickens, followed by the
publication of Fatemi et al. (2012) on the association between
NPY gene and production traits as well as growth ability in
many different chicken traits. Similarly, for VIP and VIPR-1
receptor genes, El Halawani et al. (2000) found that injecting
VIP into 25 week and 54 week-old chickens resulted in an
increase in egg production.
improve egg production is a potential strategy, yet will need to
be examined in each group of chickens. Within the scope of
this study, 8 polymorphism positions of the mentioned genes
were used to assess their association with egg yield of Noi
chicken.
2 Materials and Methods
The experiment was conducted on 130 Noi chickens raised at
an experimental farm in Vinh Long province (Vietnam), where
all hens were individually kept in cages. The hens in the period
of laying eggs (28-47 weeks old) were mated with male Noi
chicken at ratio of 1 cock: 8 hens. During the experiment,
chickens were fed with diets having metabolizable energy of
2850 kcal/ kg and 17% crude protein and all chickens were
vaccinated before and during the experiment. The eggs laid
were then collected and data were recorded daily during 20
weeks of laying.
Genotypes of candidate genes were determined by PCR-RFLP
technique with some basic steps viz. extraction and
purification of DNA from hen’s feather (Nozawa et al., 1999);
amplification of DNA by using appropriate primers
corresponding to each gene; incubation of amplified products
with restriction enzymes, and determination of the genotype by
electrophoresis band on 2% agarose gel. Details of the primer
sequences, annealing temperature, type of restriction enzyme
used and size of PCR-RFLP bands are presented in Table 1.
Data on the frequency and chi-squared value were calculated
using SNPStats program (Solé et al., 2006)
(http://bioinfo.iconcologia.net/index.php). The association
between genotype and egg production was analyzed based on
General Linear Model of Minitab software version 16.0: Yij= µ
+ Gi + ξ ij (where Yij: traits observed; μ: general mean, Gi:
Influence of genotype; ξij: random error).

Table 1 Information regarding the polymorphisms studied

Gene SNP Sequencing primer (5’-3’) Ta (oC) Enzyme PCR-RFLP References

size (bp)
DRD2 T5841629C F:tgcacataaaagcccactcactg 60 BseGI 248 Xu et al., 2011a
R: gcctgagctggtgggggg 196/52
IGF-I C364T F: actatacagaaagaacccac 60 PstI 621 Nagaraja et al.,
R: tatcactcaagtggctcaagt 364/257 2000
NPY AATA Indel F: tctcagagctccaacgtatga 56 DraI 248(252) Xu et al., 2011b
(I31391359D) R: atatttctgtgcctgaacaaca 167/81
NPY C31394761T F: cgtggctgctttgcttcctttc 58 KpnI 324 Xu et al., 2011b
R: gggtacgaggcaaggacatg 200/124
VIP C+338T F: gcttggactgatgcgtactt 55 HinfI 520 Zhou et al.,
R: gtatcactgcaaatgctctg 480/40 2010
VIP AGG Indel F: gaaacccatctcagtcatccta 58 VspI 306 Zhou et al.,
(D2648-2650I) R: accacctatttttccttttctac 154/152 2010
VIPR-1 C1715301T F:ctcctcaggcagaccatcatg 61 TaqI 486 Xu et al., 2011a
R:cttgcacgtatccttgggtagc 310/176
VIPR-1 C1704887T F:ccccgttaaactcagcagac 61 HhaI 434 Xu et al., 2011a
R:cccaaagtcccacaaggtaa 253/181
F: Forward primer; R: Reverse primer; Ta: Annealing temperature

_________________________________________________________
Journal of Experimental Biology and Agricultural Sciences
http://www.jebas.org
Effects of genetic polymorphisms on egg production in indigenous NOI chicken. 489

DRD2/BseGI IGF-I/PstI

NPY/DraI NPY/KpnI

VIP/HinfI VIP/VspI

VIPR-1/TaqI VIPR-1/HhaI
M : Standard DNA 100 bp scale (Fermentas); Ctrl: Non-incubated PCR products with restriction enzymes

Figure 1 Genotyping of different SNPs by agarose gel electrophoresis

3 Results and Discussion
In the current study, 6 Single Nucleotide Polymorphisms
(SNPs) and 2 INDELs (Insertion/Deletion) for five candidate
genes were identified from Noi chicken breed. The above
SNPs were in transition mutations (T>C or C>T), whereas 2
INDEL variations were based on the addition or removal of 4
AATA nucleotides (NPY/DraI) or 3 AGG nucleotides
(VIP/VspI). The number of bands and PCR-RFLP band size,
genotype and allele frequencies of these polymorphism are
shown in Figure 1 and Table 2. For the DRD2/BSeGI locus,
the number of Noi chickens that had T allele accounted for a
very low proportion of the population (0.12). Similar trend was
found in other loci such as C allele (0.21) (IGF-I/PstI) or T
(0.22) (VIPR-1/HhaI) and the frequency of these mutations
followed Hardy-Weinberg's law (P>0.05).

_________________________________________________________
Journal of Experimental Biology and Agricultural Sciences
http://www.jebas.org
490
Table 2 Genotype and allele frequencies of polymorphisms.
SNP n Genotype frequency
DRD2/BseGI 123 0.01 (TT) 0.23 (TC)
IGF-I/PstI 93 0.06 (CC) 0.29 (CT)
NPY/DraI 130 0.22 (II) 0.42 (ID)
NPY/KpnI 123 0.20 (TT) 0.51 (TC)
VIP/HinfI 107 0.12 (CC) 0.31 (CT)
VIP/VspI 118 0.58 (II) 0.4 (ID)
VIPR-1/TaqI 111 0.48 (CC) 0.33 (CT)
VIPR-1/HhaI 125 0.64 (CC) 0.29 (CT)
*
: P<0.05; **: P<0.01; ns: P>0.05
In the 2 INDEL variants, genotypic frequencies of VIP/VspI
mutation did not follow the Hardy-Weinberg law (P<0.05) and
comparable results were also found in other chicken
populations. For example, on Ningdu Shanghuang breed, the
frequency of C allele was higher than T allele in DRD2/BSeGI
mutation point (Xu et al., 2010; Xu et al., 2011a; Xu et al.,
2011b). In addition, Kim et al. (2004) showed that C allele
frequency (0.31) was lower than T allele (0.69) at IGF-I/PstI
polymorphic position in Ogol chicken, but on the same
Madandaran chicken, the distribution of 2 alleles was relatively
equal (0.51 and 0.49) (Abbasi & Kazemi, 2011). In addition, a
comparison of allele frequency on VIPR-1/TaqI polymorphism
also pointed out that most of the experimental chickens in the
population had a higher proportion of C allele.
The effects of polymorphic positions on egg production
indicators are displayed in Table 3, in accordance to which the
SNPs on NPY and VIPR-1 genes showed a significant
association with the egg productivity of Noi chicken in 20
weeks of laying (P<0.05). The highest egg yield was reported
in chickens with 4 nucleotides lost (AATA INDEL) at
NPY/DraI locus or chickens with CC genotype at VIPR-
1/TaqI or VIPR-1/HhaI position (49.8 to 50.9 eggs). It should
be noted that the frequency of this genotype was also in
relatively high proportion (0.36 to 0.64), which suggested that
the process of natural selection had contributed to the
improvement of laying productivity, thereby increased the
proportion of beneficial alleles in populations. For the
remaining polymorphisms of the current study, the effect of
genotype on egg production was not significant (P>0.05).
An important neural regulator that affects reproductive
function in mammals and birds is neuropeptide Y (Hilal et al.,
1996). In chickens, experiments have shown that when injected
into the brain, NPY stimulated intake, increased insulin
secretion process and altered levels of certain hormones in the
blood such as prolactin, thyrotropin and GnRH (reproduction
hormone) (Willoughby & Blessing, 1987; Kuenzel &
McMurtry, 1988). Although there are evidences that NPY may
play a role in the regulation of hormone secretion mechanism
mentioned above, the association between polymorphisms in
this gene and egg production is less evident and depends
heavily on each different population. Earlier, in a population of
commercial laying hens, Dunn et al. (2004) discovered INDEL
_________________________________________________________
Journal of Experimental Biology and Agricultural Sciences
http://www.jebas.org
Nguyen et al
Allele frequency 2
0.76 (CC) 0.12 (T) 0.88 (C) 0.49ns
0.65 (TT) 0.21 (C) 0.79 (T) 1.43ns
0.36 (DD) 0.43 (I) 0.57 (D) 2.38ns
0.29 (CC) 0.46 (T) 0.54 (C) 0.03ns
0.57 (TT) 0.28 (C) 0.72 (T) 5.55*
0.02 (DD) 0.78 (I) 0.22 (D) 3.64ns
0.19 (TT) 0.64 (C) 0.36 (T) 8.27**
0.07 (TT) 0.78 (C) 0.22 (T) 2.80ns
(4 bp) mutation at 700 bp position before the start of NPY gene
transcription, but no relationship with the total number of eggs
was found. Similar findings were also described by Fatemi et
al. (2012) on the Iranian Mazandaran local breed; Xu et al.
(2011b) on Ningdu Shanghuang breed and Abdi et al. (2014)
on West-Azarbaijan native chickens. In contrast, the report of
Li et al. (2009) suggested that NPY/DraI polymorphism affect
the total egg count of 300 day-old Wengchang chickens, which
is confirmed by the current study and this can be explained as
NPY gene variations have different effects to chicken
ovulation in different breeds (Dunn et al., 2004).
VIP gene regulates GnRH secretion in both humans and
poultry (Christian & Moenter, 2008; Li et al., 2009). The
effects of VIP on the body depend upon VIPR-1 and VIPR2
receptors, in which VIPR-1 gene is considered selective
support indicator to reduce hatchability and improve egg
quality (Zhou et al., 2008a). Results from VIPR-1/HhaI
polymorphism research on Noi chickens showed that chicken
with CC genotype had the highest egg production yield.
Research by Xu et al. (2011b) also found the influence of this
polymorphism on total egg production of Ningdu Sanhuang
laying chicken of 300 days, in which C allele benefited more in
the selection process. Besides, Zhou et al. (2008b) previously
reported a similar result in many different chicken populations;
and a number of other research results as well showed that
VIPR-1/TaqI polymorphism was closely associated with
incubation time and the first laying age and individuals
carrying CC genotype had a longer incubation period and
earlier first laying age (Zhou et al., 2008a; Zhou et al., 2008b).
Recently, Xu et al. (2011b) reported that chickens with CC
genotype had lower total egg production after 300 days as
compared with chickens carrying TT genotype. This also
implied that egg production had a negative correlation with
hatching time and therefore the two polymorphisms on VIPR-1
gene could be potential molecular markers for the
improvement of egg production in Noi chickens.
In animals, dopamine (DA) plays an important role in
regulating the physiological effects of the reproductive system
such as creating excitement in mating. Besides, DA inhibits
prolactin secretion through DRD2 in the pituitary gland. DRD2
gene functions to regulate and control the release of DA and
Effects of genetic polymorphisms on egg production in indigenous NOI chicken. 491

Table 3 Association between polymorphic positions and Noi chicken egg production (egg/hen/20 laying weeks).

SNP Genotype n Egg production P

TT 1 26.0*
DRD2/BseGI TC 27 50.7 ± 3.9 0.233
CC 91 45.3 ± 2.3
CC 6 47.0 ± 9.3
IGF-I/PstI CT 27 43.9 ± 4.4 0.930
TT 60 45.5 ± 2.6
II 28 38.9 ± 3.8b
NPY/DraI ID 55 48.7 ± 2.9ab 0.040
DD 47 50.9 ± 3.0a
TT 25 43.4 ± 4.2
NPY/KpnI TC 62 47.8 ± 3.0 0.710
CC 36 46.6 ± 3.6
CC 13 45.9 ± 6.3
VIP/HinfI CT 33 40.6 ± 3.7 0.130
TT 61 49.9 ± 2.8
II 69 46.6 ± 2.6
VIP/VspI ID 47 47.3 ± 3.1 0.863
DD 2 58.5 ± 16.3*
CC 53 49.8 ± 2.7a
VIPR-1/TaqI CT 35 44.0 ± 3.2ab 0.045
TT 21 37.7 ± 4.5b
CC 78 50.4 ± 2.2a
VIPR-1/HhaI CT 34 40.7 ± 3.3b 0.047
TT 9 42.9 ± 6.7ab
*
Data were not subjected for statistical analysis; Values without common letters differ statistically at P<0.05.

thus mutations in the gene DRD2 may affect the reproductive
performance of domestic chickens. The research by Xu et al.
(2011b) revealed that DRD2/BseGI polymorphism affiliated
with egg production of 300 days old, but this result was not
supported by the present report.
Similarly, IGF-I gene had no effect on egg production of
domestic chickens, despite its great contribution in stimulating
growth, protein synthesis, cell proliferation and differentiation,
egg development (McMurtry et al., 1997; Yun et al., 2005; Li
et al., 2006;) and IGF-I/PstI has been proven to have
correlation with egg production and days of continuous egg-
laying (Kim et al., 2004; Li et al., 2009).
of 90-300 days old when chicken with D allele (with three
nucleotides AGG inserted) yielded higher productivity.
However, the percentage of DD genotype present in the
surveyed population was very low (1.2%). Results of the
present study are in agreement with the finding of Zhou et al.
(2010) that DD genotype proportion in Noi chickens was very
low (1.7%) and egg production averaged at 58.5 eggs/20 laying
weeks/hen (the highest in all the genotypes studied). However,
it was the average of only two individuals and would be just
only for reference and no specific conclusions about the effect
of this genotype in the population could yet be made.
Conclusions

VIP gene is also believed to be related to egg production of
poultry due to its involvement in the synthesis and secretion of
prolactin hormone by the pituitary gland. The mRNA
concentration of VIP varies with hens’ physiological status
(Mauro et al., 1989; Chaiseha et al., 1998) and VIP enhances
the stability of mRNA prolactin in vivo (Tong et al., 1998) as
well. The activities that affect the VIP concentration in the
body were suggested to influence the reproductive
performance and hatching behavior (Caldwell et al., 1999).
Zhou et al. (2010) found 69 polymorphisms when they studied
7 chicken breeds in China, among which AGG INDEL had
significant effects on the total egg production during the period
In Noi chicken population, at each studied polymorphic locus
two alleles existed with three different genotypes, including
DRD2/BseGI, VIP/VspI and VIPR-1/HhaI with significant
differences in allele distribution. Besides, genotypes at the
NPY/DraI, VIPR-1/TaqI and VIPR-1/HhaI mutation points
showed association with total egg production of laying Noi
chickens of 20 laying weeks. These results provide an
additional solution in the selection process towards improving
egg production of Noi chicken.

_________________________________________________________
Journal of Experimental Biology and Agricultural Sciences
http://www.jebas.org
492
Acknowledgment
This project was completed with the support of the Ministry of
Education and Training of Vietnam, code B2013-16-27.
Conflict of interest
Authors would hereby like to declare that there is no conflict of
interests that could possibly arise.
References
Abdi M, Seyedabadi H, Gorbani A (2014) Prolactin and NPY
Gene Polymorphism and its Associations with Production and
Reproductive traits in West-Azarbaijan Native chicken.
Bulletin of Environment, Pharmacology and Life Sciences 3:
39-45.
Abbasi HA, Kazemi M (2011) Detection of polymorphism at
the Insulin Like Growth Factor-I gene in Mazandaran native
chicken using Polymerase Chain Reaction-Restriction
Fragment Length Polymorphism method. American Journal of
Animal and Veterinary Sciences 6 : 80-83. doi :
10.3844/ajavsp.2011.80.83.
Caldwell SR, Johnson AF, Yule TD, Grimes JL, Ficken M,
Christensen VL (1999) Increased egg production in juvenile
turkey hens after active immunization with vasoactive
intestinal peptide. Poultry Science 78: 899-901.
Chaiseha Y, Tong Z, Youngren OM, El Halawani ME (1998)
Transcriptional changes in hypothalamic vasoactive intestinal
peptide during a photoinduced reproductive cycles in the
turkey. Journal of Molecular Endocrinology 21: 267-275. doi:
10.1677/jme.0.0210267.
Chaiseha Y, Youngren O, Al-Zailaie K, Halawani M (2003)
Expression of D1 and D2 dopamine receptors in the
hypothalamus and pituitary during the turkey reproductive
cycle: colocalization with vasoactive intestinal peptide.
Neuroendocrinology 77: 105-118. doi:10.1159/000068649.
Christian CA, Moenter SM (2008) Vasoactive intestinal
polypeptide can excite gonadotropin-releasing hormone
neurons in a manner dependent on estradiol and gated by time
of day. Endocrinology 149: 3130-3136. doi: 10.1210/en.2007-
1098.
Dunn IC, Miao YW, Morris A, Romanov MN, Wilson PW,
Waddington D (2004) A study of association between genetic
markers in candidate genes and reproductive traits in one
generation of a commercial broiler breeder hen population.
Heredity 92: 128-134. doi:10.1038/sj.hdy.6800396.
El Halawani ME, Whiting SE, Silsby JL, Pitts GR, Chaiseha Y
(2000) Active immunization with vasoactive intestinal peptide
in turkey hens. Poultry Science 79: 349-354. doi:
10.1093/ps/79.3.349.
_________________________________________________________
Journal of Experimental Biology and Agricultural Sciences
http://www.jebas.org
Nguyen et al
Fatemi SA, Mehrabani-Yeganeh H, Nejati-Javaremi A,
Niknafs SH (2012) Association of Neuropeptide Y and
gonadotrophin-releasing hormone receptor gene SNPs with
breeding value for growth and egg production traits in
Mazandaran native chickens. University of Telhran, Karaj,
Iran.
Hilal EM, Chen JH, Silverman AJ (1996) Join migration of
gonaldotropin-releasing hormone (GnRH) and neuropeptide Y
(NPY) neurons from olfactory placode to central nervous
system. Journal of Neurobiology 31: 487-502.
Kim MH, Seo DS, Ko Y (2004) Relationship between egg
productivity and insulin-like growth factor-I genotypes in
Korean native Ogol chickens. Poultry Science 83: 1203-1208.
doi: 10.1093/ps/83.7.1203.
Kuenzel WJ, McMurtry J (1988) Neuropeptide Y: brain
localization and central effects on plasma insulin levelsin
chicks. Physiology & Behavior 44: 669-678.
doi:10.1016/0031-9384(88)90334-4.
Li HF, Zhu WQ, Chen KW, Wu X, Tang QP, Gao YS, Song
WT, Xu WJ, Xu HL (2009) Polymorphism in NPY and IGF-I
genes associate with reproductive traits in Wenchang chicken.
African Journal of Biotechnology 8: 4744-4748.
Li ZH, Li H, Zhang H, Wang SZ, Wang QG, Wang YX (2006)
Identification of a single nucleotide polymorphism of the
insulin-like growth factor binding protein 2 gene and its
association with growth and body composition traits in the
chicken. Journal of Animal Science 84: 2902-2906.
doi:10.2527/jas.2006-144.
Mauro LJ, Elde RP, Youngren OM, Phillips RE, El Halawani
ME (1989) Alterations in hypothalamic vasoactive intestinal
peptide-like immunoreactivity are associated with reproduction
and prolactin release in the female turkey. Endocrinology
125:1795–1804. http://dx.doi.org/10.1210/endo-125-4-1795.
McMurtry JP, Francis GL, Upton Z (1997) Insulin-like growth
factors in poultry. Domestic Animal Endocrinology 14: 199-
229. doi:10.1016/S0739-7240(97)00019-2.
Nagaraja SC, Aggrey SE, Yao J, Zadworny D, Fairfull RW,
Kuhnlein U (2000) Trait association of a genetic marker near
the IGF-I gene in egg-laying chickens. Journal of Heredity 91:
150-156. doi: 10.1093/jhered/91.2.150.
Nozawa H, Yamamoto T, Uchihi R, Yoshimoto T, Tamaki K,
Hayashi S, Ozawa T Katsumata Y (1999) Purification of
nuclear DNA from single hair shafts for DNA analysis in
forensic sciences. Legal Medicine 1: 61-67. DOI:
http://dx.doi.org/10.1016/S1344-6223(99)80014-5.
Quyen NV, Son VV (2008) Effects of metalizable energy
levels and crude protein to reproductive performance of Noi
 Effects of genetic polymorphisms on egg production in indigenous NOI chicken.
chiken in the Mekong Delta (In Vietnamese). Journal of
Animal Husbandry Sciences and Techniques 2: 19-25.
Solé X, Guinó E, Valls J, Iniesta R, Moreno V (2006)
SNPStats: a web tool for the analysis of association studies.
Bioinformatics 22: 1928-1929. doi:
10.1093/bioinformatics/btl268.
Tong Z, Pitts GR, You S, Foster DN, El Halawani ME (1998)
Vasoactive intestinal peptide stimulates tureky prolactin gene
expression by increasing transcription rate and enhancing
mRNA stability. Journal of Molecular Endocrinology 21: 259-
266. doi: 10.1677/jme.0.0210259.
Willoughby JO, Blessing WW (1987) Neuropeptide Y injected
into the supraoptic nucleus causes secretion of vasopressin in
the unanesthetized rat. Neuroscience Letter 75: 17-22.
doi:10.1016/0304-3940(87)90068-1.
Xu H, Shen X, Zhou M, Fang M, Zeng H, Nie Q, Zhang X
(2010) The genetic effects of the dopamine D1 receptor gene
on chicken egg production and broodiness traits. BMC
Genetics 11:17. doi: 10.1186/1471-2156-11-17.
Xu H, Zeng H, Luo C, Zhang D, Wang Q, Sun L, Yang L,
Zhou M, Nie Q, Zhang X (2011a) Genetic effects of
polymorphisms in candidate gens and the QTL region on
_________________________________________________________
Journal of Experimental Biology and Agricultural Sciences
http://www.jebas.org
View publication stats
493
chicken age at first egg. BMC Genetics 12:33. doi:
10.1186/1471-2156-12-33.
Xu HP, Zeng H, Zhang DX, Jia XL, Luo CL, Fang MX, Nie
QH, Zhang XQ (2011b) Polymorphisms associated with egg
number at 300 days of age in chickens. Genetics and Molecular
Research 10 : 2279-2289. DOI: 10.4238/2011.October.3.5
Yun JS, Seo DS, Kim WK, Ko Y (2005) Expression and
relationship of the insulin-like growth factor system with
posthatch growth in the Korean Native Ogol chicken. Poultry
Science 84: 83-90. doi: 10.1093/ps/84.1.83.
Zhou M, Du Y, Nie Q, Liang Y, Luo C, Zeng H, Zhang X
(2010) Associations between polymorphisms in the chicken
VIP gen, egg production and broody traits. British Poultry
Science 51: 195-203. doi: 10.1080/00071661003745786.
Zhou M, Lei M, Rao Y, Nie Q, Zeng H, Xia M, Liang F,
Zhang D, Zhang X (2008a) Polymorphisms of asoactive
peptide receptor-1 gene and their genetic effects on broodiness
in chickens. Poultry Science 87: 893-903. doi:
10.3382/ps.2007-00495.
Zhou M, Liang F, Rao Y, Zeng H (2008b) Association of
twelve polymorphisms of the VIPR-1 gene with chicken early
egg production traits. Chinese Journal of Animal and
Veterinary Sciences 39: 1147-1152.
 Short Communication
The Journal of Animal & Plant Sciences, 25(1): 2015, Page: 304-308
Ngu et al., ISSN: 1018-7081 J. Anim. Plant Sci. 25(1):2015

INFLUENCE OF LEPTIN GENOTYPES ON MILK FAT AND PROTEIN CONTENT OF

CROSSBRED HOLSTEIN FRIESIAN X LAI SIND COWS
N. T. Ngu1,*, L. T. B. Quynh2, N. V. Hon1, N. T. H. Nhan1, D. V. A. Khoa1, L. T. Hung3 and N. H. Xuan4

1
College of Agriculture and Applied Biology, Can Tho University, Viet Nam, 2 Soc Trang Vocational Training College,
Viet Nam, 3 Cau Ngang Satellite, Tra Vinh University, Viet Nam, 4 Can Tho University of Technology, Viet Nam
*
Corresponding author: ntngu@ctu.edu.vn

ABSTRACT
The aim of this study was to investigate leptin (LEP) gene polymorphisms in crossbred Holstein Friesian (HF) x Lai Sind
cattle and their effects on milk yield and milk quality traits. Milk yield was recorded for lactation period of 305 days.
Milk fat and protein were estimated using the Milko Tester machine. DNA extracted from blood samples (n=206) was
amplified by PCR technique followed by sequencing for single nucleotide polymorphism (SNP) identification. Applied
genotyping for the two SNPs (g.C1180T and g.C2059T) was done by PCR-RFLP method with the presence of Kpn2I
and Sau3AI restriction enzymes, respectively. At the LEP/Kpn2I locus, cows of CT genotype accounted for the highest
proportion (78%) whereas at the second SNP, the frequency of CC dominated (63%). In the association analysis, the
LEP/Kpn2I polymorphism did not affect 305-day milk yield, but showed significant influence on milk quality traits, of
which cows with CT genotype had higher protein (3.67%) and fat (3.99%) content than ones with CC and TT. The other
locus (LEP/Sau3AI) was not associated with any traits analyzed. In conclusion, the g.C1180T SNP could be included in
marker assisted selection of crossbred HF cows for improving protein and fat percentages.
Key words: Cow, leptin gene polymorphism, milk quality trait.

INTRODUCTION these alleles and their effects on milk traits in crossbred

Molecular markers contributed greatly to animal
breeding along with traditional breeding methods. In
dairy cattle, scientists have detected many SNP markers
responsible for increased milk yield and milk quality. An
example of this is Leptin (LEP), a 4067 bp gene located
on chromosome 4 consisting of three exons and two
introns (Pfister-Genskow et al., 1996). This gene plays a
role in regulating body weight and reproductive function
(Frühbeck et al., 2001), growth of breast cells and milk
secretion (Hu et al., 2002).
In exon 2 of this gene, Buchanan et al. (2002)
found a C/T transition leading to the substitution of
arginine to cysteine and this tended to change the
function of the hormone leptin. By analyzing 416
Holstein cows using Kpn2I restriction enzyme, it was
concluded that cows with TT genotype produced 1.5
kg/day much more milk than those with CC genotype but
little effect on milk fat and protein content was found
(Buchanan et al., 2003). On the contrary, Sadeghi et al.
(2008) found a significant association of this locus with
milk yield and milk fat and protein. Another SNP
(LEP/Sau3AI), previously identified in intron 2 by Pomp
et al. (1997) was also linked with 305-day milk yield
(Moussavi et al., 2006), the T allele provided greater milk
yield and reproductive performance. To better evaluate
the effect of such alleles in milking cows in Viet Nam,
this work was carried out to investigate the distribution of
HF x Lai Sind populations.
MATERIALS AND METHODS
Animals: The experiment was conducted on crossbred
HF and Lai Sind cattle (F1: 1/2 HF; F2: 3/4 HF; F3: 7/8
HF). All cattle were raised in three different state farms
and cooperatives located in the Mekong Delta of Viet
Nam.
Data collection: Milk yield of 206 cows was recorded
daily throughout the 305-day lactation. Milk samples
were collected over three consecutive milking from each
cow and milk quality including protein and fat content
was measured using the automatic Milko Tester machine
(Bulgaria). In addition, blood samples taken from the
neck veins were stored in 15 ml falcon tubes containing
EDTA anticoagulant and kept at -20oC. Subsequently, the
routine phenol/chloroform method was applied to extract
DNA (Sambrook and Russell, 2001). The quantity and
quality of extracted DNA were tested using
spectrophotometric and agarose gel monitoring methods.
Genotyping: The PCR-RFLP (Polymerase Chain
Reaction - Restriction Fragment Length Polymorphism)
technique was done for genotyping the animals. At the
LEP/Kpn2I locus, the forward (5’-
ATGCGCTGTGGACCCCTGTATC-3’) and reverse
primers (5’-TGGTGTCATCCTGGACCTTCC-3’) and
PCR condition were taken from Buchanan et al. (2002).

304
Ngu et al.,
PCR products of 94 bp were sequenced for SNP detection
and incubated with Kpn2I restriction enzyme at 37oC for
15 minutes for genotype determination. In addition, based
on the sequence available in GenBank (U50365), another
primer pair was designed to amplify a 490 bp fragment
containing the second locus LEP/Sau3AI. The sequences
of forward and reverse primers were: 5’-
AAGCTCAGACCTGCAACCAT-3’ and 5’-
TTGAAAGAGGGCACACACAG-3’, respectively. In
PCR amplification, an initial denaturation at 94oC for 3
minutes followed by 35 cycles of denaturation at 94oC for
45 seconds, annealing at 62oC for 45 seconds and
extension at 72oC for 45 seconds, and an additional
extension of 72oC for 5 minutes was set. Finally,
incubation of PCR products with Sau3AI restriction
enzyme at 37oC for 15 minutes was performed to
determine the genotypes.
Data analysis: The data were subjected to analysis using
General Linear Model of Minitab statistical program
Table 1. Descriptive statistics of traits analyzed in 305-d lactation (mean ± standard deviation)
Cow group n Milk yield (kg)
% Yield (kg)
F1 (1/2 HF) 85 2923±841 4.00±0.51
F2 (3/4 HF) 82 3220±761 3.97±0.51
F3 (7/8 HF) 39 3216±641 3.86±0.55
All groups 206 3097±785 3.96±0.52
In addition, milk fat and protein content tended
to decrease according to the higher ratio of HF blood. Fat
percentage reached 4% in F1 cows while that of F2 and
F3 cows was 3.97% and 3.86%, respectively. This result
was in line with the report of Trach and Long (2008),
who pointed out that milk fat and protein ratios reduced
when HF blood ratio increased, specifically fat ratio
decreased from 4.26% in F1 to 3.91% in F2 and 3.77% in
F3 cows. Previously, Trach (2003) also noted that HF
cows bred in Viet Nam had lower milk fat percentage,
and F1 cows usually had higher milk quality as compared
with that of F2 and F3 cows.
SNP identification and genotyping: By comparative
sequencing, two point mutations of g.C1180T and
g.C2059T were identified (Figure 1). These
polymorphisms were subjected for genotyping by PCR-
RFLP as illustrated in Figure 2. Genotyping by Kpn2I
restriction enzyme has shown that uncut PCR products
with length of 94 bp were TT; those with lengths of 75
and 19 bp were CC and fragments of 94, 75 and 19 bp
were of CT genotype (Figure 2a). At the g.C2059T locus,
there were 2 cutting sites of Sau3AI enzyme in the
305
J. Anim. Plant Sci. 25(1):2015
version 13.20; factors affecting milk production such as
sampling site, animal breed, parity and genotype were
included in the model.
RESULTS AND DISCUSSION
Milk yield and milk quality of HF x Lai Sind cows:
Milk yield, milk fat and protein content are shown in
Table 1. In general, F2 and F3 cows produced similar
milk yield (3220 and 3216 kg/305-d lactation,
respectively) and had a tendency to produce more milk
than the F1 cows (2923 kg/305-d lactation). Theoretically
cow breeds with higher HF blood ratio would have higher
yield, however as mentioned by Trach and Long (2008),
the higher HF blood ratio requires better nutrients and
environmental conditions to fully exploit the potential
milk production. Thus, it might be one of the factors
limiting the milk production potential of F3 cows in the
present study.
Fat Protein
% Yield (kg)
115.8±33.0 3.66±0.19 107.1±31.8
127.8±34.6 3.60±0.21 115.7±26.4
124.6±33.5 3.55±0.27 114.1±23.6
122.3±34.0 3.62±0.22 111.9±28.5
amplified 490 bp fragment and thus all PCR products
were cut into two bands (257 and 233 bp) (Figure 2b). In
animals carrying CC genotype, only two bands appeared
in the gel while for TT homozygous individuals, the 233
bp band was cut into two fragments of 148 and 85 bp;
finally, CT heterozygous cattle showed three fragments
of 233, 148 and 85 bp but the 85 bp band was not seen on
2% gel.
At the LEP/Kpn2I locus, Buchanan et al. (2002)
described a mutation point in Bos taurus breeding cows
namely Angus, Charolais, Hereford and Simmental.
Similar findings were proposed in various breeds such as
Limousin x Friesian, Simmental x Friesian and Jersey
cows (Konfortov et al., 1999) or on Iranian Holstein bulls
(Sadeghi et al., 2008). Besides, the LEP/Sau3AI
polymorphism was also revealed by Javanmard et al.
(2008) on the Iranian Sarabi cattle, but different primers
were used to amplify a 422 bp product. The present data
were consistent with those shown by Kulig et al. (2009)
on Jersey breed and Javanmard et al. (2010) on Iranian
Holstein breed.
Ngu et al., J. Anim. Plant Sci. 25(1):2015

Figure 1. SNP detection by sequencing, arrows show polymorphic sites: (a) g.C1180T and (b) g.C2059T

Figure 2. Agarose gel electrophoresis of PCR-RFLP: (a) LEP/Kpn2I, g.C1180T and (b) LEP/Sau3AI, g.C2059T;
M: 100-bp DNA ladder, Fermentas

Table 2. Genotype and allele frequencies of two SNPs in LEP gene

Genotype frequency (n) Allele frequency

Locus
CC CT TT C T
LEP/Kpn2I, g.C1180T 0.12 (24) 0.78 (162) 0.10 (20) 0.51 0.49
LEP/Sau3AI, g.C2059T 0.63 (73) 0.23 (27) 0.14 (16) 0.75 0.25

Genotype and allele frequencies of LEP gene
polymorphisms are shown in Table 2. At the LEP/Kpn2I
locus, cows with CT heterozygous genotype accounted
for the highest proportion (78%). For the LEP/Sau3AI
locus, the frequency of CC homozygous genotype
dominated (63%), followed by CT and TT genotypes.
In the investigation of Nassiry et al. (2007) on
the LEP/Kpn2I polymorphism, it was shown that CC and
CT genotypes appeared on both Golpayegani and Taleshi
breeds, while TT genotype was present only on Taleshi
breed. Furthermore, Choudhary et al. (2005)
demonstrated that the percentage TT genotype in HF
breed was very low, but relatively high in the Jersey
breed. In this study, similar findings were observed, for
example in HF crossbred cows, individuals carrying TT
genotype appeared in low frequency.
Influence of leptin genotypes on milk yield and milk
quality traits: In terms of Kpn2I polymorphism, in F1
group, cows with CT genotype had the highest milk yield
in 305-day lactation (3114 kg), followed by the TT
genotype (2959 kg) and CC (2500 kg) (P<0.05).
However, in F2 and F3 groups, no differences were found
between cows carrying different genotypes (Table 3).
In considering milk quality parameters, at the
LEP/Kpn2I locus, milk fat and protein percentages were
of significant difference (P<0.05), in which milk protein
was highest with CT genotype (3.67%) and lowest with
the CC genotype (3.51%). In addition, CT and TT
genotypes had similar milk fat content, which was higher
than that in the remaining genotype. As a result, the
Kpn2I polymorphism significantly associated with milk
fat and protein yield in the lactating period (P<0.05). In
details, fat yield was highest in cows of CT genotype
(130.7 kg) and lowest with CC genotype (112.0 kg) and
protein yield was highest in cows with CT genotype
(119.8 kg), followed by TT (114.8 kg) and CC genotype
(105.8 kg).

306
Ngu et al., J. Anim. Plant Sci. 25(1):2015

Table 3. Effects of LEP/Kpn2I genotypes on milk production and milk quality traits (least square mean ±
standard error)

Genotype Milk Fat Protein

Cow group
(n) yield (kg) % Yield (kg) % Yield (kg)
F1 CC (15) 2500±185b 3.82±0.12 96.4±8.8B 3.62±0.05b 90.2±7.0B
(1/2 HF) CT (58) 3114±110a 4.07±0.07 127.6±5.2A 3.73±0.03ab 116.1±4.2A
TT (10) 2959±243b 4.08±0.16 120.9±11.7AB 3.80±0.06a 112.4±9.2AB
B
F2 CC (5) 3342±322 3.54±0.27 119.4±15.6 3.46±0.09 116.6±12.0
(3/4 HF) CT (70) 3381±108 3.97±0.09 133.9±5.2 3.70±0.03A 124.9±4.0
TT (8) 3311±270 4.08±0.22 134.3±13.1 3.49±0.07B 115.6±10.1
F3 CC (4) 3894±307 3.48±0.35 138.9±17.2 3.45±0.11 134.9±11.5
(7/8 HF)1 CT (34) 3222±144 3.82±0.16 124.0±8.1 3.61±0.05 116.1±5.4
TT (2) 2980±403 3.73±0.46 114.1±22.6 3.65±0.14 109.5±15.0
CC (24) 3019±142 3.70±0.11b 112.0±6.9b 3.51±0.04B 105.0±5.3b
All groups CT (162) 3272±57 3.99±0.05a 130.7±2.8a 3.67±0.02A 119.8±2.1a
a a AB
TT (20) 3181±153 4.03±0.12 128.0±7.4 3.61±0.04 114.0±5.7ab
1
Due to low number of TT animals, statistical analysis is not available
A-B, a-b
Within each column for each cow group, values with different superscripts are significant different at: small letter
(P<0.05), capital letter (P<0.01)

At the LEP/Sau3AI locus, different genotypes
did not affect any milk traits examined (P>0.05) (Data
not shown).
There have been studies explaining the
association between the Kpn2I polymorphism and milk
traits. For example, Liefers et al. (2002) proved that
breast epithelial cell lines nurtured in an environment
with the presence of leptin had less consolidation of [3H-
thymidine], synonymous to DNA synthesis reduction. In
other words, leptin negatively affected the development
of mammary gland. Thorn et al. (2006) indicated that
bovine breast epithelial cells had insignificant receptor
expression in leptin gene and did not respond to leptin in
in vitro studies. Leptin therefore cannot affect milking by
directly impacting on the epithelial cells. Hence, changes
in milk yield recorded in different dairy leptin genotypes
might relate to the use of nutrients, in which CT cows
were prioritised to produce milk and milk compositions,
whereas CC cows favoured accumulation, leading to
differences in serum leptin concentrations in later stages
of lactation (Liefers et al., 2003).
The current work was consistent with the report
of Madeja et al. (2004), who found no link between
Kpn2I and Sau3AI polymorphisms and milk production
traits. However, this was in contrast with the conclusion
of Liefers et al. (2002) that Sau3AI polymorphism can be
used as molecular markers for milk protein yield and
milk yield. It was also noted that CT genotype gave
higher milk yield of 1.32 kg/day and higher consumption
of 0.37 kg/day as compared with CC genotype (Liefers et
al., 2003). Buchanan et al. (2003) confirmed the
remarkable effects of Kpn2I polymorphism (TT
genotype) on milk and protein yields in the early stages
of lactation, homozygous CC cows had lower milk yield
than cows carrying CT and TT genotypes. Therefore, the
authors proposed that the genotype of LEP, especially T
allele, could have played an important role in regulating
milk yield and milk protein. These observations were
partly validated by this study, where cows with T allele
improved milk protein content but had little effect on
milk production. All together, it can be concluded that in
the HF x Lai Sind population, cows with T allele would
be of interest for improving milk protein and fat yield.
Acknowledgments: This project was supported by the
Vietnam’s Ministry of Education and Training, Grant No.
B2009-16-120.
REFERENCES
Buchanan F.C., A.G. Van Kessel, C. Waldner, D.A.
Christensen, B. Laarveld and S.M. Schmutz
(2003). Hot topic: An association between a
leptin single nucleotide polymorphism and milk
and protein yield. J. Dairy Sci. 86: 3164-3166.
Buchanan, F.C., C.J. Fitzsimmons, A.G. Van Kessel,
T.D. Thue, D.C. Winkelman-Sim and S.M.
Schmutz (2002). Association of a missense
mutation in the bovine leptin gene with carcass
fat content and leptin mRNA levels. Genet. Sel.
Evol. 34: 105-116.
Choudhary, V., P. Kumar, T.K. Bhattacharya, B.
Bhushan and A. Sharma (2005). DNA
polymorphism of leptin gene in Bos indicus and
Bos taurus cattle. Genet. Mol. Biol. 28: 740-742.
Frühbeck, G., J. Gomez-Ambrosi, F.J. Muruzabal and
M.A. Burrell (2001). The adipocyte: a model for
integration of endocrine and metabolic signaling
in energy metabolism regulation. Am. J.
Physiol-Endoc. M. 280: E827.

307
Ngu et al.,
Hu, X., S.C. Juneja, N.J. Maihle and M.P. Cleary (2002).
Leptin - a growth factor in normal and malignant
breast cells and for normal mammary gland
development. J. Natl. Cancer Inst. 94: 1704.
Javanmard, A., K. Khaledi, N. Asadzadeh and A.R.
Solimanifarjam (2010). Detection of
polymorphisms in the bovine leptin (LEP) gene:
association of a single nucleotide polymorphism
with breeding value of milk traits in Iranian
Holstein cattle. J. Mol. Genet. 2: 10-14.
Javanmard, A., M.R. Mohammadabadi, G.E. Zarrigabayi,
A.A. Gharahedaghi, M.R. Nassiry, A.
Javadmansh and N. Asadzadeh (2008).
Polymorphism within the intron region of the
bovine leptin gene in Iranian Sarabi cattle
(Iranian Bos taurus). Russ. J. Genet. 44: 495-
497.
Konfortov, B.A., V.E. Licence and J.R. Miller (1999).
Re-sequencing of DNA from a diverse panel of
cattle reveals a high level of polymorphism in
both intron and exon. Mamm. Genome 10:
1142-1145.
Kulig, H., M. Kmiec, I. Kowalewska-Luczak and G.
Andziak (2009). Effect of leptin gene
polymorphisms on milk production traits of
Jersey cows. Turk. J. Vet. Anim. Sci. 33: 143-
146.
Liefers, S.C., M.F. te Pas, R.F. Veerkamp, Y. Chilliard,
C. Delavaud, R. Gerritsen and T. van der Lende
(2003). Association of leptin gene
polymorphisms with serum leptin concentration
in dairy cows. Mamm. Genome 14: 657-663.
Liefers, S.C., M.F.W. Te Pas, R.F. Veerkamp and T. Van
Der Lende (2002). Associations between leptin
gene polymorphisms and production, live
weight, energy balance, feed intake, and fertility
in Holstein heifers. J. Dairy Sci. 85: 1633-1638.
Madeja, Z., T. Adamowicz, A. Chmurzynska, T.
Jankowski, J. Melonek, M. Switonski and T.
Strabel (2004). Short communication: effect of
leptin gene polymorphisms on breeding value
308
J. Anim. Plant Sci. 25(1):2015
for milk production traits. J. Dairy Sci. 87:
3925-3927.
Moussavi A.H., M. Ahouei, M.R. Nassiry and A.
Javadmanesh (2006). Association of leptin
polymorphism with production, reproduction
and plasma glucose level in Iranian Holstein
cows. Asian Austral. J. Anim. Sci. 19: 627-731.
Nassiry, M.R., A.H. Moussavi, A.R. Alashawkany and S.
Ghovati (2007). Leptin gene polymorphism in
Iranian native Golpayegani and Taleshi cows.
Pak. J. Biol. Sci. 10: 3738-3741.
Pfister-Genskow, M., H. Hayes, A. Eggen and M. D.
Bishop (1996). Chromosomal localization of the
bovine obesity (OBS) gene. Mamm. Genome 7:
398-399.
Pomp, D., T. Zou, A.C. Clutter and W. Barendse (1997).
Rapid communication: mapping of leptin to
bovine chromosome 4 by linkage analysis of a
PCR-based polymorphism. J. Anim. Sci. 75:
1427.
Sadeghi M., M.M.S. Babak, G. Rahimi and A.N.
Javaremi (2008). Effect of leptin gene
polymorphism on the breeding value of milk
production traits in Iranian Holstein. Animal 2:
999-1002.
Sambrook J. and D.W. Russell (2001). Molecular
Cloning – A Laboratory Manual, 3rd edn. Cold
Spring Harbor Laboratory Press, Cold Spring
Harbor, NY.
Thorn, S.R., S. Purup, W.S. Cohick, M. Vestergaard, K.
Sejrsen and Y.R. Boisclair (2006). Leptin does
not act directly on mammary epithelial cells in
prepubertal dairy heifers. J. Dairy Sci. 89: 1467-
1477.
Trach, N.X. (2003). Raising dairy cows for reproduction.
Agricultural Publishing House, Ha Noi (In
Vietnamese).
Trach, N.X. and P.P. Long (2008). Reproductive
performance and milk productivity of different
types of dairy cattle raised in Lam Dong
province. J. Sci. Dev. VI (3): 284-288 (In
Vietnamese).
 môc lôc
T¹p chÝ
NGUYỄN THỊ THUỞ, PHAN THỊ HỒNG TRANG, VÕ CÔNG 5 - 12
THÀNH, LÊ VĂN HÒA. Lai tạo và tuyển chọn dòng nếp mới
NÔNG NGHIP (Oryza sativa subsp. indica) cứng cây chống ñổ ngã phục vụ cho
& PHÁT TRI N NÔNG THÔN sản xuất
ISSN 1859 - 4581
NGUYỄN TRƯỜNG SƠN, LÊ MINH TƯỜNG. Khảo sát khả 13 - 20
năng phềng trị của vi khuẩn Burkholderia cepacia TG17 ñối với
bệnh ñạo ôn hại lúa

PHAN QUỐC HUY, HỒ CÃNH THỊNH, NGUYỄN MINH 21 - 26
N¨m thø m−êi S¸U
TRUNG, NGUYỄN THỊ THU NGA. Phân lập thực khuẩn thể và
ñánh giá hiệu quả phòng trị bệnh thối hạt trên lúa do vi khuẩn
CHUYªN ĐỀ Burkholderia glumae
NÔNG NGHIỆP XANH
NGUYỄN BÁ PHÚ, LÊ MINH TRIẾT, TRẦN NHÂN DŨNG, 27 - 32
THÁNG 11/2016 NGUYỄN BẢO VỆ. Đánh giá sự ña dạng di truyền của bảy dòng
cam sành không hột ñược phát hiện năm 2013 tại Đông Phước,
Châu Thành, Hậu Giang bằng dấu chỉ thị phân tử SSR

TRẦN HOÀNG BÍCH TRÂM, NGUYỄN BÁ PHÚ, LÊ 33 - 39
Tæng biªn tËp TRƯỜNG GIANG, NGUYỄN BẢO VỆ. Khảo sát sự phát triển
PHẠM HÀ THÁI
tiểu noãn của bảy cá thể cam sành không hột ñược phát hiện năm
2013 tại Đông Phước, Châu Thành, Hậu Giang
§T: 04.37711070

TRẦN THỊ BA, VÕ THỊ BÍCH THỦY, LÂM KIỀU NƯƠNG. 40 - 49
Nghiên cứu xây dựng quy trình sản xuất giá ñậu xanh (Vigna
radiata (L.) R. Wilczek) an toàn

NGUYỄN THỊ NGỌC LÀNH, LÊ THỊ THANH THỦY, TRẦN 50 - 56
Phã tæng biªn tËp
SỸ HIẾU, TRẦN VĂN HÂU. Sự biến ñổi ñặc tính hóa học, mật
DƯƠNG THANH HẢI số vi sinh vật và cảm quan của nhựa cuống buồng hoa dừa nước
§T: 04.38345457 (Nypa fruticans Wurmb.) ở những thời ñiểm thu hoạch khác nhau

TRẦN VĂN HÙNG, LÊ PHƯỚC TOÀN, TRẦN VĂN DŨNG, 57 - 65
NGÔ NGỌC HƯNG. Hình thái và tính chất lý hóa học ñất phèn
vùng Tứ Giác Long Xuyên
Toµ so¹n - TrÞ sù

LÊ VĂN DANG, LÂM NGỌC PHƯƠNG, NGUYỄN BẢO VỆ, 66 - 72
Sè 10 NguyÔn C«ng Hoan
LÊ PHƯỚC TOÀN, NGÔ NGỌC HƯNG. Ảnh hưởng bón phân
QuËn Ba §×nh - Hµ Néi
N, P, K ñến năng suất và dưỡng chất khoáng hút thu của cây khoai
§T: 04.37711072
mì trồng trấn ñất phèn
Fax: 04.37711073

NGUYỄN THU TÂM, NGUYỄN ĐỨC HIỀN, LÝ THỊ LIÊN 73 - 77
E-mail: tapchinongnghiep@vnn.vn
Website:www.tapchikhoahocnongnghiep.vn KHAI. Phân lập và ñịnh danh vi khuẩn Clostridium spp. từ ñất
ruộng tại huyện Phú Tân và Châu Phú tỉnh An Giang

LÊ MINH TƯỜNG, ĐỔ VĂN SỬ. Đánh giá khả năng phòng trị 78 - 84
VĂN PHÒNG ĐẠI DIỆN TẠP CHÍ của xạ khuẩn ñối với bệnh thán thư trên cây sen ở ñồng bằng sông
TẠI PHÍA NAM Cửu Long
135 Pasteur
LÂM THIỆN TOÀN, TRƯƠNG THỊ NGA, LÊ NHẬT QUANG. 85 - 92
QuËn 3 - TP. Hå ChÝ Minh Mối quan hệ giữa một số tính chất hóa học ñất và sự sinh trưởng
§T/Fax: 08.38274089 của cây Mai dương (Mimosa pigra L.) tại Vườn quốc gia Tràm
Chim

NGUYỄN THỊ THÚY NHUNG, TRƯƠNG THỊ NGA, LÊ 93 - 100
NHẬT QUANG. Đánh giá chất lượng nước của mô hình rừng tôm
GiÊy phÐp sè: kết hợp trong và ngoài ñê biển ở huyện Hòa Bình, tỉnh Bạc Liêu
290/GP - BTTTT
TRẦN THỊ BÍCH VÂN, LÊ BẢO LONG VÀ NGUYỄN BẢO 101 - 108
Bé Th«ng tin - TruyÒn th«ng VỆ. Mối quan hệ giữa canxi với hiện tượng nứt và phẩm chất trái
cÊp ngµy 03 th¸ng 06 n¨m 2016. chôm chôm Rongrien (Nephelium lappaceum Linn)

HUỲNH HỮU ĐỨC, TRẦN VĂN HAI. Phân lập, ñịnh danh và 109 - 116
bước ñầu ñánh giá hiệu quả phòng trừ rệp sáp Planococcus
C«ng ty cæ phÇn Khoa häc vµ lilacinus của các chủng nấm Paecilomyces javanicus thu thập tại
c«ng nghÖ Hoµng Quèc ViÖt ñồng bằng sông Cửu Long
§Þa chØ: Sè 18 Hoµng Quèc ViÖt,
VÕ THỊ BÍCH THỦY, TRẦN THỊ BA, LÊ THỊ BÍCH TRÂM. 117 - 125
NghÜa §«, CÇu GiÊy, Hµ Néi Khảo sát ñặc ñiểm hình thái, năng suất và khả năng chống chịu
bệnh héo xanh vi khuẩn (Ralstonia solacearum) trên 12 giống ớt
(Capsicum spp.)
T¹p chÝ
TRƯƠNG THỊ NGA, TRẦN THỊ KIM SƠN, NGUYỄN 126 - 132
HOÀNG OANH. Hiện trạng canh tác ớt và một số tính chất hóa
NÔNG NGHIP học ñất trồng ớt tại vùng ñê bao triệt ñể của xã Kiến An, huyện
Chợ Mới, tỉnh An Giang
& PHÁT TRI N NÔNG THÔN

NGUYỄN THỊ KIM KHANG, NGUYỄN VIỆT FAL. Ảnh 133 - 138
ISSN 1859 - 4581 hưởng của việc bổ sung bột hồi (Pimpinella anisum) ñến khả
năng tăng trưởng của gà thịt Cobb500

MAI HUỲNH DƯ AN, HUỲNH CHÍ NGHĨA, BÙI KHÁNH 139 - 146
N¨m thø m−êi S¸U LÂM, PHAN HỮU BẰNG, LƯU HUỲNH ANH, NGUYỄN
THỊ THU NGA, NGUYỄN TRỌNG NGỮ. Thử nghiệm khả
năng phân giải vi khuẩn Escherchia coli của thực khuẩn thể
(Bacteriophage) phân lập tại các trại gà thương phẩm
CHUYªN ĐỀ

NGUYỄN THU TÂM, NGUYỄN ĐỨC HIỀN, TRẦN THỊ 147 - 150
NÔNG NGHIỆP XANH PHẬN. Phân lập và ñịnh danh vi khuẩn Clostridium botulinum từ
THÁNG 11/2016 vịt bị liệt mềm cổ tại huyện Phú Tân và Tri Tôn, tỉnh An Giang

NGUYỄN THỊ YẾN MAI, TRẦN NGỌC BÍCH, PHẠM THẾ 151 - 155
LÂM, NGUYỄN PHÚC KHÁNH. Bệnh do Parvovirus trên chó
tại Chi cục Thú y thành phố Cần Thơ
Tæng biªn tËp
TRƯƠNG PHÚC VINH, TRẦN NGỌC BÍCH, NGUYỄN HỮU 156 - 160
PHẠM HÀ THÁI NGHĨA, NGUYỄN PHÚC KHÁNH. Khảo sát tỷ lệ chó có kháng
§T: 04.37711070 thể bảo hộ sau tiêm phòng vắc xin dại tại thành phố Cần Thơ

NGUYỄN ÁI THẠCH, LÊ THÁI ANH THƯ, NGUYỄN MINH 161 - 166
THỦY. Ảnh hưởng của quá trình chần, mật ñộ Lactobacillus
plantarum và nồng ñộ muối ñến các hoạt chất sinh học trong sản
Phã tæng biªn tËp phẩm tỏi lên men muối chua
DƯƠNG THANH HẢI 167 - 174

NGUYỄN DUY TÂN, NGUYỄN MINH THỦY. Tối ưu hóa
§T: 04.38345457 hàm lượng chất mang (maltodextrin, gum xanthan) trong quá
trình sấy phun dịch trích thuốc dòi sử dụng phương pháp bề mặt
ñáp ứng

LÊ PHẠM TẤN QUỐC, NGUYỄN VĂN MƯỜI. Nghiên cứu 175 - 181
Toµ so¹n - TrÞ sù
ảnh hưởng của màng bao alginat và dịch chiết polyphenol từ củ
Sè 10 NguyÔn C«ng Hoan
hà thủ ô ñỏ trong bảo quản ñu ñủ dạng fresh-cut
QuËn Ba §×nh - Hµ Néi

TRẦN THANH TRÚC, HUỲNH NGỌC TÂM VÀ NGUYỄN 182 - 189
§T: 04.37711072
Fax: 04.37711073 VĂN MƯỜI. Xây dựng quy trình chế biến và bảo quản dưa lê
E-mail: tapchinongnghiep@vnn.vn non (Cucumis Melo L.) muối chua
Website:www.tapchikhoahocnongnghiep.vn
NHAN MINH TRÍ , TRẦN THỊ THÙY TRANG, PHẠM VĂN 190 -197
TÂM. Ảnh hưởng của việc bổ sung khoai lang ñến các biến ñổi
trong quá trình làm lạnh và chất lượng bánh phồng tôm
VĂN PHÒNG ĐẠI DIỆN TẠP CHÍ
NHAN MINH TRÍ, ĐẶNG TRẦN ĐOAN TRANG, BÙI THỊ 198 - 205
TẠI PHÍA NAM THÙY NGA. Ảnh hưởng của thời gian thu hoạch & khối lượng
135 Pasteur củ khoai ñến thành phần dinh dưỡng của khoai lang tím Nhật
QuËn 3 - TP. Hå ChÝ Minh (Ipomoea batatas L.) ở Bình Tân, tỉnh Vĩnh Long
§T/Fax: 08.38274089
PHẠM QUANG TRUNG, NGUYỄN THỊ HẠNH, LÊ 206 - 212
NGUYỄN ĐOAN DUY, NGUYỄN CÔNG HÀ. Ảnh hưởng của
ñiều kiện ngâm và ủ yếm khí ñến hoạt tính glutamat
decacboxylaza và hàm lượng axit glutamic của nếp trằng và nếp
GiÊy phÐp sè: than
290/GP - BTTTT
NGUYỄN DIỆU HIỀN, NGUYỄN HOÀNG KHANG, LÊ 213 - 218
Bé Th«ng tin - TruyÒn th«ng NGUYỄN ĐOAN DUY, NGUYỄN CÔNG HÀ. Ảnh hưởng của
cÊp ngµy 03 th¸ng 06 n¨m 2016. ñiều kiện ngâm, chế ñộ ủ sấy ở qui mô pilot ñến hàm lượng
GABA của giống lúa Một bụi ñỏ

TRƯƠNG THỊ MINH HẠNH, TRẦN THỊ NGỌC THƯ. Nghiên 219 - 224
C«ng ty cæ phÇn Khoa häc vµ cứu các ñiều kiện chiết isoflavone từ bã ñậu nành trong dung môi
c«ng nghÖ Hoµng Quèc ViÖt ethanol
§Þa chØ: Sè 18 Hoµng Quèc ViÖt,
NGÔ THỊ SONG, TRƯƠNG THỊ MINH HẠNH. Nghiên cứu 225 - 230
NghÜa §«, CÇu GiÊy, Hµ Néi các ñiều kiện chiết và khảo sát khả năng kháng oxy hóa của hợp
chất polyphenol từ quả khế (Averrhoa carambola L.)

VÕ QUANG MINH. Nông nghiệp thông minh và tiềm năng phát 231 - 238
triển vào sản xuất
 KHOA HC CÔNG NGH

THV NGHICM KH1 N6NG PHÂN GI1I VI KHU:N

Escherchia coli C9A THGC KHU:N TH
(Bacteriophage) PHÂN LFP TI CÁC TRI GÀ
THNgNG PH:M
Mai Hu¨
Hu¨nh D6 An1, Hu¨
Hu¨nh Chí NghŒa
NghŒa1, Bùi Khánh
Khánh Lâm1, Phan HH
HHu B3
B3ng1,
Hu¨nh Anh1, Nguy
L6u Hu¨ Nguyn Th Thu Nga1, Nguy
Nguyn TrT
TrTng NgH
NgH1,
TÓM TT
TT
Thí nghi>m 16Cc ti!n hành nh3m 1ánh giá kh% nng phân gi%i vi khu&n E. coli có kh% nng gây b>nh c)a
th*c khu&n thB Coliphages 16Cc phân lMp t?i các tr?i gà công nghi>p t.nh Trà Vinh và VŒnh Long. Trong
t:ng s- 32 ch)ng E. coli phân lMp 16Cc tW t.nh Trà Vinh và 32 ch)ng E. coli phân lMp 16Cc tW t.nh VŒnh Long
lan l6Ct xác 1 nh 16Cc 21 và 5 dòng th*c khu&n thB có kh% nng phân gi%i vi khu&n E. coli. Ph6Png pháp
khu!ch 1?i PCR (Polymerase Chain Reaction) 16Cc s4 dSng 1B xác 1 nh ba gien 1+c l*c FimH, Stx1 và Stx2
trên vi khu&n E. coli. K!t qu% cho th8y có 100% các ch)ng E. coli mang gien 1+c l*c FimH và không có
ch)ng nào mang gien 1+c l*c Stx1; 1-i vLi gien 1+c l*c Stx2 tìm th8y 8 ch)ng E. coli mang gien này t.nh
Trà Vinh và 13 ch)ng t.nh VŒnh Long. K!t qu% kh%o sát ph: ký ch) c)a các dòng th*c khu&n thB 1-i vLi
các ch)ng vi khu&n E. coli thu thMp Trà Vinh cho th8y ch)ng E. coli EN9 b ký sinh nhi9u nh8t, vLi s-
l6Cng dòng th*c khu&n thB ký sinh là 12 dòng. E-i vLi các tr?i gà t?i VŒnh Long, các ch)ng E. coli ED14,
ED15 và EN17 19u b ký sinh b i 5 dòng th*c khu&n thB. Ti!n hành 1ánh giá kh% nng phân gi%i ch)ng vi
khu&n EN9 t.nh Trà Vinh và ED14 t.nh VŒnh Long qua 3 th]i 1iBm 24, 48 và 72 gi], dòng th*c khu&n thB
PN10 có kh% nng phân gi%i ch)ng vi khu&n E. coli EN9 cao hPn các dòng th*c khu&n thB còn l?i và các
dòng th*c khu&n thB PD7, PD8 và PD9 có kh% nng phân gi%i vi khu&n E. coli ED14 cao hPn hai dòng PD13
và PN13. Các k!t qu% này 1ang 16Cc th4 nghi>m trên gà 1B 1ánh giá hi>u qu% phòng và tr b>nh E. coli.
khóa E.coli, th*c khu&n thB, gà th6Png ph&m, phòng, tr .
TW khóa:

1. &T VN 16
Escherichia coli (E. coli) là m+t trong nhHng vi
khu&n ph: bi!n trong 16]ng tiêu hóa c)a ng6]i và
1+ng vMt máu nóng. Hau h!t các dòng E. coli tn t?i
m+t cách t* nhiên và không gây h?i trong 16]ng tiêu
hóa. Khi cP thB vMt ch) có nhHng thay 1:i sinh lí nh6
stress, b>nh, lo?n khu&n,… thì vi khu&n E. coli si
phát triBn và gây b>nh cho vMt ch) (Lê Vn T?o,
2006). Hi>n nay, hau h!t các gi-ng gà n+i 1 a và gà
nhMp n+i Vi>t Nam 19u r8t mtn c%m vLi các ch)ng
E. coli có chGa 1+c t- gây b>nh. Bi>n pháp phòng tr
b>nh ch) y!u là s4 dSng vyc xin và thu-c kháng sinh
trong chn nuôi. Tuy nhiên, vi>c l?m dSng thu-c
kháng sinh 1ã làm xu8t hi>n ngày càng nhi9u các
ch)ng vi khu&n kháng thu-c, dtn 1!n nhi9u tr6]ng
hCp 1i9u tr b>nh kém hi>u qu% (Drulis-Kawa et al.,
2012). Vì vMy, bi>n pháp sinh hTc có ý nghŒa 1[c bi>t
quan trTng trong chi!n l6Cc qu%n lý d ch b>nh, do nó
có thB khyc phSc 16Cc tình tr?ng nh]n thu-c 1-i vLi
vi>c s4 dSng thu-c kháng sinh và còn nhi9u tính
nng 6u vi>t khác.
1 này.
Khoa Nông nghiệp và Sinh học ứng dụng, Trường Đại
học Cần Thơ.
Phòng trW sinh hTc 1-i vLi b>nh do tác nhân là vi
khu&n 1ã 16Cc ghi nhMn thành công và 1em l?i nhi9u
triBn vTng b3ng vi>c s4 dSng th*c khu&n thB
(Bacteriophage). Theo Balogh (2002), tW nhHng nm
1990 th*c khu&n thB 16Cc chGng minh có hi>u qu%
kiBm soát m+t s- vi khu&n gây b>nh bao gm
Bacillus anthracis, Staphylococus, Salmonella spp.,
Shigella và Vibtio cholera. Nghiên cGu c)a Barrow et
al. (1998) 1ã Gng dSng thành công th*c khu&n thB
trong vi>c 1i9u tr b>nh viêm màng não do E. coli gây
ra trên gà và bò t?i Brazil. Gan 1ây, Huff et al. (2002)
1ã thành công trong vi>c s4 dSng th*c khu&n 1B 1i9u
tr viêm 16]ng hô h8p do E. coli gây ra trên gà th t t?i
Mˆ. Tuy nhiên, n6Lc ta, vtn ch6a có nghiên cGu
nào v9 th*c khu&n thB trong vi>c kiBm soát vi khu&n
E. coli gây b>nh trên gà, vì vMy nghiên cGu hi>n t?i
16Cc ti!n hành vLi mSc tiêu là phân lMp th*c khu&n
thB và xác 1 nh kh% nng phân gi%i E. coli c)a th*c
khu&n thB trong 1i9u ki>n phòng thí nghi>m, tW 1ó
tìm ra dòng th*c khu&n thB có 1+c tính cao trong kí
sinh và tiêu di>t vi khu&n E.coli nh3m làm n9n t%ng
cho các nghiên cGu Gng dSng th*c khu&n thB sau

N¤NG NGHIÖP Vµ PH¸T TRIÓN N¤NG TH¤N - Th¸ng 11/2016 139

 KHOA HC CÔNG NGH
2. V T LI U VÀ PHNG PHÁP NGHIÊN C,U
2.1. VM
VMt li>
li>u
T:ng c+ng có 32 mtu 18t và 32 mtu n6Lc th%i
thu 16Cc tW 32 tr?i gà th6Png ph&m trên 1 a bàn t.nh
Trà Vinh, gm: huy>n Càng Long (12 mtu), huy>n
Cau Kè (10 mtu) và thành ph- Trà Vinh (10 mtu) và
t.nh VŒnh Long gm các huy>n Long H (6 mtu),
Mang Thít (10 mtu) và Trà Ôn (16 mtu).
2.2. Ph6Png pháp
2.2.1. Ph6Png pháp l8y mtu
Mtu 18t: Dùng mu|ng nh*a vô trùng l8y 1 gram
18t ngtu nhiên 10 v trí khác nhau trong tr?i, cho
vào túi ni lông vô trùng (Tanji et al., 2004).
Mtu n6Lc: Hút 1 ml tram tích n6Lc 10 v trí
khác nhau trong tr?i, cho vào -ng falcon (15 ml) vô
trùng 1My kín nyp (Huff et al., 2002).
T8t c% các mtu 16Cc ghi ký hi>u (PD, ED — th*c
khu&n thB phân lMp tW 18t và PN, EN — th*c khu&n
thB phân lMp tW n6Lc) và cho vào thùng 1á trH l?nh,
sau 1ó mang v9 phòng thí nghi>m trH 4oC.
2.2.2. Nuôi c8y và phân lMp các ch)ng vi khu&n
Escherichia coli
Mtu n6Lc th%i 16Cc 1ng nh8t, pha loãng vào
dung d ch pepton 1>m (Buffered Peptone Water -
BPW) vLi t~ l> 1:9 1ng nh8t h|n hCp và 1em )
37oC qua 1êm. Mtu 18t 16Cc nghi9n m n, cho vào
bình tam giác, thêm 20 ml n6Lc c8t vô trùng, lyc 19u,
1B yên trong 5 phút, sau 1ó hút 10 ml huy9n phù
phía trên cho vào -ng falcon vô trùng và ti!n hành
phân tích gi-ng nh6 mtu n6Lc th%i.
Mtu (1 ml) 16Cc pha loãng 10 lan và ti9n tng
sinh trong BPW, dùng que c8y 1au tròn l8y m+t vòng
canh khu&n c8y lên 1Œa petri chGa môi tr6]ng tng
sinh chTn lTc trên môi tr6]ng EMB (Eosin
Methylene Blue) (Quinn et al., 2009), sau 1ó l8y 3
khu&n l?c nuôi c8y phân lMp trên môi tr6]ng TBX
(Tryptone Bile X-Glucuronide) (Gross và Rowe,
1985), c8y truy9n các khu&n l?c E. coli trên môi
tr6]ng TSA (Tryptic Soy Agar) 1B tng sinh phSc
hi, sau 1ó thu ho?ch và giH gi-ng (Nguyn Ti!n
D‡ng, 2009). T8t c% các b6Lc 19u 16Cc ) 37oC
trong 24 gi].
2.2.3. Kh%o sát s* biBu hi>n c)a các gien 1+c l*c
trên các ch)ng E. coli
Sau khi tng sinh các ch)ng vi khu&n E. coli trên
môi tr6]ng TSA 37oC trong 24 gi], ti!n hành thu
sinh kh-i cho vào -ng eppendorf chGa 500 µl n6Lc
kh4 ion, 1ng nh8t h|n hCp trên, gây s-c nhi>t
100oC trong 10 phút. Ti!n hành ly tâm 13.000
140 N¤NG NGHIÖP Vµ PH¸T TRIÓN N¤NG TH¤N - Th¸ng 11/2016
vòng/phút trong 15 phút, sau 1ó chuyBn d ch trong
chGa ADN phía trên vào eppendorf vô trùng và trH -
20oC.
Trình t* các c[p mi 16Cc s4 dSng 1B xác 1 nh
gien 1+c l*c: (i) gien FimH (mi xuôi: 5’-TGC AGA
ACG GAT AAG CCG TGG-3’ và mi ng6Cc 5’-GCA
GTC ACC TGC CCT CCG GTA-3’; Tm = 57oC, s%n
ph&m khu!ch 1?i 508 bp) (Zahraa et al., 2014), (ii)
gien Stx1 (mi xuôi: 5’-ATA AAT CGC CAT TCG
TTG ACT AC-3’ và mi ng6Cc 5’-AGA ACG CCC ACT
GAG ATC ATC-3’; Tm = 40oC, s%n ph&m khu!ch 1?i
180 bp) và (iii) gien Stx2 (mi xuôi: 5’-GGC ACT
GTC TGA AAC TGC TCC-3’ và mi ng6Cc 5’-TCG
CCA GTT ATC TGA CAT TCT G; Tm = 60oC, s%n
ph&m khu!ch 1?i 255 bp) (Paton và Paton, 1998).
Thành phan hóa ch8t cho 1 ph%n Gng PCR bao
gm 25 ng ADN, 0,25 M m|i mi, 0,25 M c)a m|i
dNTP, 1x 1>m PCR, và 1U c)a Taq DNA polymeraza
(Fementas). Các ph%n Gng PCR 16Cc th*c hi>n trên
máy luân nhi>t (Veriti, Singabore 299025752) vLi chu
trình nhi>t nh6 sau: bi!n tính 94˚C trong 5 phút,
ti!p theo vLi 35 chu k¨ (94˚C trong 60 giây, Tm˚C
trong 60 giây và 72˚C trong 90 giây). Vi>c kéo dài
cu-i cùng 16Cc th*c hi>n 72˚C trong 7 phút. Ti!p
theo, 10 uL s%n ph&m PCR 16Cc kiBm tra trên gel
agaroza 2%.
2.2.4. Phân lMp các dòng th*c khu&n thB phân
gi%i vi khu&n E. coli
Mtu n6Lc th%i (9 ml) ho[c huy9n phù mtu 18t
lyc trong 5 phút, ly tâm 6000 vòng/phút trong 15
phút 4oC. Hút 6 ml phan d ch trong phía trên cho
vào -ng nghi>m có nyp, thêm clorofom 50 µl/ml, ly
tâm lo?i bz c[n. Hút 5 ml d ch trong chGa th*c khu&n
thB cho vào -ng nghi>m có nyp vLi 5 ml TSB và 0,1
ml (108 cfu/ml) vi khu&n E. coli (OD=0,3-0,5), ) 8m
37oC trong 24 gi]. Sau khi ), hút 1,5 ml h|n hCp cho
vào eppendoff vô trùng, thêm vào 50 µl clorofom/ml
và ly tâm 6.000 vòng/phút trong 15 phút 4oC, thu
l8y 1 ml phan d ch trong phía trên và b%o qu%n trong
t-i 4oC. KiBm tra th*c khu&n thB b3ng cách hút 0,1
ml huy9n phù vi khu&n E. coli cho vào 1Œa petri vô
trùng chGa 10 ml môi tr6]ng TSB (0,8% aga). Ti!p
theo nhz 5 µl dung d ch th*c khu&n thB 16Cc ly trích
tWng mtu lên nhHng v trí khác nhau trên b9 m[t
1Œa th?ch TSB chGa m|i ch)ng vi khu&n E. coli, 1ánh
d8u các 1Œa petri và 1em ) 8m 37oC trong 24 gi],
quan sát s* hình thành các vòng vô khu&n (plaques).
Tách ròng và nhân mMt s- th*c khu&n: dùng tâm
bông vô trùng c8y truy9n các màng (plaques) theo
 KHOA HC CÔNG NGH
16]ng ziczac lên b9 m[t 1Œa petri chGa môi tr6]ng
TSB (0,8% aga) k!t hCp vLi 0,1 ml huy9n phù vi
khu&n E. coli ký ch). Sau 24 gi] th*c khu&n thB 16Cc
thu ho?ch b3ng cách thêm vào 2-3 ml n6Lc c8t vô
trùng và lyc 19u, hút 2 ml huy9n phù cho vào
eppendorf thêm vào 50 µl clorofom/ml mang ly tâm
và thu phan d ch trong chGa th*c khu&n thB. Hút 0,1
ml dung d ch th*c khu&n thB cho vào 1Œa petri vô
trùng chGa 10 ml môi tr6]ng TSB (0,8% aga) và 0,1
ml (108 cfu/ml) huy9n phù vi khu&n E. coli ký ch),
lyc nhg 1B 1ng nh8t h|n hCp, ) 8m 37oC. Sau 24
gi] tìm m+t vòng plaque 1Pn l, ti!p tSc th*c hi>n
c8y truy9n nhân mMt s- và thu ho?ch dung d ch th*c
khu&n thB thuan 1ã 16Cc tách ròng, trH ngun trong
1i9u ki>n t-i nhi>t 1+ 4oC 1B th*c hi>n các thí
nghi>m ti!p theo.
2.2.5. Eánh giá ph: ký ch) c)a các dòng th*c
khu&n thB phân lMp
Các vi khu&n E. coli thuan 16Cc c8y lên 1Œa petri
chGa môi tr6]ng TSA cho nhân mMt s- trong 24 gi].
Th*c hi>n pha loãng và 1o 1+ 1Sc b3ng máy OD
quang ph: b6Lc sóng 600 nm 1B thu huy9n phù
c)a tWng ch)ng E. coli vLi OD=0,3-0,5 t6Png 16Png
mMt 1+ 108 cfu/ml (Bao et al., 2011). Hút 0,1 ml
huy9n phù c)a tWng ch)ng vi khu&n này cho vào 1Œa
petri vô trùng k!t hCp vLi 10 ml môi tr6]ng TSB
(0,8% aga). Lyc nhg 1Œa petri cho 1ng nh8t h|n hCp,
sau 1ó dùng tm bông vô trùng c8y dung d ch tWng
dòng th*c khu&n thB lên tWng v trí khác nhau trên
b9 m[t 1Œa th?ch TSB chGa các ch)ng vi khu&n E.
coli, sao cho trên 1Œa th?ch c)a m|i ch)ng E. coli 19u
có các dòng th*c khu&n thB. » 8m 37oC trong 24
gi], sau 1ó quan sát s* hình thành các 16]ng trong
su-t trên b9 m[t môi tr6]ng. Ghi nhMn k!t qu% ph:
ký ch) c)a các dòng th*c khu&n thB trên các ch)ng
vi khu&n E. coli ký ch) khác nhau.
2.2.6. Eánh giá kh% nng phân gi%i vi khu&n E.
coli c)a th*c khu&n thB
Hút 0,1 ml dung d ch tWng dòng th*c khu&n thB
cho vào eppendorf vô trùng, thêm vào 9 ml n6Lc c8t
vô trùng, 1ng nh8t h|n hCp và pha loãng 1!n nng
1+ 10-5. Hút 0,1 ml huy9n phù c)a tWng dòng th*c
khu&n thB tWng nng 1+ pha loãng khác nhau cho
B%ng 1.
1. T~
T~ l>
l> hi>
hi>n di>
di>n c)
c)a th*
th*c khu& thB ký sinh trên E. coli
Mtu 18t
E a 1iBm S- S- T~ l> S-
l6Cng mtu (+) (%) l6Cng
Trà Vinh
N¤NG NGHIÖP Vµ PH¸T TRIÓN N¤NG TH¤N - Th¸ng 11/2016
vào 1Œa petri vô trùng cùng vLi 10 ml môi tr6]ng TSB
(0,8% aga) và 0,1 ml huy9n phù vi khu&n E. coli ký
ch) (108 cfu/ml) 16Cc chTn, lyc nhg 1Œa cho 1ng
nh8t h|n hCp sau 1ó 1em ) 8m 37oC. Sau 24 gi]
ti!n hành quan sát và 1!m mMt s- plaques tWng 1Œa
petri. † m|i dòng th*c khu&n thB chTn ra m+t 1Œa
petri có mMt s- kho%ng 103 cfu/ml 1B ti!n hành so
sánh và ghi nhMn 16]ng kính các vòng vô khu&n vào
các th]i 1iBm 24, 36 và 72 gi] sau khi nuôi c8y b3ng
cách dùng th6Lc panme 1o 16]ng kính 10 vòng vô
khu&n ngtu nhiên trên m|i 1Œa petri và l8y s- li>u
trung bình.
2.3. X4
X4 lý s-
s- li>
li>u
S- li>u 16Cc phân tích thông kê theo mô hình
One-way c)a phan m9m Minitab 16.2.
3. KT QU VÀ THO LU N
3.1. Phân lM
lMp các dòng th*
th*c khu
khu&
hu&n thB
thB
K!t qu% phân lMp th*c khu&n thB ký sinh trên 32
ch)ng E. coli khác nhau trên 1 a bàn các huy>n Càng
Long, Cau Kè và thành ph- Trà Vinh 16Cc trình bày
b%ng 1. K!t qu% tìm th8y 21 dòng th*c khu&n thB
(chi!m t~ l> 65,6%) có kh% nng ký sinh phân gi%i vi
khu&n E. coli t6Png Gng tWng ký ch) c)a chúng phân
b- t?i ba huy>n huy>n Càng Long có 10 dòng
(31,3%), huy>n Cau Kè có 9 dòng (28,1%) và th8p
nh8t thành ph- Trà Vinh có 2 dòng (6,2%).
Trên 1 a bàn t.nh VŒnh Long, trong t:ng s- 32
ch)ng E. coli khác nhau, phân lMp 16Cc 5 dòng th*c
khu&n thB có kh% nng phân gi%i E. coli t6Png Gng
tWng ký ch) c)a chúng chi!m t~ l> 15,6%, trong 1ó
các tr?i Trà Ôn có 3 dòng (9,3%), Mang Thít có 2
dòng (6,3%), Long H không tìm th8y th*c khu&n thB
(B%ng 1).
K!t qu% trên cao hPn so vLi k!t qu% nghiên cGu
c)a Tanji et al. (2004) v9 th*c khu&n thB ký sinh vi
khu&n E. coli phân lMp tW phân và 18t t?i các tr?i nuôi
gia súc Tokyo, NhMt B%n vLi t~ l> hi>n di>n là 12,3%
trong t:ng s- 211 mtu. K!t qu% nghiên cGu c)a
Chibani-Chennoufi et al. (2004) v9 th*c khu&n thB
trên vi khu&n E. coli phân lMp tW phân c)a 140 tr em
t?i Bangladesh, s- l6Cng th*c khu&n thB ký sinh ch.
chi!m 19%.
khu&n thB
Mtu n6Lc th%i T:ng c+ng
S- mtu T~ l> S- S- T~ l>
(+) (%) l6Cng mtu (+) (%)
141
 KHOA HC CÔNG NGH

Tp. Trà Vinh 05 01 6,2 05 01 6,2 10 2 6,2

Càng Long 06 06 37,5 06 04 25,0 12 10 31,3
Cau Kè 05 05 31,3 05 04 25,0 10 9 28,1
T:ng 16 12 75,0 16 09 56,3 32 21 65,6
VŒnh Long
Long H 3 0 0 3 0 0 6 0 0
Mang Thít 5 1 6,3 5 1 6,3 10 2 6,3
Trà Ôn 8 3 18,8 8 0 0 16 3 9,3
T:ng 16 4 25 16 1 6,3 32 5 15,6
+: có th*c khu&n ký sinh
3.2. S*
S* biB
biBu hi>
hi>n c)
c)a các gien 1+ 1+c l*
l*c trên các l> 40,6%) t?i các tr?i VŒnh Long (B%ng 2). Khi
ch) khu&n E. coli
ch)ng vi khu& nghiên cGu trên các ch)ng vi khu&n E. coli phân lMp
Ti!n hành kh%o sát s* biBu hi>n c)a 3 gien 1+c tW phân c)a nhHng tr em b b>nh, Zahraa et al
l*c FimH, Stx1, Stx2 b3ng ph6Png pháp PCR, k!t (2014) c‡ng tìm th8y t. l> d6Png tính cao vLi gien
qu% cho th8y t8t c% các ch)ng vi khu&n E. coli phân FimH (90%). E-i vLi gien Stx1 và Stx2, nghiên cGu
lMp, 100% các ch)ng 19u có mang ít nh8t m+t gien c)a Lê Th Mai Khanh (2004) v9 E. coli trên các mtu
1+c l*c (FimH) (Hình 1) và không có ch)ng E. coli heo và bò tìm th8y tan s- xu8t hi>n c)a gien Stx2 là
nào mang gien Stx1. Bên c?nh 1ó, c‡ng tìm th8y 8 22,9% và c‡ng không th8y s* hi>n di>n c)a gien Stx1
ch)ng vi khu&n mang gien Stx2 (chi!m t~ l> 25,0%) (0%).
t.nh Trà Vinh và 13 ch)ng mang gien này (chi!m t~
B%ng 2. K!
K!t qu%
qu% phân lM
lMp và s- l6Cng E. coli
s- l6C
mang gien 1+1+c l*
l*c
S- Gien 1+c l*c
E a 1iBm l6Cng trên E. coli
E. coli FimH Stx1 Stx2
Trà Vinh
TP. Trà Vinh 10 10 0 6 (a)
Càng Long 12 12 0 1
Cau Kè 10 10 0 1
T:ng 32 32 0 8
T~ l> (%) 100 0 25
VŒnh Long
Long H 6 6 0 2
Trà Ôn 16 16 0 6 (b)
Hình 1. Gien 1+c l*
l*c FimH (a) và Stx2
Mang Thít 10 9 0 5
(b) 16C
16Cc khu!
khu!ch 1?
1?i và thB
thB hi>
hi>n trên gel
T:ng 32 32 0 13
agaroza 2%
T~ l> (%) 100 0 40,6
3.3. Ph:
Ph: ký ch)
ch) c)
c)a các dòng th*
th*c khu&
khu&n thBthB 6 ch)ng trong t:ng s- 32 ch)ng E. coli 16Cc phân
khu&n E. coli
trên vi khu& lMp, chi!m t~ l> lan l6Ct là 18,8%, 25%, 21,9%, 15,6 % và
K!t qu% kiBm tra ph: ký ch) c)a 21 dòng th*c 18,8%. Trong m+t nghiên cGu v9 th*c khu&n thB ký
khu&n thB 1-i vLi 32 ch)ng vi khu&n E. coli t?i t.nh sinh trên các ch)ng vi khu&n Salmonella pullorum
Trà Vinh cho th8y, ch)ng E. coli EN9 và ED5 b ký gây b>nh trên gà t?i Nam Kinh - Trung Qu-c (Bao et
sinh nhi9u nh8t b i các dòng th*c khu&n thB vLi s- al., 2011), nhóm tác gi% 1ã phân lMp 16Cc 2 dòng th*c
l6Cng lan l6Ct là 12 và 8 dòng (B%ng 3). K!t qu% c‡ng khu&n thB PSPu-95 và PSPu-4-116, vLi ph: ký ch)
ghi nhMn 16Cc các dòng th*c khu&n thB PD6, PN10, r+ng lan l6Ct là 17 ch)ng (85%) và 14 ch)ng (70%)
PD11, PD14 và PN15 có ph: ký ch) r+ng, vLi s- trong t:ng s- 20 ch)ng vi khu&n S. pullorum. Thêm
l6Cng ch)ng E. coli b ký sinh lan l6Ct là 6, 8, 7, 5 và vào 1ó, k!t qu% trên c‡ng cho th8y các dòng th*c

142 N¤NG NGHIÖP Vµ PH¸T TRIÓN N¤NG TH¤N - Th¸ng 11/2016

 KHOA HC CÔNG NGH

khu&n thB phân lMp 16Cc có thB t8n công phân gi%i ch)ng ED5 có thB b phân gi%i b i 8 dòng th*c
các ch)ng vi khu&n mang c% 2 gien 1+c l*c FimH và khu&n thB trong t:ng s- 21 dòng th*c thB phân lMp.
Stx2 có kh% nng gây b>nh cho vMt nuôi, 1[c bi>t là

B%ng 3. Ph:
Ph: ký ch)
ch) c)
c)a 21 dòng th*
th*c khu&
khu&n thB
thB trên 32 ch) khu&n E. coli
ch)ng vi khu& Trà Vinh

Các ch)ng Mã s- các dòng th*c khu&n thB ký sinh vi khu&n E. coli T:ng s-
vi khu&n D D N D N D N D N D N D D N D N D N TKT ký
E. coli D2 N2 D6 sinh VK
7 8 8 9 9 10 10 11 11 12 12 13 14 14 15 15 16 16
ED1 - - + - + - - - + + - - - - - - -
4 - - - -
ED2 - - - + - - - - - + - - - - - - -
2 - - - -
ED4 + - - - - - - - - - - - - - - - -
1 - - - -
ED5 + + + - + - + + - + - - - - - - 8- - - - +
ED6 - - + + - - - - - + + + - - + + -
7 - - - -
ED10 - - - - - - - - - - - - - - - - -
1 - + - -
ED11 - - - - - - - - - + - - - - - - -
2 - + - -
ED12 - - + - - - - - - - + - + - + + 6- - - + -
ED14 - - - - - - - - + - - - - - - - -
1 - - - -
ED15 - - - - - - - - + - + - - - - - -
4 + + - -
ED16 - - - - - - - - - - + - - + - - 5- + - + +
EN4 - - - - - - - - - - - - - - - - -
1 - + - -
EN5 + + - - - - + - - - - - - - - + -
4 - - - -
EN8 - + - - - + + + + + - - - - - - -
6 - - - -
EN9 - - + + + - + - + + + + - - + + -
12 + + - -
EN10 - - - - - - - - - - + - - - - - -
1 - - - -
EN13 - - - - - - - - - + - - - - - - -
1 - - - -
EN14 - - + - - - - - - - - + - - - - 4+ - - + -
EN15 - - - - - - - - - - + - - - - + 6- + + + +
EN16 - - - - - - - - - - - - - - - - 1- - - - +
T:ng s- VK b
ký sinh bLi 3 3 6 3 3 1 4 2 5 8 7 3 1 1 3 5 1 4 6 4 4
TKT
B%ng 4 cho th8y, t:ng s- 32 ch)ng E. coli t.nh B%ng 4. Ph:
Ph: ký ch)
ch) c)
c)a 5 dòng th*
th*c khu&
khu&n thB
thB trên
VŒnh Long có 12 ch)ng b ký sinh, trong 1ó các ch)ng E. coli VŒnh Long
12 ch)
ch)ng E. coli b ký sinh nhi9u nh8t là 5 dòng và ít Th*c khu&n thB T:ng
nh8t là 2 dòng th*c khu&n thB. Các dòng th*c khu&n Ch)ng s- TKT
PD7, PD8 và PD9 19u ký ch) trên 9 ch)ng E. coli E. coli PD7 PD8 PD9 PD13 PN13 ký sinh
ED14, ED15, EN2, EN3, EN4, EN5, EN6, EN7 và VK
EN1 − − − + + 2
EN17 (chi!m 27,3%), 2 dòng th*c khu&n còn l?i PD13
EN2 + + + + + 5
và PN13 19u ký ch) trên 12 ch)ng E. coli (chi!m
EN3 + + + + + 5
36,36%). K!t qu% trên cho th8y, hai dòng th*c khu&n
EN4 + + + + + 5
thB PD13 và PN13 phân lMp 16Cc có thB t8n công EN5 + + + + + 5
phân gi%i các ch)ng vi khu&n mang c% 2 gien 1+c l*c EN6 + + + + + 5
FimH và Stx2 có kh% nng gây b>nh n[ng cho vMt EN7 + + + + + 5
nuôi nh6 ED12 và ED13. Do 1ó, vi>c s4 dSng các ED12 − − − + + 2
dòng th*c khu&n thB trên trong vi>c phòng tr b>nh ED13 − − − + + 2
do vi khu&n E. coli gây ra trên gà có thB góp phan ED14 + + + + + 5
làm gi%m vi>c s4 dSng kháng sinh trong chn nuôi. ED15 + + + + + 5
EN17 + + + + + 5

N¤NG NGHIÖP Vµ PH¸T TRIÓN N¤NG TH¤N - Th¸ng 11/2016 143

 KHOA HC CÔNG NGH

T:ng s- khu&n E. coli ED14 có 16]ng kính trung bình 1,24-

VK b ký 3,71 mm. † th]i 1iBm 48 gi] và 72 gi] ti!p theo, các
9 9 9 12 12
sinh b i dòng th*c khu&n thB 19u cho hi>u qu% phân gi%i vi
TKT khu&n tng lên vLi 16]ng kính dao 1+ng 1,34-1,66
T~ l> (%) 27,3 27,3 27,3 36,4 36,4
mm (Trà Vinh) và 1,53-4,00 mm (VŒnh Long). Nghiên
Chú thích: +: có th*c khu&n ký sinh; -: không có th*c
cGu c)a Wang et al. (2006) v9 th]i gian phân gi%i c)a
khu&n ký sinh; TKT: th*c khu&n thB; VK: vi khu&n.
th*c khu&n thB cho th8y, có s* t6Png quan d6Png
3.4. Kh%
Kh% nng phân gi% khu&n E. coli EN9 và
gi%i vi khu&
giHa th]i gian phân gi%i và kích th6Lc c)a 16]ng
ED14 c)
c)a 5 dòng th*
th*c khu&
khu&n thB
thB
kính phân gi%i. K!t qu% hi>n t?i c‡ng tìm th8y 16]ng
K!t qu% b%ng 5 ch. ra r3ng các th*c khu&n thB
kính phân gi%i c)a th*c khu&n thB 1-i vLi vi khu&n E.
thu 16Cc t?i các tr?i gà VŒnh Long có kh% nng
coli tng dan theo th]i gian kh%o sát tW 24 gi] 1!n 72
phân gi%i vi khu&n E. coli có phan hi>u qu% hPn các
gi]. Nghiên cGu c)a Nguyn Th Trúc Giang và ctv.
dòng th*c khu&n thB phân lMp tW các tr?i gà Trà
(2014) c‡ng xác 1 nh 16Cc 4 dòng th*c khu&n thB có
Vinh. CS thB, th]i 1iBm 24 gi] sau khi x4 lý 5 dòng
kh% nng ký sinh vi khu&n Xanthomonas oryzae pv.
th*c khu&n thB 1-i vLi ch)ng E. coli EN9 t.nh Trà
oryzae vLi 16]ng kính gi%i tng 3,8-11,7 mm trong
Vinh thì 16]ng kính phân gi%i dao 1+ng 1,18-1,56
24-48 gi].
mm, trong khi 1ó t.nh VŒnh Long, vòng vô khu&n
c)a 5 dòng th*c khu&n thB t?o ra khi phân gi%i vi
B%ng 5. E6]
E6]ng kính phân gi%
gi%i c)
c)a 5 dòng th*
th*c khu&
khu&n thB
thB vL
vLi vi
khu&n E. coli
khu&
Dòng E6]ng kính phân gi%i
th*c (mm)
E a 1iBm phân lMp
khu&n
24 gi] 48 gi] 72 gi]
thB
Trà Vinh (ch)ng E. coli EN9)
PD6 An Tr6]ng — Càng Long 1,20b 1,34b 1,41b
PN10 Tân An — Càng Long 1,56a 1,59a 1,66a
PD11 Tân An — Càng Long 1,18b 1,47a 1,59a
PD14 An Phú Tân — Cau Kè 1,35b 1,41b 1,53a
PN15 Phong Th?nh — Cau Kè 1,40a 1,56a 1,64a Hinh 2. Vòng vô khu&
khu&n
P <0,05 <0,05 <0,05 c)a th*
th*c khu&
khu&n thB
thB PD8
t?i th]
th]i 1iB
1iBm 48 gi]
gi]
CV (%) 15,4 11,3 10,1
VŒnh Long (ch)ng E. coli ED14)
PD7 Tích Thi>n − Trà Ôn 3,04a 3,16a 3,24a
PD8 H*u Thành − Trà Ôn 3,71a 3,88a 4,00a
PD9 H*u Thành − Trà Ôn 3,35a 3,48a 3,56a
PD13 An Ph6Lc — Mang Thít 1,24b 1,30b 1,41b
PN13 An Ph6Lc — Mang Thít 1,40 b
1,53 b
1,66b
P <0,001 <0,001 <0,001
CV (%) 27,5 27,4 26,9
Chú thích: Các s- trong cùng m+t c+t theo sau b i m+t ho[c
nhi9u chH s- gi-ng nhau thì không khác bi>t có ý nghŒa th-ng kê
mGc 5%.
K!t qu% b%ng 5 c‡ng thB hi>n 2 dòng th*c PD6, PD11 và PD14 trong 1i9u ki>n phòng thí
khu&n thB PN10 và PN15 có kh% nng phân gi%i vi nghi>m. Ngoài ra, dòng th*c khu&n thB PN10 còn
khu&n E. coli EN9 cao hPn các dòng th*c khu&n thB 16Cc ghi nhMn có kh% nng kí sinh nhi9u ch)ng E.

144 N¤NG NGHIÖP Vµ PH¸T TRIÓN N¤NG TH¤N - Th¸ng 11/2016

 KHOA HC CÔNG NGH
coli nh8t (8 ch)ng) trong s- 21 dòng th*c khu&n thB
phân lMp 16Cc. E[c bi>t, trong s- 8 ch)ng E. coli b
phân gi%i có 2 ch)ng ED5 và EN8 là có mang c% 2
gien 1+c l*c FimH và Stx2. E-i vLi t.nh VŒnh Long,
các dòng th*c khu&n thB PD7, PD8 và PD9 có kh%
nng phân gi%i vi khu&n E. coli ED14 cao hPn so vLi
hai dòng th*c khu&n thB còn l?i (PD13 và PN13). Các
dòng này cùng vLi dòng PN10 có thB là các dòng
th*c khu&n thB ti9m nng can 16Cc 1ánh giá thêm v9
hi>u qu% phòng tr trong 1i9u ki>n in vivo.
4. KT LU N
Trong 32 ch)ng vi khu&n E. coli t?i các tr?i gà
c)a t.nh Trà Vinh và VŒnh Long, lan l6Ct phân lMp
16Cc 21 và 5 dòng th*c khu&n thB có kh% nng ký
sinh phân gi%i các ch)ng khác nhau trong 32 ch)ng
E. coli phân lMp. E-i vLi các ch)ng E. coli, có 100%
mang gien FimH và không có ch)ng nào mang gien
Stx1; bên c?nh 1ó, có 8 ch)ng mang gien Stx2 t.nh
Trà Vinh và 13 ch)ng t.nh VŒnh Long 16Cc tìm
th8y.
Trong các tr?i gà thu+c t.nh Trà Vinh, ch)ng E.
coli EN9 và ED5 b ký sinh nhi9u nh8t b i các dòng
th*c khu&n thB, 1ng th]i ghi nhMn 16Cc 5 dòng th*c
khu&n thB có ph: ký ch) r+ng là PD6, PN10, PD11,
PD14 và PN15 trên các ch)ng vi khu&n E. coli. E-i
vLi các tr?i gà VŒnh Long, các ch)ng E. coli ED14,
ED15 và EN17 b t8t c% 5 dòng th*c khu&n thB ký
sinh. Bên c?nh 1ó, hai dòng th*c khu&n thB PD13 và
PN13 16Cc tìm th8y ký sinh trên t8t c% 12 ch)ng
E.coli.
V9 kh% nng phân gi%i ch)ng vi khu&n E. coli
EN9 (Trà Vinh) và ED14 (VŒnh Long), dòng th*c
khu&n thB PN10 có kh% nng phân gi%i ch)ng vi
khu&n E. coli EN9 cao hPn các dòng th*c khu&n thB
còn l?i và các dòng th*c khu&n thB PD7, PD8 và PD9
có kh% nng phân gi%i vi khu&n E. coli ED14 cao hPn
hai dòng PD13 và PN13. Các k!t qu% này 1ang 16Cc
th4 nghi>m trên gà 1B 1ánh giá hi>u qu% phòng tr .
L2I CM N
Công trình 16Cc hoàn thành vLi s* tài trC c)a
Công ty TNHH Nông nghi>p Hoàng Long.
TÀI LI U THAM KHO
1. Bao H., H. Zhang, R. Wang, 2011. Isolation
and characterization of bacteriophages of Salmonella
enterica serovar Pullorum. Poult. Sci. 90(10): 2370-
2377.
2. Balogh, B., 2002. Strategies of improving
the efficacy of bacteriophages for controlling
bacterial spot of tomato. A thesis presented to the
N¤NG NGHIÖP Vµ PH¸T TRIÓN N¤NG TH¤N - Th¸ng 11/2016
graduate school of the University of Florida in partial
fulfillment of the requirements for the degree of
Master of Science. University of Florida, 74 p.
3. Chibani-Chennoufi S., S. Josette, B. Anne,
D. Marie-Lise, K. Elizabeth, Q. Firdausi, A. S.
Shafiqul, B. Harald, 2004. Isolation of Escherichia
coli bacteriophages from the stool of pediatric
diarrhea patients in Bangladesh. J. Bacteriol.
186(24): 8287-8294.
4. Drulis-Kawa, Z., Majkowska-Skrobek, B.
Maciejewska, Anne-Sophie Delattre, R. Lavigne,
2012. Learning from bacteriophages - advantages and
limitations of phage and phage-encoded protein
applications. Curr. Protein. Pept. Sci. 13(8): 699—722.
5. Huff W. E., G. R. Huff, N. C. Rath, J.M.
Balog, A. M. Donoghue, 2002. Prevention of
Escherichia coli respiratory infection in broiler
chickens with bacteriophage (SPR02). Poult. Sci.
81:437-441.
6. Lê Th Mai Khanh, 2004. Phát hi>n m+t s-
gien 1+c l*c c)a Escherichia coli phân lMp 16Cc tW
phân và th t bò, heo b3ng kˆ thuMt multiplex - PCR.
LuMn vn Th?c sŒ Nông nghi>p, Tr6]ng E?i hTc
Nông Lâm, TP. H Chí Minh.
7. Lê Vn T?o, 2006. B>nh do vi khu&n
Escherichia coli gây ra lCn. T?p chí Khoa hTc Kˆ
thuMt Thú y 3(3): 75-84.
8. Nguyn Ti!n D‡ng, 2009. Nghiên cGu phân
bi>t loài phS Salmonella gây b>nh vLi các loài phS
khác trong th*c ph&m b3ng kˆ thuMt sinh hTc phân
t4. LuMn án ti!n sŒ, chuyên ngành Vi sinh.
9. Nguyn Th Trúc Giang, Eoàn Th Ki9u
Tiên và Nguyn Th Thu Nga, 2014. Phân lMp th*c
khu&n thB và 1ánh giá hi>u qu% phòng tr b>nh cháy
bìa lá lúa do vi khu&n Xanthomonas oryzae pv.
oryzae. T?p chí Khoa hTc- Tr6]ng E?i hTc Can ThP.
S- chuyên 19: Nông nghi>p (4): 194-203.
10. Paton, J. C., A. W. Paton, 1998. Detection
and characterization of Shiga toxigenic Escherichia
coli by using multiplex PCR assays for Stx1, Stx2,
EaeA, Enterohemorrhagic E. coli hlyA, rfbO111 and
rfbO157. J. Clin. Microbiol. 36(2): 598-602.
11. Barrow P., L. Margaret, A. Jr. Berchieri,
1998. Use of lytic bacteriophage for control of
experimental Escherichia coli septicemia and
meningitis in chickens and calves. Clin. Diagn. Lab.
Immunol. 5(3): 294-298.
12. Quinn P. J., B. Markey, G. R. Carter, 1994.
Clinical veterinary microbiology. Wolfe, London.
145
 KHOA HC CÔNG NGH

13. Gross, R. J., Rowe B. 1985. Escherichia coli
diarhoea. J. Hyg. 95(3): 513-550.
14. Tanji Y., T. Shimada, M. Yoichi, K.
Miyanaga, K. Hori, H. Unno, 2004. Towards rational
control of Escherchia coli O157:H7 by a phage
cocktail. Appl Microbiol Biotechnol 64: 270-274.
15. Wang, I. N., 2006. Lysis timing and
bacteriophage fitness. Genetics 172 17—26.
16. Zahraa, A. A., A. H. Khalid, N. A. Zaid, 2014.
Genotypic study of two virulence factors Fimh and
kpsMTII in uropathogenic Escherichia coli isolates
from children patients with urinary tract infections.
Baghdad Sci J 11(4): 1475-1480.

TO LYSE ESCHERICHIA COLI OF BACTERIOPHAGES ISOLATED

INVESTIGATION ON THE ABILITY TO
FROM COMMERCIAL CHICKEN FARMS
Mai Huynh Du An, Huynh Chi Nghia, Bui Khanh Lam, Phan Huu Bang,
Luu Huynh Anh, Nguyen Thi Thu Nga, Nguyen Trong Ngu
Summary
The present study was conducted to evaluate lytic activity on pathogenic Escherichia coli of bacteriophages
isolated from industrial chicken farms in Tra Vinh and Vinh Long provinces. In total, 21 and 5
bacteriophages were identified to lyse 32 strains E. coli originally from Tra Vinh and Vinh Long,
respectively. Polymerase chain reaction (PCR) was used to determine the presence of three toxin genes
namely FimH, Stx1 and Stx2 of E. coli and tt was shown that 100% E. coli carrying FimH gene and none of
the E. coli possessed the Stx1 gene. For samples collected in Tra Vinh and Vinh Long provinces, the
presence of Stx2 gene was found in 8 and 13 E. coli strains, respectively. In addition, to chicken farms of
Tra Vinh, EN9 E. coli strain was infected with the highest number of bacteriophages (12 strains) whereas
to those from Vinh Long, ED14, ED15 and EN17 E. coli were highly infected with 5 bacteriophage strains.
Finally, on the evaluation of lytic efficacy of bacteriophages at 24, 48 and 72 hours, it was indicated that
PN10 phage were of higher lytic activity on EN9 E. coli and PD7, PD8 and PD9 phages were more effitive
on ED14 E. coli. These results are under applying and evaluation for E. coli prevention and treatment in
chickens.
Keywords: Bacteriophages, chickens, E. coli, prevention, treatment.

Ng6]i
Ng6]i ph%n bi>n:
bi>n: PGS.TS.
PGS.TS. Cù HHu
HHu Phú
Ngày nhMn
nhMn bài:
bài 5/8/2016
Ngày thông qua ph%n
ph%n bi>n:
bi>n 5/9/2016
Ngày duy>t
duy>t 1ng:
1ng 12/9/2016

146 N¤NG NGHIÖP Vµ PH¸T TRIÓN N¤NG TH¤N - Th¸ng 11/2016

KHKT Chăn nuôi Số 213 - tháng 11 năm 2016

Tổng biên tập: DI TRUYỀN - GIỐNG VẬT NUÔI

TS. Đoàn Xuân Trúc Đặng Hoàng Biên, Nguyễn Trọng Ngữ, Nguyễn Văn Trung, Phạm Công Thiếu và
Phạm Sỹ Tiệp. Ảnh hưởng của đa hình gen thụ thể prolactin đến sinh sản của một
Phó Tổng biên tập: số giống lợn bản địa Việt Nam 2
PGS.TS. ĐINH VĂN CẢI Nguyễn Hữu Tỉnh. Chỉ số chọn lọc của các tính trạng sản xuất ở lợn Yorkshire và
PGS.TS. NGUYỄN ĐĂNG VANG Landrace có nguồn gốc từ Đan Mạch 7
Trịnh Hồng Sơn. Năng suất sinh sản của hai dòng lợn ông bà VCN11 và VCN12 13
Thư ký tòa soạn: Lê Đình Phùng, Văn Ngọc Phong, Phùng Thăng Long, Lê Lan Phương, Hoàng
PGS.TS. NGUYỄN VĂN ĐỨC Ngọc Hảo, Ngô Mậu Dũng và Phạm Khánh Từ. Năng suất sinh sản của lợn nái
F1(LxY) được phối với Pic280 và Pic399 trong điều kiện chăn nuôi công nghiệp ở
Ủy viên Ban biên tập:
Quảng Bình 18
PGS.TS. NGUYỄN TẤN ANH Nguyễn Khánh Toán, Nguyễn Thị Liên, Nguyễn Hoàng Thịnh và Nguyễn Thị
Châu Giang. Đặc điểm ngoại hình và khả năng sinh sản của gà 6 ngón nuôi tại
PGS.TS. NGUYỄN XUÂN BẢ
Lạng Sơn 25
TS. NGUYỄN QUỐC ĐẠT
PGS.TS. NGUYỄN VĂN ĐỨC
PGS.TS. HOÀNG KIM GIAO DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
PGS.TS. NGUYỄN DUY HOAN Nguyễn Thị Kim Khang, Phạm Ngọc Du và Trần Hoàng Nhân. Ảnh hưởng của việc
bổ sung bột gừng lên năng suất và chất lượng trứng gà công nghiệp 31
PGS.TS. ĐỖ VÕ ANH KHOA
TS. ĐỖ ĐỨC LỰC Nguyễn Thị Kim Khang, Nguyễn Trọng Ngữ, Châu Thanh Vũ, Nguyễn Công Danh
và Nguyễn Ngọc Hân. Ảnh hưởng của việc bổ sung Yucca Schidigera lên năng suất
TS. NGUYỄN TẤT THẮNG
sinh sản của gà Nòi 36
Phạm Kim Đăng, Nguyễn Đình Trình, Nguyễn Hoàng Thịnh, Nguyễn Thị
Xuất bản và Phát hành:
Phương Giang và Nguyễn Bá Tiếp. Ảnh hưởng của Probiotic Bacillus dạng bào tử
TS. NGUYỄN TẤT THẮNG chịu nhiệt đến năng suất, vi khuẩn và hình thái vi thể biểu mô đường ruột gà thịt
lông màu 40
Lê Việt Phương. Sử dụng bột rong mơ (Sargassum spp.) trong thức ăn cho gà đẻ
trứng 47
Ngô Thị Thùy, Bùi Huy Doanh, Đặng Thái Hải, Nguyễn Thị Hoà Bình và Bùi Quang
Tuấn. Ảnh hưởng của tỷ lệ cỏ voi và cây lạc dại khô trong khẩu phần đến hiệu quả
Giấy phép: Bộ Thông tin và Truyền thông sử dụng thức ăn, chuyển hóa nitơ và dẫn xuất purine trong nước tiểu của dê 54
Số 257/GP- BTTTT ngày 20/05/2016
CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
ISSN 1859 - 476X
Phan Văn Sỹ, Lâm Bích Thảo, Phan Thị Tường Vi, Lê Quang Trí, Phạm Ngọc
Xuất bản: Hàng tháng Thảo và Đinh Thị Quỳnh Liên. Sử dụng chế phẩm Chùm Ngây trong khẩu phần thức
Toà soạn: ăn cho heo thịt 60
Địa chỉ: Tầng 8, Tòa nhà Sunrise Tower, Nguyễn Thanh Bình và Phí Thị Thu Hiền. Tác động của việc bổ sung chế phẩm
sinh học Vem - K vào thức ăn đến sinh trưởng và thành phần thân thịt của heo Rừng
số 187, Nguyễn Lương Bằng, nuôi nhốt tại Cẩm Mỹ, Đồng Nai 64
Phường Quang Trung,
Nguyễn Bá Trung. Sinh trưởng của bê lai giữa Red Angus và Red Brahman với bò
Quận Đống Đa, Hà Nội. Vàng nuôi trong nông hộ tỉnh An Giang và Đồng Tháp 70
Điện thoại: 04.36290621 Diệp Tấn Toàn và Nguyễn Văn Phát. Ketone huyết trên bò sữa và thử nghiệm phòng
Fax: 04.38691511 trị bằng Propylene glycol 75
E - mail: tapchichannuoi@hoichannuoi.vn Lê Thị Thanh. Phòng trừ bệnh thường gặp cho Ba ba trơn trong điều kiện nuôi ở đồng
bằng sông Cửu Long 82
Website: www.hoichannuoi.vn Lưu Hữu Mãnh, Trần Quang Thái, Nguyễn Nhựt Xuân Dung và Bùi Thị Lê
Tài khoản: Minh. Mức độ vấy nhiễm vi khuẩn trên thịt heo tại lò mổ và chợ bán lẻ thành phố
Tên tài khoản: Hội Chăn nuôi Việt Nam Bến Tre 88
Số tài khoản: 1300 311 0000 40, tại Ngân hàng
Nông nghiệp và Phát triển Nông thôn Chi nhánh THÔNG TIN KHOA HỌC CÔNG NGHỆ
Thăng Long - Số 4, Phạm Ngọc Thạch, Hà Nội. Lâm Thái Hùng. Hội thảo quốc tế Việt Nam - Hungary lần thứ 9 nghiên cứu về sự
phát triển nông nghiệp bền vững 94
In 1.000 bản, khổ 19x27 tại Công ty CP KH&CN
Nguyễn Tấn Anh. Tái sử dụng Cidr gây động dục bò 96
Hoàng Quốc Việt. In xong và nộp lưu chiểu:
Vũ Duy Giảng và Phạm Kim Đăng. Hiệu quả chăn nuôi và chất lượng của chế phẩm
tháng 11/2016. probiotic 98
 dinh dưỡng và thức ăn chăn nuôi

10. Onu P.N. (2010), Evaluation of two herbal spices as feed
additives for finisher broilers, Biotechnology in Animal
Husbandry, 26: 383-392.
11. Shukla Y. and Singh M. (2007), Cancer Preventive
Properties of Ginger: A Brief Review, Food Chem.
Toxicol., 45: 683–690.
12. Zhao X.Z.,Yang B., Yang W.R., Wang Y., Jiang S.Z.,
Zhang G.G. (2011), Effects of ginger root (Zingiber
officinale) on laying performance and antioxidant status
of laying hens and on dietary oxidation stability, J.
Poult. Sci., 90: 1720-1727.
13. Zomrawi W.B., Abdel-Atti K.A., Dousa B.M.,
Mohammed K.E., Mahala A.G. and Elamin K.M.
(2014), The effect of dietary ginger root powder (Zingiber
officinale) on yolk cholesterol and egg characteristic, Int.
J. Livestock Research, 4: 42-47.

ẢNH HƯỞNG CỦA VIỆC BỔ SUNG YUCCA SCHIDIGERA

LÊN NĂNG SUẤT SINH SẢN CỦA GÀ NÒI
Nguyễn Thị Kim Khang1*, Nguyễn Trọng Ngữ1, Châu Thanh Vũ1, Nguyễn Công Danh1 và
Nguyễn Ngọc Hân1
Ngày nhận bài báo: 10/07/2016 - Ngày nhận bài phản biện: 23/07/2016
Ngày bài báo được chấp nhận đăng: 25/07/2016
TÓM TẮT
Thí nghiệm nhằm khảo sát ảnh hưởng của việc bổ sung Yucca schidigera lên năng suất sinh sản của
gà Nòi giai đoạn 72-79 tuần tuổi. Tổng số 32 gà Nòi đẻ được bố trí hoàn toàn ngẫu nhiên với 4 nghiệm
thức (NT) tương ứng với 4 khẩu phần như sau: đối chứng (ĐC) chỉ gồm khẩu phần cơ sở (KPCS); 50YC
gồm KPCS và 50 mg Yucca/kg thức ăn (TA); 75YC gồm KPCS và 75 mg Yucca/kg TA và 100YC gồm
KPCS và 100 mg Yucca/kg TA, thí nghiệm được lặp lại 4 lần, mỗi lần lặp lại là 2 gà mái đẻ. Thí nghiệm
nuôi dưỡng được thực hiện tại ấp Thuận Tiến B, Thuận An, Bình Minh, Vĩnh Long, từ ngày 09/09/2014
đến ngày 04/11/2014. Kết quả phân tích cho thấy năng suất trứng và tỷ lệ đẻ của gà Nòi ở các NT có bổ
sung Yucca cao hơn có ý nghĩa thống kê so với ĐC (P<0,05). Tiêu tốn thức ăn (TTTA) của gà giữa các NT
khác biệt có ý nghĩa thống kê với TTTA cao nhất ở 50YC (93,19 g/mái/ngày) và thấp nhất là ĐC (80,03
g/mái/ngày) và 100YC (80,04 g/mái/ngày) (P<0,05). Bổ sung Yucca trong khẩu phần không ảnh hưởng
đến khối lượng (KL) cuối kì của gà Nòi và các chỉ tiêu về chất lượng trứng (P>0,05), ngoại trừ độ dày
vỏ trứng cao nhất ở 75YC (0,37 mm) và thấp nhất ở 100YC (0,32 mm) (P>0,05). Từ các kết quả trên cho
thấy bổ sung Yucca vào khẩu phần của gà Nòi giúp cải thiện năng suất trứng và tỷ lệ đẻ của gà Nòi.
Từ khóa: bột Yucca schidigera, tỷ lệ đẻ, gà Nòi
ABSTRACT
Effect of Yucca schidigera supplementation on reproduction performance of Noi laying hens
Nguyen Thi Kim Khang, Nguyen Trong Ngu, Chau Thanh Vu, Nguyen Cong Danh and
Nguyen Ngoc Han
This experiment was carried out to evaluate the effect of Yucca supplementation into dietary on
reproduction performance of Noi laying hens from 72 to 79 weeks of age. 32 Noi laying hens were
completely randomized design into 4 dietary treatments which consisted of a standard layer feed as a
control diet and the other three levels of Yucca supplemented at 50, 75 and 75 mg/kg feed. Each dietary
treatment was four replicates which two hens/cage. The experiment was done from September 9th to
November 4th, 2014 at Thuan Tien hamlet, Thuan An commune, Binh Minh town, Vinh Long province.
The results showed that egg performance and laying rate of Noi laying hens supplemented with Yucca
were significantly higher than control (P<0.05). There was different significance among treatments on
daily feed consumption which highest was 50YC (91.19 g/hen/day) and lowest was control (80.03 g/
hen/day) and 100YC (80.04 g/hen/day) (P<0.05). Yucca schidigera supplementation to hens’ dietary had
no effect on final body weight as well as egg quality parameters, except the shell thickness was highest
on 75YC (0,37 mm) and lowest on 100YC (0,32 mm) (P<0.05). The results from this study indicated
that Yucca schidigera supplementation to diet improved egg performance and laying rate of Noi hens.
Keywords: Yucca schidigera powder, laying rate, Noi hens
1
Trường Đại học Cần Thơ
*Tác giả để liên hệ: TS. Nguyễn Thị Kim Khang, Bộ môn Chăn nuôi, Khoa Nông nghiệp và Sinh học ứng dụng, Trường Đại
học Cần Thơ. TP Cần Thơ. Điện thoại: 0939.205.355. Email: ntkkhang@ctu.edu.vn

36 KHKT Chăn nuôi số 213 - tháng 11 năm 2016

dinh dưỡng và thức ăn chăn nuôi
1. ĐẶT VẤN ĐỀ
Cây Yucca có tên khoa học là Yucca
schidigera, thuộc họ Agavaceae thường mọc
nhiều ở sa mạc Mojave và Sonoran thuộc
vùng Đông Nam California. Hoạt chất chính
của loài cây này là saponin (steroid saponin,
triterpenoid saponin) có tác dụng hạn chế mùi
hôi và giảm nồng độ amoniac của chất thải
(Cheeke, 2001). Cây Yucca hiện được sử dụng
như thức ăn phụ gia cho gia súc và các vật
nuôi khác, giúp nâng cao khả năng tiêu hóa,
hấp thu thức ăn, nâng cao đáp ứng miễn dịch,
cải thiện năng suất sinh sản và tăng trưởng
tốt hơn (Hứa Thị Chúc và Trương Quốc Phú,
2014). Ayasan và ctv (2005) cho thấy bổ sung
cây Yucca trong thức ăn của gà có thể giúp
duy trì sự trao đổi chất, kiểm soát được môi
trường NH3 và cải thiện được khối lượng
trứng, hệ số chuyển hóa thức ăn và năng suất
của gà đẻ (Guclu, 2003; Ayasan và ctv, 2005).
Mặc khác, các hoạt chất của cây Yucca
còn ngăn ngừa một số bệnh nhiễm khuẩn của
heo, gà, tôm, cá giúp kích thích tăng trưởng
(10%), giảm 10-20% chi phí thức ăn (Vũ Duy
Giảng, 2010). Kết quả nghiên cứu gần đây cho
thấy việc bổ sung 50mg bột Yucca/kg thức ăn
giúp cải thiện năng suất sinh trưởng của gà
Cobb500 cũng như chất lượng thân thịt của
giống gà này (Nguyễn Thị Kim Khang, 2015).
Dựa vào những thực tiễn đó đề tài “Ảnh
hưởng của việc bổ sung Yucca schidigera lên khả
năng sản xuất của gà Nòi” được tiến hành để
đánh giá khả năng sinh sản và chất lượng trứng
gà Nòi.
2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU
2.1. Vật liệu thí nghiệm
Bột Yucca có màu trắng và mùi thơm,
được nhập khẩu bởi công ty TNHH Vương
Sơn (Phước Hiệp, Trường Thạnh, Quận 9, Tp
Hồ Chí Minh).
2.2. Đối tượng nghiên cứu
- Ba mươi hai gà Nòi mái được khảo sát
từ tuần tuổi 72 đến tuần 79 (khối lượng 1,96-
2,2 kg).
KHKT Chăn nuôi số 213 - tháng 11 năm 2016
- Gà được nuôi nhốt trên lồng có kích thước
là 40 x 53 x 40 cm, mỗi lồng chuồng chứa 2 gà
mái đẻ. Chuồng gà thí nghiệm được thiết kế
theo hệ thống chuồng hở, nền chuồng lót trấu
được trộn men vi sinh khử mùi dày 60 cm, xung
quanh được bao bọc bằng lưới B40 cao khoảng 2
m, kết hợp bạt cao su có thể kéo lên xuống để che
mưa gió. Dãy chuồng được thiết kế theo hướng
Đông Bắc – Tây Nam, mái chuồng lợp tole với
kích thước 30 x 6 m có lót một lớp mốp làm la
phông chống nóng. Gà được chăm sóc và nuôi
dưỡng trong cùng chế độ, được chủng ngừa các
loại vaccin như dịch tả, gumboro, đậu, cúm gia
cầm, và tẩy ký sinh trùng đầy đủ.
- Gà được ăn 2 lần/ngày (7 giờ sáng và 4
giờ chiều), được uống nước tự do.
2.3. Bố trí thí nghiệm
Ba mươi hai gà Nòi mái ở 72 tuần tuổi
được bố trí theo thể thức hoàn toàn ngẫu nhiên
với 4 nghiệm thức (NT) và 4 lần lặp lại, mỗi lần
lặp lại là 2 gà. Các NT lần lượt là: ĐC bao gồm
duy nhất khẩu phần cơ sở (KPCS), YC50 gồm
KPCS và 50 mg Yucca/kg thức ăn (TA), 75YC
gồm có KPCS và 75 mg Yucca/kg TA và 100YC
gồm KPCS và 100 mg Yucca/kg TA.
Thức ăn do công ty Cargill sản xuất dành
cho gà đẻ giai đoạn 25-68 tuần tuổi có năng
lượng trao đổi (NLTĐ) và protein thô (CP) lần
lượt là 2.850 kcal và 17% CP.
2.4. Ghi nhận số liệu và các chỉ tiêu theo dõi
Khối lượng gà được cân khi bắt đầu thí
nghiệm và khi kết thúc thí nghiệm.
TTTA, HSCH TA được ghi nhận hàng ngày
dựa trên lượng TA ăn vào và lượng TA thừa.
Trứng gà được thu gom và ghi nhận
hằng ngày vào lúc 17 giờ chiều để tính các chỉ
tiêu về tỷ lệ đẻ và năng suất trứng bình quân
(NSTBQ).
Mẫu trứng được lấy và đo các chỉ tiêu về
chất lượng trứng vào 3 thời điểm lúc 72, 75 và
79 tuần tuổi, mỗi NT chọn ra 5 quả cho mỗi
lần đo. Các chỉ tiêu về chất lượng trứng như
KL trứng, tỷ lệ các thành phần của quả trứng,
chỉ số hình dáng (CSHD), chỉ số lòng trắng
đặc và lòng đỏ, màu sắc lòng đỏ và độ dày vỏ.
37

2.5. Địa điểm và thời gian nghiên cứu
2.5.1. Địa điểm nghiên cứu
Thí nghiệm được tiến hành tại ấp Thuận
Tiến B, Thuận An, Bình Minh, Vĩnh Long.
2.5.2. Thời gian nghiên cứu
Thí nghiệm được thực hiện từ ngày
09/09/2014 đến ngày 04/11/2014.
2.6. Xử lý số liệu
Số liệu thu thập được xử lý sơ bộ bằng
chương trình Excel và mô hình One-way factor
Minitab 16. Sự sai khác giữa các NT được phân tốn thức ăn (TTTA) của gà cao hơn có ý nghĩa
tích bằng phép thử Tukey ở mức ý nghĩa 5%.
Bảng 1. Năng suất sinh sản của gà Nòi
Nghiệm Năng suất sinh sản của gà Nòi đẻ (M±SD)
thức KL đầu kì, g KL cuối kì, g Tổng NST, quả/mái
ĐC 1.958±290 1.820±272
50YC 1.973±363 1.990±541
75YC 2.208±417 2.030±320
100YC 2.183±446 2.035±420
Giá trị mang các chữ cái a, b trên cùng một cột thì khác biệt và có ý nghĩa thống kê ở mức P<0,05
Nhìn chung KL gà cuối kì (79 tuần tuổi)
ở các NT đều giảm so với KL đầu kì (72 tuần
tuổi), sự giảm này là do gà TN đang trong giai
đoạn thay lông. Vì vậy, mọi dưỡng chất cũng
như năng lượng gà hấp thu được trong giai
đoạn này phần lớn đều tập trung cho quá trình
thay lông. Điều này cũng có thể là nguyên nhân
ảnh hưởng đến năng suất trứng của gà Nòi
trong thời gian TN, tổng NST của gà Nòi trong
9 tuần đối với các NT có bổ sung Yucca là 21,5-
22 trứng/mái với TL đẻ TB là 38,39-39,29% cao
hơn so với ĐC (17 trứng/mái và 30,36%). Kết
quả này cho thấy các mức bổ sung Yucca trong
khẩu phần cải thiện được năng suất trứng của
gà Nòi. Nghiên cứu của Rowland và ctv (1976)
cho kết quả tương tự khi bổ sung Yucca 31 hoặc
155 mg/kg thức ăn cho gả đẻ đã cải thiện được
năng suất trứng và làm giảm mức NH3 trong
chuồng. Nghiên cứu của Kutlu và ctv (2000) về
bổ sung Yucca cho chim cút đã cải thiện được
tỷ lệ đẻ của cút. Tuy nhiên, kết quả của nghiên
cứu của Guclu (2003) và Kaya và ctv (2003)
cho rằng bổ sung Yucca không ảnh hưởng đến
năng suất trứng của cút.
Kết quả điều tra của Nguyễn Minh Dũng
38
dinh dưỡng và thức ăn chăn nuôi
3. KẾT QUẢ VÀ THẢO LUẬN
3.1. Ảnh hưởng của bột Yucca schidigera lên
khả năng sinh sản của gà Nòi
Kết quả ghi nhận về năng suất sinh sản
của gà Nòi (Bảng 1) cho thấy bổ sung Yucca
trong khẩu phần gà Nòi đẻ không ảnh hưởng
đến khối lượng (KL) gà đầu và cuối kì TN
(P>0,05). Tuy nhiên, các NT có bổ sung Yucca
có tổng năng suất trứng (NST), tỷ lệ đẻ và tiêu
thống kê so với ĐC (P<0,05).
TL đẻ TB, % TTTA, g/mái/ngày
17,0±1,63b 30,36±2,92b 80,03±4,66b
21,5±0,58a 38,39±3,05a 93,19±5,58a
21,8±1,71a 38,84±2,46a 90,67±6,46ab
22,0±0,82a 39,29±2,92a 80,04±5,18b
và Huỳnh Hồng Hải (2006) cho rằng năng
suất trứng của gà Nòi (48 trứng/mái/năm),
thấp hơn so với các giống gà khác. Năng suất
trứng của gà Nòi giai đoạn 28-47 tuần tuổi là
46 trứng/mái và tỷ lệ đẻ trung bình là 13,4%
(Nguyễn Văn Quyên và Võ Văn Sơn, 2008)
thấp hơn tỷ lệ đẻ của gà TN.
Ayasan và ctv (2005) cho rằng bổ sung
Yucca trên chim cút đẻ không ảnh hưởng đến
tiêu tốn thức ăn (g/mái/ngày) giữa các NT, kết
quả thí nghiệm cũng tương tự về TTTA của gà.
Nghiên cứu của Ayasan và Okan (2001) cho
thấy bổ sung 120mg Yucca vào khẩu phần của
cút đẻ cải thiện được HSCHTA nhưng không
ảnh hưởng đến lượng thức ăn tiêu tốn. Các
nghiên cứu khác của Kutlu và ctv (2001) và
Kaya và ctv (2003) kết luận rằng bổ sung 100 và
200mg Yucca/kg TA đều có năng suất trứng và
hiệu quả sử dụng thức ăn tương đương nhau.
3.2. Ảnh hưởng của bột Yucca schidigera lên
chất lượng trứng của gà Nòi
Bổ sung Yucca hoặc Yucca kết hợp với
probiotic không ảnh hưởng đến KL trứng, tỷ
lệ lòng trắng, tỷ lệ lòng đỏ, tỷ lệ vỏ và màu sắc
lòng đỏ (P>0,05).
KHKT Chăn nuôi số 213 - tháng 11 năm 2016
dinh dưỡng và thức ăn chăn nuôi
Bảng 2. Chất lượng trứng gà Nòi
Chỉ tiêu
ĐC
KL trứng, g 47,51±3,41
Tỷ lệ lòng trắng, % 51,81±3,01
Tỷ lệ lòng đỏ, % 36,50±2,38
Tỷ lệ vỏ, % 11,69±1,23
Màu lòng đỏ 7,78±1,20
CSHD 73,95±2,45
CSLTĐ 0,056±0,016
CSLĐ 0,437±0,042
Haugh 88,12±0,70
Độ dày vỏ, mm 0,36ab±0,029
Giá trị mang các chữ cái a, b trên cùng một cột thì khác biệt và có ý nghĩa thống kê ở mức P<0,05.
Các chỉ tiêu CSHD, CSLTĐ, CSLĐ và đơn
vị Haugh giữa các NT khác biệt không có ý
nghĩa thống kê (P>0,05). Duy nhất, sự sai khác
giữa các giá trị trung bình của các NT có ý
nghĩa thống kê về độ dày vỏ trứng, cao nhất
ở 75YC (0,37 mm) và thấp nhất ở 100YC (0,32
mm) (P<0,05).
Như vậy, việc bổ sung Yucca không ảnh
hưởng đến chất lượng trứng ở gà Nòi, ngoại trừ
độ dày vỏ của trứng. Kết quả nghiên cứu của
Gurbuz và ctv (2011) cũng có kết luận tương tự
khi bổ sung Yucca trong khẩu phần của gà Hy-
Line-V36 ở 48 tuần tuổi. Trong khi đó, Ayasan
và Okan (2001) cho rằng KL trứng được cải
thiện khi bổ sung 120 mg Yucca vào khẩu phần
của cút đẻ. Một số tác giả khác cũng cho rằng
khẩu phần có bổ sung Yucca ở gà đẻ cải thiện
được KL trứng (Ayasan và ctv, 2005; Wang và
Kim, 2011). Về độ dày vỏ trứng, Ayasan và ctv
(2005) cho rằng bổ sung Yucca để nuôi chim cút
làm giảm độ dày vỏ trứng.
4. KẾT LUẬN
Bổ sung bột Yucca trong khẩu phần giúp
cải thiện năng suất trứng và tỷ lệ đẻ của gà Nòi,
nhưng không ảnh hưởng đến chất lượng trứng.
TÀI LIỆU THAM KHẢO
1. Ayasan T. and Okan F. (2001), The Effect of A Diet with
Different Probiotic (Protexin) Levels on the Fattening
Performance and Carcass Characteristics of Japanese
Quails. Proceedings of XVth European Symposium on the
Quality of Poultry Meat, pp: 169-174, Kuþadasi, Turkey.
2. Ayasan T., Yurtseven S., Baylan M. and Canogullari
S. (2005), The Effects of Dietary Yucca Schidigera
KHKT Chăn nuôi số 213 - tháng 11 năm 2016
Nghiệm thức
50YC 75YC 100YC
46,05±4,51 44,91±4,30 49,56±6,93
51,42±3,49 50,91±5,72 52,94±5,27
37,46±3,15 37,02±4,83 37,17±4,16
11,11±1,13 12,07±1,83 9,88±1,42
7,86±2,19 7,25±1,36 8,0±0,71
73,17±4,58 74,01±4,12 70,28±1,61
0,071±0,029 0,061±0,012 0,075±0,015
0,439±0,079 0,413±0,069 0,449±0,049
88,74±1,23 88,38±0,50 88,83±0,90
0,34ab±0,029 0,37a±0,027 0,32b±0,034
on Egg Yield Parameters and Egg Shell Quality of
Laying Japanese Quails (Coturnix coturnix japonica),
International Journal of Poultry Science, 4: 159-162.
3. Cheeke P.R. (2001), Actual and potential applications
of Yucca schidigera and Quillaja saponaria saponins
in human and animal nutrition, Recent Advances in
Animal Nutrition in Australia, 13: 115-126.
4. Hứa Thị Chúc và Trương Quốc Phú (2014), Khả năng hấp
thụ TAN (total ammonia nitrogen) của yucca trong môi
trường nước ngọt, Tạp chí Khoa học ĐHCT, 2: 248-255.
5. Nguyễn Minh Dũng và Huỳnh Hồng Hải (2006), Điều
tra tình hình chăn nuôi giống gà nòi thả vườn ở ĐBSCL,
Luận án tốt nghiệp ĐH Cần Thơ, Trang: 15- 17.
6. Vũ Duy Giảng (2010), Saponin và chất chống oxy hóa
trong phụ gia thức ăn chăn nuôi nguồn thảo dược, Tạp
chí Thức ăn chăn nuôi, 4: 11.
7. Guclu B. (2003), Bildircin Rasyonlarina Katilan
Yuccaschidigera Ekstraktinin Yumurta Verimi ve
Yumurta Kalitesi ile Bazi Kan Parametrelerine Etkisi,
Turk Veterinerlik ve Hayvancilik Dergisi, 27: 567-574.
8. Gurbuz E., Balevi T., Kurtoglu V. and Oznurlu Y. (2011),
Use of yeast cell walls and Yucca schidigera extract in layer
hens’ diets, Italian J. Anim. Sci., 10 (e26): 134-138.
9. Kaya S., Erdogan Z. and Erdogan S. (2003), Effect
of Different Levels of Yucca schidigera Powder on
the performance, Blood Parameters and Egg Yolk
Cholesterol of Laying Hens, J. Vet. Med. A. Physiol.
Pathol. Clin. Med., 50: 14-17.
10. Nguyễn Thị Kim Khang (2015), Ảnh hưởng của các
mức bổ sung bột Yucca schidigera lên khả năng tăng
trưởng và thân thịt của gà Cobb500, Tạp chí KHKT
Chăn nuôi, 6: 67-74.
11. Kutlu H.R., Gorgulu M. and Unsal I. (2001), Effects
of dietary Yucca schidigera powder on performance
and egg cholesterol content of laying hens, Journal of
Applied Animal Research, 20: 49–56.
12. Kutlu HR., Unsal I., Gorgulu M. and Yurtseven S.
(2000), Yumurta Tavuklarinda Verim ve Yumurta
Kolesterol Düzeyi Üzerine Rasyona Katilan Yucca
schidigera Tozunun Etkisi. International Animal
Nutrition Congress. Sayfa: 95-102.
13. Nguyễn Văn Quyên và Võ Văn Sơn (2008), Kết quả
39
KHKT Chăn nuôi Số 213 - tháng 11 năm 2016

Tổng biên tập: DI TRUYỀN - GIỐNG VẬT NUÔI

TS. Đoàn Xuân Trúc Đặng Hoàng Biên, Nguyễn Trọng Ngữ, Nguyễn Văn Trung, Phạm Công Thiếu và
Phạm Sỹ Tiệp. Ảnh hưởng của đa hình gen thụ thể prolactin đến sinh sản của một
Phó Tổng biên tập: số giống lợn bản địa Việt Nam 2
PGS.TS. ĐINH VĂN CẢI Nguyễn Hữu Tỉnh. Chỉ số chọn lọc của các tính trạng sản xuất ở lợn Yorkshire và
PGS.TS. NGUYỄN ĐĂNG VANG Landrace có nguồn gốc từ Đan Mạch 7
Trịnh Hồng Sơn. Năng suất sinh sản của hai dòng lợn ông bà VCN11 và VCN12 13
Thư ký tòa soạn: Lê Đình Phùng, Văn Ngọc Phong, Phùng Thăng Long, Lê Lan Phương, Hoàng
PGS.TS. NGUYỄN VĂN ĐỨC Ngọc Hảo, Ngô Mậu Dũng và Phạm Khánh Từ. Năng suất sinh sản của lợn nái
F1(LxY) được phối với Pic280 và Pic399 trong điều kiện chăn nuôi công nghiệp ở
Ủy viên Ban biên tập:
Quảng Bình 18
PGS.TS. NGUYỄN TẤN ANH Nguyễn Khánh Toán, Nguyễn Thị Liên, Nguyễn Hoàng Thịnh và Nguyễn Thị
Châu Giang. Đặc điểm ngoại hình và khả năng sinh sản của gà 6 ngón nuôi tại
PGS.TS. NGUYỄN XUÂN BẢ
Lạng Sơn 25
TS. NGUYỄN QUỐC ĐẠT
PGS.TS. NGUYỄN VĂN ĐỨC
PGS.TS. HOÀNG KIM GIAO DINH DƯỠNG VÀ THỨC ĂN CHĂN NUÔI
PGS.TS. NGUYỄN DUY HOAN Nguyễn Thị Kim Khang, Phạm Ngọc Du và Trần Hoàng Nhân. Ảnh hưởng của việc
bổ sung bột gừng lên năng suất và chất lượng trứng gà công nghiệp 31
PGS.TS. ĐỖ VÕ ANH KHOA
TS. ĐỖ ĐỨC LỰC Nguyễn Thị Kim Khang, Nguyễn Trọng Ngữ, Châu Thanh Vũ, Nguyễn Công Danh
và Nguyễn Ngọc Hân. Ảnh hưởng của việc bổ sung Yucca Schidigera lên năng suất
TS. NGUYỄN TẤT THẮNG
sinh sản của gà Nòi 36
Phạm Kim Đăng, Nguyễn Đình Trình, Nguyễn Hoàng Thịnh, Nguyễn Thị
Xuất bản và Phát hành:
Phương Giang và Nguyễn Bá Tiếp. Ảnh hưởng của Probiotic Bacillus dạng bào tử
TS. NGUYỄN TẤT THẮNG chịu nhiệt đến năng suất, vi khuẩn và hình thái vi thể biểu mô đường ruột gà thịt
lông màu 40
Lê Việt Phương. Sử dụng bột rong mơ (Sargassum spp.) trong thức ăn cho gà đẻ
trứng 47
Ngô Thị Thùy, Bùi Huy Doanh, Đặng Thái Hải, Nguyễn Thị Hoà Bình và Bùi Quang
Tuấn. Ảnh hưởng của tỷ lệ cỏ voi và cây lạc dại khô trong khẩu phần đến hiệu quả
Giấy phép: Bộ Thông tin và Truyền thông sử dụng thức ăn, chuyển hóa nitơ và dẫn xuất purine trong nước tiểu của dê 54
Số 257/GP- BTTTT ngày 20/05/2016
CHĂN NUÔI ĐỘNG VẬT VÀ CÁC VẤN ĐỀ KHÁC
ISSN 1859 - 476X
Phan Văn Sỹ, Lâm Bích Thảo, Phan Thị Tường Vi, Lê Quang Trí, Phạm Ngọc
Xuất bản: Hàng tháng Thảo và Đinh Thị Quỳnh Liên. Sử dụng chế phẩm Chùm Ngây trong khẩu phần thức
Toà soạn: ăn cho heo thịt 60
Địa chỉ: Tầng 8, Tòa nhà Sunrise Tower, Nguyễn Thanh Bình và Phí Thị Thu Hiền. Tác động của việc bổ sung chế phẩm
sinh học Vem - K vào thức ăn đến sinh trưởng và thành phần thân thịt của heo Rừng
số 187, Nguyễn Lương Bằng, nuôi nhốt tại Cẩm Mỹ, Đồng Nai 64
Phường Quang Trung,
Nguyễn Bá Trung. Sinh trưởng của bê lai giữa Red Angus và Red Brahman với bò
Quận Đống Đa, Hà Nội. Vàng nuôi trong nông hộ tỉnh An Giang và Đồng Tháp 70
Điện thoại: 04.36290621 Diệp Tấn Toàn và Nguyễn Văn Phát. Ketone huyết trên bò sữa và thử nghiệm phòng
Fax: 04.38691511 trị bằng Propylene glycol 75
E - mail: tapchichannuoi@hoichannuoi.vn Lê Thị Thanh. Phòng trừ bệnh thường gặp cho Ba ba trơn trong điều kiện nuôi ở đồng
bằng sông Cửu Long 82
Website: www.hoichannuoi.vn Lưu Hữu Mãnh, Trần Quang Thái, Nguyễn Nhựt Xuân Dung và Bùi Thị Lê
Tài khoản: Minh. Mức độ vấy nhiễm vi khuẩn trên thịt heo tại lò mổ và chợ bán lẻ thành phố
Tên tài khoản: Hội Chăn nuôi Việt Nam Bến Tre 88
Số tài khoản: 1300 311 0000 40, tại Ngân hàng
Nông nghiệp và Phát triển Nông thôn Chi nhánh THÔNG TIN KHOA HỌC CÔNG NGHỆ
Thăng Long - Số 4, Phạm Ngọc Thạch, Hà Nội. Lâm Thái Hùng. Hội thảo quốc tế Việt Nam - Hungary lần thứ 9 nghiên cứu về sự
phát triển nông nghiệp bền vững 94
In 1.000 bản, khổ 19x27 tại Công ty CP KH&CN
Nguyễn Tấn Anh. Tái sử dụng Cidr gây động dục bò 96
Hoàng Quốc Việt. In xong và nộp lưu chiểu:
Vũ Duy Giảng và Phạm Kim Đăng. Hiệu quả chăn nuôi và chất lượng của chế phẩm
tháng 11/2016. probiotic 98
 DI TRUYỀN
DI TRUYỀN - GIỐNG VẬT NUÔI - GIỐNG VẬT NUÔI

ẢNH HƯỞNG CỦA ĐA HÌNH GEN THỤ THỂ PROLACTIN ĐẾN

SINH SẢN CỦA MỘT SỐ GIỐNG LỢN BẢN ĐỊA VIỆT NAM
Đặng Hoàng Biên1*, Nguyễn Trọng Ngữ,2 Nguyễn Văn Trung1,
Phạm Công Thiếu1 và Phạm Sỹ Tiệp1
Ngày nhận bài báo: 29/08/2016 - Ngày nhận bài phản biện: 11/09/2016
Ngày bài báo được chấp nhận đăng: 25/09/2016
TÓM TẮT
Nghiên cứu này nhằm đánh giá ảnh hưởng của các đa hình trên gen Prolactin Receptor (PRLR)
đến năng suất sinh sản ở 6 giống lợn địa phương: Bản, Hung, Lửng, Lũng Pù, Mẹo và Ô Lâm (40
cá thể/giống qua 7 lứa đẻ). Phương pháp PCR-RFLP được sử dụng để xác định kiểu gen tại đa hình
PRLR-AluI và PRLR-HpaII. Kết quả, đa hình PRLR-AluI có tần số alen A dao động 32,5-55,0% và
alen B chiếm tỷ lệ 45,0-67,5% trong quần thể. Bên cạnh đó, đa hình PRLR-HpaII tồn tại 3 kiểu gen
AA, AB và BB với tần số xuất hiện của alen A (58,8-76,3%) cao hơn alen B (28,8-41,3%) trên tất cả
các giống. Về ảnh hưởng gen đến các tính trạng sinh sản, kết quả cho thấy có sự liên kết (P<0,05)
giữa đa hình PRLR-HpaII với số con sơ sinh, số con sơ sinh sống và số con cai sữa qua 7 lứa đẻ
giống lợn Hung, Lửng và Mẹo, trong đó lợn mang alen A có năng suất cao hơn lợn alen B. Đối với
đa hình PRLR-AluI, không tìm thấy mối liên kết với các chỉ tiêu về năng suất sinh sản ở cả 6 giống
lợn thí nghiệm.
Từ khóa: Gen Prolactin receptor, đa hình gen, sinh sản, lợn bản địa

ABSTRACT
Effects of Prolactin Receptor gene polymorphisms on reproductive traits of Vietnamese
native pig breeds
Dang Hoang Bien, Nguyen Trong Ngu, Nguyen Van Trung,
Pham Cong Thieu and Pham Sy Tiep
The present study was conducted to evaluate the effects of PRLR-AluI and PRLR-HpaII genetic
polymorphisms on reproductive performance of 6 native pig breeds Ban, Hung, Lung, Lung
Pu, Meo and O Lam (40 sows/breed, over 7 parities). PCR-RFLP method was used to determine
the genotype of PRLR mutations using AluI and HpaII restriction enzymes. In all populations
studied, allele frequencies of the PRLR-AluI polymorphism ranged from 32.5-55.0% (allele A) and
45.0-67.5% (allele B) and there were three genotypes available at PRLR-HpaII locus with higher
frequencies of allele A (58.8-76.3%) than allele B (28,8-41,3%). In addition, the association analysis
showed significant linkage (P<0.05) between the PRLR-HpaII mutation with number of offspring,
born alive and weaned piglets over 7 parities in Hung, Lung and Meo pig breeds, of which sows
carrying A allele were more productive than those with B allele. For the other polymorphic site, the
effects of genotypes on reproductive traits were not found.
Keywords: Prolactive receptor, genetic polymorphism, reproductive traits, native pigs, PCR-RFLP

1. ĐẶT VẤN ĐỀ1
Trong chăn nuôi lợn, vấn đề quan trọng là
lợn phải mắn đẻ, sai con, tốc độ tăng trưởng
1 Viện Chăn nuôi
2
Trường Đại học Cần Thơ
*Tác giả để liên hệ: TS. Đặng Hoàng Biên, Phó trưởng Phòng
Khoa học, Viện Chăn nuôi, Thuỵ Phương, Bắc Từ Liêm, Hà
Nội, Điện thoại: 098.266.4900. Email: biendang79@gmail.com
nhanh, ít tiêu tốn thức ăn và phẩm chất thịt
tốt. Vì vậy, các nhà chọn giống đã không
ngừng nghiên cứu, chọn lọc và cải tạo giống
nhằm đem lại năng suất và hiệu quả cao nhất.
Các tính trạng sinh sản luôn được chú ý trong
chăn nuôi, bởi chúng đóng vai trò chính trong
nâng cao hiệu quả chăn nuôi. Để cải thiện
năng suất sinh sản trên lợn nái, đặc biệt là

2 KHKT Chăn nuôi số 213 - tháng 11 năm 2016

DI TRUYỀN - GIỐNG VẬT NUÔI
số con trên ổ, tỉ lệ sống sót của lợn con sau
khi sinh các nhà chọn giống ở các nước đã áp
dụng nhiều chương trình chọn giống mới kết
hợp với phương pháp chọn lọc truyền thống.
Giải pháp chọn lọc dựa vào tính đa hình trên
những gen ứng cử tạo ra sự sai khác kiểu hình
về sinh lý-sinh hóa có thể thúc đẩy nhanh khả
năng nâng cao các tính trạng sinh sản của lợn.
Một trong số các gen được đề cập đến nhiều
trong thời gian qua là gen thụ thể Prolactin
(Prolactin Receptor-PRLR). Gen PRLR định vị
trên nhiễm sắc thể số 16 và có vai trò trong
việc chuẩn bị và duy trì môi trường thích hợp
cho quá trình mang thai của lợn. Các kết quả
nghiên cứu cho thấy, gen PRLR liên quan mật
thiết đến số lượng lợn con sinh ra còn sống
(Rothschild và Bidanel, 1998). Theo các nghiên
cứu của Drogemuller và ctv (2001) nếu trên
các cá thể lợn có sự xuất hiện của gen thụ thể
prolactin thì số con trên ổ đẻ nhiều, tỷ lệ sống
sót của lợn con cao. Đặc biệt, khối lượng lợn
con sinh ra vẫn duy trì ở mức bình thường
không có chênh lệch đáng kể so với các ổ đẻ
có số con ít. Chính vì những lý do trên việc
nghiên cứu đa hình gen PRLR được thực hiện
nhằm hiểu rõ hơn về sự ảnh hưởng của gen
này đến khả năng sinh sản ở một số giống lợn
bản địa Việt Nam.
2. VẬT LIỆU VÀ PHƯƠNG PHÁP
2.1. Vật liệu và thời gian nghiên cứu
Nghiên cứu được thực hiện trên 6 giống
lợn Bản, Hung, Lửng, Lũng Pù, Mẹo và lợn Ô
Lâm dựa vào đặc điểm ngoại hình đặc trưng
của giống, chọn 40 lợn cái và 4 lợn đực hậu bị/
giống. Mỗi giống được bố trí 10 hộ nông dân
(4 con/hộ) với điều kiện chăn nuôi tương đồng
nhau. Theo dõi khả năng sinh sản từ lứa 1 đến
lứa 7, từ tháng 10/2011 đến tháng 05/2015.
2.2. Phương pháp xác định kiểu gen
Mẫu DNA được ly trích từ mô tai theo
quy trình phenol/chloroform (Wickramarante
và ctv, 2010). Trình tự primers PRLR-AluI
(forward: 5’ CGT GGC TCC GTT TGA AGA
ACC 3’, reverse: 5’ CTG AAA GGA GTG
CAT AAA GCC 3’: Tm = 55) và PRLR-HpaII
KHKT Chăn nuôi số 213 - tháng 11 năm 2016
(forward: 5’ GTC TGG GCA GTG GCT TTG
3’, reverse : 5’ TAA AGC CTG CGG GAT CGA
GGT 3’: Tm =68) được sử dụng để khuếch
đại các đoạn gen có kích thước tương ứng là
163 bp (Drogemuller và ctv, 2001) và 3,9 kb
(Putnova và ctv, 2002).
Thành phần hóa chất cho 1 phản ứng
PCR bao gồm 25 ng DNA, 0,25 M mỗi mồi,
0,25 M của mỗi dNTP, 1 × đệm PCR, và 1U
của Taq DNA polymerase (Fementas, Toronto,
Canada). Các phản ứng PCR được thực hiện
trên máy PCR (Veriti, Singabore 299025752)
với chu trình nhiệt như sau: biến tính trong
4 phút ở 94°C, tiếp theo với 35 chu kỳ (94°C
trong 30s, 55°C trong 60s và 72°C trong 30s).
Việc kéo dài cuối cùng được thực hiện tại 72°C
trong 5 phút đối với đa hình PRLR-AluI và
biến tính trong 2 phút ở 95°C, tiếp theo với 35
chu kỳ (95°C trong 30s, 68°C trong 30s và 72°C
trong 120s), kéo dài cuối cùng ở 72°C trong 7
phút đối với đa hình PRLR-HpaII. Tiếp theo,
15 uL sản phẩm PCR được cắt với 10 U AluI và
HpaII (Fementas), sản phẩm cuối cùng được
kiểm tra trên gel agarose trong 1 × TAE buffer,
kết quả được đọc thông qua ánh sáng UV của
máy chụp hình Gel Logic 212.
2.3. Phân tích thống kê
Các số liệu được xử lý sơ bộ bằng phần
mềm Microsoft Excel 2010 và tiếp theo được
phân tích phương sai theo mô hình General
Linear Model của phần mềm Minitab version
16.0.
3. KẾT QUẢ VÀ THẢO LUẬN
3.1. Xác định kiểu gen của 2 đa hình
Bằng phương pháp PCR sử dụng các cặp
mồi đặc hiệu cho từng đoạn gen riêng biệt đã
nhân thành công các đoạn gen nghiên cứu
(PRLR-AluI và PRLR-HpaII) với các kích thước
lần lượt là 163 bp và 3,9 kb. Về kiểu gen tại
mỗi vị trí đột biến, đa hình PRLR-AluI có hai
alen A và B tương ứng với 3 kiểu gen AA (85
bp, 59 bp và 19 bp); AB (104 bp; 85 bp; 59 bp;
19 bp); BB (104 bp; 59 bp) và đa hình PRLR-
HpaII cũng tồn tại hai alen A (2,4 kb) và B (2 kb
và 0,4 kb) (Hình 1).
3
 DI TRUYỀN - GIỐNG VẬT NUÔI

Kết quả nghiên cứu hiện tại phù hợp đại được các đoạn gen với kích thước tương tự
với các nghiên cứu của Drogemuller và ctv là 163 bp và 3,9 kb. Bên cạnh đó, các alen được
(2001) và Putnova và ctv (2002) trên các giống xác định trong nghiên cứu hiện tại cũng phù
Landrace, Duroc và Large White, đã khuếch hợp với nghiên cứu của các tác giả trên.

(a) (b)

Hình 1. Sản phẩm PCR-RFLP quan sát trên gel 4%, (a) PRLR-AluI và (b) PRLR-HpaII

3.2. Tần số kiểu gen và tần số alen của các đa lợn Duroc tác giả tìm thấy tỷ lệ xuất hiện cao
hình gen PRLR của alen A (82,0%). Kết quả nghiên cứu của Đỗ
Đối với đa hình PRLR-AluI tần số alen Minh Trí (2006) trên Duroc cũng tìm thấy alen
A và B xuất hiện tương đối đồng đều ở các A xuất hiện với tỉ lệ 100% trong quần thể, ngược
quần thể lợn nghiên cứu. Ở quần thể lợn Bản lại ở hai giống lợn Landrace và Yorkshire thì
hai alen này chiếm tỷ lệ ngang nhau trong alen B xuất hiện cao hơn alen A.
quần thể (50%). Ở quần thể lợn Mẹo thì alen Bảng 1. Tần số kiểu gen và alen ở đa hình
A xuất hiện cao hơn alen B 10%. Ở các quần PRLR-AluI trên 6 giống lợn nội
thể lợn còn lại cho thấy alen B xuất hiện cao
Tần số alen
hơn alen A, trong đó quần thể lợn Lũng Pù Giống
Tần số kiểu gen (%) (%)
thể hiện rõ nhất với alen B chiếm 67,5% và AA AB BB A B
alen A chỉ chiếm 32,5%. Xét về tần số kiểu
Bản 32,5 35,0 32,5 50,0 50,0
gen ở các quần thể lợn nghiên cứu, kết quả ở
Hung 25,0 40,0 35,0 45,0 55,0
Bảng 1 cho thấy ở hầu hết các nhóm lợn kiểu
gen AB luôn chiếm tỷ lệ xuất hiện cao hơn hai Lửng 25,0 45,0 30,0 47,5 52,5
kiểu gen còn lại, tiếp theo là kiểu gen BB và Lũng Pù 7,5 50,0 42,5 32,5 67,5
thấp nhất là kiểu gen AA. Ngoại trừ ở nhóm Mẹo 40,0 30,0 30,0 55,0 45,0
lợn Mẹo, kiểu gen AA chiếm tỷ lệ cao hơn hai Ô Lâm 25,0 40,0 35,0 45,0 55,0
kiểu gen còn lại. Đối với đa hình PRLR-HpaII, kết quả thể
Omelka và ctv (2008) nghiên cứu trên hiện ở Bảng 2 cho thấy tần số alen A (dao
3 giống lợn Large White, White Meaty và động 58,7-76,3%) xuất hiện cao hơn alen B
Landrace cho biết hai alen A và B xuất hiện (dao động 23,7-41,3%). Tương ứng kiểu gen
với tỷ lệ chênh lệnh nhau không nhiều trong AA luôn xuất hiện cao ở các nhóm lợn nghiên
quần thể: alen A dao động 45,7-49,2% và alen B cứu ngoại trừ nhóm lợn Ô Lâm thì kiểu gen
là 50,8% đến 54,3%. Kết quả này tương tự với AB (47,5%) trội hơn kiểu gen AA (35,0%). Kết
kết quả nghiên cứu hiện tại trên các giống lợn quả này cũng tương tự với nghiên cứu của
bản địa Hung, Lửng và Ô Lâm. Nghiên cứu Putnova và ctv (2002), nhóm tác giả này khi
của Drogemuller và ctv (2001) trên giống lợn nghiên cứu trên các giống lợn ngoại Landrace
Landrace cũng tìm thấy alen A (40%) xuất hiện và Large White cũng tìm thấy alen A (59-80%)
thấp hơn alen B (60%), ngược lại trên giống xuất hiện với tần số cao hơn alen B (20-41%).

4 KHKT Chăn nuôi số 213 - tháng 11 năm 2016

DI TRUYỀN - GIỐNG VẬT NUÔI

Bảng 2. Tần số kiểu gen và alen ở đa hình (6,94 con và 6,66 con) và khác biệt có ý nghĩa
PRLR-HpaII trên 6 giống lợn nội với kiểu gen BB (6,53 con và 6,31 con).
Tần số kiều gen(%) Tần số len(%)
Putnova và ctv (2002) nghiên cứu trên
Giống giống lợn Landrace và Large White, đa hình
AA AB BB A B
Bản 50,0 42,5 7,5 71,3 28,7 PRLR-HpaII có ảnh hưởng đến số con sơ sinh,
Hung 57,5 37,5 5,0 76,3 23,7 số con sơ sinh sống cũng như số con cai sữa
Lửng 42,5 40,0 17,5 62,5 37,5 trên hai giống lợn này. Cụ thể nhóm tác giả đã
Lũng Pù 42,5 42,5 15,0 63,7 36,3 tìm thấy alen A là alen ảnh hưởng đáng kể đến
Mẹo 47,5 42,5 10,0 68,7 31,3 số con sơ sinh còn sống và số con cai sữa ở lợn
Ô Lâm 35,0 47,5 17,5 58,7 41,3 Landrace và số con sơ sinh ở giống lợn Large
3.3. Ảnh hưởng của các đa hình đến năng White. Từ kết quả nghiên cứu của Putnova và
suất sinh sản của 6 giống lợn nội ctv (2002) cũng như kết quả nghiên cứu hiện
tại cho thấy alen A là alen tiềm năng cho công
Prolactin là một hormone peptide tuyến
tác chọn giống lợn với mục đích nâng cao
yên trước tham gia vào nhiều hoạt động nội
năng suất sinh sản.
tiết khác nhau và rất cần thiết cho khả năng
sinh sản. Các thụ thể prolactin đã được phát Bảng 3. Ảnh hưởng đa hình PRLR-HpaII đến
hiện trong các mô khác nhau bao gồm cả não, năng suất sinh sản của 6 giống lợn
buồng trứng, nhau thai và tử cung ở một số
Tính trạng
loài động vật có vú. Những đặc điểm này làm Giống Kiểu gen
SCSS-L1-7 SCSSS-L1-7 SCCS-L1-7
cho gen PRLR trở thành ứng cử viên cho tính
AA (n=137) 7,32±0,12 7,00±0,11 6,63±0,10
trạng sinh sản (Vincent và ctv, 1997). Kết quả AB (n=104) 7,37±0,14 7,16±0,13 6,76±0,19
phân tích ảnh hưởng của đa hình PRLR-HpaII Bản
BB (n=21) 7,52±0,31 7,14±0,29 6,71±0,26
đến tính trạng sinh sản của các giống lợn bản P 0,83 0,66 0,70
địa trong nghiên cứu được trình bày ở Bảng 3. AA (n=104) 7,24a±0,12 7,01a±0,12 6,58a± 0,12
3.3.1. Đa hình PRLR-HpaII AB (n=149) 6,91ab±0,10 6,76ab±0,10 6,39a±0,09
Hung
Kết quả nghiên cứu cho thấy, lợn Ô Lâm BB (n=9) 6,00b±0,42 5,89b±0,42 5,33b±0,39
và Lũng Pù là hai giống lợn có số con sơ sinh, P 0,01 0,02 0,01
số con sơ sinh sống cũng như số con cai sữa AA (n=105) 7,01a±0,09 6,74a±0,09 6,28±0,09
AB (n=108) 6,94a±0,09 6,66ab±0,09 6,31±0,09
cao hơn các giống lợn còn lại, tuy nhiên đa Lửng
BB (n=49) 6,53b±0,14 6,31b±0,14 5,96±0,14
hình PRLR-HpaII không tác động đến hai
P 0,02 0,03 0,11
giống lợn này. Ở lợn Hung, những cá thể
AA (n=110) 7,54±0,12 7,36±0,12 6,96±0,11
mang kiểu gen AA có số con cai sữa cao nhất
Lũng AB (n=108) 7,48±0,13 7,29±0,12 6,93±0,11
(6,58 con), tiếp theo là kiểu gen AB (6,39 con) Pù BB (n=41) 7,76±0,20 7,49±0,19 7,19±0,18
và thấp nhất là kiểu gen BB (5,33 con) và sự P 0,51 0,70 0,41
khác biệt này là có ý nghĩa thống kê (P<0,05). AA (n=127) 7,41a±0,09 7,05±0,08 6,67a±0,07
Ở giống lợn Mẹo những cá thể mang kiểu gen AB (n=102) 7,08b±0,09 6,94±0,09 6,62a±0,08
AA (6,67 con) lại cho số con cai sữa cao nhất Mẹo
BB (n=28) 7,14ab±0,19 6,68±0,17 6,14b±0,15
và khác biệt có ý nghĩa (P<0,01) với kiểu gen P 0,04 0,16 0,01
BB (6,14 con). Cũng ở giống lợn này, ở chỉ tiêu AA (n=94) 9,89 ± 0,15 9,21±0,14 8,43±0,13
số con sơ sinh từ lứa 1 đến lứa 7 những cá thể Ô AB (n=127) 9,73 ± 0,13 9,00±0,12 8,28±0,11
mang kiểu gen AA (7,41 con) cũng chiếm ưu Lâm BB (n=49) 9,96 ± 0,21 9,41 ± 0,19 8,51±0,18
thế hơn và khác biệt có ý nghĩa so với kiểu P 0,58 0,19 0,49
gen AB (7,08 con). Tương tự ở giống lợn Lửng, Ghi chú: SCSS-L1-7: Số con sơ sinh/ổ lứa 1-7; SCSSS: Số
những cá thể mang kiểu gen AA cũng có số con sơ sinh sống/ổ ; SCCS: Số con cai sữa/ổ. Các giá trị
con sơ sinh và số con sơ sinh sống cao nhất lần trung bình trong cùng cột mang chữ cái khác nhau thì sự
lượt là 7,01 và 6,74 con, kế đến là kiểu gen AB sai khác có ý nghĩa thống kê (P<0,05).

KHKT Chăn nuôi số 213 - tháng 11 năm 2016 5

 DI TRUYỀN - GIỐNG VẬT NUÔI

3.3.2. Đa hình PRLR-AluI này không ảnh hưởng đến các tính trạnh sinh
Bảng 4. Ảnh hưởng của đa hình PRLR-AluI sản của hai giống lợn trên. Tương tự nghiên
đến năng suất sinh sản của 6 giống lợn nội cứu của Đỗ Minh Trí (2006) trên hai giống lợn
Landrace và Yorkshire cũng không tìm thấy
Tính trạng ảnh hưởng của đa hình này đến số con sinh ra
Giống Kiểu gen
SCSS-L1-7 SCSSS-L1-7 SCCS-L1-7 và số con sinh ra còn sống.
AA (n=84) 7,23±0,16 6,99±0,15 6,61±0,13
4. KẾT LUẬN
AB (n=94) 7,36±0,15 7,09±0,14 6,71±0,13
Bản
BB (n=84) 7,48±0,16 7,16±0,15 6,74±0,13 Tại mỗi vị trí đa hình đều tồn tại 2 alen với
P 0,53 0,73 0,76 3 kiểu gen khác nhau, trong đó đa hình PRLR-
AA (n=63) 7,11±0,16 6,91±0,16 6,46±0,15 AluI không ảnh hưởng đến khả năng sinh sản
AB (n=105) 7,11±0,13 6,85±0,13 6,46±0,12 của 6 giống lợn nội này. Riêng đa hình PRLR-
Hung HpaII, có mối liên kết giữa các kiểu gen với các
BB (n=94) 6,92±0,13 6,79±0,13 6,42±0,13
P 0,51 0,88 0,96 tính trạng sinh sản (số con sơ sinh, số con sơ sinh
AA (n=57) 6,83±0,13 6,58±0,13 6,25±0,13 sống, số con cai sữa) của lợn Hung, Lửng và
AB (n=121) 7,01±0,09 6,76±0,09 6,27±0,09
Mẹo với alen A là một alen tiềm năng trong công
Lửng
BB (n=84) 6,76±0,11 6,46±0,10 6,16±0,11
tác chọn giống lợn có năng suất sinh sản cao.
P 0,18 0,09 0,70 TÀI LIỆU THAM KHẢO
AA (n=21) 7,43±0,28 7,29±0,27 7,05±0,25 1. Drogemuller C., H. Hamann and O. Distl (2001),
Candidate gene markers for litter size in different
Lũng AB (n=131) 7,43±0,28 7,33±0,11 6,91±0,09
German pigs line, J. Anim. Sci., 79: 2565-70.
Pù BB (n=107) 7,58±0,13 7,40±0,12 7,06±0,11
2. Isler B.J., K.M. Irvin, M.F. Rothschild and G.J. Evans
P 0,89 0,87 0,58 (2000), Association between the prolactin receptor gene
AA and reproductive components in swine. In: Proc. 27th Int.
7,27±0,09 6,96±0,09 6,69±0,08 Conf. Anim. Genet., Minneapolis, MN p 67.
(n=104)
3. Omelka R., M. Martiniaková, D. Peškovičová and
Mẹo AB (n=76) 7,37±0,11 7,00±0,11 6,54±0,09
M. Bauerová (2008), Associations between Alu I
BB (n=77) 7,10±0,11 6,94±0,11 6,55±0,09 Polymorphism in the Prolactin Receptor Gene and
P 0,25 0,91 0,36 Reproductive Traits of Slovak Large White, White Meaty
and Landrace Pigs. Asian-Aust. J. Anim. Sci., 21(4): 484-488
AA (n=66) 9,79±0,18 9,06±0,17 8,39±0,15
4. Putnova L., A. Knoll, J. Dvorak and S. Cepica (2002),
Ô AB (n=108) 9,79±0,14 9,12±0,13 8,41±0,12 A new HpaII PCR-RFLP within the porcine prolactin
Lâm BB (n=96) 9,91±0,15 9,24±0,14 8,32±0,13 receptor (PRLR) gene and study of its effect on litter size
and number of teats. J. Anim. Breed. Genet., 119: 57-63.
P 0,82 0,70 0,88
5. Rothschild M.F. and J.P. Bidanel (1998), Biology
Theo nghiên cứu của Drogemuller và ctv and Genetics of reproduction. The genetics of the
(2001) gen prolactin là một gen tiềm năng ảnh pig, Rothschild, M.F. and Ruvinsky, A. (eds), CAB
international, 313-345.
hưởng đến số con sinh ra còn sống, ở điểm 6. Đỗ Minh Trí (2006), Xác định các kiểu gen thụ thể prolactin
đa hình PRLR-AluI nhóm tác giả tìm thấy trên một số giống heo công nghiệp bằng kỹ thuật PCR –
alen B có ảnh hưởng mạnh đến số con sinh RFLP. Luận văn kỹ sư, chuyên ngành: công nghệ sinh học.
Trường Đại Học Nông Lâm TP. Hồ Chí Minh.
ra còn sống ở nhóm lợn Duroc. Kết quả này
7. Vincent A.L., L. Wang, C.K. Tuggle, A. Robic and M.F.
cũng được chứng minh trong nghiên cứu của Rothschild (1997), Prolactin Receptor maps to pig
nhóm tác giả Isler và ctv (2000) trên nhóm chromosome 16. Mamm. Genome, 8: 793-794.
lợn lai Yorshire x Large White. Tuy nhiên, 8. Vickramarante S.H.G, Vlmek B.R., Dixit S.P., Kumar
S. and Vyas M.K. (2010), Use of growth hormone gene
trong nghiên cứu hiện tại không tìm thấy ảnh Polymorphism in selecting Osmanabadi and Sangamneri
hưởng của đa hình này đến cả ba tính trạng Goats. Trop. Agr. Res., 24: 398-411.
khảo sát ở tất cả các nhóm lợn nghiên cứu 9. Ziółkowska A., M. Bogdzińska and J. Biegniewski
(Bảng 4). Trong nghiên cứu của Ziółkowska (2010), Polymorphism of prolactin receptor gene (PRLR)
in the Polish Landrace and Polish Large White swine
và ctv (2010) trên giống lợn Polish Landrace population and reproductive traits. J. Cent. Eur. Agr.,
và Polish Large White cũng cho thấy đa hình 11(4): 443-448.

6 KHKT Chăn nuôi số 213 - tháng 11 năm 2016