Bai Bao KH 2001-2011 (01-20)

Catalog
001-2001-Anh.pdf ······································································································································· 1
002-2003-Anh.pdf ······································································································································· 9
003-2005-Anh.pdf ····································································································································· 19
004-2006-Anh.pdf ····································································································································· 27
005-2007-Anh.pdf ····································································································································· 39
006-2007-Anh.pdf ····································································································································· 49
007-2007-Anh.pdf ····································································································································· 73
008-2007-Anh.pdf ····································································································································· 81
009-2007-Anh.pdf ····································································································································· 93
010-2007-Anh.pdf ··································································································································· 107
011-2008-Anh.pdf ··································································································································· 117
012-2008-Anh.pdf ··································································································································· 129
013-2009-Viet.pdf ··································································································································· 137
014-2010-Anh.pdf ··································································································································· 149
015-2010-Viet.pdf ··································································································································· 157
016-2010-Viet..pdf ·································································································································· 165
017-2011-Viet..pdf ·································································································································· 173
018-2011-Viet..pdf ·································································································································· 183
019-2011-Viet..pdf ·································································································································· 191
020-2011-Viet..pdf ·································································································································· 201
Welcome to AJAS
Not logged in.
Home About AJAS Registration Subscription E-Submission Article Search
Print ISSN : 1011-2367

AJAS 2012 Best Reviewer Award [2013.01.04] Online ISSN 1976-5517
Publication Schedule of AJAS (... [2012.12.05] Current Issue

June.2013 Vol. 26 (No.6)
Joint ISNH - ISRP [2012.12.04]
ERRATUM (AJAS 22(1):107-112) [2009.09.30]
Retraction of a Published Pape... [2009.09.30]
Deletion of a published paper [2008.05.09]
Investments on Pro-poor Development Enhancing Mulberry Leaf Meal with Urea by Pell...
Animal Welfare in Different Human Cultures, Molecular Characterization and Expression Patt...
Vitamin C Nutrition in Cattle Molecular Cloning, Characterization, and Expre...
PUBLICATION OFFICE Asian-Australasian Association of Animal Societies

Room 708 Sammo Sporex, 1638-32 Seowon-dong, Gwanak-gu, Seoul 151-730, Korea
A registration number : 124-82-06422 / Administrator : Jong Kyu, Ha
Tel : +82 -2 - 888 -6558 / Fax : +82-2-888-6559 / E-mail : jongkha@hotmail.com
Copyright (c) 2013 by Asian-Australasian Journal of Animal Sciences
1 of 1
Welcome to AJAS
Not logged in. Contact | Links
Home About AJAS Registration Subscription E-Submission Article Search FAQ Q&A AAAP Home
Archive
2010 2011 2012 2013
2000 2001 2002 2003 2004 2005 2006 2007 2008 2009
1990 1991 1992 1993 1994 1995 1996 1997 1998 1999
1988 1989
2001(Vol.14)
No.1 No.2 No.3 No.4 No.5 No.6 No.7 No.8 No.9 No.10 No.11 No.12
N. T. Yen, C. Tai, Y. S. Cheng, M. C. Huang

Relative Genetic Effects of Duroc and Taoyuan Breeds on the Economic Traits of Their Hybrids
Asian-Aust. J. Anim. Sci. Vol. 14 No. 4 : 447 ROC(TAIWAN)
April 2001. [Abstract] Counter : 1 [PDF] PdfDown : 21
J. C. Ju, Y. C. Chang, W. T. Huang, P. C. Tang, S. P. Cheng

Superovulation and Transplantation of Demi- and Aggregated Embryos in Rabbits
Asian-Aust. J. Anim. Sci. Vol. 14 No. 4 : 455 ROC(TAIWAN)
M. J. Lee, O. Han, K. Back, Y. J. Choi, M. G. Baik

Induction of Lysozyme Gene Expression During Involution of Mouse Mammary Gland
Asian-Aust. J. Anim. Sci. Vol. 14 No. 4 : 462 KOREA, REPUBLIC OF
Katsunori Sunagawa, Richard S. Weisinger, Michael J. McKinley, Brett S. Purcell, Craig Thomson, Peta L. Burns
The Effects of Water Deprivation on Cerebrospinal Fluid Constituents During Feeding in Sheep
Asian-Aust. J. Anim. Sci. Vol. 14 No. 4 : 467 JAPAN
V. K. Vidyarthi, C. K. Kurar
Influence of Dietary Butyrate on Growth Rate, Efficiency of Nutrient Utilization and Cost of Unit Gain in Murrah Buffalo (Bubalus bubalis) Male
Calves
Asian-Aust. J. Anim. Sci. Vol. 14 No. 4 : 474 INDIA
A. K. Misra, S. S. Thakur
Effect of Dietary Supplementation of Sodium Salt of Isobutyric Acid on Ruminal Fermentation and Nutrient Utilization in a Wheat Straw Based
Low Protein Diet Fed to Crossbred Cattle
Nguyen Thi Hong Nhan, Nguyen Van Hon, Nguyen Trong Ngu, Nguyen Tien Von, T. R. Preston, R. A. Leng
Practical Application of Defaunation of Cattle on Farms in Vietnam: Response of Young Cattle Fed Rice Straw and Grass to a Single Drench of
Groundnut Oil
Asian-Aust. J. Anim. Sci. Vol. 14 No. 4 : 485 VIET NAM
E. N. Njoka-Njiru, A. Y. Guliye
Grazing Behaviour of Jersey and Guernsey Heifers in Sub-Humid Tropical Conditions of Kenya
Asian-Aust. J. Anim. Sci. Vol. 14 No. 4 : 491 KENYA
M. S. Yahaya, A. Kibon, E. M. Aregheore, S. A. Abdulrazak, J. Takahashi, S. Matsuoka

The Evaluation of Nutritive Value of Three Tropical Browse Species for Sheep Using in Vitro and in Vivo Digestibility
Asian-Aust. J. Anim. Sci. Vol. 14 No. 4 : 496 JAPAN
M. S. Yahaya, A. Kibon, E. M. Aregheore, S. A. Abdulrazak, J. Takahashi, S. Matsuoka

The Evaluation of Nutritive Value of Three Tropical Browse Species for Sheep Using in Vitro and in Vivo Digestibility
Damry, J. V. Nolan, R. E. Bell, E. S. Thomson

Duckweed as a Protein Source for Fine-Wool Merino Sheep: Its Edibility and Effects on Wool Yield and Characteristics
Asian-Aust. J. Anim. Sci. Vol. 14 No. 4 : 507 AUSTRALIA
1 of 2
Livestock Research for Rural Developement Volume 15
Livestock Research for Rural

Development
The international journal for research into

sustainable developing world agriculture
Published by Fundación CIPAV, Cali, Colombia
Volume 15, On-line Edition
Issue 1 (January)
Issue 2 (February)
Issue 3 (March)
Issue 4 (April)
Issue 5 (May)
Issue 6 (June)
Issue 7 (July)
Issue 8 (August)
Issue 9 (September)
Issue 10 (October)
Issue 11 (November)
Issue 12 (December)
ISSN 0121-3784
1 of 1
Livestock Research for Rural Development, Volume 15, Number 7, July 2003
Back to LRRD Home page
Livestock Research for Rural Development, Volume 15, Number 7, July 2003 ISSN 0121-3784
Contents
Papers:
Some chemical and biological measurements of two contrasting cultivars of Gliricidia sepium
(Jacq) Kunth ex Walp; R Alonso, R M Pedraza, S O Apori and E R Ørskov
Effect of drenching with cooking oil on performance of local “Yellow” cattle fed rice straw and
cassava foliage; Nguyen Thi Hong Nhan, Nguyen Van Hon, Nguyen Trong Ngu, Nguyen Thi
Thu Hong, T R Preston and R A Leng
Studies on utilization of trees and shrubs as the sole feedstuff by growing goats; foliage
preferences and nutrient utilization; Theng Kouch, T R Preston and J Ly
Effects of supplementation of wet brewers’ grains and sugarcane molasses to rice straw on
rumen degradation efficiency; Nguyen Xuan Trach
Pastoralists’ perception of livestock production systems and opportunities for improvement in

Southwestern Marsabit, Kenya; J C Njanja, J M Gathuma, G K Gitau, F M Njeruh and R N
Kinuthia
Effect of retention time on gas production and fertilizer value of biodigester effluent; San Thy, T
R Preston and J Ly
The use of ensiled cassava leaves in diets for growing pigs. 1. The effect of graded levels of
palm oil on N digestibility and N balance; Chhay Ty, T R Preston and J Ly
Short communications
Preliminary research results on application of a local medicinal herb (Achyranthes aspera) as
dietary supplement to sows to prevent diarrhea in piglets; Pham Hong Son, Pham Quang Trung,
Tran Quang Vui and Dinh Thi Bich Lan
Administrative
LRRD News
1 of 2
Effect of drenching with cooking oil on performance of local “Yellow” cattle fed rice straw and cassava foliage
Livestock Research for Rural Development 15 (7) 2003 Citation of this paper
Effect of drenching with cooking oil on performance of

local “Yellow” cattle fed rice straw and cassava foliage
Nguyen Thi Hong Nhan, Nguyen Van Hon, Nguyen Trong Ngu, Nguyen
Thi Thu Hong*, T R Preston** and R A Leng***
Cantho University, Cantho, Vietnam
nthnhan@ctu.edu.vn
*An Giang University, An Giang
** regpreston@utafoundation.org
*** rleng@ozemail.com.au
Abstract
The experiment was carried out at a cooperative farm with 20 female cattle of the local “Yellow” breed, divided
into 10 groups (pens) with 2 animals in each (5 replicates per treatment). The treatments were administration of
an oil drench (groundnut oil) or no oil drench. The basal diet was: Urea-sprayed rice straw (2% urea) offered ad
libitum + fresh cassava leaves (3 kg/day). The experiment lasted 90 days. The groundnut oil drench (5 ml / 1 kg
live weight) was given once at the beginning of the trial. The cattle were weighed (average of two daily
consecutive weighings) at the beginning, and after 45 and 90 days. Samples of rumen fluid were taken by
stomach tube before eating in the morning, on the day before oil treatment, and after 45 and 90 days, for
counting of protozoa and determination of rumen ammonia and pH.
Growth rates were 28% higher (234 g/day) for cattle given the oil drench compared with the control (183
g/day). After 45 days the rumen protozoa numbers and rumen ammonia concentrations were depressed in cattle
given the oil drench compared with the control animals (0.272*105/ml vs 0.40*105/ml) and (116 vs 133
mg/litre), respectively.
Key words: Cassava leaves, cattle, drench, growth, oil, rice straw, urea
Introduction
Eliminating the protozoa from the rumen of cattle and sheep has been shown to improve
growth rates, as the bacterial population increases and the microbial protein flow from the
rumen is increased when the protozoa are absent (Leng 1989). The early procedures for
eliminating the protozoa required dosing the animals with a chemical surfactant, and was a
difficult procedure which often resulted in the death of the animals, thus there was little
impact of the technology at farmer level. Recently, it was observed by scientists in Central
Vietnam, that oral administration of a single dose of groundnut oil was regularly used by
farmers in the area as their experience was that this resulted in better performance of their
animals. These observations were followed up by Nguyen Thi Hong Nhan and co-workers
(2001) who showed that the effect of the oil drench was to kill the rumen protozoa and that
the treated animals subsequently grew faster with better feed conversion. These findings
were confirmed by Seng Mom et al (2001) in a trial in Cambodia in which local cattle fed
rice straw, a rumen supplement (urea and minerals) and fresh cassava foliage, grew faster
after being dosed with standard cooking oil purchased in the local market. These
researchers also showed that the effect of the oil was mainly against the large protozoa
1 of 7 http://www.lrrd.org/lrrd15/7/nhan157.htm
(Holotrich and Dasytrich spp), and because these organisms have a half life of over 120
days (Leng 1989), there was a considerable delay before they were re-established in the
rumen. By contrast, the smaller protozoa (mainly Entodinia spp) were quickly
re-established (half-life of less than 20 days; Leng 1989), and returned to normal levels
within about one month of the oil treatment. It was hypothesised that, as the small
protozoa occupied less space in the rumen than the large protozoa, the beneficial effects of
higher bacterial population would be maintained (Seng Mom et al 2001).
The research to be reported in this paper aimed to demonstrate at farmer level the
advantages of the oil treatment in local cattle fed on rice straw as the basal diet.
Materials and methods
Experimental design
The experiment was carried out at a cooperative farm in An Giang province. Twenty
female cattle of the local ("Yellow") breed (average initial weight 82 kg) were selected and
allocated at random into 10 pens (Photo 1) each with 2 animals, to give 5 replications of
the two treatments which were:
C: Urea-sprayed rice straw (2% urea) offered ad libitum + fresh cassava leaves (3
kg/day)
GO: The same as "C" but the animals were dosed with groundnut oil (5ml/kg live
weight) at the beginning of the trial.
The experiment lasted 90 days.
Photo 1. Local "Yellow" cattle consuming fresh cassava

leaves
Feeding system
Urea was sprayed on the rice straw (2 kg urea dissolved in 50 litres water and sprayed onto
100 kg rice straw) using a watering can immediately before it was offered to the animals.
The sprayed straw was supplied at approximately 50% more than the recorded intakes.
Cassava leaves (including petioles) were harvested from the lower parts of cassava plants
on nearby farms, that had been planted for root production (the farmers considered that this
procedure did not affect the subsequent root yield). The leaves were fed fresh immediately
after they were harvested at a fixed level of 3 kg/animal/day. The groundnut oil was
purchased in the local market. I t was administered to the animals after an over-night fast,
using a bamboo tube as a "dosing" bottle (Photo 2 ).
Photo 3: Taking the rumen samples with a stomach

Photo 2: Administering the groundnut oil
tube and vacuum pump
Measurements
Intakes were recorded separately of the straw and the cassava leaves. The cattle were
weighed on two consecutive days at the beginning, after 45 days and after 90 days.
Samples (about 100 ml) of rumen fluid was taken with a stomach tube using a vacuum
pump) in the morning before eating (Photo 3), on the day before oil treatment, and after 45
and 90 days, for counting of protozoa and determination of rumen ammonia and pH. pH
was determined immediately with a portable digital meter. Samples of the rumen fluid
were put into an ice-box to transport them to the College of Agriculture in Cantho
University. Part of the sample was distilled directly for determination of ammonia.
Another portion of the sample was treated with methylene blue to stain the protozoa which
were counted in a Malasser cell (0.2mm chamber), under a microscope at 10X
magnification. DM and N in feed samples and ammonia in rumen fluid were determined
according to AOAC (1990) procedures.
Results and discussion
Intake of rice straw and cassava leaves was depressed during the first 45 days following
drenching with groundnut oil (Table 1). From 46 to 90 days, intakes of rice straw were the
same on both treatments, but continued to be lower for the cassava leaves in the cattle
dosed with the oil. Overall from 0 to 90 days, intakes of rice straw tended to be lower
(P=0.12) for cattle dosed with oil and were significantly lower for the cassava leaves. The
reduced intake of straw and cassava leaves in the 45 days immediately following oil
administration is presumed to be due to the disturbance of the rumen ecosystem caused by
the high dose of oil. A similar depression of feed intake following oil treatment was also
noted by Nguyen Thi Hong Nhan et al (2001). There were no apparent toxic effects from
feeding fresh leaves of cassava which agrees with the experiences of Seng Mom et al
(2001) with cattle, and Seng Sokerya and Rodríguez (2001) and Theng Kouch et al 2003)
with goats.
Growth rates did not differ during the first 45 days after oil treatment but were higher in
the 46 to 90 day period and in the overall 90 days of the trial, for the cattle dosed with oil
(Figure 1). These findings are similar to those reported by Nguyen Thi Hong Nhan et al
(2001) and Seng Mom et al (2001).
Figure 1: Effect of a drench of groundnut oil on the growth rates of local "Yellow" cattle
fed rice straw and cassava leaves
Oil treatment had no effect on rumen pH, but depressed ammonia levels and the protozoal
population after 45 days with tendencies for values to remain lower at 90 days (Table 2;
Figures 2 and 3). These findings are similar to those reported by Nguyen Thi Hong Nhan
et al (2000) and Seng Mom et al (2001), using diets based on untreated rice straw and a
similar drench with vegetable oil.
Figure 2. Effect of a drench of groundnut oil on the rumen ammonia concentrations in local "Yellow" cattle
Figure 3. Effect of a drench of groundnut oil on the protozoal populations in the rumen of local "Yellow" cattle
Conclusions
A single dose of groundnut oil (5 ml/kg live weight) to local "Yellow" cattle fed
urea-sprayed rice straw and fresh cassava leaves increased the growth rate by 28%.
Rumen protozoal populations and rumen ammonia levels were depressed after oil
treatment.
Acknowledgements
This research was supported by a grant from the MEKARN Regional Project, financed by
SidaSAREC of Sweden. The authors are grateful to the farmers cooperative in An Giang
province who provided the facilities and assisted in the conduct of the trial.
References
AOAC 1990 Official Methods of Analysis 13th Edition. Association of Official Analytical Chemists,
Washington DC
Leng R A 1989 Dynamics of protozoa in the rumen. In J V Nolan, R A Leng and D I Demeyer (eds ).
The roles of protozoa and fungi in ruminant digestion. Proceeding of an international seminar held at the
University of New England, Armidale, Australia. pp 51-57
Nguyen Thi Hong Nhan, Nguyen Van Hon, Ngu N T, Von N T, Preston T R and Leng R A
2001 Practical Application of Defaunation of Cattle on Farms in Vietnam: Response of Young Cattle Fed
Rice Straw and Grass to a Single Drench of Groundnut oil. Asian-Aust. Journal Animal Science Vol. 14,
No.4: 485-490.
Seng Mom, Preston T R and Leng R A 2001 Response of young cattle fed rice straw to supplementation with
cassava foliage and a single drench of cooking oil. Livestock Research for Rural Development (13) 4:
http://www.cipav.org.co/lrrd/lrrd13/4/seng134.htm
Received 28 March; accepted 30 July 2003
Go to top
Welcome to AJAS
Not logged in.
Home About AJAS Registration Subscription E-Submission Article Search
Print ISSN : 1011-2367

AJAS 2012 Best Reviewer Award [2013.01.04] Online ISSN 1976-5517
Publication Schedule of AJAS (... [2012.12.05] Current Issue

June.2013 Vol. 26 (No.6)
Joint ISNH - ISRP [2012.12.04]
ERRATUM (AJAS 22(1):107-112) [2009.09.30]
Retraction of a Published Pape... [2009.09.30]
Deletion of a published paper [2008.05.09]
Investments on Pro-poor Development Enhancing Mulberry Leaf Meal with Urea by Pell...
Animal Welfare in Different Human Cultures, Molecular Characterization and Expression Patt...
Vitamin C Nutrition in Cattle Molecular Cloning, Characterization, and Expre...
PUBLICATION OFFICE Asian-Australasian Association of Animal Societies

Room 708 Sammo Sporex, 1638-32 Seowon-dong, Gwanak-gu, Seoul 151-730, Korea
A registration number : 124-82-06422 / Administrator : Jong Kyu, Ha
Tel : +82 -2 - 888 -6558 / Fax : +82-2-888-6559 / E-mail : jongkha@hotmail.com
Copyright (c) 2013 by Asian-Australasian Journal of Animal Sciences
1 of 1
Welcome to AJAS
Not logged in. Contact | Links
Home About AJAS Registration Subscription E-Submission Article Search FAQ Q&A AAAP Home
Archive
2010 2011 2012 2013
2000 2001 2002 2003 2004 2005 2006 2007 2008 2009
1990 1991 1992 1993 1994 1995 1996 1997 1998 1999
1988 1989
2005(Vol.18)
No.1 No.2 No.3 No.4 No.5 No.6 No.7 No.8 No.9 No.10 No.11 No.12
N. Assan, S. M. Makuza
The Effect of Non-genetic Factors on Birth Weight and Weaning Weight in Three Sheep Breeds of Zimbabwe
Asian-Aust. J. Anim. Sci. Vol. 18 No. 2 : 151 ZIMBABWE
January 2005. [Abstract] Counter : 1 [PDF] PdfDown : 10
Chaeyoung Lee, Haifeng Yan, Bingnan Xiao, Pavel Trefil, Shixun Liu, Younyoung Kim, Xiaolin Wu
Production of Transgenic Chimeric Chickens Using Blastodermal Cells
Asian-Aust. J. Anim. Sci. Vol. 18 No. 2 : 158 P. R. CHINA
K. J. Lee, G. W. Jang, K. H. Cho, T. H. Kim, S. J. Oh, I. C. Cheong

Association of Candidate Genes with Production Traits in Korean Dairy Proven and Young Bulls
Honglin Liu, Zengxiang Pan, Jie Chen, Dan Xu, Zhihua Jiang, Zhuang Xie
In silico Discovery of Genes Expressed in Liver, Kidney, Spleen and Small Intestine of Pigs
Asian-Aust. J. Anim. Sci. Vol. 18 No. 2 : 170 P. R. CHINA
P. K. Singh, Dhirendra Kumar, S. K. Varma

Genetic Studies and Development of Prediction Equations in Jersey횞 횞 Sahiwal and Holstein-Friesian횞
횞 Sahiwal Half Breds
P. K. Naik, Usha R. Mehra, Kalicharan , V. P. Varshney, R. S. Dass

Effect of Feeding Ammoniated Wheat Straw Treated with Hydrochloric Acid on Blood Biochemical Profile in Growing Male Buffalo (Bubalus
bubalis) Calves
C. S. Ahuja, Neeraj Sharma, S. P. S. Singha

Changes in Serum Protein Profile, Cholesterol and Blood Glucose during Endotoxic Shock in Buffalo Calves Supplemented with Vitamin E and
Selenium
Inger Ledin, Nguyen Trong Ngu

Effects of Feeding Wastes from Brassica Species on Growth of Goats and Pesticide/Insecticide Residues in Goat Meat
Asian-Aust. J. Anim. Sci. Vol. 18 No. 2 : 197 VIET NAM
Adem Kamalak, Onder Canbolat, Yavuz Gurbuz, Osman Ozay, Emin Ozkose
Chemical Composition and Its Relationship to In vitro Gas Production of Several Tannin Containing Trees and Shrub Leaves
Asian-Aust. J. Anim. Sci. Vol. 18 No. 2 : 203 TURKEY
B. H. Paek, S. W. Kang, Y. M. Cho, W. M. Cho, C. J. Yang, S. G. Yun

Effects of Substituting Concentrates with Dried Leftover Food on Growth and Carcass Characteristics of Hanwoo Steers
M. M. W. Abu-Zanat
Voluntary Intake and Digestibility of Saltbush by Sheep
Asian-Aust. J. Anim. Sci. Vol. 18 No. 2 : 214 JORDAN
1 of 2 http://www.ajas.info/archives.asp?reqYear=2005&reqMon=2
197
Effects of Feeding Wastes from Brassica Species on Growth of Goats and

Pesticide/Insecticide Residues in Goat Meat
Nguyen Trong Ngu and Inger Ledin*

Department of Animal Husbandry, College of Agriculture, Cantho University, Cantho City, Vietnam
ABSTRACT : The effects of feeding Brassica vegetable market wastes on intake, body weight changes and pesticide/insecticide
residues in products of goats were evaluated in two experiments. In the first experiment (Exp. 1) 16 goats (Bach Thao, 9 to 10 kg, 3
months old, 9 males and 7 females) were fed four diets with leaves either from cabbage (Brassica oleracea var. capitata), cauliflower
(Brassica oleracea var. botrytis) or Chinese cabbage (Brassica campestris subsp. pekinensis) with 30% of Para grass. The control group
was fed 100% Para grass. All diets contained soybean waste as a supplement and the experiment lasted for 136 days. In the second
experiment (Exp. 2) 24 goats (Bach Thao, 12 to 14 kg, all males) were assigned to three treatments in a completely randomised block
design based on initial body weight. The goats were fed cabbage waste supplemented with 200 g or 100 g DM (dry matter) of
concentrate. Para grass with 100 g DM concentrate supplementation was used as a control group. The experiment lasted for 90 days and
at the end of the study, 12 goats were slaughtered for pesticide/insecticide analysis. Due to low DM content (5.3 and 3.7%, respectively)
feed intakes of cabbage and Chinese cabbage groups were lower than those of other groups in the experiment. The highest feed intake
and body weight gain was obtained when the goats were fed cauliflower (529 g DM/day and 87.5 g/day, respectively). In Exp. 2 total
intake of cabbage and concentrate was similar (484 g and 453 g DM/day) whether the goats were fed 100 or 200 g concentrate/day but
lower than that of Para grass and concentrate probably due to the low DM content of the cabbage (5.9%). Crude protein intake (79 g to
86 g/day) and body weight gain (70 g to 88 g/day) was not significantly different between treatments. Adding concentrate consequently
resulted in higher DM intake than in Exp. 1 but did not result in any higher growth rate. Three of the pesticide/insecticide residues tested
were found in cabbage, Alpha-Cypermethrin, Bassa-Fenobucarb and Dimethoate with levels of 0.175, 0.074 and 0.028 mg/kg fresh
cabbage respectively. Weight of livers from goats fed cabbage was about 90 g higher than from goats fed Para grass but no
pesticide/herbicide residues were found in meat or liver. (Asian-Aust. J. Anim. Sci. 2005. Vol 18, No. 2 : 197-202)
Key Words : Goat, Cabbage, Cauliflower, Chinese Cabbage, Growth, Intake, Pesticide/Insecticide Residues
INTRODUCTION survey by Ngu et al. (2001), the waste of leaves from

cabbage species can reach 30% to 50% of total production.
Animal production in Vietnam is based mainly on Especially cabbage waste is available in large quantities
smallholder farms. Use of local resources and crop by- during the whole year. Leaves from Brassica species have
products as livestock feeds is a necessary precondition for been used for livestock feeding to a limited degree (Gustine
profitable production. Several by-products have potential and Jung, 1985) but utilisation of market wastes is neither
value, especially for ruminants, due to their ability to digest efficient nor structured.
fibre (Boucqué and Fiems, 1988). Utilisation of by-products The nutritive value of Brassica species is influenced by
is, however, limited due to the poor understanding of their the high water content (i.e., 8.6% dry matter (DM) in
nutritional and economic value as well as their proper use in cabbage and 10.1% DM in cauliflower (Gupta et al., 1993)),
ruminant rations (Schroeder, 1999). Among the less used which negatively affects intake. The DM, however, is rich
by-products are the fruit and vegetable market wastes. in protein. For example cauliflower contains 20.8% crude
The cultivated area for vegetables in Vietnam is about protein (CP) (Gupta et al., 1993).
400,000 hectares, from which five million tonnes of gross Other factors that affect the nutritive value of waste
output can be expected (General Statistical Office, 1999). from Brassica species are anti-nutritional substances and
Vegetables are normally not consumed completely but will secondary metabolites such as S-methyl-L-cysteine or
partly be left in the field or destroyed during transport. glucosinolates (Duncan and Milne, 1993). Barry et al.
Outer leaves (in the following referred to as waste) are often (1981) demonstrated that the major factor limiting the
trimmed at the market. Discarded products are dumped, feeding value of kale (Brassica oleracea) was the high
burnt or thrown into rivers as waste contributing to the content of these substances, which caused depressed
problem of environmental pollution. According to a market voluntary intake. In addition, the wastes may contain
* Corresponding Author: Inger Ledin. Department of Animal pesticide or herbicide residues, which may have negative
Nutrition and Management, Swedish University of Agricultural effects on rumen microorganisms. According to Duncan and
Sciences, Box 7024, 750 07, Uppsala, Sweden. Fax: +46- Milne (1993) ruminants may be efficient in the
18672995, E-mail: Inger.Ledin@huv.slu.se detoxification of both anti-nutritional compounds and
Received October 20, 2003; Accepted May 21, 2004 herbicides and pesticides, either by hepatic pathways or
198 NGU AND LEDIN
more probably as a result of rumen activity itself. Yousef et before commencement of the experiments.
al. (1999) reported significantly increased weights of liver The goats were housed in individual pens on slatted
and spleen when sheep were orally fed test doses of floors and had access to clean water ad libitum. They were
Dimethoate 1.6 and 3.2 mg/kg BW (body weight) or fed four times per day, at 07:00 h, 10:00 h, 13:00 h and
Cypermethrin 6 to 12 mg/BW and day. Casteel et al. (1993) 16:00 h. The feeds, Brassica species, Para grass and
reported neurological dysfunction and sudden deaths of soybean waste or concentrate, were fed in separate
feedlot calves when the complete feed given contained 528 containers.
ug of Aldrin/g feed. The goats were randomly assigned to four dietary
Forage Brassica species are widely exploited as treatments based on BW and sex. The goats were adapted
ruminant feeds in temperate agricultural systems. However, during one month by gradually exchanging Para grass for
few attempts have been made to exploit Brassica species in Brassica species. The treatments were 1) Chinese cabbage+
the form of vegetable waste as livestock feeds (Gupta et al., Para grass+soybean waste (ChC+PG+SB), 2) Cabbage+
1993). Para grass+soybean waste (C+PG+SB), 3) Cauliflower+
The objective of the present experiments was to Para grass+soybean waste (CF+PG+SB), 4) Para grass+
investigate the potential of using market wastes from soybean waste (PG+SB).
Brassica species as feeds for goats especially in relation to Before the experiment started, the three cabbage species
feed intake, growth and eventual pesticide/insecticide were analysed for DM and fed ad libitum to estimate the
residues in the goat meat. voluntary feed intake. The DM consumed from the cabbage
species did not meet the nutritional requirements of the
MATERIAL AND METODS goats i.e. 36 g digestible CP and 5.52 MJ/kg ME for a 20 kg
goat gaining 50 g/day (NRC, 1981) with an estimated DM
Location and climate intake of 3% of LW (Hai, 1994). Para grass was therefore
The experiments were carried out at the experimental included at 30% of DM offered. Addition of soybean waste
farm of Can Tho University, Can Tho City, Vietnam. In this supplied CP and energy to the diet. The study lasted for 136
area, the climate is monsoon tropical with a wet season d and 200 g/d of fresh soybean waste was fed during the
between May and November and a dry season between first 65 d and 400 g/d for the last 71 d to meet the
December and April. Annual rainfall varies from 1,400 to increasing requirements of the growing animals.
2,400 mm and mean air temperature is 26.6°C. Feed samples were analysed weekly for DM to balance
the amounts of Para grass and cabbage species. Amount of
Experiment 1 Para grass and cabbage species offered was increased
Exp. 1 was carried out from April to September 2000. weekly, based on the individual consumption the previous
The feeds used in the experiment were three kinds of week, to supply 130% of voluntary intake for cabbage
market waste, leaves from Chinese cabbage (Brassica species and 150% for Para grass.
campestris. subsp. pekinensis), cabbage (Brassica oleracea Feed samples were taken for analysis during the
var. capitata) and cauliflower (Brassica oleracea var. experimental periods. Feed intake was estimated daily by
botrytis) were collected at the Can Tho market in the the difference between DM of amounts offered and refused.
morning and late afternoon. The leaves were fed directly Samples of the refusals were collected individually daily
when they were still green and fresh. Natural grass, mainly and were pooled for 2 weeks and treatment group.
Para grass (Brachiaria multica) cut at an immature stage, The changes in BW gain were recorded by weighing the
was obtained from areas surrounding the university farm. goats monthly, always in the morning before feeding.
Soybean waste, after being processed for soybean milk at a
beverage factory in Can Tho, was collected daily and Experiment 2
supplied fresh. A mineral lick including 60% mineral (85% Exp. 2 was carried out from February to May 2002. The
CaCO3, 15% trace elements), 20% wheat bran as carrier and feeds used were cabbage waste (Brassica oleracea var.
20% NaCl was available inside the pens. capitata), Para grass of the same quality as in Exp. 1 and a
Sixteen 3 month-old goats (3 groups with 2 males and 2 concentrate consisting of rice bran (50%), broken rice
females and one group with 3 males and 1 female) with a (40%) and molasses (10%). In order to make it possible to
BW of 9.2±0.16 kg at the start of the experiment, were mix the ingredients, 500 g water was added to 1.6 kg
selected from flocks of goats raised in confinement systems concentrate to get the feed that was presented to the animals.
on farms in Can Tho province. The goats were of the Bach Salt was available in the pens.
Thao breed, mature BW 63 kg, male; 42 kg, female. They Twentyfour 4-month old male goats with an initial BW
were vaccinated against foot and mouth disease and treated of 13.1±0.81 kg of the same breed and origin as in Exp.1
against gastrointestinal parasites using Albendazole tablets were selected. The vaccinations, housing and feeding
FEEDING WASTES FROM BRASSICA SPECIES TO GOATS 199
Table 1. Chemical composition of the diet components*

Exp.1 Exp. 2
Item
ChC C CF PG SB C PG Con
n 8 8 8 8 4 3 3 3
DM (g/kg) 37±2 53±5 102±5 158±7 221±2 59±6 159±1 705±2
g/kg DM
Ash 172±4 137±2 141±13 119±8 10±5 130±2 130±10 47±3
CP 295±3 233±9 297±3 140±2 378±3 218±7 118±2 92±8
NDF 253±2 279±3 276±2 678±2 175±2 295±3 653±2 279±1
ADF 223±1 236±2 210±1 357±1 129±1 210±3 332±2 104±1
* Means and standard deviation, n=number of samples; ChC: Chinese cabbage Brassica oleracea var. capitata.
C: cabbage Brassica oleracea var. botryti; CF: cauliflower Brassica campestris subsp. Pekinensis; PG: para grass; SB: soybean waste; Con: concentrate.
routines were the same as in Exp. 1. Cabbage waste, Para 65°C for 6 h. The rendered fat was dissolved in light
grass and concentrate were fed in separate containers. petroleum so that the solution contained less than 200 mg
The goats were assigned to a completely randomised fat/ml and was further cleaned up as mentioned above
block design based on initial weight and were kept one (AOAC, 2000). Being known as commonly used
month for adaptation to the new feeds. The treatments were pesticide/insecticides, the following six compounds were
1) Cabbage waste+200 g DM concentrate (C+200 Con), 2) analysed: Alpha-Cypermethrin, Bassa-Fenobucarb, Dimethoate,
Para grass+100 g DM concentrate (PG+100 Con) and 3) Aldrin, Endosulphan and Diazinon.
Cabbage waste+100 g DM concentrate (C+100 Con). The
study lasted for 90 days. Statistical analysis
Amount of Para grass and cabbage waste offered was Data were analysed by variance analysis using the
increased weekly, based on the individual consumption the General Linear Model (GLM) of Minitab Software 12.21
previous week, to supply 130% of voluntary intake for both (1998). When the F-test was significantly different (p<0.05),
cabbage and Para grass. Tukey’s test for pair wise comparisons was used. The
Samples of fed and refusals were collected as in Exp. 1. following statistical model was used:
The changes in BW gain were recorded by weighing the
goats every second week, always in the morning before Yi = µ+Ai+Ei (Exp. 1)
feeding. At the end of the experiment 12 goats were
slaughtered and liver and muscle samples from the hind where, Yi = dependent variable; µ = overall mean; Ai =
legs (biceps femoris) were taken for analyse of effect of diet; Ei = random error.
pesticides/insecticides. In Exp. 2 the effect of block was included. The effect of
sex was tested in Exp. 1 but not included in the model, as
Chemical analyses there were no significant differences due to sex.
DM and ash were determined according to the
procedures of AOAC (1990). Nitrogen (N) determination RESULTS
was made by the Macro Kjeldahl method and CP calculated
as N×6.25. Neutral detergent fiber (NDF) and acid The DM was low in all Brassica species and especially
detergent fiber (ADF) were analysed according to the low (3.7%) in Chinese cabbage (Table 1) and the variation
method described by Van Soest and Robertson (1985). in DM content during the experiments was also low. High
Pesticide/insecticide concentration was determined levels of CP were observed in all three species of Brassica.
using a gas chromatograph (Shimadzu, model 14B) The NDF and ADF of cabbage species were low.
following the method described in AOAC (2000). Fifteen g In Exp. 1 the animals fed the cauliflower diet had higher
cabbage sample was chopped, mixed and homogenized with (p<0.05) DM intake than those fed the Para grass diet. The
30 ml acetone in a centrifuge tube for 30 seconds. Chinese cabbage diet had the lowest intake (Table 2). Intake
Dichloromethan and petroleum ether, 30 ml of each, was of CP was highest (p<0.05) for the cauliflower diet. NDF
added and homogenized another 30 seconds. The tube was and ADF consumption was highest for goats fed the Para
then centrifuged for 2 minutes at 4,000 rpm and the organic grass diet followed by cauliflower, cabbage and Chinese
extract was decanted for further clean-up procedure using cabbage diets.
Gel Permeation Chromatography. The liver and muscle In Exp. 2 the different levels of concentrate that were
samples were cut in cubes of approximately 1 cm size and supplemented to the basic feeds clearly were influencing
25 g was placed in a glass funnel with 70 mm diameter feed intake (Table 2). Goats that were supplemented with
placed on top of a conical flask. The sample was heated at 200 g DM concentrate/day were consuming less cabbage
200 NGU AND LEDIN
Table 2. Feed intake of the experimental diets*

Exp.1, diets Exp. 2, diets
ChC+ C+ CF+ -
PG+ PG+ PG+ PG+ C+ PG+ C+
SB SB SB SB SE 200 Con 100 Con 100 Con SE
Feed intake (g DM/day)
Chinese cabbage 162 - - - - - - - -
Cabbage - 197 - - - 284 - 353 -
Cauliflower - - 353 - - - - - -
Paragrass 54 63 109 355 - - 570 - -
Soybean waste 67 67 67 67 - - - - -
Concentrate - - - - - 200 100 100 -
Total 283d 327c 529a 422b 25.8 484b 670a 453b 19.7
Nutrient intake (g/day)
OM 249d 294c 467a 380b 22.5 438b 586a 402b 17.4
CP 81b 81b 146a 80b 7.2 82 79 86 3.5
NDF 88d 108c 181b 249a 16.5 139b 394a 132b 10.2
ADF 62d 80c 122b 145a 9.4 79b 295a 83b 5.6
DM intake (% of BW) 2.1b 2.3b 3.5a 3.0a 0.1 2.9b 4.1a 2.8b 0.2
DM intake (g/kg W0.75) 40c 45bc 69a 59b 3.1 59b 82a 56b 3.2
* Least squares means and SE, a, b, c, d Means within rows and experiments with different superscripts are significantly different (p<0.05).
ChC: Chinese cabbage Brassica oleracea var. capitata; C: cabbage Brassica oleracea var. botrytis.
CF: cauliflower Brassica campestris subsp. Pekinensis; PG: para grass; SB: soybean waste; Con: concentrate.
Table 3. Effect of diets on daily live weight gain (LS-means and SE)
Exp.1, diets Exp. 2, diets
ChC+ C+ CF+
PG+ PG+ PG+ PG+ C+ PG+ C+
SB SB SB SB SE 200 Con 100 Con 100 Con SE
Initial weight (kg) 9.5 9.2 9.3 9.6 0.2 13.3 12.6 13.3 0.81
Final weight (kg) 18.0b 19.1b 21.2a 18.3b 0.4 20.2 20.6 19.6 1.06
BWG (g/day) 62.8c 73.4b 87.5a 64.0c 2.7 76 88 70 5.6
c c b
FCR (kg DM/kg BWG) 4.5 4.5 6.0 6.7a 0.3 6.5 7.6 6.6 0.4
a, b, c
Means within rows and experiment with different superscripts are significantly different (p<0.05).
BWG: body weight gain; FCR: feed conversion ratio; CHc: Chinese cabbage Brassica oleracea var. capitata; C: cabbage Brassica oleracea var. botryti;
CF: cauliflower Brassica campestris subsp. Pekinensis; PG: para grass; SB: soybean waste; Con: concentrate.
Table 4. Pesticide/insecticide content in feeds and animal products, Exp. 2

Samples Alpha-fenobucarb Bassa-cypermethrin Dime-thoate Aldrin Endosul-phan Diazinon
Cabbage (mg/kg fresh) 0.175 0.074 0.028 ND ND ND
Para grass ND ND ND - - -
Concentrate ND ND ND - - -
Liver (C+200 Con) ND ND ND - - -
Muscle (C+200 Con) ND ND ND - - -
Liver (C+100 Con) ND ND ND - - -
Muscle (C+100 Con) ND ND ND - - -
ND: not detected; - not analysed.
than those supplemented with 100 g. The total amount of cabbage diet the lowest, 62.8 g/day. In Exp. 2 the
DM that was consumed in these two rations was, however, differences in live weight gain between the treatments were
similar (484 and 453 g/day), leading to a non-significant not statistically significant although goats fed Para grass
difference in DM intake expressed as percentage of BW had slightly higher growth rates (88 vs. 76 and 70 g/day).
(2.9 and 2.8%). In spite of the difference in level of Three of the six kinds of possible pesticide/insecticide
concentrate supplementation and CP components, the residues that were tested in Exp. 2 were found in cabbage,
amount of CP consumed by the goats in three diets was Alpha-Cypermethrin, Bassa-Fenobucarb and Dimethoate
nearly similar (82, 79 and 86 g/day, respectively). (Table 4) but no residues were detected in grass or
Goats that were fed the cauliflower diet in Exp. 1 had concentrate. None of the residues were detected in goat
the highest (p<0.05) growth rate, 87.5 g/day, compared to meat or liver indicating no harmful effects for humans
the other diets and the goats that were fed the Chinese consuming meat from goats fed cabbage waste. The spleen
FEEDING WASTES FROM BRASSICA SPECIES TO GOATS 201
Table 5. Weight of liver and spleen of the goats, Exp. 2 from the cabbage species offered gave acceptable daily
Diets Exp. 2 gains compared to those from traditional or conventional
C+200 Con PG+100 Con C+100 Con SE feeds. The growth rate of 5 to 6 month old Bach Thao goats
Liver (g) 353a 256b 348a 17.9 fed Sesbania grandiflora was 100±34 g, as reported by
Spleen (g) 27 27 30 1.4
a, b Thuy and Do (1996). Similar results were reported by Tien
Means within rows with different superscripts are significantly different
(p<0.01). and Nhan (1998), who found that goats gained 78 g/day
C: Cabbage Brassica oleracea var. botrytis. when given Leucaena leucocephala. Live weight gain of
PG: para grass; Con: concentrate. the goats fed Chinese cabbage and Para grass were lower
weight was normal and similar in three treatments. The than suggested by Binh et al. (1995) for Bach Thao goats of
weight of the liver was, however, significantly (p<0.01) 6 to 9 months of age (87 to 111 g/day).
higher for the diets containing cabbage. Adding concentrate to the cabbage in Exp. 2 increased
DM intake but the levels of CP intake were similar to the
DISCUSSION cabbage diet in Exp. 1 and the live weight gains were
between 70 and 76 g/day for the cabbage diets in the two
The present results concerning the chemical experiments. Since the content of energy in the diets is not
composition of cauliflower were in agreement with the known it is not possible to compare energy intake, the diets
results of Francis (1980), who reported that the DM and CP may be similar also in that respect.
content of cauliflower was 7.7% and 29%, respectively. The It is commonly known that Brassica species may
NDF content of cauliflower was slightly higher in this study contain pesticide/insecticide residues and different amounts
than obtained by Gasa et al. (1989). Concerning cabbage of compounds called glucosinolates of which breakdown
the present results were slightly lower than those from products are responsible for various toxic symptoms
Gupta et al. (1993), who reported that DM and CP content (Duncan and Milne, 1992). It was reported by Chi (1997),
of cabbage was 8.6% and 28%, respectively. Low NDF and that pesticide levels present on cabbage leaves were
ADF percentages were also observed in cabbage. The relatively high. In this study three of the six kinds of
chemical compositions of the feeds used in the two different compounds considered commonly used were found at low
experiments in this paper were similar. The differences levels in the cabbage leaves. None of the residues were,
compared to results reported in the literature may be due to however, carried over to goat meat or liver. Few
season, development stage, variety or production system. comparative figures in the literature in this field made it
Among the cabbage species studied, the adaptation of difficult to determine the tolerance of goats to these kinds of
the goats to the feeding of cauliflower and cabbage was toxins. Which levels will have an effect on animal
faster than to Chinese cabbage. Soybean waste was readily performance, and ultimately on product quality and human
accepted, as was the concentrate when mixed with molasses. health, is open to debate.
The difference in intake of the Brassica species can be due The glucosinolates were not analysed in these
to the different DM contents, which have been suggested to experiments but the high liver weights from goats fed the
limit DM intake (Lambert et al., 1987). However, lambs fed cabbage diets in Exp. 2 indicate increased liver activity
Brassica forage containing 91.2% water consumed nearly implying break down of toxic substances.
enough DM to meet recommendations for growth (Cassida
et al., 1994). In Exp. 2 concentrate was added to the diets to CONCLUSIONS
increase the DM content. This resulted in lower cabbage
intake at higher levels of concentrate supplementation. The results from the studies showed that the best
Subsequently there was a substitution effect of the performance in intake and live weight gain was obtained
concentrate. In this case an addition of 100 g DM when the goats were fed cauliflower leaves and soybean
concentrate decreased the intake of cabbage with 69 g DM. waste. Cabbage and Chinese cabbage can be potentially
Higher intake of CP resulted in higher growth rates in useful feeds, especially cabbage since it is available in large
Exp. 1. Evidently there was a genetic capacity for growth amounts all the year around. Adding concentrate resulted in
rate around 85 g/day, which could be expected when the CP higher DM intake but did not result in any higher growth
intake was sufficiently high. Goats fed the cauliflower diet rate.
over consumed CP in relation to the requirements (26 g There may have been some effects of pesticides/
digestible CP for maintenance and 20 g digestible CP for herbicides or glucosinolates resulting in increased liver
gaining 100 g/day for a 20 kg goat according to NRC activity and manifested as higher liver weights. However,
(1981). The surplus of CP would have been excreted in the the pesticides/herbicides were not detectable in muscle
urine, which was not analysed in Exp. 1. Different diets samples and liver.
202 NGU AND LEDIN
REFERENCES General Statistical Office. 1999. Statistical data of agriculture,

forestry and fishery 1990-1998 and forecast in the year 2000
AOAC. 1990. Official methods of analysis of the Association of (in Vietnamese). Statistical Publishing House p. 80.
Official Analytical Chemist. 15th edn. Washington, DC. 1:69- Gupta, R., T. R. Chauhau and D. Lall. 1993. Nutritional protential
90. of vegetable waste products for ruminants. Biores. Technol.
AOAC. 2000. Official methods of analysis of the Association of 44:263-265.
Official Analytical Chemist. 17th edn. Washington, DC. Capter Gustine, D. L. and G. A. Jung. 1985. Influence of some
10:5-8. management parameters on glucosinolate levels in Brassica
Barry, T. N., R. C. McDonald and T. C. Reid. 1981. Nutritional forage. Agron. J. 77:593-597.
evaluation of kale (Brassica oleracea) diets: 1. Growth of Lambert, M. G., S. M. Abrams, H. W. Harpster and G. A. Jung.
grazing lambs as affected by time after incubation to the crop, 1987. Effect of hay substitution on intake and digestibility of
feed allowance and intraperiotoneal amino acid forage rape (Brassica napus) fed to lambs. J. Anim. Sci.
supplementation. J. Agric. Sci. 96:257-267. 65:1639-1646.
Binh, D. V., N. Q. Suc, C. D. Khu and D. X. Bien. 1995. Results MINITAB For Windows. 1998. MINITAB release 12.21. Minitab
from the research of Bachthao raising in the Northen Vietnam Inc.
(in Vietnamese). In Selection of scientific works on animal Ngu, N. T., I. Ledin, M. Dahlgren and A. Nilsson. 2001. The
production (1969-1995). Agricultural Publishing House. Hanoi, potential of market wastes from fruits and vegetables as
Vietnam. p. 32. livestock feed in urban areas of the Mekong Delta, Vietnam.
Boucqué, C. V. and L. O. Fiems. 1988. Vegetable by-products of In: Improving utilisation of market wastes from fruits and
agro-industrial origin. Livestock Production Science 19:97-135. vegetables in goat feeding (Ed. N. T. Ngu). M.Sc. Thesis,
Cassida, K. A., B. A. Barton, R. L. Hough, M. H. Wiedenhoeft and Swedish University of Agricultural Sciences, Department of
K. Guillard. 1994. Feed intake and apparent digestibility of Animal Nutrition and Management pp.1-17.
hay-supplemented Brassica diets for lambs. J. Anim. Sci. NRC. National Research Council. 1981. Nutrient requirements of
72:1623-1629. goats: Angora, Dairy and Meat goats in temperate and tropical
Casteel, S. W., F. T. Satalowich, J. D. Kendall, G. E. Rottinghaus, country 15:10-12. National Academy Press, Washington DC.
H. S. Gosser and N. R. Schneider. 1993. Aldrin intoxication Schroeder, J. W. 1999. By-products and regionally available
and clearance of associated dieldrin residues in a group of alternative feedstuffs for dairy cattle. North Dakota State
feedlot cattle. J. Am. Vet. Ass. 202:83-85. University. NDSU Extension Service. http://www.ext.nodak.
Chi, N. T. K. 1997. Investigating of pesticides on some kinds of edu/extpubs/ansci/dairy/as1180w.html.
vegetables in Can Tho City (in Vietnamese). Department of Thuy, N. T. T. and H. Q. Do. 1996. Using Sesbania grandiflora for
Science, Technology and Environment of Can Tho, pp. 12-14. growing goats (in Vietnamese). B.Sc. Thesis, Can Tho
Duncan, A. J. and J. A. Milne. 1992. Rumen microbial degradation University, Vietnam, p. 17.
of Allyl Cyanide as a possible explanation for the tolerance of Tien, N. V. and N. T. H. Nhan. 1998. Effect of Sesbania
sheep to Brassica-derived glucosinolates. J. Sci. Food Agric. grandiflora, Leucaena leucocephala, Hibiscus rosa-sinensis
5:15-19.
and Ceiba pentadra on intake, digestion and rumen
Duncan, A. J. and J. A. Milne. 1993. Effects of oral administration
environment of growing goats (in Vietnamese). B.Sc. Thesis,
of Brassica secondary metabolites, allyl cyanide, allyl
Can Tho University, Vietnam, p. 26.
isothiocyanate and dimethyl disulpide on the voluntary food
Van Soest, P. J. and J. B. Robertson. 1985. Analysis of forages and
intake and metabolism of sheep. Br. J. Nutr. 70:631-645.
fibrous foods. A laboratory Manual for Animal Science 613.
Francis, G. H. 1980. Use of vegetable and arable by-products. In:
Department of Animal Science. Cornell University. Ithaca,
By-products and wastes in animal feeding (Ed. E. R. Orskov).
New York, pp. 80-117
An occasional publication of the British Society of Animal
Yousef, M. I, M. S. Abbassy and M. H. M. Yacout. 1999.
Production pp. 33-43.
Assessment of cypermethrin and dimethoate toxicity in Barki
Gasa, J., C. Castrillo, M. D. Baucells and J. A. Guada. 1989. By-
sheep. Biochemical and histological changes, and tissue
products from the canning industry as feed stuff for ruminants:
residues. Egyptian Journal of Animal Production 36:25-41.
digestibility and its prediction from chemical composition and
laboratory bioassays. Anim. Feed Sci. Technol. 25:67-77.
ARCHIVES OF ANIMAL BREEDING “The importance of prenatal events for
postnatal muscle growth in relation to the
VOLUME 49 2006 SPECIAL quality of muscle based foods”
ISSUE 2nd Work Group meeting
VOLOS, GREECE
29th-30th September 2005
Content
PAGES abstract PDF
OKSBJERG, N.; TE PAS, M.F.W.; STICKLAND, N.; WIMMERS, K.:

3 PDF
Preface
WG1 SESSIONS
LEFAUCHEUR, L.: Myofibre typing and its relationships to growth

4-17 abstract PDF
performance and meat quality (workshop contribution)
BAYOL, ST. A.; SIMBI, B. H.; STICKLAND, N.C.: Eating “junk food”
during pregnancy and lactation impairs skeletal muscle development and 18 PDF
metabolism in rat offspring at weaning
KARUNARATNE, J.F.; ASHTON, C.J.; C. STICKLAND, N.C.: Prenatal

undernutrition increases fat deposition and collagen content within skeletal 19 PDF
muscle in the porcine fetus
BEE, G.; CALDERINI, M.; BIOLLEY, C.; GUEX, G.; HERZOG, W.:
Changes of the histochemical properties and meat quality traits of porcine
20-24 abstract PDF
muscles during growth. I) Effect of feed restriction in pigs slaughtered at
the same age and varying body weight
BRAMELD, J.; DANIEL, Z.; FAHEY, A.; PARR, T.; SCOLLAN, N.;
BUTTERY, P.: Effect of maternal undernutrition on ruminant carcass and 25 PDF
meat quality
GIL, M.; GISPERT, M.; KLONT, R.; SOSNICKI, A.; PLASTOW, G.:
Metabolic and contractile characteristics of muscles longissimus thoracis 26-30 abstract PDF
and Semimembranosus from two porcine lines
BERRI, C.; GODET, E.; HAJ HATTAB, N.; DUCLOS, M.J.: Growth and
differentiation of the chicken Pectoralis major muscle: Effect of genotype 31-32 PDF
and early nutrition
CODINA, M.; MONTSERRAT, N.; GARCÍA DE LA SERRANA, D.;

RALLIÈRE, C.; GABILLARD, J.CH.; NAVARRO, I.; RESCAN, P.Y.;
33-38 abstract PDF
GUTIÉRREZ, J.: Role of insulin and igfs in fish muscle development and
quality
ALAMI-DURANTE, H.; OLHASQUE, V.; ASHTON, C.; STICKLAND,

N.C.; KENTOURI, M.; DIVANACH, P.: The influence of two temperatures 39 PDF
maintained constant during incubation and larval life on the early
types
MAU, M.; VIERGUTZ, T.; REHFELDT, C.: Influence of estrogens and

81-85 abstract PDF
isoflavones on porcine muscle satellite cell growth
PICKOVA, J.; BRÄNNÄS, E.: Egg quality in Arctic charr (Salvelinus

86-89 abstract PDF
alpinus)
THERKILDSEN, M.; SØRENSEN, I.L.; OKSBJERG, N.: Use of casein

zymography to measure the activities of µ- and mM calcium-dependent
90 PDF
calpains during myogenesis in primary porcine satellite cell cultures
(preliminary data)
WG2 SESSIONS
PICARD, B.; JURIE, C.; CASSAR-MALEK, I.: Is the myosin heavy chain
91 PDF
IIb isoform expressed in bovine muscles?
SARROPOULOU, E.;. POWER, D.M.; MAMURIS, Z.; MOUTOU, K.A.:

The two isoforms of myosin light chain 2 in gilthead sea bream (Sparus 92-96 abstract PDF
aurata); alternative polyadenylation site selection and tissue expression
SILVA, N.; BAPTISTA, V.M.; POWER, D.M.: Expression patterns of MLC

97-101 abstract PDF
isoforms during halibut (Hippoglossus hippoglossus L.) metamorphosis
MAAK, S.; NEUMANN, K.; SWALVE, H.H.: Identification and

characterization of potential regulatory elements for the porcine MYF5 102 PDF
gene
VALENTE, L.M.P.; MOREIRA, S.; RALLIÈRE, C.; RAMOS, A.M.;

Rescan, P.-Y.: Variability of myostatin genes in rainbow trout
103-108 abstract PDF
(Oncorhynchus mykiss) strains exhibiting distinct hyperplastic growth:
preliminary results
CASSAR-MALEK, I.; PASSELAIGUE, F.; BERNARD, C.; GAUTIER, P.;

HOCQUETTE, J.-F.: Target genes of myostatin loss-of-function in bovine 109 PDF
foetuses
TE PAS, M.F.W.; POOL, M.H.; HULSEGGE, I.; JANSS, L.L.G.: Analysis

of the differential transcriptome expression profiles during prenatal muscle 110-115 abstract PDF
tissue development in pigs (workshop contribution)
WIMMERS, K.; Trong Ngu, N.; MURANI, E.; SCHELLANDER, K.;

PONSUKSILI, S.: Linkage and expression analysis to elucidate the
genetic background of muscle structure and meat quality in the pig
(workshop contribution)
PUOLANNE, E.; RUUSUNEN, M.; VOUTILA, L.; YLÄ-AJOS, M.: Growth

rate, muscle physiology, carcass traits and meat quality in pigs - A 126-131 abstract PDF
collage of studies on pigs at the University of Helsinki
TATARA, M.R.; TYGESEN, M.P.; SAWA-WOJTANOWICZ, B.;

HARRISON, A.P.: The impact of bone development on final carcass 132-136 abstract PDF
weight
KIESSLING, A.; RUOHONEN, K.; BJØRNEVIK, M.: Muscle fibre growth

and quality in fish (workshop contribution)
DUCLOS, M.J.; MOLETTE, C.; GUERNEC, A.; RÉMIGNON, H.; BERRI,

147-
C.: Cellular aspects of breast muscle development in chickens with high abstract PDF
151
or low growth rate
Arch. Tierz., Dummerstorf 49 (2006) Special Issue, 116-125
1
Research Institute for the Biology of Farm Animals (FBN), Research Unit Molecular Biology, 18196 Dummerstorf,
Germany
2
Institute of Animal Breeding and Genetics, University of Bonn, Endenicher Allee 15, 53115 Bonn
3
Research Institute for the Biology of Farm Animals (FBN), Research Group Functional Genomics,
18196 Dummerstorf, Germany
KLAUS WIMMERS1, NGUYEN TRONG NGU2, EDUARD MURANI1,

KARL SCHELLANDER2 and SIRILUCK PONSUKSILI3
Linkage and expression analysis to elucidate the genetic background

of muscle structure and meat quality in the pig
Abstract
Genome scans are the most general approaches to identify genomic regions exhibiting quantitative trait loci,
QTL, without prior hypothesis of the physiology and genetic control of a trait. Function-oriented expression
analyses are a complementary approach to derive hypotheses of the physiologic and genetic background of
phenotypic variation. The proportion of muscle fibre types and their size affect body composition traits,
muscularity and obesity as well as and functional properties of skeletal muscle and meat quality. We detected
QTL for microstructural and biophysical muscle properties as well as traits related to muscling and obesity in a
porcine experimental population that is based on Duroc and Berlin Miniature Pig. Regions with either significant
QTL for muscle fibre traits or significant QTL for meat quality and muscularity or both were detected on
chromosomes 1, 2, 3, 4, 5, 13, 14, 15, and 16. Here effects on the complex traits of muscularity, obesity,
metabolic type and biophysical muscle characteristics might be the result of genetic variation primarily affecting
fibre type distribution traits. In order to complement the QTL approach by displaying trait-associated expression-
profiles and detection of eQTL (expression QTL) we evaluated the quantification of transcripts of the myosin
heavy chain isoforms, MYHC isoforms, by real time PCR as a new phenotype that was found to be significantly
correlated to results of fibre typing by ATPase staining. This new phenotype is probably more suitable to unravel
the genetic background of variation in traits related to muscle and meat properties than technological meat
quality parameters and conventional fibre typing.
Key Words: QTL, muscle fibre, meat quality, myosin heavy chain isoforms, transcript quantification, pig
Zusammenfassung
Titel der Arbeit: Kopplungs- und Expressionanalysen zur Klärung der genetischen Grundlagen
mikrostruktureller und biophysikalischer Merkmale des Muskels beim Schwein
Genomscans stellen einen Ansatz zur Identifizierung von QTL, quantitative trait loci, dar, der ohne vorherige
Hypothese über die Physiologie und die genetische Steuerung eines Merkmals auskommt. Funktions-orientierte
Genexpressionsanalysen stellen einen komplementären Ansatz dar zur Ableitung von Hypothesen über den
physiologischen und genetischen Hintergrund phänotypischer Variation. Die Verteilung der Muskelfasertypen
und ihre Größe beeinflussen Merkmale der Körperzusammensetzung, des Muskel- und Fettansatzes, der
Funktion der Muskulatur und der Fleischqualität. Wir haben QTL für mikrostrukturelle und biophysikalische
Muskeleigenschaften sowie Merkmale der Schlachtkörperzusammensetzung in einer porcinen Ressourcen-
population basierend auf Duroc und Berliner Miniaturschwein identifiziert. Regionen mit entweder genomweit
signifikanten QTL für Muskelfasermerkmale oder genomweit signifikanten QTL für Fleischqualität und
Schlachtkörpermerkmale oder beides wurden auf Chromosomen 1, 2, 3, 4, 5, 13, 14, 15 und 16 ermittelt. Hier
könnten Effekte auf die komplexen Merkmale der Körperzusammensetzung, des Stoffwechseltyps und der
Fleischqualität das Ergebnis genetischer Variation mit direktem Einfluss auf Muskelfasermerkmale sein. Um
diese Ergebnisse durch die Darstellung Merkmals-abhängiger Expressionsprofile und die Identifizierung von
eQTL (Expressions-QTL) zu ergänzen, haben wir Echtzeit-PCR zur Quantifizierung der Transkripte der
Isoformen der schweren Ketten des Myosins (myosin heavy chain MYHC) als neuen Phänotyp evaluiert, der
signifikant mit Ergebnissen der ATPase-Muskelfasertypisierung korreliert. Dieser neue Phänotyp ist potentiell
besser geeignet den genetischen Hintergrund der Variation in Merkmalen der Muskel- und Fleischeigenschaften
zu beleuchten, als technologische Fleischqualitätsparameter und das herkömmliche Verfahren der
Muskelfasertypisierung.
Schlüsselwörter: QTL, Muskelfasern, Fleischqualität, Myosin-Isoformen, Transkriptquantifizierung, Schwein

117
Introduction
Basic principles of QTL analyses
Researchers have used different strategies to detect genes controlling quantitative
traits. Genome scans are the most general approaches to identify genomic regions
exhibiting quantitative trait loci, QTL, without prior hypothesis of the physiology and
genetic control of a trait.
The phenotypic variation, Vp, among individuals in a population such as F2 for any
trait can be easily measured. Vp is the result of genetic and environmental
components, i.e. Vp=Vg + Ve. The proportion of Vp arising from genetic causes is the
heritability of that trait in that population, h²=Vg/Vp. Vg represents the combined
effects of all QTL. By combining the measurement of phenotypic variation and
genotypic variation, using a number of unambiguous single site genetic markers, it is
possible to study individual QTL. Within pedigrees the co-segregation of trait
phenotypes and marker genotypes is observed. Among the number of markers
distributed throughout the genome at least some will be linked to QTL for the trait of
interest. QTL analysis depends on the fact that where such linkage occurs, the marker
locus and the QTL will not segregate independently but linkages disequilibrium exists
within the pedigrees examined. Differences in those marker genotypes will be
associated with different trait phenotypes (Figure 1).
a b
1 2
F0 1 X 2
2 2
F1
1 X 1
1 1 2
1 2 2
1 Fig. 1: Segregation (a) and regression (b) of marker
F2 2 1
genotype and trait phenotype (body weight and
2 1 2
colour) within a three generation F2-resource
population. (Segregation (a) und Regression (b) von
Markergenotyp und Merkmal (Körpergewicht und Farbe) innerhalb einer Drei-Generationen F2-Ressourcen-
Population).
F2 animals that inherited the marker genotype 11 are large but either white or black; animals of the genotype 22 are
small and also either black or white; animals with the genotype 12 are of intermediate weight and also either black
or white. Thus the marker locus investigated is in linkage to a QTL for body weight; the marker allele 1 is in
linkage disequilibrium with the QTL+ allele. Interval mapping based on least square regression analysis involves
estimation of additive genetic effects as half of the difference of the trait value between homozygous carriers of
alternative QTL alleles, i.e. the QTL alleles derived from the divergent founder populations. Dominance effects are
estimated as the difference between the trait value of heterozygous individuals and the mean trait value observed
for homozygous animals. Subsequently, additive and dominant coefficients at fixed positions in the genome of
each F2 animal and their phenotypic values were regressed onto the additive and dominance coefficients in
intervals of 1 cM.
In order to estimate the most likely position of a QTL, its effects, and to test its
significance several statistical approaches have been developed and implemented in
various softwares. The most commonly used analytical approaches explore the interval
between pairs of markers for the presence of QTL (interval mapping) (LANDER and
118
BOTSTEIN, 1989). The likelihood of a QTL at any point between the marker pairs is
deduced from the observed trait and genotype information. The test statistic is the
likelihood ratio (LOD) of a QTL across all intervals compared to getting this result by
chance. Regression analysis provides comparable results (HALEY and KNOTT,
1992). QTL analyses have been conducted successfully for numerous traits in various
pig (crossbred-) populations. The current status of QTL studies in the pig can be found
at `Pig Quantitative Trait Loci database, PigQTLdb´ (HU et al., 2005).
QTL for muscle and meat traits

The power of QTL analyses depends largely on the size of the experiment in terms of
number of animals and markers used and also on the trait analysed. The application of
QTL analyses, which are a priori hypothesis-free, for traits of high heritability
increases the power of the approach. Disentangling complex traits in their constituent
phenotypes might therefore facilitate the identification of QTL and the elucidation of
the pleiotropic nature of QTL effects.
Each muscle consists of three main fibre types, slow-twitch oxidative, fast-twitch
oxido-glycolytic and fast-twitch glycolytic fibres (PETER et al., 1972), which are
characterised by different microstructural, biochemical and metabolic properties. The
number and size of the muscle fibres are major factors determining growth and weight
of each muscle and post mortem development of muscle to meat and thus meat quality
traits in pigs (LENGERKEN et al., 1994; LARZUL et al., 1997; FIEDLER et al.,
2004). Hence, with regard to muscle and meat, muscle fibre properties represent some
of the phenotypic components that contribute to the complex traits of meat and carcass
quality. Consequently, we aimed to identify QTL for for microstructural and
biophysical muscle properties as well as traits related to muscling and obesity in a
porcine experimental population that is based on Duroc and Berlin Miniature Pig.
Moreover, in order to complement the QTL approach by displaying trait-associated
expression-profiles and detection of eQTL (expression QTL) we evaluated the
quantification of transcripts of the myosin heavy chain isoforms, MyHC isoforms, by
real time PCR as a new phenotype.
Material and methods

Animals
Analyses were done in a three-generation porcine F2 population (DUMI population)
based on reciprocal crossbreeding of Duroc and Berlin Miniature Pig breeds
(HARDGE et al., 1999). Thirty-three full sib-families comprising 469 F2-individuals
born from 32 sows and four boars were kept and performance tested on the research
farm of the Institute of Animal Science in Berlin Dahlem, Humboldt University of
Berlin (up to day 100) and at the performance test station of the federal country
Brandenburg (day 100 to day 200). At the research farm Frankenforst of the Institute
of Animal Breeding and Genetics, University of Bonn, 436 F2 animals of 21 full sib-
families were born from 11 sows and three boars, raised and performance tested. F2
piglets were weaned at about 6 weeks of age and kept in flat decks until day 100 and
subsequently in single pens until slaughter at 200 days of age. Performance testing and
trait recording was done according to according to the German performance test
directives (ZDS, 2003)
119
Phenotypes
Muscle fibre characteristics of the longissimus muscle were determined by
microscopic image analyses after histochemical fibre type differentiation. The samples
were taken immediately post mortem at the 13th/14th rib, frozen in liquid nitrogen and
stored at –70 °C. Serial cross-sections (12 µm) were obtained in a cryostat microtom
(–20 oC) in order to be processed for the following histochemical reactions:
In order to differentiate the three main fibre types “red”, “intermediate”, “white” and
“slow twitch oxidative = STO”, “fast twitch oxidative = FTO”, “fast twitch glycolytic
= FTG”, respectively, the samples were stained either by the NADH tetrazolium
reductase reaction (NADH-TR) alone or by the combined NADH-TR/ATPase
reaction. For the identification of the capillaries the alkaline phosphatase reaction was
used detecting this marker enzyme of endothelial cells (JOSZA et al., 1993).
The quantitative microscopic determination of fibre type proportion, fibre size and
capillar density was done on 400 fibre cross sections per animal. In total 308 F2
animals were examined for microstructural muscle traits. QTL analysis for these traits
involving differentiation of fibre types based on staining intensity was performed
separately for the two subsets of the material with phenotypic evaluation using either
NADH-TR (n=168) or combined NADH-TR/ATPase reaction (n=140).
Markers and QTL-analysis

Altogether the animals of the DUMI population were genotyped at 88 loci covering
the porcine autosomes with mean interval size of 30.7 cM. The set of markers includes
72 microsatellites and 16 biallelic markers. Linkage analysis was performed using the
program CRI MAP, version 2.4 (GREEN et al., 1990). The QTL analysis was done
with the program QTLexpress (SEATON et al., 2002) that is accessible via internet
and developed to perform interval mapping based on least square regression analysis
in three generation F2 populations and half-sib families (see Figure 1). Least square
regression models used for QTL analysis included along with additive and dominance
coefficients for the putative QTL the fixed effects of family, parity and sex as well as
slaughter weight as a co-variable, which were found to affect almost all traits analyses
in previous analyses of variance ignoring any molecular genetic information. Paternal
half-sib analysis was accomplished making no assumptions on the relative frequencies
of the QTL alleles in the founder populations. Therefore the F2-animals were treated
as paternal half-sib families and the probability for the occurrence of a paternal allele
was estimated in intervals of 1 cM. The probabilities of inheritance of distinct paternal
gametic phases were regressed onto allele substitution effects at the putative QTL. The
regression model included sex and litter as fixed effects and slaughter weight as co
variable. Significance thresholds at the 5 and 1% level were determined empirically by
permutation for individual chromosomes (CHURCHILL and DOERGE, 1994).
Chromosome-wide 1 and 5% significance thresholds became genome-wide
significance thresholds after Bonferroni correction for 18 autosomes of the haploid
porcine genome.
MYHC isoform quantification

In order to establish the quantification of transcripts of myosin heavy gene (MYHC)
isoforms (slow/I, IIa, IIx, and IIb) in M. longissiumus dorsi by SyBR green real time
120
RT-PCR assays as a new phenotype a comparison of results of these assays and

ATPase fibre typing was conducted. RNA and serial cross-sections were obtained
from M. longissimus dorsi samples of 30 animals of a Duroc x Pietrain F2 crossbreed
population, which represent discordant sibpairs for the trait loin eye area. RNA was
reverse transcripted using oligo(d)T and random hexamer primers. Real time PCR
using isotype-specific primers (DA COSTA et al., 2002) were performed on an ABI
Prism 7000 instrument. Abundance of transcripts of MYHC isoforms were normalized
for transcript levels of the 18S gene and expressed as proportion of the total amount of
MYHC transcripts. Serial cross-section were stained by ATPase reaction after
preincubation at pH4.6 and evaluated visually to obtain the relative proportion of
typeI, typeIIb/x, and typeIIa fibres.

QTL for muscle fibre, meat quality and carcass traits
Results of the QTL analyses are compiled in Tables 1 and 2, in which all QTL
exceeding the 5% genome-wide significance threshold are included. Suggestive QTL
are detailed elsewhere (Wimmers et al., 2006).
Due to their economic importance, meat quality and body composition traits are
recorded in routine in pig breeding. Correspondingly, there are many efforts to identify
QTL responsible for the variation in these traits. Genome scans were conducted in
many different experimental and commercial populations and revealed QTL effects on
all 18 autosomes and chromosome X (for review see the `Pig Quantitative Trait Loci
database, PigQTLdb´). Here, we report QTL for meat quality traits with genome-wide
significance on SSC3, 5, 13, 15, 16 and 17 and QTL for traits related to lean meat
content on SSC2, 4, 6, and 16.
Table 1
Evidence for QTL significant at the 5% genome-wide level for traits related to microstructural muscle properties,
to meat quality, and to carcass composition obtained by F2 analysis. Estimated significance levels (F-value),
position, % of F2 variance explained by each QTL, and gene effects. (QTL mit Genom-weiter Signifikanz für
Muskelstruktur, Fleischqualitäts- und Schlachtkörpermerkmale gemäß F2-Analyse. Geschätzte Signifikanzlevel
(F-Werte), Position, % der F2-Varianz erklärt durch den QTL und Geneffekt)
Trait SSC Position F- % Additive Dominance
[cM] Value Variance1 Effect2 S.E. Effect2 S.E.
DiaAnF 1 3 8.4* 11.8 2.64 1.39 -7.04 1.80
muscle DiaFTG 2 63 9.4* 17.8 -7.40 1.90 -10.07 5.91
fibre Diamean 2 66 9.5* 17.9 -7.04 1.78 -8.85 5.58
traits DiaFTG 4 96 8.6* 16.3 0.57 2.14 8.82 2.53
Diaw 14 102 7.9* 12.7 1.60 1.96 -15.65 4.09
MCopto 3 0 13.4** 3.6 -1.74 0.35 0.57 0.51
meat & FOM 4 80 19.0** 5.1 3.21 0.53 0.06 0.89
carcass MAML 4 78 13.8** 3.7 1.27 0.25 0.47 0.42
traits MAML 6 175 11.4* 3.0 -0.99 0.23 0.52 0.35
MCopto 15 117 8.0* 2.2 -1.27 0.37 -0.89 0.50
*: significant at the 5% genome-wide level, **: significant at the 1% genome-wide level,
1
the fraction of phenotypic variance in the F2 explained by a QTL; calculated as the proportion of residual variance of the
statistical models with and without the QTL effect
2
positive values of additive genetic and dominance effects imply higher trait values forced by the Duroc allele;
121
Table 2
Evidence for QTL significant at the 5% genome-wide level for traits related to microstructural muscle properties,
to meat quality, and to carcass composition obtained by half-sib analysis. Estimated significance levels (F-
value), position, % of F2 variance explained by each QTL, and gene effects. (QTL mit Genom-weiter
Signifikanz für Muskelstruktur, Fleischqualitäts- und Schlachtkörpermerkmale gemäß Halbgeschwister-Analyse.
Geschätzte Signifikanzlevel (F-Werte), Position, % der F2-Varianz erklärt durch den QTL und Geneffekt)
Trait SSC Position F- %
[cM] Value Variance1
ProFTO 2 100 5.8* 18.2
CapSTO 2 123 5.6* 17.5
muscle ProGiF 4 132 6.2* 8.8
fibre ProFTO 8 55 6.0* 18.9
traits Fib/mm² 11 91 5.2* 5.9
ProGiF 12 38 10.3* 24.4
DiaGiF 12 56 7.4* 17.5
ProGiF 15 32 12.7** 15.5
FOM 2 20 6.6** 3.8
MAML 2 20 10.0** 5.8
MCOpto 3 0 7.6** 5.6
FOM 4 73 5.7** 3.3
MCOpto 5 9 6.6* 4.9
meat &
FOM 6 0 4.7* 2.7
carcass
MAML 6 32 5.4** 3.1
traits
MCOpto 13 43 8.0** 5.9
pH24ML 15 48 5.4* 3.1
FOM 16 0 5.2** 3.0
C1ML 16 20 4.5* 2.3
C24ML 17 0 5.2* 3.0
*: significant at the 5% genome-wide level, **: significant at the 1% genome-wide level,
1
the fraction of phenotypic variance in the F2 explained by a QTL; calculated as the proportion of residual variance of the
statistical models with and without the QTL effect
For muscle fibre traits we found QTL on SSC1, 2, 4, 8, 11, 12, 14, and 15. In detail,
the telomeric region of SSC1 contained a QTL for the diameter of angular fibres
(DiaAnF) reaching 5% genome-wide significance under the line-cross model. Estimated
additive and dominance effects indicated an overdominant QTL (dominance effect >
additive genetic effect) with the Miniature Pig allele causing higher trait values (Table
1). According to line-cross model a QTL for mean fibre diameter (Diamean) mapped to
the intermediate region of SSC2 that explained a considerable high proportion of
phenotypic variation (Table 1); distal of these are QTL with genome-wide significance
and strong effects on proportion of slow twitch fibres and their capillarisation (ProSTO
and CapSTO) (Table 2). Line-cross analysis detected significant QTL for lean meat
content, FOM, and eye muscle area, MAML, as well as for diameter of FTG fibres in
the intermediate region of SSC4 (Table 1). According to the half-sib model the more
distal region of SSC4 bore QTL for the number and size of giant fibres (Table 2).
Chromosomes 5, 6 and 7 did not show any or just suggestive QTL for microstructural
muscle properties. Loci controlling lean meat content segregated on SSC6 - proximal
according to the half-sib model and distal according to the line-cross model (Tables 1,
2). For SSC8 using the half-sib model a significant QTL for proportion of fast twitch
oxidative fibres (ProFTO) was detected (Table 2). While on SSC9 and 10 there were no
significant QTL for muscle fibre traits SSC11 had a significant QTL for fibre number
per mm² (Fib/mm²) as detected by half-sib analysis (Table 2). According to the half-
sib analysis loci affecting proportion and size of giant fibres (ProGiF, DiaGiF) segregated
on SSC12 (Table 2). No QTL reaching genome-wide significance mapped to SSC13.
122
The distal part of SSC14 exhibited a significant QTL for fibre diameter (Diaw). SSC15
showed significant QTL for proportion and diameter of giant fibres (ProGiF, DiaGiF)
and for ph24ML as revealed by half-sib analysis (Table 2). More distal a significant
QTL for meat colour was found in the line cross model analysis (Table 1). The
telomeric regions of SSC16 and SSC17 contained significant QTL for meat quality
(C1ML, C24ML) and carcass traits (FOM) under the half-sib model (Table 2). SSC 18
carried no QTL reaching the genome-wide significance for the traits analysed.
In contrast to many production traits for which various QTL regions have been
identified, information about QTL for muscle fibre traits is scare. Recently, NII and
coworkers (2005) reported on QTL for muscle fibre traits and meat quality in a
Japanese Wild Boar x Large White intercross on SSC 1, 2, 6, 14, and X.
Discrimination of type I, IIA, or IIB fibres was based on myosine ATP method after
alkaline preincubation expected to reveal phenotypes corresponding to ours. NII and
co-worker (2005) found genome-wide significant QTL for type I fibres on SSC1 and
14 in vicinity of the regions where we found chromosome-wide significant QTL for
slow twitch and red fibres, respectively. Moreover, QTL for type IIA, IIB and
intermediate, white, and fast twitch fibres on the intermediate region of SSC2 and
proximal on SSC14 have been found by us and NII et al. (2005). QTL for proportion
of type I fibres were detected on SSC8.
With regard to the final target to develop marker assisted selection tools those genomic
regions are of interest that exhibit both (1) QTL for carcass and meat quality traits,
which are used to select in breeding routine, and (2) QTL for muscle fibre number and
distribution traits, which are more strictly genetically controlled but affect growth,
body composition and meat quality to a large extent.
Regions with either genome-wide significant QTL for fibre type traits or genome-wide
significant QTL for meat quality or both are on SSC1 (pH24ML and DiaAnF), on SSC2
(C1ML and Diamean and DiaFTG), on SSC3 (MCopto and ProGif, Proim, ProFTO), on SSC5
(MCopto and Diared), on SSC13 (MCopto and Fib/mm²), on SSC14 (C24ML and Diaw), on
SSC15 (pH24ML and ProGiF), and on SSC16 (C1ML and Prored). With regard to the
relationship between meat quality, lean meat content and fibre type distribution traits
p-arm of SSC2 and proximal region of q-arm of SSC4 are of interest. On SSC2 and
SSC4 we found genome-wide significant QTL for FOM and area of M longissimus on
the one hand and fibre diameter (DiaFTG, Diamean) on the other hand that might again
indicate a common genetic background. On SSC7 and 9 we only found QTL for
muscle fibre type distribution traits. SSC6 showed genome-wide significant QTL for
FOM and MAML and for meat quality traits, but no QTL for muscle fibre traits. NII et
al. (2005) found QTL for meat colour and hematin content on SSC6 close to QTL for
type II fibres.
In summary, least square regression interval mapping revealed five significant and 42
suggestive QTL for traits related to muscle fibre composition under the line-cross
model as well as eight significant and 40 suggestive QTL under the half-sib model.
For traits related to body composition and biophysical parameters of meat quality five
and twelve significant plus nine and 22 suggestive QTL were found under the line-
cross and half-sib model, respectively. Microstructural properties of pig muscle and
meat quality are governed by genetic variation at many loci distributed throughout the
123
genome. Estimates of the degree of phenotypic variation explained by the QTL range
between some 2% for suggestive QTL for meat quality and carcass traits and 24% for
a QTL for proportion of giant fibres on SSC12.
In general, QTL for microstructural properties explained a larger proportion of
variance than did QTL for meat quality and body composition. This indicates higher
power of the analyses for the fibre type traits. Muscle fibre traits have moderate to
high heritabilities (h²=0.20 – 0.59) compared to meat quality traits (h²=0.15 – 0.32)
(LARZUL et al., 1997). Thus large effects of QTL for fibre traits might reflect the
larger impact of genetic variation on these traits than on meat quality. Thus, by looking
at the microstructural properties of muscle rather than measuring complex meat quality
traits one gets closer to the genes` effects. Moreover, coefficients of variation for fibre
size were close to 15%, for proportion of STO and FTO fibres exceeded 30%, while it
was up to 3% for meat pH, 10 and 15% for meat colour and conductivity. Thus, the
large effects of QTL for fibre traits may also be due to higher variation in fibre type
traits than meat quality traits in the DUMI population. Higher phenotypic variation of
these traits facilitates the identification of QTL. The application of linkage analyses,
which are a priori hypothesis-free, on traits of high heritability, increases the power of
the approach. Disentangling complex traits in their constituent phenotypes might
facilitate the identification of QTL and the elucidation of the pleiotropic nature of QTL
effects.
We found more QTL using the half-sib model than the line-cross model indicating that
the founders of the DUMI population are not fixed for different alleles at many of the
QTL. QTL analysis under both, the line-cross and half-sib model, allows detecting
QTL that are fixed or segregating among the founder populations and thus provide
comprehensive insight into the genetic variation of the traits under investigation. The
line-cross model assuming that different QTL alleles are fixed in founder populations
is very powerful when this assumption corresponds to the true state of nature of the
QTL and it is quite robust to limited deviations from this ideal situation. The half-sib
model is more general with no assumption about the number and frequency of QTL
alleles in founder populations and probably more realistic for many QTL.
Perspectives: MYHC isotype transcript abundance as a new phenotype

The map-based data provided here will facilitate the identification of genes affecting
muscle fibre traits and/or meat quality traits especially when combined and
complemented by function-driven genomic approaches, including QTL-genotype-
dependent and QTL-region-specific expression patterns, trait-associated expression
profiles, as well as detection of eQTL, i.e. loci controlling the transcription level of
target genes. We previously analysed muscle expression profiles depending on muscle
size, breed and/or muscle developmental stage (PONSUKSILI et al., 2000;
WIMMERS et al., 2005). By mapping differentially expressed genes we combined
functional and positional evidence for the candidacy of these loci. Recently, by
microarray analysis, we identified genes that are differentially expressed among
discordant sibpairs of a Duroc and Pietrain based F2 crossbreeding population. The
discordant sibpairs differed significantly in the trait eye muscle area, but not in body
weight. We aimed to address the three-way-relationship between muscle area, muscle
fibre type traits as determined by histochemical methods and the abundance of
transcripts of the muscle fibre type specific myosine heavy chain isoforms. Animals
124
with large muscle areas had significant higher numbers of typeIIb fibres and a
significant lower number of typeIIa fibres; also typeI and typeIIx fibres tended to be
less frequent in large muscle. Interestingly, simultaneous muscle fibre typing by
ATPase reaction and MYHC isoform transcript quantification by real time PCR
revealed significant correlations ranging between .5 and .7 (typeI -MYHCI: r=0.71
(p=0.004); typeIIb&x - MYHCIIb and IIx: r= 0.52 (p=0.05); typeIIa -MYHCIIa: r=
0.67 (p=0.008). Taking into account (1) existing difficulties to standardised
conventional myofibre typing, (2) the fact that the conventional histochemical fibre
typing in types I, IIA and IIB is not well adapted for pig skeletal muscles where four
fibre types are present based on MYHC polymorphism, i.e. types I, IIa, IIx and IIb
(LEFAUCHEUR, 2006) and (3) considerable variation of mRNA expression of each
MYHC isoform among muscles even within the same animal, that is likely to reflect
differences in the physiological state of individual muscles (DA COSTA et al., 2002)
we propose the abundance of transcripts of MYHC isoforms as a new more precise
phenotype. This new phenotype is probably more suitable to unravel the genetic
background of variation in traits related to muscle and meat properties than
technological meat quality parameters and conventional fibre typing in further
attempts to display trait-associated expression profiles and to detect eQTL.
References
CHURCHILL, G.A.; DOERGE, R.W.:
Empirical threshold values for quantitative trait mapping. Genetics 138 (1994), 963-971
DA COSTA, N.; BLACKLEY, R.; ALZUHERRI, H.; CHANG, K.C.:
Quantifying the temporospatial expression of postnatal porcine skeletal myosin heavy chain genes. J.
Histochem. Cytochem. 50 (2002), 353-64
FIEDLER, I.; DIETL, G.; REHFELDT, C.; WEGNER, J.; ENDER, K.:
Muscle fibre traits as additional selection criteria for muscle growth and meat quality in pigs – results of
a simulated selection. J. Anim. Breed. Genet. 121 (2004), 331-344
GREEN, P.; FALLS, K.; CROOKS, S.:
Documentation for CRI-MAP, Version 2.4 (1990)
HALEY, C.S.; KNOTT, S.A.:
A simple regression method for mapping quantitative traits loci in line crosses using flanking markers.
Heredity 69 (1992), 315-324
HARDGE, T.; KOEPKE, K.; REISSMANN, M.; WIMMERS, K.:
Maternal influences on litter size and growth in reciprocal crossed Miniature Pigs and Durocs. Arch.
Tierz., Dummerstorf 42 (1999), 83-92
HU, Z.L.; DRACHEVA, S.; JANG, W.; MAGLOTT, D.; BASTIAANSEN, J.; ROTHSCHILD, M.F.; REECY,
J.M.:
A QTL resource and comparison tool for pigs: PigQTLDB. Mamm. Genome 16 (2005), 792-800.
JOSZA, L.; LEHTO, M.U.; JARVINEN, M.; KVIST, M.; REFFY, A.; KANNUS, P.:
A comparative-study of methods for demonstration and quantification of capillaries in skeletal-muscle.
Acta Histochem. 94 (1993), 89-96
LANDER, E.S.; BOTSTEIN, D.:
Mapping mendelian factors underlying quantitative traits using RFLP linkage maps. Genetics 121
(1989), 185-99
LARZUL, C.; LEFAUCHEUR, L.; ECOLAN, P.; GOGUE, J.; TALMANT, A.; SELLIER, P.; LE ROY, P.;
MONIN, G.:
Phenotypic and genetic parameters for longissimus muscle fibre characteristics in relation to growth,
carcass, and meat quality traits in large white pigs. J. Anim. Sci. 75 (1997), 3126-3137
LEFAUCHEUR, L.:
Myofibre typing and its relationships to growth performance and meat quality. Arch. Tierz.,
Dummerstorf 49 (2006) Special Issue, 4-17
LENGERKEN, G. v.; MAAK, S.; WICKE, M.; FIEDLER, I.; ENDER, K.:
Suitability of structural and functional traits of skeletal muscle for the genetic improvement of meat
quality in pigs. Arch. Tierz., Dummerstorf 37 (1994), 133-143
125
NII, M.; HAYASHI, T.; MIKAWA, S.; TANI, F.; NIKI, A.; MORI, N.; UCHIDA, Y.; FUJISHIMA-KANAYA,
N.; KOMATSU, M.; AWATA, T.:
Quantitative trait loci mapping for meat quality and muscle fiber traits in a Japanese wild boar x Large
White intercross. J. Anim. Sci. 83 (2005), 308-315
PETER, J.B.; BARNARD, R.J.; EDGERTON, V.R.; GILLESPIE, C.A.; STEMPEL, K.E.:
Metabolic profiles of three fiber types of skeletal muscle in guinea pigs and rabbits. Biochemistry 11
(1972), 2627-2633
PigQTLdb:
http://www. animalgenome.org/QTLdb/
PONSUKSILI, S.; WIMMERS, K.; SCHMOLL, F.; ROBIC, A.; SCHELLANDER, K.:
Porcine ESTs detected by differential display representing possible candidates for carcass traits. J.
Anim. Breed. Genet. 117 (2000), 25-35
QTL express:
http://qtl.cap.ed.ac.uk
SEATON, G.; HALEY, C.S.; KNOTT, S.A.; KEARSEY, M.; VISSCHER, P.M.:
QTL Express: mapping quantitative trait loci in simple and complex pedigrees. Bioinformatics 18
(2002), 339-340
WIMMERS, K.; MURANI, E.; SCHELLANDER, K.; PONSUKSILI, S.:
Combining QTL- and expression-analysis: identification of functional positional candidate genes for
meat quality and carcass traits. Arch. Tierz., Dummerstorf 48 (2005) Special Issue, 23-31
WIMMERS, K.; FIEDLER, I.; HARDGE, T.; MURANI, E.; SCHELLANDER, K.; PONSUKSILI, S.:
QTL for microstructural and biophysical muscle properties and body composition in pigs. BMC
Genetics (2006), open-access
ZDS, Zentralverband der Deutschen Schweineproduktion e. V:
Richtlinie für die Stationsprüfung auf Mastleistung, Schlachtkörperwert und Fleischbeschaffenheit beim
Schwein. 10. 12. 2003, Bonn, Germany.
Author´s addresses
PD Dr. KLAUS WIMMERS, Dr. EDUARD MURANI, PD Dr. SIRILUCK PONSUKSILI*
Research Institute for Biology of Farm Animals
Wilhelm-Stahl-Allee 2
18196 Dummerstorf, Germany
Prof Dr. KARL SCHELLANDER, NGUYEN TRONG NGU

Institute of Animal Breeding and Genetics
University of Bonn
Endenicher Allee 15
53115 Bonn, Germany
*Corresponding author
Journal of Animal Breeding and Genetics - Volume 124, Issue Supplement s1 - November 2007 - Wiley Online Library
Journal of Animal Breeding and Genetics

© Blackwell Verlag GmbH
November 2007
Volume 124, Issue Supplement s1
Pages 1–58
1. Drip Loss and Water Holding Capacity of Porcine Meat
1. Top of page
3. Review Articles
1. Preface
You have free access to this content

Drip loss and water holding capacity of porcine meat (page 1) (/doi/10.1111/j.1439-0388.2007.00680.x
/abstract)
Karl Schellander
Article first published online: 5 NOV 2007 | DOI: 10.1111/j.1439-0388.2007.00680.x
Abstract (/doi/10.1111/j.1439-0388.2007.00680.x/abstract)
Full Article (HTML) (/doi/10.1111/j.1439-0388.2007.00680.x/full)
PDF(24K) (/doi/10.1111/j.1439-0388.2007.00680.x/pdf)
Request Permissions
2. Review Articles
1. Top of page
3. Review Articles
1. Genetic aspects concerning drip loss and water-holding capacity of porcine meat (pages 2–11)
(/doi/10.1111/j.1439-0388.2007.00681.x/abstract)
D. G. J. Jennen, A. D. Brings, G. Liu, H. Jüngst, E. Tholen, E. Jonas, D. Tesfaye, K. Schellander and

1 of 3
Journal of Animal Breeding and Genetics - Volume 124, Issue Supplement s1 - November 2007 - Wiley Online Library
C. Phatsara
PDF(204K) (/doi/10.1111/j.1439-0388.2007.00681.x/pdf)
References (/doi/10.1111/j.1439-0388.2007.00681.x/references)
Request Permissions
2. Drip loss in pork: influencing factors and relation to further meat quality traits (pages 12–18)
(/doi/10.1111/j.1439-0388.2007.00682.x/abstract)
K. Fischer
PDF(220K) (/doi/10.1111/j.1439-0388.2007.00682.x/pdf)
Request Permissions
3. New frontiers in understanding drip loss in pork: recent insights on the role of postmortem muscle
biochemistry (pages 19–26) (/doi/10.1111/j.1439-0388.2007.00683.x/abstract)
E. Huff-Lonergan and S. M. Lonergan
PDF(80K) (/doi/10.1111/j.1439-0388.2007.00683.x/pdf)
Request Permissions
4. Structural and functional genomics to elucidate the genetic background of microstructural and
biophysical muscle properties in the pig (pages 27–34) (/doi/10.1111/j.1439-0388.2007.00684.x
/abstract)
K. Wimmers, E. Murani, N. T. Ngu, K. Schellander and S. Ponsuksili
PDF(95K) (/doi/10.1111/j.1439-0388.2007.00684.x/pdf)
Request Permissions
5. NMR and the water-holding issue of pork (pages 35–42) (/doi/10.1111/j.1439-0388.2007.00685.x
/abstract)
H. C. Bertram and H. J. Andersen
PDF(102K) (/doi/10.1111/j.1439-0388.2007.00685.x/pdf)
2 of 3
J. Anim. Breed. Genet. ISSN 0931-2668
REVIEW ARTICLE
Structural and functional genomics to elucidate the genetic

background of microstructural and biophysical muscle
properties in the pig
K. Wimmers1, E. Murani1, N. T. Ngu2, K. Schellander2 & S. Ponsuksili3
1 Research Institute for the Biology of Farm Animals (FBN), Research Unit Molecular Biology, Dummerstorf, Germany
2 Institute of Animal Science, Animal Breeding and Husbandry Group, University of Bonn, Bonn, Germany
3 Research Institute for the Biology of Farm Animals (FBN), Research Group Functional Genomics, Dummerstorf, Germany
Keywords Summary
carcass traits; muscle fibre types; myogenesis;
myosin heavy chain; quantitative trait loci; Linkage analyses enable identifying genomic regions that exhibit quanti-
transcriptome tative trait loci (QTL) without prior hypothesis on the physiology of a
trait. Function-oriented expression analyses are a complementary
Correspondence approach to derive hypothesis on the genetic background of phenotypic
Klaus Wimmers, Research Institute for the
variation. Muscle fibre types and size affect body composition and meat
Biology of Farm Animals (FBN), Research Unit
Molecular Biology, Wilhelm-Stahl-Allee 2,
quality traits. The number and proportion of muscle fibres are to a large
18196 Dummerstorf, Germany. extent determined during the prenatal development. Consequently, QTL
Tel: +49 38208 68700; Fax: +49 38208 68702 for muscle fibre, meat quality and carcass traits were detected in a por-
E-mail: wimmers@fbn-dummerstorf.de cine experimental population based on Duroc and Berlin Miniature Pig.
Regions with either significant QTL for muscle fibre traits or significant
Conflicts of Interest: QTL for meat quality and muscularity or both were detected on SSC1,
All authors declare no conflicts of interest
2, 3, 4, 5, 13, 14, 15 and 16. Here, effects on the complex traits of mus-
cularity and meat quality might be the result of genetic variation pri-
marily affecting fibre type distribution traits. To complement the QTL
study expression profiling of prenatal muscle tissue of Duroc and Pie-
train was conducted that revealed a list of functional candidate genes
for meat quality and carcass traits of various physiological networks.
Assignments of these genes to QTL regions highlight them as positional
functional candidates. Exemplarily, five genes were analysed further
and shown to be associated with meat quality and carcass traits. Further,
the relative MYH isotype transcript abundance was found to be associ-
ated with muscularity. Relative MYH isotype transcript abundance is
proposed as a new phenotype to unravel the genetic background of vari-
ation in traits related to muscle and meat properties.
tion. Skeletal muscle becomes meat after slaughter.

Introduction
It consists of three different types of muscle fibres
Growth in general is controlled by many endo- each characterized by certain biophysical, biochemi-
genous and exogenous factors, and characterized cal and metabolic properties. The number, size and
mainly by the deposition of adipose and connective proportion of different muscle fibres affect growth
tissue, bone and muscle. Muscle tissue accounts for performance and are endogenous factors on post-
most of the body mass and daily energy consump- mortal meat quality traits (von Lengerken et al.
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Verlag, Berlin • J. Anim. Breed. Genet. 124 (Suppl. 1) (2007) 27–34 27
Genetic background of microstructural and biophysical muscle properties in the pig K. Wimmers et al.
1994). The number and proportion of muscle fibres In all 308 F2 animals were examined for micro-
are to a large extent determined during the prenatal structural muscle traits. The quantitative microscopic
development. determination of fibre type proportion (Pro) and
Consequently, to identify genes controlling meat fibre size (Dia) and capillar density (Cap) of the
quality and carcass traits we are aiming to combine respective muscle fibres as well as the total number
two approaches: (i) the quantitative trait loci (QTL) of fibres and fibres per mm2 at the section of M. lon-
analysis for traits related to microstructural and bio- gissimus dorsi (ML) was carried out on 400 fibre
physical muscle properties, and (ii) expression profil- cross-sections per animal. To differentiate the three
ing of muscle tissue depending on prenatal main fibre types ‘red’, ‘intermediate’, ‘white’ and
developmental stage, breed and phenotype. ‘slow twitch oxidative (STO)’, ‘fast twitch oxidative
Genome scans are the most general approaches to (FTO)’, ‘fast twitch glycolytic (FTG)’, respectively,
identify genomic regions exhibiting QTL without the samples were stained either by the NADH tetra-
prior hypothesis on the physiology and genetic con- zolium reductase reaction (NADH-TR) alone or by
trol of a trait. However, dissecting complex traits in the combined NADH-TR/ATPase reaction. Meat
properties that are likely to underlie direct genetic quality traits taken into account were obtained from
control can facilitate the identification of QTL. all F2 animals and included pH values and conduc-
Therefore, focus was on muscle fibre traits that also tivity measured 45 min and 24 h postmortem in ML
affect body composition traits and functional proper- at 13th/14th rib (pH1ML, pH24ML, C1ML, C24ML) and
ties of the musculature and thus meat quality. In the meat colour (MCOpto). For carcass composition lean
livestock field several attempts to the use of gene meat content according to regression [Fat-O-Meater
expression profiling techniques have been made to (FOM)] and loin eye area (MAML) were measured.
elucidate tissue-specific differential gene expression Altogether the animals of the DUMI population
in relation to particulate developmental stages and/ were genotyped at 88 loci covering the porcine auto-
or exhibition of certain phenotypes. The results will somes with mean interval size of 30.7 cM. The set of
significantly improve and enlarge the list of candi- markers includes 72 microsatellites and 16 biallelic
date genes for economic important traits including markers. QTL analysis was performed using interval
growth, carcass composition and meat quality for mapping by regression under the line-cross and half-
which muscle is the major target tissue. Combining sib model (QTL-Express; Seaton et al. 2002). Pheno-
and complementing map-based QTL data and typic data were adjusted for systematic effects by
function-driven genomic approaches (including QTL- fixed models taking into account effects of sire, dam,
genotype-dependent and QTL-region-specific expres- sex, parity and slaughter weight and slaughter date,
sion patterns, trait-associated expression profiles, as as appropriate. Significance thresholds at the 5 and
well as detection of eQTL, i.e. loci controlling the 1% level were determined empirically by permuta-
transcription level of target genes) will enable to tion for individual chromosomes (Churchill and
qualify the lists of candidate genes based on position, Doerge 1994). Chromosome-wide 1 and 5% signifi-
functional and genetic information. cance thresholds became genome-wide significance
thresholds after Bonferroni correction for 18 auto-
somes of the haploid porcine genome.
Quantitative trait loci analysis
Expression analyses
A genome scan was conducted in a three-generation
porcine F2 population [Duroc · Berlin Miniature Pig For expression profiling during myogenesis either
(DUMI) population] based on reciprocal crossbreed- embryos or foetal ML tissue were collected at seven
ing of DUMI breeds (Hardge et al. 1999). Fifty-four key time points (day 14, 21, 35, 49, 63, 77 and 91)
full-sib families comprising 905 F2 individuals born of the porcine myogenesis of the two breeds, Duroc
from 43 sows and seven boars were kept and perfor- and Pietrain (DUPI). Total RNA was isolated and for
mance tested on the research farm of the Institute of differential display (DD) analysis 14 RNA pools were
Animal Science in Berlin Dahlem, Humboldt Univer- set up, one for each breed (2) per stage (7). The
sity of Berlin, and at the research farm Frankenforst pools were prepared by mixing equal amounts of
of the Institute of Animal Science, University of RNA from 10 individuals of the particular breed, one
Bonn. Performance testing and trait recording was male and one female sib from five litters. DD-PCR
carried out according to the German performance was performed in duplicate according to the protocol
test directives (ZDS 2003). of Ponsuksili et al. (2001). DD-PCR products were
ª 2007 The Authors
28 Journal compilation ª 2007 Blackwell Verlag, Berlin • J. Anim. Breed. Genet. 124 (Suppl. 1) (2007) 27–34
K. Wimmers et al. Genetic background of microstructural and biophysical muscle properties in the pig
separated by electrophoresis on 5% denaturing PAA train and Duroc and two crossbreeds of DUPI and
gels for 4.5 h, visualized by silver staining. Selected DUMI were analysed.
fragments with breed or stage-specific appearance
were excised, re-amplified, cloned and sequenced.
Loci that were either temporal regulated during
myogenesis or differentially expressed between the Quantitative trait loci analysis
two breeds were screened for polymorphism by com- Least-squares regression interval mapping revealed 5
parative sequencing of a set of DNAs of animals of significant and 42 suggestive QTL for traits related to
the breeds Duroc, Pietrain and German Landrace. muscle fibre composition under the line-cross model
Subsequently, PCR-RFLPs, PCR-SSCPs or melting as well as 8 significant and 40 suggestive QTL under
curve analysis protocols were established for high the half-sib model. For traits related to body compo-
throughput genotyping of the polymorphisms sition and biophysical parameters of meat quality 5
(Murani et al. 2005). Association of five candidate and 12 significant plus 9 and 22 suggestive QTL
genes with meat quality and carcass traits was evalu- were found under the line-cross and half-sib model,
ated by analysing genotypic and phenotypic data of respectively. Results of the QTL analyses are com-
1700 performance tested fattening pigs of commer- piled in Tables 1 and 2, in which all QTL exceeding
cial purebred and crossbred herds, Duroc (Du, n ¼ the 5% genome-wide significance threshold are
125), Pietrain (Pi, n ¼ 259), Pietrain · (Land- included. Suggestive QTL are detailed elsewhere
race · Large White) (PiF1, n ¼ 481) and (Wimmers et al. 2006a). QTL for meat quality traits
Duroc · (Landrace · Large White) (DuF1, n ¼ 626) with genome-wide significance were detected on
as well as an experimental F2 population based on a SSC3, 5, 13, 15, 16 and 17, and QTL for traits related
reciprocal cross of DUPI (n ¼ 335) using ASReml to lean meat content on SSC2, 4, 6 and 16. For mus-
and taking into account pedigree data as well as the cle fibre traits we found QTL on SSC1, 2, 4, 8, 11,
fixed effects of gender, day of slaughter, genotype at 12, 14 and 15. Microstructural properties of pig mus-
a candidate gene, litter, line, and the random effect cle and meat quality are governed by genetic varia-
of animal and the covariable of slaughter weight. tion at many loci distributed throughout the
Analyses were done separately for Pietrain, Pie- genome. Estimates of the degree of phenotypic vari-
train · F1, Duroc · F1 and Duroc · Pietrain. Relative ation explained by the QTL range between some 2%
abundance of MYH transcripts was measured by for suggestive QTL for meat quality and carcass traits
real-time PCR of animals showing high and low and 24% for a QTL for proportion of giant fibres on
muscularity within breeds and among pig breeds of SSC12. QTL analysis under both the line-cross and
discordant muscle growth and meat quality. Accord- half-sib model allows detecting QTL in case of fixa-
ingly, animals of three pig breeds of Mongcai, Pie- tion or segregation of the QTL alleles among the
Table 1 Evidence for quantitative trait loci
(QTL) for traits related to microstructural Position Additive Dominance
muscle properties, to meat quality and to Trait SSC (cM) F-value % Variance1 effect2 SE effect2 SE
carcass composition obtained by F2 analy- Muscle fibre traits
sis. Estimated significance levels (F-value), DiaAnF 1 3 8.4* 11.8 2.64 1.39 )7.04 1.80
position, % of F2 variance explained by each DiaFTG 2 63 9.4* 17.8 )7.40 1.90 )10.07 5.91
QTL and gene effects Diamean 2 66 9.5* 17.9 )7.04 1.78 )8.85 5.58
DiaFTG 4 96 8.6* 16.3 0.57 2.14 8.82 2.53
Diaw 14 102 7.9* 12.7 1.60 1.96 )15.65 4.09
Meat and carcass traits
MCopto 3 0 13.4** 3.6 )1.74 0.35 0.57 0.51
FOM 4 80 19.0** 5.1 3.21 0.53 0.06 0.89
MAML 4 78 13.8** 3.7 1.27 0.25 0.47 0.42
MAML 6 175 11.4* 3.0 )0.99 0.23 0.52 0.35
MCopto 15 117 8.0* 2.2 )1.27 0.37 )0.89 0.50
*Significant at the 5% genome-wide level.

**Significant at the 1% genome-wide level.
1
The fraction of phenotypic variance in the F2 explained by a QTL; calculated as the proportion
of residual variance of the statistical models with and without the QTL effect.
2
Positive values of additive genetic and dominance effects imply higher trait values forced by
the Duroc allele.
ª 2007 The Authors

Table 2 Evidence for quantitative trait loci (QTL) for traits related to type traits than meat quality traits in the DUMI pop-
microstructural muscle properties, to meat quality and to carcass ulation. Higher phenotypic variation of these traits
composition obtained by half-sib analysis. Estimated significance levels
facilitates the identification of QTL. The application
(F-value), position, % of F2 variance explained by each QTL and gene
effects
of linkage analyses, which are a priori hypothesis-
free, on traits of high heritability, increases the
Trait SSC Position (cM) F-value % Variance1 power of the approach. Disentangling complex traits
Muscle fibre traits
in their constituent phenotypes might facilitate the
ProFTO 2 100 5.8* 18.2 identification of QTL and the elucidation of the
CapSTO 2 123 5.6* 17.5 pleiotropic nature of QTL effects.
ProGiF 4 132 6.2* 8.8 With regard to the final target to develop marker-
ProFTO 8 55 6.0* 18.9 assisted selection tools those genomic regions are of
Fib/mm2 11 91 5.2* 5.9 interest that exhibit both (i) QTL for carcass and
ProGiF 12 38 10.3* 24.4
meat quality traits, which are used to select in
DiaGiF 12 56 7.4* 17.5
ProGiF 15 32 12.7** 15.5
breeding routine, and (ii) QTL for muscle fibre num-
Meat and carcass traits ber and distribution traits, which are more strictly
FOM 2 20 6.6** 3.8 genetically controlled but affect growth, body com-
MAML 2 20 10.0** 5.8 position and meat quality to a large extent.
MCOpto 3 0 7.6** 5.6 Regions with either genome-wide significant QTL
FOM 4 73 5.7** 3.3 for fibre type traits or genome-wide significant QTL
MCOpto 5 9 6.6* 4.9
for meat quality or both are on SSC1 (pH24ML and
FOM 6 0 4.7* 2.7
MAML 6 32 5.4** 3.1
DiaAnF), on SSC2 (C1ML and Diamean, DiaFTG), on
MCOpto 13 43 8.0** 5.9 SSC3 (MCopto and ProGif, Proim, ProFTO), on SSC5
pH24ML 15 48 5.4* 3.1 (MCopto andDiared), on SSC13 (MCopto and Fib/
FOM 16 0 5.2** 3.0 mm2), on SSC14 (C24ML and Diaw), on SSC15
C1ML 16 20 4.5* 2.3 (pH24ML and ProGiF), and on SSC16 (C1ML and
C24ML 17 0 5.2* 3.0 Prored). With regard to the relationship between
*Significant at the 5% genome-wide level. meat quality, lean meat content and fibre type distri-
**Significant at the 1% genome-wide level. bution traits p-arm of SSC2 and proximal region of
1
The fraction of phenotypic variance in the F2 explained by a QTL; cal- q-arm of SSC4 are of interest. On SSC2 and SSC4
culated as the proportion of residual variance of the statistical models we found genome-wide significant QTL for FOM and
with and without the QTL effect. area of M. longissimus on the one hand and fibre
diameter (DiaFTG, Diamean) on the other hand that
founder populations and thus provide comprehen- might again indicate a common genetic background.
sive insight into the genetic variation of the traits On SSC7 and 9, we only found QTL for muscle fibre
under investigation. type distribution traits. SSC6 showed genome-wide
In general, QTL for microstructural properties significant QTL for FOM and MAML and for meat
explained a larger proportion of variance than did quality traits, but no QTL for muscle fibre traits. Nii
QTL for meat quality and body composition. This et al. (2005) found QTL for meat colour and haema-
indicates higher power of the analyses for the fibre tin content on SSC6 close to QTL for type II fibres.
type traits. Muscle fibre traits have moderate to high These genomic regions affecting complex traits of
heritabilities (h2 ¼ 0.20–0.59) compared with meat muscularity and meat quality as well as micro-
quality traits (h2 ¼ 0.15–0.32) (Larzul et al. 1997). structural properties might point to QTL that in
Thus large effects of QTL for fibre traits might reflect first instance affect muscle fibre traits and by this in
the larger impact of genetic variation on these traits second instance meat quality.
than on meat quality. Thus, by looking at the micro- Because of their economic importance, meat qual-
structural properties of muscle rather than measur- ity and body composition traits are recorded in rou-
ing complex meat quality traits one gets closer to the tine in pig breeding. Correspondingly, there are
genes‘ effects. Moreover, coefficients of variation for many efforts to identify QTL responsible for the vari-
fibre size were close to 15%, for proportion of STO ation in these traits. Genome scans were conducted
and FTO fibres exceeded 30%, while it was up to in many different experimental and commercial pop-
3% for meat pH, 10 and 15% for meat colour and ulations and revealed QTL effects on all 18 auto-
conductivity. Thus, the large effects of QTL for fibre somes and chromosome X (for review see the ‘Pig
traits may also be due to higher variation in fibre Quantitative Trait Loci database, PigQTLdb’). In
ª 2007 The Authors
contrast to many production traits for which various Table 3 DD-RT-PCR-fragments showing stage- and breed-specific
QTL regions have been identified, information about patterns of expression
QTL for muscle fibre traits is scare. Recently, Nii Prenatal stage (days
et al. (2005) reported on QTL for muscle fibre traits Group by postcomceptionem) Breed
and meat quality in a Japanese Wild Boar · Large stage No. of specificity: No. of
specificity 14 21 35 49 63 77 91 bands appeared bands
White intercross on SSC 1, 2, 6, 14 and X. Discrimi-
nation of type I, IIA or IIB fibres was based on myo- 1 1 0 0 0 0 0 0 85 Only in Pi 38
sine ATP method after alkaline preincubation 2 0 1 1 1 1 1 1 51 Only in Du 30
expected to reveal phenotypes corresponding to 3 0 1 0 0 0 0 0 26 Stronger in Pi 38
ours. Nii et al. (2005) found genome-wide significant 4 1 1 0 0 0 0 0 19 Stronger in Du 12
5 0 1 <1 1 1 1 1 20 Earlier in Pi 11
QTL for type I fibres on SSC1 and 14 in vicinity of
6 0 0 1 1 1 1 1 38 Earlier in Du 5
the regions where we found chromosome-wide sig- 7 0 0 0 1 1 1 1 7 Longer in Pi 4
nificant QTL for slow twitch and red fibres, respec- 8 0 0 0 0 1 1 1 9 Longer in Du 6
tively. Moreover, QTL for type IIA, IIB and 9 1 >1 1 1 1 1 1 12
intermediate, white, and fast twitch fibres on the 10 0/1 <1 <1 <1 <1 <1 <1 6
intermediate region of SSC2 and proximal on SSC14 11 1 >1 >1 >1 >1 >1 >1 3
have been found by us and Nii et al. (2005). QTL for singleton – – – – – – – 25
proportion of type I fibres were detected on SSC8. 0 and 1 indicate absence and presence of bands at a particular devel-
opmental stage.
Expression analyses
interesting are groups 5 and 6 associated with the
An European initiative, PorDictor, aimed to detect time point of the generation of primary myotubes,
prenatal differential expressed muscle transcripts for group 7 related to time point of generation of sec-
the Pietrain and Duroc breeds at seven key develop- ondary fibres and group 8 comprised of fragments
mental stages (day 14, 21, 35, 49, 63, 77 and 91 to differentially regulated along with the cessation of
obtain genes affecting meat quality) (Wimmers et al. the primary fibre formation.
2002). In all 94 EST were sequenced, including 25 stage-
Several techniques for expression profiling, i.e. specific bands, which are identical regulated along
cDNA-microarrays, DD-RT-PCR, construction of myogenesis in both breeds, and 31 breed-specific
stage-specific muscle cDNA libraries and subtractive bands that are exclusively detected in one of the two
hybridization, were applied. The various techniques breeds. These loci were assorted according to their
of expression profiling revealed a total of 584 genes function. Thirty-eight sequences could not be unam-
that were temporally regulated during myogenesis biguously assigned to known target sequences and
and/or differentially expressed between the two were therefore not considered for further work.
breeds. DD analyses of the seven stages during por- A shortlist of genes was established based on (i)
cine myogenesis in the two breeds using a total of the consistency of the expression pattern and its
88 DD primer combinations revealed 445 fragments reproducibility, (ii) known function of the particular
varying either in their intensity or in their presence gene (categorized as structural, metabolic, transla-
between breeds and/or between stages. Among these tional, transcriptional, signalling, receptor/endocrine
are 144 fragments showing differences between factors, differentiation, proliferation and others), and
breeds and 301 fragments differentially displayed (iii) the map position, giving preference to those
between stages (Table 3) (Murani et al. 2003; Wim- genes located in QTL regions for meat quality traits.
mers et al. 2005). Furthermore, preference was given to breed-specific
The majority of the differences identified are asso- expressed genes, i.e. genes that are differentially reg-
ciated with early embryonic stages (groups 1–4, 9). ulated between the breeds, as these exhibit a higher
Among genes represented in these groups are per- likelihood to represent genetic variation useful in
haps those involved in the recruitment of mesoder- breeding. Genes of the shortlist were screened for
mal cells to myogenic lineage or those controlling polymorphisms by comparative sequencing of a sin-
proliferation of myoblasts. In addition, as whole day gle nucleotide polymorphism (SNP) discovery panel
14 and day 21 embryos were used for RNA isolation, of 20 unrelated animals covering five economically
the groups of fragments appearing or differentially relevant breeds (Duroc, Pietrain, German Landrace,
regulated at the early stages represent a rich source Large White and Dutch Yorkshire). Finally, five
of candidates for embryo survival. Functionally, very genes (bR10D1, HMGA2, NME1, PDGFRA, ERC1),
ª 2007 The Authors
whose candidacy for meat quality and carcass traits Table 5 Summary of associations significant at p < 0.1 per gene, per
arise from their prenatal differential expression in population, per trait
muscle development, were examined for association Population
in 1700 performance tested fattening pigs of com-
mercial purebred and crossbred herds of Duroc, Pie- Gene DuF1 Pi PiF1 DuPi
train, Pietrain · (Landrace · Large White), bR10D1 Dloss (0.09) MCOpto (0.03) Shforce (0.009) LEA (0.005)
Duroc · (Landrace · Large White) as well as an Tloss (0.09) Tloss (0.04) FOM (0.008)
experimental F2 population based on a reciprocal FOP (0.05) MCML (0.08)
cross of Duroc and Pietrain. Comparative sequencing Shforce (0.03) MCMB (0.09)
revealed polymorphic sites segregating across com- ERC1 MCJC (0.05) MCML (0.02) LEA (0.02) MCOpto (0.04)
LOIN1 (0.08) MCOpto (0.04) HAM (0.02)
mercial breeds (Table 4). Genetic mapping results
LOIN (0.03)
corresponded to pre-existing assignments to porcine HMGA2 pH24loin (0.04)
chromosomes or current human–porcine compara- FOP (0.08)
tive maps (Table 4). Association of the candidate pH24ham (0.07)
genes with meat quality and carcass traits was evalu- Shforce (0.01)
ated using ASReml and taking into account pedigree MCML (0.0004)
data. Analyses were carried out separately for Pie- MCMB (0.004)
NME1 Closs (0.08) Shforce (0.07)
train, Pietrain · F1, Duroc · F1 and Duroc · Pietrain
C24loin (0.001) LD (0.02)
using the models including the fixed effects of sex, LOIN (0.01)
day of slaughter, genotype at a candidate gene, litter, PDGFRA Shforce (0.07) LEA (0.07)
line and the random effect of animal, and the co- LEA2 (0.06)
variable of slaughter weight. As detailed in Table 5
p-values are given in parenthesis.
the genes showed effects (p £ 0.1) on meat quality 1
Deboned loin weight.
and carcass traits. In particular, HMGA2, NME and 2
HGP loin.
bR10D1 showed highly significant effects (p £ 0.01)
Table 4 List of candidate genes, their function, polymorphism and mapping position
Mapping
Accession no. and Human

details of Genotyping Porcine chromosomal assignment; chromosomal
Gene Function polymorphisms method* genetic mapping assignment
bR10D1 (Similar to Unknown (non-coding DQ631863; nt 162–164 SSLP SSC14 (S0007 20.5-bR10D1-40.8-SWC27) HSA10q21.1
cDNA FLJ26539 fis) regulatory RNA) CAT indel
HMGA2 (high mobility Regulation of DQ631866; nt 84 LC-MCA [SSC5] HSA12q15
group AT-hook 2) transcription, SNP C>A in 3’ UTR SSC5 (SW1482 41.3-HMGA2-8.6-S0005)
cell growth
NME1 (non-metastatic Negative regulation of DQ631864; nt 361–363 SSLP 12p11-p131 HSA17q21.3
cells 1, protein) cell proliferation, cell CAG indel in intron SSC12 (SW874-6.1-NME1-41.5-SW605)
growth and/or
maintenance
PDGFRA Cell proliferation DQ631865; nt 94 LC MCA SSC8p122 HSA4q11
(platelet-derived SNP C>T in 3’UTR SSC8 (PDGFRA-5.1-S0086)
growth factor
receptor, a
polypeptide)
ERC1 (ELKS/RAB6- Small DQ631862; nt 1018 LC MCA 5q113 HSA12p13
interacting/CAST GTPase-mediated SNP C>C in intron SSC5 (S0005-13.7-ELKS-21.8-IGF1)
family member 1) signal transduction
(Rab6-interacting
protein 2 (ELKS))
[ ] Comparative mapping. *SSLP, simple sequence length polymorphism; LC-MCA, LightCycler melting curve analysis.
1
Jorgensen et al. (1997); 2Johansson et al. (1992); 3Ponsuksili et al. (2001).
ª 2007 The Authors

on meat colour, pH and conductivity of loin 24 h abundance of MYH IIb accounted for more than
postmortem, thaw loss and shearforce; bR10D1, half of the MYH transcripts (65.4, 59.7, 61.3 and
exhibited highly significant effects on lean content 54.0%). Mongcai showed very low MYH IIb
(FOM), loin eye area and ham weight. However, (11.4%) but high type I, IIa and IIx RNA levels
none of the genes showed significant associations for (24.1, 28.5 and 35.9%). High consistency was seen
a particular trait across all populations. The study between fibre typing by ATPase staining and quan-
revealed statistically genetic evidence for the effect titative RT-PCR assays of MYH isoforms with signif-
of the functional candidate genes on traits related to icant correlations between corresponding pairs of
meat quality and muscle deposition. The polymor- type I, IIa and IIx/IIb (r ¼ 0.71, 0.67 and 0.52,
phisms detected are not likely causal but markers in respectively). All together, both methods were in
linkage equilibrium with causal genetic variation accordance and indicated that IIb fibres are the
were identified. Expression analysis of the transcrip- most prominent in pigs having large eye muscle
tome of Duroc and Pietrain prenatal pig muscle area.
revealed a number of genes that show stage- and/or Taking into account (i) existing difficulties to stan-
breed-specific expression in prenatal muscle and rep- dardized conventional myofibre typing, (ii) the fact
resent as such, functional candidate genes for meat that the conventional histochemical fibre typing in
quality and carcass traits (Murani et al. 2003; Te Pas types I, IIA and IIB is not well adapted for pig skele-
et al. 2005; Cagnazzo et al. 2006; Wimmers et al. tal muscles where four fibre types are present based
2006b). Here, we showed that for most of the genes on MYHC polymorphism, i.e. types I, IIa, IIx and IIb
knowledge on their physiological role support their (Lefaucheur 2006) and (iii) considerable variation of
putative involvement in genetic regulation of these mRNA expression of each MYHC isoform among
traits. Moreover, association studies provided statisti- muscles even within the same animal, that is likely
cal evidence for the effects of DNA variation at these to reflect differences in the physiological state of
loci on the traits of interest. The regional assign- individual muscles (Da Costa et al. 2002) we propose
ments to QTL regions also support the findings. the abundance of transcripts of MYHC isoforms as a
These genes are thus functional positional candidate new more precise phenotype. This new phenotype is
genes, for which linkage and association with the probably more suitable to unravel the genetic back-
traits analysed could be demonstrated. ground of variation in traits related to muscle and
To complement these results obtained by QTL meat properties than technological meat quality
analysis and expression profiling of prenatal muscle parameters and conventional fibre typing in further
tissue, we further aimed to address the three-way attempts to display trait-associated expression pro-
relationship between muscle area, muscle fibre type files and to detect eQTL.
traits as determined by histochemical methods and
the abundance of transcripts of the muscle fibre
Acknowledgements
type-specific myosine heavy chain isoforms at
slaughter within breeds and among pig breeds of Financial support was provided by the EU commis-
discordant muscle growth and meat quality (Wim- sion (FP5 EU-Project ‘PorDictor’, QLK5-CT-20000-
mers et al. 2006b). The animals used were from 01363; coordinator K. Wimmers), the DFG
three purebreds of Pietrain, Duroc and Mongcai, (Forschergruppe ‘DRIP’, FOR 753; coordinator K.
and two crossbreds of DUPI and DUMI. Real-time Schellander) and the BMBF (BMBF/IB-project VNB
PCR quantification of MYH isoform I, IIa, IIx and 02/B06).
IIb showed that the relative expression of MYH IIb
was higher in pigs with large muscle areas in both
References
DUPI (69.6% versus 53.0%) and DUMI (60.5%
versus 47.5%). In DUPI similar transcript levels of Cagnazzo M., te Pas M.F., Priem J., de Wit A.A., Pool
MYH I were found in both large and small muscle M.H., Davoli R., Russo V. (2006) Comparison of prenatal
(14.7 and 15.2%) whereas in DUMI animals these muscle tissue expression profiles of two pig breeds
figures were 18.4 and 33.5% (p < 0.05). The differing in muscle characteristics. J. Anim. Sci., 84, 1–10.
extreme groups in the DUPI tend to differ in MYH Churchill G.A., Doerge R.W. (1994) Empirical threshold
IIa and IIx transcripts too. The comparison among values for quantitative trait mapping. Genetics, 138,
breeds confirmed the trend of high MYH IIb tran- 963–971.
script abundance going together with high muscu- Da Costa N., Blackley R., Alzuherri H., Chang K.C.
(2002) Quantifying the temporospatial expression of
larity. In Pietrain, Duroc, DUPI and DUMI
ª 2007 The Authors
postnatal porcine skeletal myosin heavy chain genes. (2005) Quantitative trait loci mapping for meat quality
J. Histochem. Cytochem., 50, 353–364. and muscle fiber traits in a Japanese wild boar · Large
Hardge T., Koepke K., Reissmann M., Wimmers K. White intercross. J. Anim. Sci., 83, 308–315.
(1999) Maternal influences on litter size and growth in Ponsuksili S., Wimmers K., Schellander K. (2001) Appli-
reciprocal crossed Miniature Pigs and Durocs. Arch. cation of differential display RT-PCR to identify porcine
Tierz., 42, 83–92. liver ESTs. Gene, 280, 75–85.
Johansson M., Ellegren H., Marklund L., Gustaysson U., Seaton G., Haley C.S., Knott S.A., Kearsey M., Visscher
Ringmar-Cederberg E., Andersson K., Edfors-Lilja I. & P.M. (2002) QTL Express: mapping quantitative trait
Andersson I. (1992) The gene for dominant white color loci in simple and complex pedigrees. Bioinformatics, 18,
in the pig is closely linked to ALB and PDGRFRA on 339–340.
chromosome 8. Genomics 14, 965–969. Te Pas M.F., De Wit A.A., Priem J., Cagnazzo M., Davoli
Jorgensen C.B., Wintero A.K., Verb M. & Fredholm M. R., Russo V., Pool M.H. (2005) Transcriptome expres-
(1997) Mapping of twenty-two expressed sequence sion profiles in prenatal pigs in relation to myogenesis.
tags isolated from a porcine small intestine cDNA J. Muscle Res. Cell Motil., 26, 157–165.
library. Mammalian Genome 8, 423–424. Wimmers K., Te Pas M.F.W., Chang K.C., Davoli R.,
Larzul C., Lefaucheur L., Ecolan P., Gogue J., Talmant Merks J.W.M., Wörner R., Eping H., Murani E., Pon-
A., Sellier P., Le Roy P., Monin G (1997) Phenotypic suksili S., Schellander K., Priem J.M., Cagnazzo M.,
and genetic parameters for longissimus muscle fibre Fontanesi L., Lama B., Harlizius B., Henne H. (2002)
characteristics in relation to growth, carcass, and meat An European initiative towards identification of genes
quality traits in large white pigs. J. Anim. Sci., 75, controlling pork quality. Proceedings of the 7th WCGALP,
3126–3137. Montpellier, France. pp. 11–13.
Lefaucheur L. (2006) Myofibre typing and its relation- Wimmers K., Murani E., Schellander K., Ponsuksili S.
ships to growth performance and meat quality. Arch. (2005) Combining QTL- and expression-analysis: iden-
Tierz., 49, 4–17. tification of functional positional candidate genes for
von Lengerken G., Maak S., Wicke M., Fiedler I., Ender meat quality and carcass traits. Arch. Tierz., 48(Special
K. (1994) Suitability of structural and functional traits Issue), 23–31.
of skeletal muscle for the improvement of meat quality Wimmers K., Fiedler I., Hardge T., Murani E., Schelland-
in pigs. Arch. Tierz., 37, 133–143. er K., Ponsuksili S. (2006a) QTL for microstructural
Murani E., Muraniova M., Ponsuksili S., Schellarider K. and biophysical muscle properties and body composi-
& Wimmers K. (2003) Expressed Sequence Tags tion in pigs. BMC Genet. 7, 15.
Derived from Prenatal Development of Skeletal Muscle Wimmers K., Trong Ngu N., Murani E., Schellander K.,
in Pigs: A Source of Functional Candidate Genes for Ponsuksili S. (2006b) Linkage and expression analysis
Pork Quality. Book of Abstracts of the 54th Annual Meeting to elucidate the genetic background of muscle structure
of the European Association for Animal Production and meat quality in the pig. Arch. Tierz., 49(Special
(Ed. by V. van der Honing). No. 9, 247. Wegeningen Issue), 116–125.
Academic Publishers, Wageningen, the Netherlands. ZDS, Zentral Verband der Deutschen Schweineproduk-
Murani E., Ponsuksili S., Wimmers K. (2005) Simulta- tion e, V. (2004) Richtlinie fuer die Statlonspruefung
neous detection of SNPs in four porcine genes using auf Mastleistung, Schlachtkoerperwert und Fleisch-
hybridisation probes and the Light Cycler 2.0 instru- beschaffenheit beim Schwein. Bonn, Germany
ment. Biochemica, 2, 7–9. 01.01.2004. Available at: http://www.zds-bonn.de/
Nii M., Hayashi T., Mikawa S., Tani F., Niki A., Mori N., section_namtpubllkationen.html.
Uchida Y., Fujishima-Kanaya N., Komatsu M., Awata T.
ª 2007 The Authors

 
☺  
     
Vol. 34 No. 3 September 2007 ISSN 0125 - 2526
Opinion
Journal Impact Factors - How useful are they?
Robert Molloy 269-271
Contributed Paper
On Multivalent Harmonic Functions with Positive Real Part
Sibel Yalcin and Metin Öztürk 273-279
On Common Fixed Points of Two Non-self Nonexpansive Mappings in
Banach Spaces
Hukmi Kiziltunç, Murat Özdemir and Sezgin Akbulut 281-288
Strong Coupling Solutions of Superposed Harmonic Oscillator with a Generalized
Even Power Potential
Lalit K.Sharma, Phillip Monowe and Lessolle D. Sebitla 289-295
Study on Electrical Properties of Mn-doped 6h-BaTiO3 Ceramics Using
Impedance Spectroscopy
Neungreuthai Phoosit and Sukon Phanichphant 297-308
Intra- and Extracellular Microcystins Concentrations in Mae Kuang Udomtara
Reservoir, Chiang Mai, Thailand in 2004-2005
Inthira Seekhao, Yuwadee Peerapornpisal and Somporn Chantara 309-318
Review of Angkak Production (Monascus purpureus)
Patcharee Pattanagul, Renu Pinthong, Aphirak Phianmongkhol and Noppol Leksawasdi 318-328
Simple Purification of Indirubin from Indigofera tinctoria Linn. and Inhibitory
Effect on MCF-7 Human Breast Cancer Cells
Paitoon Aobchey, Supachok Sinchaikul, Suree Phutrakul and Shui-Tein Chen 329-337
Antitubercular and Antiplasmodial Prenylated Flavones from the Roots of
Artocarpus altilis
Surat Boonphong , Apiwat Baramee, Prasat Kittakoop and Pakawan Puangsombat 339-344
Growth Inhibition of Ralstonia solanacearum PT1J by Antagonistic Bacteria
Isolated from Soils in the Northern Part of Thailand
Narumol Thongwai and Jirapa Kunopakarn 345-354
Population Dynamics of Polynemus paradiseus from Estuarine Set Bag Net
Fishery of Bangladesh
Md. Rashed-Un-Nabi, Md. Azharul Hoque, Ridzwan A. Rahman, Saleem Mustafa and
Md. Abdul Kader 355-365
Microarray and RNA Interference: the Tools to Understand Gene Expression in
Preimplantation Embryo Development
Korakot Nganvongpanit, Ashraf El-Sayed, and Nguyen T. Ngu 367-388
Chiang Mai J. Sci. 2007; 34(3) 367
Chiang Mai J. Sci. 2007; 34(3) : 367-388

www.science.cmu.ac.th/journal-science/josci.html
Contributed Paper
Microarray and RNA Interference: the Tools to

Understand Gene Expression in Preimplantation
Embryo Development
Korakot Nganvongpanit*[a], Ashraf El-Sayed [b], and Nguyen T. Ngu [c]
[a] Department of Veterinary Preclinical Science, Faculty of Veterinary Medicine,
Chiang Mai 50100, Thailand.
[b] Department of Animal Production, Faculty of Agriculture, Cairo University, 12613 Giza, Egypt.
[c] Department of Agricultural Genetics and Breeding, College of Agriculture and Applied Biology,
Cantho University, Cantho, Vietnam.
*Author for correspondence; e-mail : korakot@chiangmai.ac.th
Received: 20 February 2007

Accepted: 19 June 2007.
ABSTRACT
Ultimately, one wishes to determine how genes and the proteins they encode function
in the intact embryo. Today, the exploration of gene function often begins with a DNA
microarray. This technique has revolutionized the way in which gene expression is now analyzed
by allowing the RNA products of thousands of genes to be monitored at once. Comprehensive
studies of gene expression and identifying gene interaction partners also provide an additional
layer of information useful for predicting gene function. Other approaches to discover a
gene’s function, include searching for homologous genes in other organisms and determining
when and where a gene is expressed. Searching for homologous genes and analyzing gene
expression patterns can provide clues about gene function, but they do not reveal what exactly
a gene does inside a cell. Genetic engineering provides a powerful solution to this problem
especially allows one to specifically produce such gene knockouts. Normally, only one of the
two DNA strands in is transcribed into RNA, and it is always the same strand for a given gene.
If a cloned gene is engineered so that the opposite DNA strand is transcribed instead, it will
produce antisense RNA molecules that have a sequence complementary to the normal RNA
transcripts. Such antisense RNA can often hybridize with the “sense” RNA and thereby inhibit
the synthesis of the corresponding protein. The purpose of this review is to focus on microarray
and RNA interference technology as tools to study gene expression in bovine embryos during
the preimplantation period.
Keywords: microarray, RNA interference, embryo, preimplantation, gene expression.
1. INTRODUCTION
In mammals, the meeting of the oocyte the following days, the embryo travels down
and sperm, and subsequent fertilization, takes from the oviduct to the uterus, and prepares
place in the ampulla of the oviduct. During for implantation. Preimplantation development
368 Chiang Mai J. Sci. 2007; 34(3)
can also occur in vitro. In all mammalian 2. DEVELOPMENTAL COMPETENCE

species studied, the preimplantation stage is Developmental competence is the ability
characterized by a relatively synchronous of the oocyte to produce normal, viable and
doubling of cell numbers until the 8-cell stage fertile offspring after fertilization. The
followed by asynchronous cell divisions after developmental competence of the oocyte is
compaction. At the 8- to 16-cell stage the acquired within the ovary during the stages
embryo enters the uterine environment, that precede ovulation or in case of in vitro
develops into a blastocyst, in which the first maturation (IVM), precede the isolation of
events of cellular differentiation are observed. the oocyte from its follicle [8]. Oocyte
At the blastocyst stage the embryo hatches competence is a difficult parameter to assess
from the surrounding zona pellucida and since embryonic development may fail due
subsequently implants in the uterus. to other reasons independent of oocyte quality.
What do we know about this mechanism Developmental competence is usually
that activate gene expression in mammals and expressed as the percentage of oocytes that
thereby turn on the developmental program? can develop to the blastocyst stage [9].
Historically, answers to this question have relied However, development to the blastocyst stage
heavily on studies done with fertilized-oocytes does not guarantee that the embryo will
from frogs and flies [1] In mammals, the develop to term. Other aspects used to
preimplantation embryo is defined by the evaluate developmental competence include
development of the zygote through several morphological evaluations, such as number
cleavage divisions, the activation of embryonic of blastomeres or the ratio between inner cells
transcription, and the morphogenetic events mass (ICM) and trophoectoderm (TE) cells
of compaction and cavitations resulting in the number and metabolic rates [10]. The size and
formation of a blastocyst. The period from the quality of the follicle of origin [11]
fertilization to implantation involves various influence the developmental capacity of
morphological, cellular, and biochemical bovine oocytes. It appears that oocyte requires
changes related to genomic activity [2]. Various an additional prematuration to express their
technologies, such as artificial insemination, competence [12]. If in vivo, this prematuration
embryo transfer, and cloning, have been occurs during preovulatory growth before the
applied to bovine reproduction [3,4]. Precise lutenising hormone (LH) surge, the ovarian
knowledge of the gene expression profile morphology, the number and size of the
during preimplantation is necessary to reduce follicles present in the ovary at the time of
early losses and to improve the reproductive aspiration, the composition of the follicular
efficiency of these new technologies [5-7]. fluid [6,11,13] may be critical for the oocyte
However, little is known about the complex to acquire developmental competence. The
molecular regulation of embryos and extra- developmental competence of the oocyte may
embryonic membrane development in cattle. also be lost during IVM since the number and
Thus, the genes to be profiled include new, quality of cumulus cells surrounding the
functional gene candidates. This suggests an oocyte are important in this process [9,14].
assessment method for key genes to help The absence of reliable markers for the
clarify the complex mechanisms in early identification of viable embryos for transfer
embryo development, including also at the early cleavage stage is likely to contribute
trophoblast cell proliferation and differentia- to the generally low implantation rates in in
tion. vitro fertilization (IVF) treatment [15]. Early
Chiang Mai J. Sci. 2007; 34(3) 369
cleavage is an indicator of increased protein that a cell expresses depends on the

developmental potential in embryos and may tissue, the developmental stage of the
be useful as a criterion in the selection of organism and the metabolic or physiologic
embryos for transfer. To improve the state of the cell. Gene expression is one of
selection of the embryo with the highest the most important principles underlying the
implantation potential, Van Montfoort et al., development and control of cells, systems and
2004 [16] suggested that selection for transfer organisms. Essentially gene expression is the
should not be based on cell number and process by which genetic information is
morphology on the day of transfer alone but converted into entities (mainly proteins) that
also on early cleavage status. contribute to the structure and operation of
a cell. The study of gene expression not only
2.1 Preimplantation Embryo encompasses the transcription of DNA to
Development RNA (transcription) by predominantly
The changes during mammalian messenger RNA (mRNA), but also transfer
preimplantation development include the RNA (tRNA) and ribosomal RNA (rRNA),
inside zona diameter of gamete from less than followed by protein synthesis (translation).
30 µm in the primordial follicle to more than Initiation of transcription is the most
120 µm in the bovine tertiary follicle [17] and important step in gene expression. Without
also the elongation of embryonic tissues, cell- the initiation of transcription, and the
cell contact between the mother and the subsequent transcription of the gene into
embryo, and placentation. The embryo begins mRNA by RNA polymerase, the phenotype
to form the placenta around day 20 of controlled by the gene will not be seen.
gestation in the bovine [18,19], while Therefore in depth studies have revealed about
embryonic trophoblast and endometrial cells what is needed for transcription to begin. In
tightly unite to form placentomes on day 30 conjunction with the activation of the
[20,21]. Embryonic cells undergo both embryonic genome, conventional one
proliferation and differentiation to form the dimensional of sodium dodecyl sulfate
fetus and placenta throughout early polyacrylamide gel electrophoresis (SDS-
embryogenesis. Reprogramming of the PAGE) has shown that major changes occur
genome may be completed and reset during in protein synthesis between day 1 (2-cell stage)
these steps, with embryonic development and 2 (4- to 8-cell stage) of preimplantation
progressing to temporal and spatial gene mouse embryo development [24,25]. The first
expression [22,23]. proteins synthesized in the late 2-cell embryos
coinciding with embryonic genome activation
2.2 Gene Expression in Preimplantation appear to be heat shock proteins (67,000-
Embryo 70,000 daltons) [26]. During the late 4- and
Gene expression (also protein expression 8-cell stage new transcription is necessary to
or simply expression) is the process by which prepare the embryo for compaction, while
a gene’s information is converted into the during the morula to blastocyst transition there
structures and functions of a cell. Gene is also a change in transcriptional activity in
expression is a multi-step process that begins line with the increase in the rate of protein
with transcription and translation and is synthesis [27]. These changes ultimately lead
followed by folding, post-translational to the appearance of tissue or stage specific
modification and targeting. The amount of polypeptides in the ICM and TE cells at the
370 Chiang Mai J. Sci. 2007; 34(3)
blastocyst stage [28,29]. variety of products which are activated in a

Early embryonic development of most stage and sequence specific manner in early
animals requires a specific complement or development [39,40]. During this time,
abundance of oogenetic mRNAs and different factors were mentioned to be
proteins to confer full developmental responsible for the regulation of translation
competence following fertilization [30,31]. The in this stored mRNAs. Sub-cellular
formation of zygotes with successful localization, cytoplasmic polyadenylation, and
fertilization triggers cohorts of events that Y-box proteins have emerged as leading
begin by repeated cycles of cell division, candidates to regulate the translation of
activation of embryonic genome, compaction maternal mRNAs [41]. Although these and a
and differentiation into ICM and TE cells number of other mechanisms are probably
resulting in the formation of blastocyst responsible for the translational control of
[32-34]. While these series of events have been maternal mRNA, one that appears to be
the distinctive characteristics of preimplanta- widespread is cytoplasmic poly (A) elongation
tion embryo development, temporal [40,42,43]. As a result, mRNAs and proteins
occurrences vary between different species synthesized and stored during oogenesis
[33,35] and relies on the sequential and initiate and support a developmental program
temporal expression of about 10,000 genes induced by sperm penetration [6,44-46].
out of which the sequence, expression and However, after one to four cleavage divisions,
function of only a very minor portion has based on the species, the maternal phase
been recognized so far [34,36]. Generally, the gradually looses its development control
control of development in preimplantation [32,35,47]. This transition from maternal to
embryos is guided by two major activation embryonic control of development is
events occurring temporally at the characterized by a degradation of maternal
preimplantation development stage. These are RNA and protein, arrest in embryonic
maternal and zygotic gene activation events development, increased sensitivity to
that control development sequentially. transcriptional inhibitors such as alpha-
amanitin, a burst of transcriptional activity
2.3 Maternal Gene Activation and from the embryonic genome [48] and the
Development Control replacement of transcripts previously
Early embryonic development in degraded and the generation of new
mammalian species is regulated by maternal transcripts that were not present in the oocyte
transcripts. As a result, any activity that requires [49].
the creation and development of an embryo, 2.4 Embryonic Gene Activation and
whether it is in the context of infertility Development Control
treatment or in the creation of a reconstructed In all species, the development beyond
embryo by nuclear transfer, is dependent on early cleavage divisions is dependent on
the intrinsic ability of that oocyte to support zygotic gene activation and subsequent
development [37,38]. This is, however, guided maintenance of temporally and spatially
by a very stable for m of RNA that appropriate zygotic transcription[50]. The
accumulated in the oocyte and translated trigger for the initiation of embryonic
during maturation, fertilization and early transcription remains unclear [51,52].
embryonic development [39]. These However, it involves the synthesis of proteins,
translationally dormant mRNAs encode a which are about 40 proteins in mouse [53].
Chiang Mai J. Sci. 2007; 34(3) 371
During the transition from maternal to 3. TRADITIONAL METHODS OF GENE

embryonic control of development, maternal EXPRESSION ANALYSIS AND LIMITATIONS
transcripts are depleted and embryo specific Details on the traditional methods of
transcripts involved in early embryogenesis are gene expression analyses have been mentioned
generated [54]. The transcription of the 18S, elsewhere [56,57]. Traditionally, studies
5.8S, and 28S rRNA polymerase I and their measuring the differences between cell types
subsequent processing lead to the formation or cell pathways following treatment or
of a distinct nuclear structure of the perturbation of the cell have been carried out
nucleus [46]. Furthermore, the transition is at the level of transcribed mRNA using
accompanied by modifications in chromatin methods such as the classical and most well
structure and post-translational modifications established northern blot [58], RNase
of the transcriptional abilities in early embryos protection assay [59], differential display [57],
[45]. In addition, a dramatic reprogramming representational difference analysis [60,61] and
of gene expression occurs during this suppressive subtractive hybridisation [62-63].
transition, and this is similar to the molecular These methods, although fruitful and still in
foundation for transforming the highly use, have limited scope in terms of the
differentiated oocyte into the totipotent number of genes that can be analysed, and
blastomeres of the early cleavage stage some of these methods identify only known
preimplantation embryo [51]. The timing of genes [56]. As a consequence, genes were not
zygotic gene activation, or competence to exhaustively characterized for different
sustain appreciable transcriptional activity in physiological parameters. The case for
bovine embryos may be controlled temporally developmental studies was not different from
by a time-dependent mechanism referred to this general truth. Techniques are continuously
as zygotic clock rather than by developmental being developed in terms of technical
stage [47,55]. This was confirmed by efficiency, cost, sample requirement, and
transfecting a reporter gene into 1 cell stage number of samples analysed at a time, albeit
bovine embryos and examines the expression the previous methods are valuable and still in
at a particular stage [47]. Similar test has also use. Recently real-time RT-PCR method has
been done with mouse zygote [55]. In bovine been introduced as an additional tool for gene
embryos, zygotic gene activation has definitely expression studies. However, it is not a method
occurred by the 8- to 16- cells stage as of choice to explore the expression patterns
evidenced by incorporation of [3H]-uridine of multiple genes simultaneously. Therefore,
into nuclei and nucleolei at the 8-cells stage all these techniques have now been superseded
[32]. This activation is responsible for by technologies that allow the simultaneous
controlling subsequent development, and analysis of multiple genes. More robust
different transcripts are expressed in a stage methods, aiming at capturing gene expression
specific manner. However, first transcript at genomic scales, including serial analysis of
initiation at 2- to 4- cells stages was observed gene expression (SAGE) [64-66], expressed
in bovine embryo development and this sequence tags (EST) library sequencing [67,68],
initiation is ±- amanitin insensitive and is not massive parallel signature sequencing (MPSS)
required for the progression of embryonic and microarray have taken their place [69].
development to advanced preimplantation The common trait among these technologies
stage. is their capability to capture comprehensive
biological information, in which all endpoints
372 Chiang Mai J. Sci. 2007; 34(3)
are, measured simultaneously [70]. However, investigated yet [71,81,82]. As a consequence

microarrays are more preferred in terms of of this burgeoning interest, the field of
number of genes that can be analysed functional genomics has arisen, which
simultaneously, ease of controlling and encompasses the development and application
handling the experiment [71]. of methods to examine the expression of
large numbers of genes using a holistic
4. STUDY THE GENE EXPRESSION DURING approach, rather than on a gene by gene basis
PREIMPLANTATION EMBRYO USING (81, 83). Moreover, the value of these tomes
MICROARRAY AND RNAI of information will be fully realised when the
To understand the development of function and control of genes, and their
preimplantation embryo, the expression of pathways are elucidated [77]. Microarrays have
gene(s) controlling this process has been been evolved at this cross road as impetus
intensively studied, especially with the for solving such numerical mayhem by
development of powerful techniques such as providing insight in to gene functions using a
microarray and RNAi. While microarray is systematic global approach. Generally two
used as a tool to measure the expression levels types of microarrays are recognized; cDNA
of thousands of genes simultaneously, RNAi and oligonucleotide arrays and both are
can be applied to have further knowledge on sensitive in identifying regulated transcripts
the functions of target genes derived from [84,85]. A typical microarray expression
the microarray. profiling experiment involves the hybridisation
of a fluorescently labelled cDNA probe to
4.1 Microarray as a Method of Gene cDNA clones or oligonucleotides
Expression Analysis immobilized onto glass slides and the data
Microarrays are, in principle and practice, offer an insight in to the transcriptional
extensions of hybridisation-based methods responses of a genome to a particular
such as southern blot [72], northern blot [58], mutational event or environmental insult [86].
and dot blots [73], which have been used for On the other hand, array based technologies,
decades to identify and quantify nucleic acids while seductive can sometimes be corruptive
in biological samples [74-76]. It is simply a [87]. Although the high-throughput technology
large scale dot blot [77]. However, the main enables researchers to study expression for
distinction is in the use of an impermeable, thousands of genes simultaneously,
rigid substrate, such as glass in microarray experiments by using microarrays may be
experiment [78]. The technique exploits the costly, time consuming, and output is subject
capacity of nucleic acid strands to recognize to substantial variability [88,89], needs large
the complementary sequences through base amount of RNA [80] and the level of mRNA
pairing [79] and was first developed and expression does not always reflect protein
introduced by the pioneering works of Schena concentration. Microarrays are also closed
and colleagues [80]. The near completion of systems that enable the investigator to look at
human genome sequence, ag gressive the expression of predetermined genes of
identifications of ESTs in different species, interest spotted on the glass slide [77].
and gene expression studies at various Furthermore, the generated data are not end
laboratories have marked today’s genetic era point of the study but needs to be confirmed
by so many genes whose expression patterns by independent methods. Finally, cDNA
and biological functions need to be arrays are liable for cross-hybridization due
Chiang Mai J. Sci. 2007; 34(3) 373
to sequence homology, particularly when involved in various developmental pathways.

several members of the same family are These include study in the analysis of
included [90]. preimplantation stage human embryos [93,94],
study the gene expression in mouse embryos
4.1.1 Applications of Microarray in using cDNA arrays [92,95], study bovine
Preimplantation Embryo Development oocyte maturation using heterologous cDNA
The use of DNA microarrays to examine array [96], identification of important genes
mammalian development is a small but rapidly in oocyte library important for embryogenesis
growing field of study. It is currently [97], compare the developmental competence
dominated by the exploitation of arrays to between oocyte and preimplantation embryo
perform screens for molecules involved in in bovine [98,99], compare the expression
particular developmental processes [86]. profiles for embryos derived from different
However, addressing the functional pathways origins [100], detect the gene expressions
and how cellular components work together during bovine embryogenesis and
to regulate and carry out cellular processes, implantation [101] and recently identification
requires the quantitative monitoring of the of differentially expressed genes in
expression levels of very large numbers of preimplantation embryos produced by nuclear
genes repeatedly and reproducibly, under the transfer to study the effect of this new
influence of genetic, biochemical and chemical technology on reprogramming the genes
perturbations [71,79,88]. Oocytes and required for development [102,103].
preimplantation stage embryos express a wide Nevertheless, recently the methodologies have
variety of genes of which many have made a remarkable progress and RNA
overlapping or apparently redundant amplification coupled with gene specific target
functions. Thus, characterisation of production is a common procedure to pursue
preimplantation development at the molecular microarray experiment, and fill the previous
level in all species requires the simultaneous research gaps.
examination of the full repertoire of
functionally related genes [91]. So far, the 4.1.2 Post Analysis Follow-up and
application of microarray technology to study Validation of Microarray Experiments
preimplantation stage embryo development Although there has been great progress
has been hampered by both cultural and in measurement of gene-expression profiles
technical issues [86]. The frequently mentioned using microarray technology, investigators are
technical problems are the need for large still confronted with a difficult question after
amount of input RNA, which can not be completing their experiments: how to validate
secured from standard embryo sample [88] the large data sets that are generated? There
and by lack of appropriate cDNA collection are two approaches to independent
[92]. On the other hand, the cultural issue refers confirmation of microarray data: in silico
to the familiarity of developmental biologists analysis and laboratory-based analysis [104].
with the previous techniques and lack of The in silico method compares array results
familiarity with microarrays [86]. As a result, with information available in the literature and
only limited studies were published so far. in public or private expression databases, and
Recently, cDNA microarray has been provides the opportunity to validate data
applied successfully to profile the expression without further experimentation [105,106].
pattern of a large number of transcripts Agreement between array results from other
374 Chiang Mai J. Sci. 2007; 34(3)
groups, as well as with known expression corresponding protein products. The selection
information in the literature, validates the of the gene set for follow-up analysis in the
general perfor mance of a system and laboratory depends on the aim (s) of the study,
provides confidence in the overall data, but is influenced by factors such as the relative
including the unique and novel discoveries difference in expression among the samples,
made in a study [104]. Laboratory-based biological function, abundance levels, and
validation of data provides independent, availability of appropriate reagents (probes
experimental verification of gene-expression and antibodies).
levels, and typically begins with the same
samples that were studied in the initial array 4.2 RNA Interference or Gene Silencing
experiment(s). The methodology used varies Presently, the genomes of various species
depending on the scientific question, but including the bovine are largely sequenced.
commonly used techniques include semi- Moreover, several studies have been carried
quantitative reverse-transcription PCR out during the last decade to investigate the
(RT–PCR), real-time PCR, northern blot, expression patterns of genes in bovine
ribonuclease protection assay, and in situ embryogenesis in response to various culture
hybridization or immunohistochemistry and treatment conditions [6,111-113]. Despite
using tissue microarrays [96, 103,105,107,108]. the fact that the bovine genome has been
Real-time RT–PCR is the choice of many for reported to be completely sequenced, the
quantitatively measuring specific mRNAs as, function of most of the genes is not yet
once established, the method is rapid, relatively known. Till recently, the function of a specific
inexpensive and requires minimal starting gene in bovine species has been predicted
template [109,110]. In addition to validating using knockout experiments conducted in
array results at the mRNA level, it is equally mouse (114, 115). However, these knockout
important to evaluate expression levels of the technologies are extremely laborious and need
Figure 1. RNAi mechanism in mammalian cell, starts with the processing of double-stranded
RNA (dsRNA) or short hairpin RNA (shRNA) into small interfering RNA (siRNA) by the
dicer emzyme. Small interfering RNA serves as guide sequences for RNA induced silencing
complex (RISC), which recognizes and cleaves the cognate mRNA.
Chiang Mai J. Sci. 2007; 34(3) 375
long time to see the effects. So what is needed mouse [117-130], swine [131,132] and bovine
is a technique that can be used to jump directly [133-136]. This approach has been reported
from sequence to function in the whole animal. to be an effective tool to inhibit genes from
For this, the post transcriptional gene silencing both maternal and embryonic genome
(PTGS) by double-stranded RNA (dsRNA) expressed in those species.
or RNA interference (RNAi), has emerged as A working model for RNAi is shown in
a new tool for studying gene function in an Figure 1. The first step is the production of
increasing number of organisms [116]. To dsRNA directed against an mRNA. The
overcome this, the RNAi approach through second step involves the recognition of
introduction of sequence specific dsRNA into dsRNA and its processing to produce 21-23
the cells has been reported for the first time nt siRNAs. The effected step is the recognition
in Caenorhabditis elegans as an effective tool of the target mRNA by the siRNAs and the
to study gene function in this species [116]. selective degradation of that mRNA. In this
Due to its relatively easy application and its section, three mechanistic features of RNAi
effectiveness, this technique has been used to relevant to the mammalian pathway will be
study gene function during early embryo- shown: 1) processing of dsRNA into siRNA;
genesis in mammalian species including and 2) recognition and cleavage of the cognate
Table 1. The applications of gene silencing in different species.

Phylum Species Mechanism Effector References
Fungi Neurospora Quelling Transgenes Cogoni and Macino, 1999 [139]
Plants Arabidopsis PTGS Transgenes Elmayan et al., 1998 [140]
Nicotiana Transcriptional gene Transgenes, Virus Furner et al., 1998 [141]
silencing
Pitunia PTGS Transgenes Dehio and Schell, 1994 [142]
Invertebrates C. elegans RNAiTranscriptional dsRNA, Fire et al., 1998 [116]; Kelly and
gene silencing Transgenes Fire, 1998 [143]; Ketting et al.,
1999 [144]
D. melanogaster RNAi dsRNAshRNA Misquitta and Paterson, 1999
[145]; Paddison et al., 2002 [146]
Paramecium Homology-dependent Transgene Ruiz et al., 1998 [147]
silencing
Trypanosome RNAi dsRNA Wang et al., 2000 [148]
Vertebrates Danio rerio RNAi dsRNA Wargelius et al., 1999 [149]
Mus musculus RNAi dsRNA Knott et al., 2005 [122]; Plusa
et al., 2005 [150]; Wianny and
Zernicka-Goetz, 2000 [129]
RNAi siRNA Haraguchi et al., 2004 [120]
Sus scrofa RNAi dsRNA Anger et al., 2004 [131]; Cabot
and Prather, 2003 [132]
Bos turus RNAi dsRNA Tesfaye et al., 2007 [133];
Nganvongpanit et al., 2006 [134];
Nganvongpanit et al., 2006 [135] ;
Paradis et al., 2005 [136]
Homo sapien RNAi dsRNA Brown and Catteruccia, 2006 [137]
shRNA Rossi, 2006 [138]
siRNA Gaur, 2006 ; Rossi, 2006 [138]
376 Chiang Mai J. Sci. 2007; 34(3)
mRNA, for more detail see Svoboda, 2004 tion embryos. In this experiment, three genes
[126]. namely: MmGFP, C-mos, and E-cadherin
were tested. For the first gene, a mouse line
4.2.1 Application of RNA Interference to was created in which carried the MmGFP
Establish Developmental Gene Function gene, was paternally inherited to prevent
The most widely used RNAi technology complications from maternal transcripts and
has been in cell culture and in vivo studies translation products. Tests showed that when
aimed at understanding the function of an embryos were injected with dsRNA specific
individual or multiple proteins. The complex for MmGFP, the fluorescence was significantly
and remarkably rapid change that occurs diminished; indicating that expression of the
during development of the fertilized oocyte gene had been blocked. Also, when the
or zygote into an adult organism remains a embryos were injected with dsRNA specific
large mystery. There would appear to be a for C-mos or E-cadherin, no effect on the
great potential for RNAi technology to unravel fluorescence occurred, although changes
the cellular and molecular events that regulate resulted from the blockage of these two genes
development processes. Methods for silencing were observed, which indicates that in mice
single or multiple selected genes in developing as well as in invertebrates, the interference
embryos in vivo and in vitro are beginning to effect is specific. A similar test was done with
reveal the functions of specific proteins in dsRNA specific for E-cadherin. The
development processes (Table 1). The RNAi disruption of this gene leads to uncompaction,
was used to demonstrate that siRNAs directed a severe preimplantation defect, which
against the mRNA encoding Oct-3/4 and C- prevents the embryo from developing
mos resulted in depletion of the encoded correctly [114,115]. Similar effects to the
proteins and phenotypes similar to those MmGFP study were found, dsRNA specific
observed in Oct-3/4 and C-mos knockout for E-cadherin resulted in uncompaction of
mice [121]. A key role for microtubule- the embryos and dsRNA specific for C-mos
associated protein-2 in the regulation of or MmGFP did not. The final test involved
dendrite outgrowth in developing brain C-mos, a maternally inherited gene which
neurons was demonstrated using siRNAs arrests maturing oocytes at metaphase during
[137]. The transcription factor Myc is known the second meiotic division. The injection of
to play a fundamental role in the regulation dsRNA specific for C-mos caused 63% of
of cell proliferation. A key role for the novel the injected cells to fail to maintain arrest at
Myc target gene Mina53 in the regulation of MII, whereas 1-2% of the control group
cell proliferation by Myc was demonstrated failed to maintain arrest [129]. This
using RNAi technology [138]. demonstrated that, unlike the knockout
method, dsRNA can block expression of
4.2.2 Application of RNA Interference in maternally provided gene products. RNA
Preimplantation Embryo interference is important because it allows
In Table 2, the application of RNAi in researchers to study the effects of genes loss
mammalian embryos is shown. The first of their function on developing embryos
application was reported in 2000 by 2 without the complications of the gene
research groups [126,129]. Wianny and knockout method. The application of this
Zernicka-Goetz, 2000 [129] used this mechanism to vertebrates and then to
technique in mouse oocytes and preimplanta- mammals is likely to provides better models
Chiang Mai J. Sci. 2007; 34(3) 377
Table 2. The applications of RNAi in mammalian preimplantation embryos.
Species Tissue Gene Molecule Reference

Mouse Oocytes Bmp-15 dsRNA Gui and Joyce, 2005 [119]
C-mos dsRNA Svoboda et al., 2000 [128]; Wianny
and Zernicka-Goetz, 2000 [129]
Plat dsRNA Svoboda et al., 2000 [128]
PLCz shRNA Knott et al., 2005 [122]
Egfp dsRNA Wianny and Zernicka-Goetz, 2000
[129]; Stein et al., 2003 [124]
Gdf-9 dsRNA Gui and Joyce, 2005 [119]
Itpr1 dsRNA Xu et al., 2003 [130]
Miss dsRNA Lefebvre et al., 2002 [151]
Doc1r dsRNA Terret et al., 2003 [152]
Bnc dsRNA Ma et al., 2002 [153]
Ctcf dsRNA Fedoriw et al., 2004 [154]
Msy2 dsRNA Yu et al., 2004 [155]
Embryo Dicer1 siRNA Svoboda et al., 2001 [127]
E-cadherin dsRNA Wianny and Zernica-Goetz, 2000
[129]; Sonn et al., 2004 [123]
Egfp siRNA Haraguchi et al., 2004 [120]
Nek2A dsRNA Sonn et al., 2004 [123]
Oct-4 siRNA Haraguchi et al., 2004 [120]
Par3 dsRNA Plusa et al., 2005 [150]
aPKC dsRNA Plusa et al., 2005 [150]
Porcine Oocyte Plk1 dsRNA Anger et al., 2004 131]
Embryo Karyopherins a2, a3 dsRNA Cabot and Prather, 2003 [132]
Bovine Oocyte C-mos dsRNA Nganvongpanit et al., 2006 [135]
Cyclin B1 dsRNA Paradis et al., 2005 [136]
Embryo Connexin 43 dsRNA Tesfaye et al., 2007 [133]
E-cadherin dsRNA Nganvongpanit et al., 2006 [134],
Tesfaye et al., 2007 [133]
Oct-4 dsRNA Nganvongpanit et al., 2006 [134] ;
Nganvongpanit et al., 2006 [135]
for studying the effects of genes and staining techniques. Injection with Gdf-9
inactivation of genes in livestock for example dsRNA knocked down Gdf-9 but not Bmp-
cattle, swine and poultry in addition to human. 15 mRNA expression in oocytes, and vice
Also, dsRNA was used to investigate the versa. Furthermore, Gdf-9 protein levels were
possible role of Gdf-9 in mediating oocyte reduced in the Gdf-9 dsRNA injected oocytes.
regulation of cumulus expansion [119]. Fully- To investigate the role of Gdf-9 in cumulus
grown mouse oocytes injected with Gdf-9 expansion, two endpoints genes namely: Has-
dsRNA, Bmp15 dsRNA or injection buffer 2 and Ptgs-2 were used to evaluate cumulus
were cultured for 24 h and processed for expansion. The mRNA levels were measured
measurement of Gdf-9 and Bmp-15 mRNA in cumulus cells using real-time RT-PCR and
levels using real-time RT-PCR, and for assessment of cumulus expansion was
measurement of Gdf-9 protein levels using undertaken morphologically. After 24 h of
western blotting and immunofluorescence culture in the presence of 0.5 U/ml follicle
378 Chiang Mai J. Sci. 2007; 34(3)
stimulating hormone (FSH), cumulus shells co- specific dsRNA or siRNA to induce RNAi in
cultured with buffer and Bmp-15 dsRNA mammalian oocytes and embryos to suppress
injected oocytes exhibited a high degree of maternal and embryonic transcripts leads to a
expansion, while cumulus shells co-cultured subsequent reduction in functional protein
with Gdf-9 dsRNA injected oocytes exhibited expression and a distinct developmental
only limited expansion. Supporting this phenotype. Furthermore, those results
observation, after 8 h of co-culture Has-2 and demonstrated that sequence specific dsRNA
Ptgs-2 mRNA levels were lower in cumulus can be used to knockdown maternal or
cells co-cultured with Gdf-9 dsRNA injected embryonic transcripts in mammalian
oocytes than in those co-cultured with buffer embryogenesis and used as a tool to study
injected oocytes. These results strongly support the function of genes.
the concept that Gdf-9 is a key mediator of
oocyte-enabled cumulus expansion in mice. 5. CONCLUSION
In bovine, RNAi represents a useful technique Microarray has become a very important
to study gene function in oocyte. The injection tool for studying gene expression profiles
of Cyclin B1 dsRNA resulted in a decrease in under various conditions. Based on its main
Cyclin B1 mRNA and protein, while the Cyclin function in the identification of transcripts
B2 mRNA remained unaffected. Further- whose abundance differs between samples,
more, the injection of GFP dsRNA did not microarray has made important contributions
interfere with Cyclin B1 mRNA or protein to both basic and applied research, and
with the ability of the oocyte to mature promise to change the practice of several
properly [136]. Moreover, the study research fields. This technique allows us to
conducted by our group has shown the E- study global gene expression in the complex
cadherin transcripts and proteins were reduced of metabolic pathways. Emerging from their
after embryos were treated with E-cadherin roots in gene screening and target identification
dsRNA, and the blastocyte rates in those microarrays are now being applied to disease
embryos was found to be lower as compared characterization and developmental biology.
with that of the control group [134]. Generally, microarray has come to play a
Moreover, in the other study of our group, central role in the rapidly evolving field of
microinjection of C-mos dsRNA has resulted transcriptomics and the advantage of
in 70% reduction of C-mos transcript after microarray is fulfilled with the improvement
maturation compared to the water injected of RNAi technique. In fact, RNAi is a
and uninjected controls (P < 0.01). revolution in the field of animal molecular
Microinjection of zygotes with Oct-4 dsRNA genetics that it has enormous potential for
has resulted in 72% reduction in transcript engineering control of gene expression, as
abundance at the blastocyst stage compared well as for the use of a tool in functional
to the uninjected control zygotes (P < 0.01). genomics. The ability to manipulate RNAi has
From oocytes injected with C-mos dsRNA a wide variety of practical applications of
60% showed the extrusion of first polar body biotechnology ranging from molecular
compared to 50% in water injected and 44% biology to gene therapy. The use of RNAi as
in uninjected controls. Moreover, only oocytes a method to alter gene expression in
injected with C-mos dsRNA showed mammalian embryo has been attempted in a
spontaneous activation [135]. Those studies diverse rate of success. Analysis of more genes
have given evidence that the use of sequence using RNAi in bovine including other
Chiang Mai J. Sci. 2007; 34(3) 379
mammalian species will help researchers to stage in vitro or in vivo, Biol. Reprod.,
better understand what genes are suitable for 2003; 69: 1424-1431.
RNAi targeting and function of those genes. [7] Schultz R.M., Davis W., Stein P., and
However, various RNAi approaches need to Svoboda P., Reprogramming of gene
be compared and standard protocols must expression during preimplantation
development, J. Exp. Zool., 1999; 285:
be developed for a better use. The RNAi
276-282.
transgenic approach is very interesting for
[8] Mayes M., The meiotic arrest of bovine
studies of early mammalian development. oocytes, PhD Thesis, University of Laval
Quebec, Canada, 2002.
[9] Gandolfi F., Luciano A.M., Modina S.,
REFERENCES
Ponzini A., Pocar P., Armstrong D.T.,
[1] Yasuda G.K., and Schubiger G.,
and Lauria A., The in vitro developmental
Temporal regulation in the early embryo
competence of bovine oocytes can be
- is mbt too good to be true, Trends
related to the morphology of the ovary,
Genet., 1992; 8: 124-127.
Theriogenology, 1997; 48: 1153-1160.
[2] Stanton J.A., Macgregor A.B., and Green
[10] Crosier A.E., Farin P.W., Dykstra M.J.,
D.P., Gene expression in the mouse
Alexander J.E., and Farin C.E.,
preimplantation embryo, Reproduction,
Ultrastructural morphometry of bovine
2003; 125: 457-468.
blastocysts produced in vivo or in vitro,
[3] Hashizume K., Ishiwata H., Kizaki K.,
Biol. Reprod., 2001; 64: 1375-1385.
Yamada O., Takahashi T., Imai K., Patel
[11] Hazeleger N.L., Hill D.J., Stubbings R.B.,
O.V., Akagi S., Shimizu M., Takahashi S.,
and Walton J.S., Relationship of
Katsuma S., Shiojima S., Hirasawa A.,
morpholog y and follicular-fluid
Tsujimoto G., Todoroki J., Izaike Y.,
environment of bovine oocytes to their
Implantation and placental development
developmental potential in-vitro,
in somatic cell clone recipient cows,
Theriogenology, 1995; 43: 509-522.
Cloning Stem Cells, 2002; 4: 197-209.
[12] Hendriksen P.J.M., Vos P., Steenweg
[4] Holm P., Booth P.J., Schmidt M.H., Greve
W.N.M., Bevers M.M., and Dieleman S.J.,
T., and Callesen H., High bovine
Bovine follicular development and its
blastocyst development in a static in vitro
effect on the in vitro competence of
production system using SOFaa medium
oocytes, Theriogenology, 2000; 53: 11-
supplemented with sodium citrate and
20.
myo-inositol with or without serum-
[13] Madison V., Avery B., and Greve T.,
proteins, Theriogenology, 1999; 52: 683-
Selection of immature bovine oocytes
700.
for developmental potential invitro,
[5] Vigneault C., McGraw S., Massicotte L.,
Anim. Reprod. Sci., 1992; 27: 1-11.
and Sirard M.A., Transcription factor
[14] Blondin P., and Sirard M.A., Oocyte and
expression patterns in bovine in vitro-
follicular morphology as determining
derived embryos prior to maternal-
characteristics for developmental
zygotic transition, Biol. Reprod., 2004; 70:
competence in bovine oocytes, Mol.
1701-1709.
Reprod. Dev., 1995; 41: 54-62.
[6] Lonergan P., Rizos D., Gutierrez-Adan
[15] Fenwick J., Platteau P., Murdoch A.P., and
A., Moreira P.M., Pintado B., De La
Herbert M., Time from insemination to
Fuente J., and Boland M.P., Temporal
first cleavage predicts developmental
divergence in the pattern of messenger
competence of human preimplantation
RNA expression in bovine embryos
embryos in vitro, Hum. Reprod., 2002;
cultured from the zygote to blastocyst
17: 407-412.
380 Chiang Mai J. Sci. 2007; 34(3)
[16] Van Montfoort A.P.A., Dumoulin J.C.M., developmental cDNA microarray, Proc.
Kester A.D.M., and Evers J.L.H., Early Natl. Acad. Sci. U.S.A., 2000; 97: 9127-
cleavage is a valuable addition to existing 9132.
embryo selection parameters: a study [24] Epstein C.J., and Smith S.A., Amino acid
using single embryo transfers, Hum. uptake and protein synthesis in
Reprod., 2004; 19: 2103-2108. preimplanatation mouse embryos, Dev.
[17] Humblot P., Holm P., Lonergan P., Biol., 1973; 33: 171-184.
Wrenzycki C., Lequarre A.S., Joly C.G., [25] Vanblerkom J., and Brockway G.O.
Herrmann D., Lopes A., Rizos D., Qualitative patterns of protein-synthesis
Niemann H., and Callesen H., Effect of in preimplantation mouse embryo .1.
stage of follicular growth during normal-pregnancy, Dev. Biol., 1975; 44:
superovulation on developmental 148-157.
competence of bovine oocytes, Therio- [26] Bensaude O., Babinet C., Morange M.,
genology, 2005; 63: 1149-1166. and Jacob F., Heat shock proteins, first
[18] King G.J., Atkinson B.A., and Robertson major products of zygotic gene activity
H.A., Development of the Bovine in mouse embryo, Nature, 1983; 305:
Placentome from Days 20 to 29 of 331-333.
Gestation, J. Reprod. Fertil., 1980; 59: 95- [27] Braude P.R., Control of Protein-Synthesis
100. During blastocyst formation in the
[19] Yamada O., Todoroki J., Kizaki K., mouse, Dev. Biol., 1979; 68: 440-452.
Takahashi T., Imai K., Patel O.V., Schuler [28] Handyside A.H., and Johnson M.H.,
L.A., and Hashizume K., Expression of Temporal and spatial patterns of
prolactin-related protein I at the fetor- synthesis of tissue-specific polypeptides
naternal interface during the implantation in pre-implantation mouse embryo, J.
period in cows, Reproduction, 2002; 124: Embryol. Exp. Morphol., 1978; 44: 191-
427-437. 199.
[20] Wooding F., and Flint A., Placentation;.in [29] Howe C.C., Gmur R., and Solter D.,
Lamming G, ed, ‘Mashall’s Physiology of Cytoplasmic and nuclear protein synthesis
Reproduction, Chapman & Hall, during in vitro differentiation of murine
London, 1994: 233-460. ICM and embryonal carcinoma cells,
[21] Wooding F.B.P., The synepitheliochorial Dev. Biol., 1980; 74: 351-363.
placenta of ruminants - binucleate cell [30] Babinet C., Richoux V., Guenet J.L., and
fusions and hormone production, Renard J.P., The DDK inbred strain as a
Placenta, 1992; 13: 101-113. model for the study of interactions
[22] Lee J., Inoue K., Ono R., Ogonuki N., between parental genomes and egg
Kohda T., Kaneko-Ishino T., Ogura A., cytoplasm in mouse preimplantation
and Ishino F., Erasing genomic imprinting development, Development, 1990; 81-
memory in mouse clone embryos 87.
produced from day 11.5 primordial [31] Renard J.P., Baldacci P., Richouxduranthon
germ cells. Development, 2002; 129: V., Pournin S., and Babinet C., A Maternal
1807-1817. Factor Affecting Mouse Blastocyst
[23] Tanaka T.S., Jaradat S.A., Lim M.K., Formation, Development, 1994; 120:
Kargul G.J., Wang X.H., Grahovac M.J., 797-802.
Pantano S., Sano Y., Piao Y., Nagaraja R., [32] De Sousa P., Watson A.J., Schultz G.A.,
Doi H., Wood W.H., Becker K.G., and and Bilodeau-Goeseels S., Oogenetic and
Ko M.S.H., Genome-wide expression zygotic gene expression directing early
profiling of mid-gestation placenta and bovine embryogenesis: A review, Mol.
embryo using a 15,000 mouse Reprod. Dev., 1998; 51: 112-121.
Chiang Mai J. Sci. 2007; 34(3) 381
[33] Lawinger P., Rastelli L., Zhao Z.Y., and Cell. Biol., 1997; 17: 6419-6426.
Majumder S., Lack of enhancer function [41] Yu J.Y., Deng M.Q., Medvedev S., Yang
in mammals is unique to oocytes and J.X., Hecht N.B., and Schultz R.M.,
fertilized eggs, J. Biol. Chem., 1999; 274: Transgenic RNAi-mediated reduction of
8002-8011. MSY2 in mouse oocytes results in
[34] Ko M.S.H., Kitchen J.R., Wang X.H., reduced fertility, Dev. Biol., 2004; 268:
Threat T.A., Wang X.Q., Hasegawa A., 195-206.
Sun T., Grahovac M.J., Kargul G.J., Lim [42] Charlesworth A., Ridge J.A., King L.A.,
M.K., Cui Y., Sano Y., Tanaka T., Liang MacNicol M.C., and MacNicol A.M., A
Y., Mason S., Paonessa P.D., Sauls A.D., novel regulatory element determines the
DePalma G.E., Sharara R., Rowe L.B., timing of Mos mRNA translation during
Eppig J., Morrell C., and Doi H., Large- Xenopus oocyte maturation, EMBO J.,
scale cDNA analysis reveals phased gene 2002; 21: 2798-2806.
expression patterns during [43] Tay J., Hodgman R., Sarkissian M., and
preimplantation mouse development, Richter J.D., Regulated CPEB
Development, 2000; 127: 1737-1749. phosphorylation during meiotic
[35] Telford N.A., Watson A.J., and Schultz progression suggests a mechanism for
G.A., Transition from maternal to temporal control of maternal mRNA
embryonic control in early mammalian translation, Genes Dev., 2003; 17: 1457-
development - a comparison of several 1462.
species, Mol. Reprod. Dev., 1990; 26: 90- [44] Memili, E., and First, N.L., Control of
100. gene expression at the onset of bovine
[36] Niemann H., and Wrenzycki C., embryonic development, Biol. Reprod.
Alterations of expression of 1999; 61: 1198-1207.
developmentally important genes in [45] Pacheco-Trigon S., Hennequet-Antier C.,
preimplantation bovine embryos by in Oudin J.F., Piumi F., Renard J.P., and
vitro culture conditions: Implications for Duranthon W., Molecular characterization
subsequent development, Theriogeno- of genomic activities at the onset of
logy, 2000; 53: 21-34. zygotic transcription in mammals, Biol.
[37] Nusser K.D., Mitalipov S., Widmann A., Reprod., 2002; 67: 1907-1918.
Gerami-Naini B., Yeoman R.R., and Wolf [46] Viuff D., Hyttel P., Avery B., Vajta G.,
D.P., Developmental competence of Greve T., Callesen H., and Thomsen P.D.,
oocytes after ICSI in the rhesus monkey, Ribosomal ribonucleic acid is transcribed
Hum. Reprod., 2001; 16: 130-137. at the 4-cell stage in in vitro produced
[38] Rodriguez K.F., and Farin C.E., Gene bovine embryos, Biol. Reprod., 1998; 59:
transcription and regulation of oocyte 626-631.
maturation, Reprod. Fertil. Dev., 2004; [47] Watson A.J., Westhusin M.E., De Sousa
16: 55-67. P.A., Betts D.H., and Barcroft L.C., Gene
[39] Stutz A., Conne B., Huarte J., Gubler P., expression regulating blastocyst
Volkel V., Flandin P., and Vassalli J.D., formation. Theriogenology, 1999; 51:
Masking, unmasking, and regulated 117-133.
polyadenylation cooperate in the [48] Natale D.R., Kidder G.M., Westhusin
translational control of a dormant M.E., and Watson A.J., Assessment by
mRNA in mouse oocytes, Genes Dev., differential display-RT-PCR of mRNA
1998; 12: 2535-2548. transcript transitions and alpha-amanitin
[40] De Moor C.H., and Richter J.D., The sensitivity during bovine preattachment
Mos pathway regulates cytoplasmic development, Mol. Reprod. Dev., 2000;
polyadenylation in Xenopus oocytes, Mol. 55: 152-163.
382 Chiang Mai J. Sci. 2007; 34(3)
[49] Brunet-Simon A., Henrion G., Renard Method for detection of specific RNas
J.P., and Duranthon V., Onset of zygotic in agarose gels by transfer to
transcription and maternal transcript diazobenzyloxymethyl-paper and
legacy in the rabbit embryo, Mol. Reprod. hybridization with DNA probes, Proc.
Dev., 2001; 58: 127-136. Natl. Acad. Sci. U. S. A., 1977; 74: 5350-
[50] Henrion G., Renard J.P., Chesne P., Oudin 5354.
J.F., Maniey D., Brunet A., Osborne H.B., [59] Berk A.J., and Sharp P.A., Sizing and
and Duranthon V., Differential regulation mapping of early adenovirus mRNAs by
of the translation and the stability of two gel electrophoresis of S1 endonuclease-
maternal transcripts in preimplantation digested hybrids, Cell, 1977; 12: 721-732.
rabbit embryos, Mol. Reprod. Dev., [60] Hubank M., and Schatz D.G., Identifying
2000; 56: 12-25. differences in mRNA expression by
[51] Ma J., Svoboda P., Schultz R.M., and Stein representational difference analysis of
P., Regulation of zygotic gene activation cDNA, Nucl. Acids. Res., 1994; 22: 5640-
in the preimplantation mouse embryo: 5648.
Global activation and repression of gene [61] Kuvbachieva A.A., and Goffinet A.M.,
expression, Biol. Reprod., 2001; 64: A modification of Representational
1713-1721. Difference Analysis, with application to
[52] Memili E., Dominko T., and First N.L., the cloning of a candidate in the Reelin
Onset of transcription in bovine oocytes signalling pathway, BMC Molecular
and preimplantation embryos, Mol. Biology, 2002; 3.
Reprod. Dev., 1998; 51: 36-41. [62] Diatchenko L., Lau Y.F.C., Campbell A.P.,
[53] Latham K.E., Garrels J.I., Chang C., and Chenchik A., Moqadam F., Huang B.,
Solter D., Quantitative-analysis of Lukyanov S., Lukyanov K., Gurskaya N.,
protein-synthesis in mouse embryos .1. Sverdlov E.D., and Siebert P.D.,
extensive reprogramming at the one-cell Suppression subtractive hybridization: A
and 2-cell stages, Development, 1991; method for generating differentially
112: 921-932. regulated or tissue-specific cDNA probes
[54] Adjaye J., Bolton V., and Monk M., and libraries, Proc. Natl. Acad. Sci. U.S.A.,
Developmental expression of specific 1996; 93: 6025-6030.
genes detected in high-quality cDNA [63] Zimmermann C.R., Orr W.C., Leclerc
libraries from single human R.F., Barnard E.C., and Timberlake W.E.,
preimplantation embryos, Gene, 1999; Molecular-cloning and selection of genes
237: 373-383. regulated in aspergillus development,
[55] Nothias J.Y., Majumder S., Kaneko K.J., Cell, 1980; 21: 709-715.
and Depamphilis M.L., Regulation of [64] Sharon D., Blackshaw S., Cepko C.L.,
gene-expression at the beginning of and Dryja T.P., Profile of the genes
mammalian development, J. Biol. Chem., expressed in the human peripheral retina,
1995; 270: 22077-22080. macula, and retinal pigment epithelium
[56] Kozian D.H., and Kirschbaum B.J., determined through serial analysis of
Comparative gene-expression analysis, gene expression (SAGE), Proc. Natl.
Trends Biotechno, 1999; 17: 73-78. Acad. Sci. U.S.A., 2002; 99: 315-320.
[57] Liang P., and Pardee A.B., Differential [65] Van Den Berg A., Van Der Leij J., and
display of eukaryotic messenger-RNA by Poppema S., Serial analysis of gene
means of the polymerase chain-reaction, expression: rapid RT-PCR analysis of
Science, 1992; 257: 967-971. unknown SAGE tags, Nucl. Acids Res.,
[58] Alwine J.C., Kemp D.J., and Stark G.R., 1999; 27: e17-e17.
Chiang Mai J. Sci. 2007; 34(3) 383
[66] Velculescu V.E., Zhang L., Vogelstein B., [77] Wildsmith S.E., and Elcock F.J.,
and Kinzler K.W., Serial analysis of gene Microarrays under the microscope,
expression, Science, 1995; 270: 484-487. J. Clinic. Patho. Mol. Patho., 2001; 54:
[67] Adams M.D., Kelley J.M., Gocayne J.D., 8-16.
Dubnick M., Polymeropoulos M.H., [78] Southern E., Mir K., and Shchepinov M.,
Xiao H., Merril C.R., Wu A., Olde B., Molecular interactions on microarrays,
Moreno R.F., Kerlavage A.R., Mc Nat. Genet., 1999; 21: 5-9.
Combie W.R., and Venter J.C., [79] Lipshutz R.J., Fodor S.P.A., Gingeras T.R.,
Complementary-dna sequencing - and Lockhart D.J., High density synthetic
expressed sequence tags and human oligonucleotide arrays, Nat. Genet., 1999;
genome project, Science, 1991; 252: 21: 20-24.
1651-1656. [80] Schena M., Shalon D., Davis R.W., and
[68] Okubo K., Hori N., Matoba R., Niiyama Brown P.O., Quantitative monitoring of
T., Fukushima A., Kojima Y., and gene-expression patterns with a
Matsubara K., Large-scale cdna complementary-dna microarray, Science,
sequencing for analysis of quantitative and 1995; 270: 467-470.
qualitative aspects of gene-expression, [81] Butte A., The use and analysis of
Nat. Genet., 1992; 2: 173-179. microarray data, Nature Reviews Drug
[69] Ochs M.E., and Godwin A.K., Discovery, 2002: 1; 951-960.
Microarrays in cancer: Research and [82] Miller W., So many genomes, so little time,
applications, BioTechniques, 2003; 4-15. Nat. Biotechnol., 2000; 18: 148-149.
[70] Anderle P., Duval M., Draghici S., Kuklin [83] Young R.A., Biomedical discovery with
A., Littlejohn T.G., Medrano J.E., DNA arrays, Cell, 2000: 102: 9-15.
Vilanova D., and Roberts, M.A., Gene [84] T Hoen P.A.C., De Kort F., Van Ommen
expression databases and data mining, G.J.B., and Den Dunnen J.T., Fluorescent
Biotechniques, 2003; 36-44. labelling of cRNA for microarray
[71] Lockhart D.J., and Barlow C., Expressing applications, Nucleic Acids Res., 2003; 31:
what’s on your mind: DNA arrays and e24..
the brain. Nature Reviews Neuroscience, [85] Yuen T., Wurmbach E., Pfeffer R.L.,
2001; 2: 63-68. Ebersole B.J., and Sealfon S.C., Accuracy
[72] Southern E.M., Detection of specific and calibration of commercial
sequences among dna fragments oligonucleotide and custom cDNA
separated by gel-electrophoresis. J. Mol. microarrays, Nucleic Acids Res., 2002; 30:
Biol., 1975; 98: 503-517. e48.
[73] Kafatos F.C., Jones C.W., and Efstratiadis [86] Smith L., and Greenfield A., DNA
A., Determination of nucleic-acid microarrays and development, Hum.
sequence homologies and relative Mol. Genet., 2003; 12: R1-R8.
concentrations by a dot hybridization [87] Duyk G.M., Sharper tools and simpler
procedure, Nucleic. Acids. Res., 1979; 7: methods, Nat. Genet., 2002; 32: 465-468.
1541-1552. [88] Hegde P., Qi R., Abernathy K., Gay C.,
[74] Eisen M.B., and Brown P.O., DNA arrays Dharap S., Gaspard R., Hughes J.E.,
for analysis of gene expression, Methods Snesrud E., Lee N., and Quackenbush J.,
Enzymol., 1999; 303: 179-205. A concise guide to cDNA microarray
[75] Lander E.S., Array of hope, Nat. Genet., analysis, BioTechniques, 2000; 29: 548-
1999; 21: 3-4. 562.
[76] Phimister B., Going global, Nat. Genet.,
1999; 21: 1-1.
384 Chiang Mai J. Sci. 2007; 34(3)
[89] Stoeckert C.J., Causton H.C., and Ball [97] Yao J.B., Ren X.N., Ireland J.J., Coussens
C.A., Microarray databases: standards P.M., Smith T.P.L., and Smith G.W.,
and ontologies, Nat. Genet., 2002; 32: Generation of a bovine oocyte cDNA
469-473. library and microarray: resources for
[90] Li X.M., Gu W.K., Mohan S., and Baylink identification of genes important for
D.J., DNA microarrays: Their use and follicular development and early
misuse, Microcirculation, 2002; 9: 13-22. embryogenesis, Physiological Genomics,
[91] Metcalfe A.D., Bloor D.J., Lieberman 2004; 19: 84-92.
B.A., Kimber S.J., and Brison D.R., [98] Mamo S., Sargent C., Affara N.,
Amplification of representative c-DNA Wimmers K., Ponsuksili S., Gilles M.,
pools from single human oocytes and and Schellander K., Construction of
pronucleate embryos, Mol. Reprod. Dev., stage-specific cDNA microarray, and
2003; 65: 1-8. analysis of in vitro produced pre-
[92] Tanaka T.S., Kunath T., Kimber W.L., implantation stage bovine embryos for
Jaradat S.A., Stagg C.A., Usuda M., developmental competence, Reprod.
Yokota T., Niwa H., Rossant J., and Ko Fertil. Dev., 2005; 17: 264-264.
M.S.H., Gene expression profiling of [99] Sirard M.A., Dufort I., Vallee M.,
embryo-derived stem cells reveals Massicotte L., Gravel C., Reghenas H.,
candidate genes associated with Watson A.J., King W.A., and Robert C.,
pluripotency and lineage specificity, Potential and limitations of bovine-
Genome Res., 2002; 12: 1921-1928. specific arrays for the analysis of mRNA
[93] Adjaye J., Huntriss J., Herwig R., levels in early development: preliminary
BenKahla A., Brink T.C., Wierling C., analysis using a bovine embryonic array,
Hultschig C., Groth D., Yaspo M.L., Reprod. Fertil. Dev. 2005; 17: 47-57.
Picton H.M., Gosden R.G., and Lehrach [100]Wrenzycki C., Brambrink T., Herrmann
H., Primary differentiation in the human D., Carnwath J.W., and Niemann H.,
blastocyst: Comparative molecular Construction of a bovine cdna array to
portraits of inner cell mass and monitor gene expression profiles in
trophectoderm cells, Stem Cells, 2005; bovine preimplantation embryos,
23: 1514-1525. Reprod. Fertil. Dev., 2004; 16: 248-248.
[94] Kelly D.L., and Rizzino A., DNA [101]Ushizawa K., Herath C., Kaneyama K.,
microarray analyses of genes regulated Shiojima S., Hirasawa A., Takahashi T.,
during the differentiation of embryonic Imai K., Ochiai K., Tokunaga T.,
stem cells, Mol. Reprod. Dev., 2000; 56: Tsunoda Y., Tsujimoto G., and
113-123. Hashizume K., cDNA microarray
[95] Brambrink, T., Wabnitz, P., Halter, R., analysis of bovine embryo gene
Klocke, R., Carnwath, J., Kues, W., expression profiles during the pre-
Wrenzycki, C., Pau, D., and Niemann, H., implantation period. Reprod, Biol.
Application of cDNA Arrays to monitor Endo., 2004; 2: 77.
mRNA profiles in single preimplantation [102]Camargo L.S.A., Powell A.M., Filho
mouse embryos, BioTechniques, 2002; V.R.V., and Wall R.J., Comparison of
33, 376-378. gene expression in individual
[96] Dalbies-Tran R., and Mermillod P., Use preimplantation bovine embryos
of heterologous complementary DNA produced by in vitro fertilisation or
array screening to analyze bovine oocyte somatic cell nuclear transfer, Reprod.
transcriptome and its evolution during in Fert. Develop., 2005; 17: 487-496.
vitro maturation, Biol. Reprod., 2003; 68:
252-261.
Chiang Mai J. Sci. 2007; 34(3) 385
[103] Pfister-Genskow M., Myers C., Childs endometrial genes regulated by early
L.A., Lacson J.C., Patterson T., pregnancy, progesterone, and interferon
Betthauser J.M., Goueleke P.J., Koppang tau in the ovine uterus. Biol. Reprod,
R.W., Lange G., Fisher P. Watt S.R., 2006; 74: 383-394.
Forsberg E.J., Zheng Y., Leno G.H., [108] Klein C., Bauersachs S., Ulbrich S.E.,
Schultz R.M., Liu B., Chetia C., Yang X., Einspanier R., Meyer H.H.D., Schmidt
Hoeschele I., Eilertsen K.J., Identification S.E.M., Reichenbach H.D., Vermehren
of differentially expressed genes in M., Sinowatz F., Blum H., and Wolf E.,
individual bovine preimplantation Monozygotic twin model reveals novel
embryos produced by nuclear transfer: embryo-induced transcriptome changes
Improper reprogramming of genes of bovine endometrium in the
required for development, Biol. preattachment period, Biol. Reprod.,
Reprod., 2005; 72: 546-555. 2006; 74: 253-264.
[104] Chuaqui R.F., Bonner R.F., Best C.J.M., [109] Rajeevan M.S., Vernon S.D., Taysavang
Gillespie J.W., Flaig M.J., Hewitt S.M., N., and Unger E.R., Validation of array-
Phillips J.L., Krizman D.B., Tangrea based gene expression profiles by real-
M.A., Ahram M., Linehan W.M., time (kinetic) RT-PCR, J. Mol. Diag.,
Knezevic V., and Emmert-Buck M.R., 2001; 3: 26-31.
Post-analysis follow-up and validation of [110] Walker N.J., A technique whose time has
microarray experiments, Nat. Genet., come, Science, 2002; 296: 557-559.
2002; 32: [111] El-Halawany, N., Ponsuksili, S.,
509-514. Wimmers, K., Gilles, M., Tesfaye, D.,
[105] Dhanasekaran S.M., Barrette T.R., Ghosh and Schellander, K., Quantitative
D., Shah R., Varambally S., Kurachi K., expression analysis of blastocyst-derived
Pienta K.J., Rubin M.A., and Chinnaiyan gene transcripts in preimplantation
A.M., Delineation of prognostic developmental stages of in vitro-
biomarkers in prostate cancer, Nature, produced bovine embryos using real-
2001; 412: 822-826. time polymerase chain reaction
[106] Emmert-Buck M.R., Strausberg R.L., technology. Reproduction Fertility and
Krizman D.B., Bonaldo M.F., Bonner Development, 2004; 16: 753-762.
R.F., Bostwick D.G., Brown M.R., [112] Rizos D., Gutierrez-Adan A., Perez-
Buetow K.H., Chuaqui R.F., Cole K.A., Garnelo S., De La Fuente J., Boland
Duray P.H., Englert C.R., Gillespie J.W., M.P., and Lonergan P., Bovine embryo
Greenhut S., Grouse L., Hillier L.W., culture in the presence or absence of
Katz K.S., Klausner R.D., Kuznetzov V., serum: Implications for blastocyst
Lash A.E., Lennon G., Linehan W.M., development, cryotolerance, and
Liotta L.A., Marra M.A., Munson P.J., messenger RNA expression, Biol.
Ornstein D.K., Prabhu V.V., Prang C., Reprod., 2003; 68: 236-243.
Schuler G.D., Soares M.B., Tolstoshev [113] Rizos D., Lonergan P., Boland M.P.,
C.M., Vocke C.D., and Waterston R.H., Arroyo-Garcia R., Pintado B., De La
Molecular profiling of clinical tissues Fuente J., and Gutierrez-Adan A.,
specimens: feasibility and applications, J. Analysis of differential messenger RNA
Mol. Diagn., 2000; 2: 60-66. expression between bovine blastocysts
[107] Gray, C.A., Abbey, C.A., Beremand, produced in different culture systems:
P.D., Choi, Y.S., Farmer, J.L., Adelson, Implications for blastocyst quality, Biol.
D.L., Thomas, T.L., Bazer, F.W., and Reprod., 2002; 66: 589-595.
Spencer, T.E., Identification of
386 Chiang Mai J. Sci. 2007; 34(3)
[114] Larue L., Ohsugi M., Hirchenhain J., and [122] Knott J.G., Kurokawa M., Fissore R.A.,
Kemler R., E-Cadherin null mutant Schultz R.M., and Williams C.J.,
embryos fail to form a trophectoderm Transgenic RNA interference reveals role
epithelium, Proc. Natl. Acad. Sci. U.S.A., for mouse sperm phospholipase Czeta
1994; 91: 8263-8267. in triggering Ca2+ oscillations during
[115] Riethmacher D., Brinkmann V., and fertilization, Biol. Reprod., 2005; 72:
Birchmeier C., A targeted mutation in 992-996.
the mouse e-cadherin gene results in [123] Sonn S., Khang I., Kim K., and Rhee
defective preimplantation development, K., Suppression of Nek2A in mouse
Proc. Natl. Acad. Sci. U.S.A., 1995; 92: early embryos confirms its requirement
855-859. for chromosome segregation, J. Cell Sci.,
[116] Fire A., Xu S.Q., Montgomery M.K., 2004; 117: 5557-5566.
Kostas S.A., Driver S.E., and Mello C.C., [124] Stein P., Svoboda P., Anger M., and
Potent and specific genetic interference Schultz R.M., RNAi: Mammalian
by double-stranded RNA in oocytes do it without RNA-dependent
Caenorhab-ditis elegans, Nature, 1998; RNA polymerase, Rna-a Publication of
391: 806-811. the Rna Society, 2003; 9, 187-192.
[117] Alizadeh Z., Kageyama S., and Aoki F., [125] Stein P., Svoboda P., and Schultz R.M.,
Degradation of maternal mRNA in Transgenic RNAi in mouse oocytes: a
mouse embryos: selective degradation simple and fast approach to study gene
of specific mRNAs after fertilization, function, Dev. Biol., 2003; 256: 187-193.
Mol. Reprod. Dev., 2005: 72; 281-290. [126] Svoboda P., Long dsRNA and silent
[118] Grabarek J.B., Plusa B., Glover D.M., genes strike back : RNAi in mouse
and Zernicka-Goetz M., Efficient oocytes and early embryos, Cytogenet.
delivery of dsRNA into zona-enclosed Genome Res., 2004; 105: 422-434.
mouse oocytes and preimplantation [127] Svoboda P., Stain P., Hayashi H., and
embryos by electroporation, Genesis, Schultz R.M., Selective reduction of
2002; 32: 269-276. dormant maternal mRNAs in mouse
[119] Gui U.M., and Joyce L.A., RNA oocytes by RNA interference.
interference evidence that growth Development, 2000; 127: 4147-4156.
differentiation factor-9 mediates clocyte [128] Svoboda P., Stein P., and Schultz R.M.,
regulation of cumulus expansion in mice, RNAi in mouse oocytes and preimplan-
Biol. Reprod., 2005; 72: 195-199. tation embryos: Effectiveness of hairpin
[120] Haraguchi S., Saga Y., Naito K., Inoue dsRNA, Biochem. Biophys. Res.
H., and Seto A., Specific gene silencing Commun., 2001; 287: 1099-1104.
in the pre-implantation stage mouse [129] Wianny F., and Zernicka-Goetz M.,
embryo by an siRNA expression vector Specific interference with gene function
system, Mol. Reprod. Dev., 2004; 68: by double-stranded RNA in early mouse
17-24. development, Nature Cell Biology, 2000;
[121] Kim M.H., Yuan X.M., Okumura S., and 2: 70-75.
Ishikawa F., Successful inactivation of [130] Xu Z., Williams C.J., Kopf G.S., and
endogenous Oct-3/4 and c-mos genes Schultz R.M., Maturation-associated
in mouse preimplantation embryos and increase in IP3 receptor type 1: Role in
oocytes using short interfering RNAs, conferring increased IP3 sensitivity and
Biochem. Biophys. Res. Commun., Ca2+ oscillatory behavior in mouse
2002; 296: 1372-1377. eggs, Dev. Biol., 2003; 254: 163-171.
Chiang Mai J. Sci. 2007; 34(3) 387
[131] Anger M., Klima J., Kubelka M., [137] Krichevsky A.M., and Kosik K.S., RNAi
Prochazka R., Motlik J., and Schultz R.M., functions in cultured mammalian
Timing of Plk1 and MPF activation neurons, Proc. Natl. Acad. Sci. U. S. A.,
during porcine oocyte maturation, Mol. 2002; 99: 11926-11929.
Reprod. Dev., 2004: 69; 11-16. [138] Rossi J.J., RNAi as a treatment for HIV-
[132] Cabot R.A., and Prather R.S., Cleavage 1 infection, Biotechniques, 2006; 40:
stage porcine embryos may have 25-29.
differing developmental requirements [138] Tsuneoka M., Koda Y., Soejima M., Teye
for Karyopherins alpha 2 and alpha 3, K., and Kimura H., A novel Myc target
Mol. Reprod. Dev., 2003; 64: 292-301. gene, mina53, that is involved in cell
[133] Tesfaye D., Lonergan P., Hoelker M., proliferation, J. Biol. Chem., 2002; 277:
Rings F., Nganvongpanit K., Havlicek 35450-35459.
V., Besenfelder U., Jennen D., Tholen E., [139] Cogoni C., and Macino G., Homology-
and Schellander K., Suppression of dependent gene silencing in plants and
connexin 43 and E-cadherin transcripts fungi: a number of variations on the
in in vitro derived bovine embryos same theme, Curr. Opin. Microbiol.,
following culture in vitro or in vivo in 1999; 2: 657-662.
the homologous bovine oviduct, Mol. [139] Gaur R.K., RNA interference: a potential
Reprod. Dev., 2007; 74(8) : 978-88. therapeutic tool for silencing splice
[134] Nganvongpanit K., Muller H., Rings F., isoforms linked to human diseases,
Gilles M., Jennen D., Holker M., Tholen Biotechniques, 2006; 40: 15-22.
E., Schellander K., and Tesfaye D., [140] Elmayan T., Balzergue S., Beon F.,
Targeted suppression of E-cadherin Bourdon V., Daubremet J., Guenet Y.,
gene expression in bovine Mourrain P., Palauqui J.C., Vernhettes S.,
preimplantation embryo by RNA Vialle T., Wostrikoff K., and Vaucheret
interference technology using double- H., Arabidopsis mutants impaired in
stranded RNA, Mol. Reprod. Dev., 2006; cosuppression, Plant Cell, 1998; 10:
73: 153-163. 1747-1757.
[135] Nganvongpanit K., Muller H., Rings F., [141] Furner I.J., Sheikh M.A., and Collett
Hoelker M., Jennen D., Tholen E., C.E., Gene silencing and homology-
Havlicek V., Besenfelder U., Schellander dependent gene silencing in Arabidopsis:
K., and Tesfaye D., Selective degradation Genetic modifiers and DNA
of maternal and embryonic transcripts methylation, Genetics, 1998; 149: 651-
in in vitro produced bovine oocytes and 662.
embryos using sequence specific double- [142] Dehio C., and Schell J., Identification of
stranded RNA, Reproduction, 2006; 131: plant genetic-loci involved in a
861-874. posttranscriptional mechanism for
[136] Paradis F., Vigneault C., Robert C., and meiotically reversible transgene silencing,
Sirard M.A., RNA interference as a tool Proc. Natl. Acad. Sci. U.S.A., 1994; 91:
to study gene function in bovine oocytes, 5538-5542.
Mol. Reprod. Dev., 2005; 70: 111-121. [143] Kelly W.G., and Fire A., Chromatin
[137] Brown A.E., and Catteruccia F., Toward silencing and the maintenance of a
silencing the burden of malaria: progress functional germline in Caenorhabditis
and prospects for RNAi-based elegans, Development, 1998; 125: 2451-
approaches, Biotechniques, 2006; 40: 2456.
38-44.
388 Chiang Mai J. Sci. 2007; 34(3)
[144] Ketting R.F., Haverkamp T.H.A., Van Papalopulu N., Papaioannou V.E.,
Luenen H., and Plasterk R.H.A., mut-7 Glover D.M., and Zernicka-Goetz M.,
of C-elegans, required for transposon Downregulation of Par3 and aPKC
silencing and RNA interference, is a function directs cells towards the ICM
homolog of Werner syndrome helicase in the preimplantation mouse embryo,
and RnaseD, Cell, 1999; 99: 133-141. J. Cell Sci., 2005; 118: 505-515.
[145] Misquitta L., and Paterson B.M., [151] Lefebvre C., Terret M.E., Djiane A.,
Targeted disruption of gene function in Rassinier P., Maro B., and Verlhac M.H.,
Drosophila by RNA interference (RNA- Meiotic spindle stability depends on
i): A role for nautilus in embryonic MAPK-interacting and spindle-
somatic muscle formation, Proc. Natl. stabilizing protein (MISS), a new MAPK
Acad. Sci. U.S.A., 1999; 96: 1451-1456. substrate. J. Cell Biol., 2002; 157: 603-
[146] Paddison P.J., Caudy A.A., Bernstein E., 613.
Hannon G.J., and Conklin D.S., Short [152] Terret M.E., Lefebvre C., Djiane A.,
hairpin RNAs (shRNAs) induce Rassinier P., Moreau J., Maro B., and
sequence-specific silencing in Verlhac M.H., DOC1R: a MAP kinase
mammalian cells, Genes Dev., 2002; 16: substrate that control microtubule
948-958. organization of metaphase II mouse
[147] Ruiz F., Vayssie L., Klotz C., Sperling L., oocytes, Development, 2003; 130: 5169-
and Madeddu L., Homology-dependent 5177.
gene silencing in Paramecium, Mol. Biol. [153] Ma J., Zhou H.L., Su L., and Ji W.Z.,
Cell, 1998; 9: 931-943. Effects of exogenous double-stranded
[148] Wang Z.F., Morris J.C., Drew M.E., and RNA on the basonuclin gene expression
Englund P.T., Inhibition of in mouse oocytes, Science in China Series
Trypanosoma brucei gene expression by C-Life Sciences, 2002; 45: 593-603.
RNA interference using an integratable [154] Fedoriw A.M., Stein P., Svoboda P.,
vector with opposing T7 promoters, J. Schultz R.M., and Bartolomei M.S.,
Biol. Chem., 2000; 275: 40174-40179. Transgenic RNAi reveals essential
[149] Wargelius A., Ellingsen S., and Fjose A., function for CTCF in H19 gene
Double-stranded RNA induces specific imprinting, Science, 2004; 303: 238-240.
developmental defects in zebrafish [155] Yu J.Y., Hecht N.B., and Schultz R.M.,
embryos, Biochem. Biophys. Res. Expression of MSY2 in mouse oocytes
Commun., 1999; 263: 156-161. and preimplantation embryos, Biol.
[150] Plusa B., Frankenberg S., Chalmers A., Reprod., 2001; 65: 1260-1270.
Hadjantonakis A.K., Moore C.A.,

Development

Issue 1 (January)
Issue 2 (February)
Issue 3 (March)
Issue 4 (April)
Issue 5 (May)
Issue 6 (June)
Issue 7 (July)
Issue 8 (August)
Issue 9 (September)
Issue 10 (October)
Issue 11 (November)
Issue 12 (December)
ISSN 0121-3784
1 of 1 http://www.lrrd.org/lrrd19/lrrd19.htm
Livestock Research for Rural Development, Volume 19, Number 8, August 2007
(Medicago sativa) on feed intake and weight gain; M N Kinuthia, M M Wanyoike, C K Gachuiri
and J W Wakhungu
116. Cost benefit analysis of yak and yak-cow cross breed in Baltistan, Northern Pakistan; A Hassan,
M Ishaq and S H Saddozai
117. Determination of the optimum level of a soybean oil drench with respect to rumen ecosystem,
feed intake and digestibility in cattle; Nguyen Thi Hong Nhan, Nguyen Trong Ngu, Nguyen
Thiet, T R Preston and R A Leng
118. Effect of different housing and feeding systems on the performances of broiler rabbit in Eastern
Himalayan Region of India; S K Das and A K Sikka
119. Effect of Foot and Mouth Disease (FMD) vaccination in linkage villages of IVRI's India; B P
Singh, M C Sharma and R Tiwari
120. Effect of Moringa oleifera leaf meal as a substitute for sunflower seed meal on performance of
laying hens in Tanzania; A M V Kakengi, J T Kaijage, S V Sarwatt, S K Mutayoba, M N Shem
and T Fujihara
Administrative
LRRD News
Norms for preparation of papers for LRRD
2 of 2 http://www.lrrd.org/lrrd19/8/cont1908.htm
Determination of the optimum level of a soybean oil drench with respect to rumen ecosystem, feed intake and digestibility in cattle
Guide for preparation Citation of this

Livestock Research for Rural Development 19 (8) 2007 LRRD News
of papers paper
Determination of the optimum level of a soybean oil drench with respect to

rumen ecosystem, feed intake and digestibility in cattle
Nguyen Thi Hong Nhan, Nguyen Trong Ngu, Nguyen Thiet, T R Preston* and R A Leng**
College of Agriculture, Cantho University, Cantho, Vietnam
nthnhan@ctu.edu.vn ; ntngu@ctu.edu.vn ; nthiet@ctu.edu.vn
*
UTA Colombia, AA48 Socorro, Santander, Colombia
**
PO Box 814, Coolum Beach 4573, Australia
Abstract
Four rumen-fistulated Sindhi-Yellow cattle were fed a basal diet of rice straw and grass (1:1 DM basis) and given a single drench of 2, 4, 6 or 8 ml/kg
LW of soybean oil in successive 30 day periods according to a 4*4 Latin square arrangement. Days 1 to 10 in each period were for adaptation (or
re-faunation for 2nd, 3rd and 4th periods). The single oil drench was given and measurements of rumen ecology, feed intake and digestibility were
done in successive sub-periods of 5 days (days 1-5; 6-10, 11-15, 16-20 after defaunation).
Oil treatment removed most of the protozoa, lowered the concentration of ammonia and increased the numbers of bacteria. There were linear
increases in DM intake and DM digestibility according to the level of oil drench in the periods of 10 to 15 days and 16 to 20 days after giving oil. The
use of 6 ml of oil/kg is suggested as the most appropriate dose level.
Keywords: bacteria, digestibility, feed intake, oil drench, protozoa
Introduction
Eliminating protozoa from the rumen with chemicals such as Dioctyl sodium sulfosuccinate (Demeyer and Van Nevel
1979) or Ethoxylated nonyl phenol (Bird et al 1979) is a difficult procedure, which may result in the death of animals.
Thus, despite the potential benefits in animal productivity (Bird and Leng 1984), there was little impact of this
technology at farmer level (Leng R A, personal communication).
Soybean oil containing elevated proportions of long-chain poly-unsaturated fatty acids has been used for defaunation in
sheep (Broudiscou et al 1990). However, a practical way of applying this technique has been developed only in Vietnam
(Nhan et al 2001) and confirmed in Cambodia (Seng Mom et al 2001). In those studies, it was shown that an oil dose of 5
ml/kg LW had positive effects on cattle performance in terms of faster growth rate and better feed conversion ratio. So
far, an appropriate oil level for drenching and how it affects the rumen ecosystem has received little attention. Therefore,
the following trial was set up to examine responses of cattle to different levels of oil drench.
Animals and diets
Four Sindhi x Yellow cattle of 180 - 200 kg fitted with permanent rumen cannulae were allocated to treatments according
to a 4*4 Latin square design. Each period consisted of 30 days in which, the first 10 days were for adaptation followed by
oil administration and data collection of rumen ecology, feed intake and digestibility in successive 5-day sub-periods 1-5;
6-10; 11-15 and 16-20 days after oil administration. The animals were fed on a basal diet of rice straw and natural grass
(1:1 DM basis) and given a single drench of soybean oil at 2, 4, 6 or 8 ml/kg LW. The chemical composition of the
experimental diets is presented in Table 1.
Table 1. Chemical analysis of the feed components

DM % (DM basis)
% N*6.25 EE ADF NDF Ash
Rice straw 89.4 5.9 1.4 39.4 67.1 15.4
Para grass 17.7 11.6 4.0 31.7 59.6 11.9
Experimental procedure
Feces, feed offered and refused were recorded daily from day 1 to day 20 for digestibility evaluation. Samples of rumen
fluid (100 ml) were taken by a plastic tube and syringe every day in the morning before feeding, and 2h and 6h
post-feeding. Protozoa biomass and numbers of bacteria were counted under a microscope using 0.1 and 0.2 mm counting
chambers. pH value was determined by a digital pH meter. Ammonia concentration was measured by steam distillation of
a 20 ml sample rumen fluid, with collection of the ammonia in boric acid solution and titration with 0.1 N H2SO4.
Data analysis
Values of pH, protozoa and bacteria number, ammonia were averaged over sampling periods of 5 collection days and
analyzed by the General Linear Model of the ANOVA program in the Minitab Software (version 13.2).
Results
Rumen ecosystem
The oil drench eliminated most of the protozoa population in the rumen (Table 2 and Figure 1) and, as a consequence, the
numbers of rumen bacteria were remarkably increased (Table 3 and Figure 2). In fact, the higher the oil administration the
lower the numbers of protozoa observed in all sub-periods. At levels of 6 and 8 ml of oil/kg LW, the protozoa population
was less than 1*105, while these values were 4 times higher in treatments of 2 and 4 ml of oil/kg LW. In an opposite
trend, higher bacteria populations were counted in treatments of 6 and 8 ml of oil/kg LW with significant difference
(P<0.01) in all sub-periods except for the first one.
Table 2. Number of rumen protozoa before (0h), 2h and 6h post-feeding during 20 days
after oil drench
Days after oil Oil drench (ml/kg live weight)
P
drench 2 4 6 8
Numbers of protozoa 0h (105)
a
2-5 4.90 3.85 a 0.70 b 0.55 b 0.001
6-10 4.60 a 4.48 a 0.50 b 0.70 b 0.001
11-15 4.55 a 4.33 a 0.70 b 0.78 b 0.001
16-20 5.13 a 4.63 a 0.83 b 0.98 b 0.001
2-5 5.10 a 4.75 a 0.93 b 0.73 b 0.001
6-10 4.85 a 4.65 a 0.60 b 0.38 b 0.001
11-15 4.65 a 4.60 a 0.93 b 0.45 b 0.001
16-20 4.55 a 4.23 a 1.30 b 0.73 b 0.001
2-5 4.25 a 5.13 a 1.03 b 0.60 b 0.001
a a b
6-10 5.20 4.36 0.48 0.45 b 0.001
11-15 4.55 a 4.58 a 0.75 b 0.31 b 0.001
16-20 4.60 a 4.73 a 1.23 b 0.86 b 0.001
a,b Means in the same row for each parameter with different superscripts are significantly
different (P < 0.05)
Table 3. Numbers of rumen bacteria before (0h), 2h and 6h post-feeding during 20 days
after oil drench
Days after oil Oil drench (ml/kg live weight)
P
drench 2 4 6 8
Number of bacteria 0h (108)
2-5 4.32 4.41 4.07 5.22 0.874
6-10 4.23 b 4.30 b 6.68 ab 9.23 a 0.004
11-15 4.37 c 4.98 c 7.45 b 9.69 a 0.001
16-20 4.63 c 5.75 bc 10.53 ab 12.04 a 0.006

8
Number of bacteria 2h (10 )
2-5 4.16 4.03 4.47 5.78 0.620
6-10 4.48 b 5.46 b 7.02 ab 11.11 a 0.006
11-15 5.15 b 5.53 b 8.89 a 10.65 a 0.001
16-20 5.09 b 6.03 b 9.74 a 11.30 a 0.003
Number of bacteria 6h (108)
2-5 4.41 4.01 5.13 5.68 0.700
6-10 4.22 b 5.62 b 6.63 ab 9.58 a 0.010
11-15 5.21 c 5.94 c 8.76 b 10.44 a 0.001
b b a
16-20 5.01 6.36 10.53 11.33 a 0.001
a,b Means in the same row for each parameter with different superscripts are significantly
different (p < 0.05)
Figure 1. Numbers of protozoa (105) in rumen fluid in successive Figure 2. Numbers of bacteria (108) in rumen fluid in successive
time periods after an oil dose of 2, 4, 6 or 8 ml kg/LW time periods after an oil dose of 2, 4, 6 or 8 ml kg/LW
Intake and apparent digestibility
In general, feed intake was affected in all treatments in the first sub-period as cattle were stressed and did not show any
wish to drink or eat during the first day after being drenched. However, this activity improved daily and by day 5 the
cattle were totally recovered. DM intake was therefore lowest in the first sub-period (Table 4) and did not show any
significant differences among 4 levels of oil administration (P>0.05). In the 3rd and 4th sub-period, DM intake increased
with the increase in the oil drench (P<0.01). For example, at 2 ml of oil/kg LW, cattle consumed 2.99 kg DM/d, but this
value increased up to 3.13, 3.40 and 3.64 kg DM/d in treatments of 4, 6 and 8 ml of oil/kg LW, respectively. In addition,
levels of oil supplement had a close relationship with DM intake as reflected by the determination coefficient value
(R2=0.98) (Figure 3).
Table 4. DM intake and apparent digestibility of cattle during 20 days after oil
drench
Days in each Oil supplement (ml/kg live weight)
P
period 2 4 6 8
DM intake (kg/d)
2-5 2.10 1.95 2.21 1.91 0.670
6-10 2.96 3.02 3.02 3.10 0.600
11-15 2.94 c 3.22 bc 3.38 ab 3.64 a 0.002
16-20 2.99 c 3.13 bc 3.40 ab 3.64 a 0.020
DM digestibility (%)
2-5 33.0 b 34.7 ab 42.8 a 39.3 ab 0.025
6-10 40.4 b 42.7 b 45.4 ab 49.1 a 0.015

a b b
11-15 41.6 45.2 48.6 52.6 c 0.001
16-20 40.1 a 46.1 b 53.6 c 54.6 c 0.001
a,b,c Means in the same row for each parameter with different superscripts are
significantly different (P < 0.05)
In spite of similar feed intake in some sub-periods, DM digestibility was found statistically different at all oil levels in the
whole period of 20 days after the oil drench. Significantly higher DM digestibility was measured in treatments of 6 and 8
of oil/kg LW particularly in the last sub-period; the difference was about 15% units in digestibility between the lowest
and highest oil supplement (P<0.01) (Table 4). A high correlation between DM digestibility and different oil levels was
also recorded as shown in Figure 4.
Figure 3. Relationship between DM intake and different Figure 4. Relationship between DM digestibility and different
levels of oil drench (■ 11-15 days; ■ 16-20 days) levels of oil drench (■ 11-15 days; ■ 16-20 days)
Discussion
The protozoa population was reduced by more than 70% due to the toxic effect of the unsaturated fat in the soybean oil
on surface and absorption activities of protozoa cell walls (Dawson and Kemp 1969). This is supported by several studies
done in sheep (Ikwuegbu and Sutton 1982) and in cattle (Seng Mom et al 2001). Moreover, irrespective of time, a higher
level of oil drench resulted in lower numbers of protozoa counted in the rumen. In this study, an oil level of 6 or 8 ml/kg
LW had a similar influence on eliminating a large proportion of protozoa, thus for economical reasons, the lower dose is
suggested for cattle defaunation.
There is conclusive evidence on the interaction between bacteria and protozoa. The remarkable increase in bacteria
numbers in this experiment reflected this interaction and is supported by various findings, one of which was a study done
by Rowe et al (1985), who reported a considerably higher number of bacteria in defaunated animals. The higher bacterial
growth efficiency in the absence of the protozoa in the rumen is probably related to the fact that protozoa engulf and
digest bacteria (Coleman 1975). This is supported by Leng (1990), who discovered that removal of protozoa or a decrease
in protozoal density in the rumen can be expected to increase ruminant production under most feeding conditions
pertaining to roughage-fed ruminants.
The increase of feed intake over a longer period in cattle received a high level of oil administration is in agreement with
the results of Bird et al (1994) and Seng Mom et al (2001), who reported a higher intake in defaunated sheep and cattle.
Similar results were also demonstrated by Trach and Thom (2004), in which defaunated cattle receiving 5 ml of oil/kg
LW consumed more rice straw than normal animals. In terms of DM intake, an oil level of 6 or 8 ml/kg LW seems to be
appropriate in defaunating cattle according to the present study. However, defaunation does not always lead to increased
feed intake as, according to Ankrah et al (1990) and Chaudhary et al (1995), intakes of DM in sheep and buffalo calves,
respectively, were not affected by defaunation.
There are conflicting reports as to the extent that defaunation affects digestibility. Veira et al (1983) reported a positive
influence on apparent digestibility of both OM and starch. Bird and Leng (1985) also found an improvement up to 18%
units of DM digestibility in defaunated sheep, which is comparable to the value of approximately 15% units of
digestibility increase in the current research. Similar results were found in buffaloes by Chaudhary and Srivastava (1995)
and in cattle by Nhan et al (2001). In contrast, Rowe et al (1985) reported a significant reduction of OM digestibility in
the whole digestive tract while Chaudhary et al (1995) found no difference in DM and OM digestibility in goats fed a
straw-based diet with and without elimination of protozoa. The linear correlation between DM digestibility and levels of
oil drench suggests the effectiveness of elimination of protozoa on feed digestion in this study. On the contrary, other
researchers seem to agree on the important role of protozoa in the degradation of plant materials and therefore they may
have positive effects on the nutrition of the host (Kayouli et al 1983; Ushida and Jouany 1990). The explanation for the
improvement in feed digestibility can be that (i) feed digestion by bacteria and fungi has compensated for those digested
by protozoa and (ii) the elimination of predatory activity of protozoa has increased the number of bacteria (Bird et al
1994).
Conclusions
Oil treatment removed most of the protozoa and increased the numbers of bacteria.
There were linear increases in DM intake and DM digestibility according to the increasing levels of oil drench in
the sub-periods 10-15 and 16-20 days after oil administration.
The use of 6 ml of oil/kg LW is suggested as the most appropriate dose in cattle defaunation.
References
Ankrah P, Loerch S C, Kampman K A and Dehority B A 1990. Effects of defaunation on in situ dry matter disappearance in steers and growth of
lambs. Journal of Animal Science, 68: 3330-3336.
Bird S H and Leng R A 1984 Further studies on the effect of the presence or absence of protozoa in the rumen on live weight and wool growth of
sheep. British Journal of Nutrition, 52: 607-611.
Bird S H and Leng R A 1985. Productivity responses to eliminating protozoa from the rumen of sheep. Reviews in Rural Science, 6: 109-117.
Bird S H, Romulo B and Leng R A 1994. Effect of lucerne supplementation and defaunation on feed intake, digestibility, N retention and
productivity of sheep fed straw based diets. Animal Feed Science and Technology, 45: 119-129.
Bird S H, Hill M K and Leng R A 1979 The effects of defaunation of the rumen on the growth of lambs on low-protein, high-energy diets. British
Journal of Nutrition 42: 81-87.
Broudiscou L, van Nevel C J and Demeyer D I 1990 Effect of soya oil hydrolyzate on rumen digestion in defaunated and refaunated sheep. Animal
Feed Science and Technology, 30: 51-67.
Chaudhary L C and Srivastava A 1995. Performance of growing murrah buffalo calves as affected by treatment of manoxol and presence of ciliate
protozoa in rumen. Animal Feed Science and Technology, Volume 51: 281-286.
Chaudhary L C, Srivastava A and Singh K K 1995. Rumen fermentation pattern and digestion of structural carbohydrates in buffalo (Bubalus
bubalis) calves as affected by ciliate protozoa. Animal Feed Science and Technology, Volume 56, Number 1, pp. 111-117
Coleman G S 1975. The interrelationships between rumen ciliate protozoa and bacteria. In: W. 258 McDonald and A. C. I. Warner (Editors),
Digestion and Metabolism in the Ruminant. The University of New England Publishing Unit, 149-164.
Dawson R M C and Kemp P 1969. The effect of defaunation on the phospholipids and on the hydrogenation of unsaturated fatty acids in the rumen.
Biochemical Journal, 115: 351-352.
Demeyer D I and Van Nevel C J 1979 Effect of defaunation on the metabolism of rumen micro-organism. British Journal of Nutrition, 42: 515-525.
Ikwuegbu O A and Sutton J D 1982 The effect of the amount of linseed oil supplementation on rumen metabolism in sheep. British Journal
Nutrition, 48: 365-375.
Kayouli C, Demeyer D I, Van Nevel C J and Dendooven R 1983. Effect of defaunation on straw digestion in sacco and on particle retention in the
rumen. Animal Feed Science and Technology, 10: 165-172.
Leng R A 1990. Factors affecting the utilization of poor-quality forages by ruminants particularly under tropical conditions. Nutrition Research
Reviews, 3: 27-91.
Trach N X and Thom M T 2004: Responses of growing beef cattle to a feeding regime combining road side grazing and rice straw feeding
supplemented with urea and brewers' grains following an oil drench. Livestock Research for Rural Development. Volume 16, Article # 53 from
http://www.cipav.org.co/lrrd/lrrd16/7/trach16053.htm
Nhan N T H, Hon N V, Ngu N T, Von N T, Preston T R and Leng R A 2001 Practical application of defaunation of cattle on farms in Vietnam:
response of young cattle fed rice straw and grass to a single drench of groundnut oil. Asian-Australasian Journal Animal Science, 14 (4): 485-490.
Rowe J B, Davies A and Broome A W 1985. Quantitative effects of defaunation on rumen fermentation and digestion in sheep. British Journal
Nutrition, 54 (1):105-119.
Seng Mom, Preston T R, Leng R A and ter Meulen U 2001 Response of young cattle fed rice straw to supplementation with cassava foliage and a
single drench of cooking oil. Livestock Research for Rural Development. Volume 13, Article # 134 from http://www.cipav.org.co/lrrd/lrrd13
/4/seng134.htm.
Ushida K and Jouany J P 1990. Effect of defaunation on fiber digestion in sheep given two isonitrogenous diets. Animal Feed Science and
Technology, 29: 153-158.
Veira D M, Ivan M and Jui P Y 1983 Rumen ciliate protozoa: effects on digestion in the stomach of sheep. Journal of Dairy Science,
66:1015-1022.
Received 14 July 2007; Accepted 27 July 2007; Published 6 August 2007
Go to top

Development

Issue 1 (January)
Issue 2 (February)
Issue 3 (March)
Issue 4 (April)
Issue 5 (May)
Issue 6 (June)
Issue 7 (July)
Issue 8 (August)
Issue 9 (September)
Issue 10 (October)
Issue 11 (November)
Issue 12 (December)
ISSN 0121-3784
Livestock Research for Rural Development, Volume 19, Number 9, September 2007
133. Effects of oil drench on growth rate of cattle fattened on grass, supplemented with molasses, rice
bran or rice straw; Nguyen Thi Hong Nhan, Nguyen Trong Ngu, Vo Van Son, T R Preston and R
A Leng
134. Determinants of smallholder dairy farmers' adoption of various milk marketing channels in
Kenya highlands; L M Mburu, J W Wakhungu and K W Gitu
135. Effect of variety and wilting on HCN content of cassava leaves and on intake, digestibility and
N retention by growing pigs; Chhay Ty, T R Preston and Khieu Borin
136. A note on the effect of fresh mulberry leaves, fresh sweet potato vine or a mixture of both
foliages on intake, digestibility and N retention of growing pigs given a basal diet of broken rice;
Chhay Ty, Khieu Borin and Chiv Phiny
137. Intake, digestibility and N retention by growing pigs fed ensiled or dried Taro (Colocasia
esculenta) leaves as the protein supplement in basal diets of rice bran/broken rice or rice
bran/cassava root meal; Chhay Ty, Khieu Borin, T R Preston and Meas Sokveasna
138. Strategies for the development of small- and medium-scale rabbit farming in South-East Asia; S
D Lukefahr
Administrative
LRRD News
Effects of oil drench on growth rate of cattle fattened on grass, supplemented with molasses, rice bran or rice straw
Guide for
Livestock Research for Rural Development 19 (9) Citation of
preparation of LRRD News
2007 this paper
papers
Effects of oil drench on growth rate of cattle fattened on grass,

supplemented with molasses, rice bran or rice straw
Nguyen Thi Hong Nhan, Nguyen Trong Ngu, Vo Van Son, T R Preston* and R A
Leng**
nthnhan@ctu.edu.vn ; ntngu@ctu.edu.vn ; vvson@ctu.edu.vn
*
trpreston@mekarn.org
**
rleng@ozmail.com.au
Abstract
This study was conducted to investigate the effects of defaunation in cattle received different sources of carbohydrate. The
hypothesis to be tested was that growth responses of cattle to a drench of soybean oil would be greater in the diet based on
molasses compared with rice straw. Experimental design followed a 3*2 factorial arrangement of three basal diets and with
or without an oil drench at 6 ml/kg live weight (LW). Individual treatments were MGU (30 % molasses + 70% grass + 50 g
urea/100 kg LW), RGU (50% rice straw + 50% grass + 50 g urea/100 kg LW) and RGR (45% rice straw + 45% grass + 10%
rice bran). Thirty growing cattle of 132-144 kg were allocated to 6 treatments (5 replicates per treatment) and the trial lasted
for 90 days.
Intakes were affected in the first 30 days after oil drench, but over the whole period these values were similar in defaunated
and faunated cattle. However, among rations, molasses supplementation has provided a significantly higher DM intake
(p<0.01). Changes in live weight of cattle were not statistically different although at the end of the experiment, cattle
received oil tended to growth faster than the other group (p=0.07). Diets and oil drench had strong effects on daily weight
gain of cattle (p<0.01) with highest average daily gain (p<0.01) on treatment MGU. Nevertheless, due to a high proportion
of molasses in the diet, the cost of MGU treatment was higher compared to the other two treatments. The diet with inclusion
of rice straw and urea (RGU) offered a lowest cost and thus greater benefit was found in this group.
In conclusion, the introduced system of feeding grass with rice straw and urea supplement with an oil drench resulted in
more financial profits to the farmers than the system normally practiced.
Key words: cattle, economic benefits, growth, oil drench
Introduction
Strategies to develop animal production systems in the tropics, which are sustainable and applicable,
must be based on locally available feed resources. Economic viability depends on achieving optimum
level of animal performance with minimum inputs of cost, scarce concentrate and protein
supplements. In Vietnam, rice straw is abundant in most provinces and molasses is also widely
available. Moreover, researchers have found that molasses, a by-product of sugar production, is one
such a component that can replace cereal grains as a component in diets for beef cattle production.
Molasses is traditionally used by farmers in Vietnam as a feed for pigs and cattle.
In principle, it is possible to improve the feeding value of rice straw with a number of treatment
techniques that have been developed (Trach and Thom 1998). A feeding trial carried out in An Giang
province (Nhan et al 2003) confirmed the advantages of the oil drench in increasing the live weight
gain of local Yellow cattle fed on untreated rice straw supplemented with cassava foliage. In a similar
trial in Lao, live weight gains of 289 g/day were reported in local Yellow cattle fed rice straw and
cassava foliage and given the same oil drench (Vyrapheth 2002 Missing). According to Seng et al
(2001), the oil drench has a defaunation effect which may improve rumen cellulolysis thus increasing
straw digestibility and intake, and eventually animal growth.
It is therefore proposed to measure the responses of growing cattle to the oil drench with a basal diet
of molasses compared with rice straw with the hypotheses that (i) there will be positive effects of
defaunation by soybean oil in cattle at local conditions and (ii) the research will establish a basis
background for an economical way of fattening cattle in Vietnam.
Location and animals
The experiment was carried out in co-operative farms in Angiang province. Five farmers, who
traditionally fatten cattle on rice straw and grass, were selected to participate in the study. Thirty
Sindhi x Yellow cattle of 132 - 144 kg were allocated to 6 treatments according to a 3*2 factorial
design with 5 replicates per treatment. The animals were vaccinated against foot and mouth disease
and dewormed before the initiation of the experiment. They were housed in individual pens; drinking
water and rumen supplement (1.5% sulphur, 5% salt, 5% bone meal, and 73.5% rice bran) were
available at all time. Cattle were fed totally in shed for the whole experimental period of 90 days.
Feeds and treatments
Rice straw was purchased from local farmers and Hymenachne acutigluna grass was planted in the
farms and harvested at 30 day interval (Photo 1).
Photo 1. Hymenachneacutigluna grass planted and Photo 2. Low-cost system of weighing cattle
harvested by farmers
The animals were fed on three basal diets with or without oil administration at the beginning of the
trial to provide totally six treatments:
MGU: 30 % molasses + 70% grass (DM basis) + 50 g urea/100 kg LW

MGUO: similar to MGU with oil drench at 6 ml/kg LW
RGU: 50% rice straw + 50% grass (DM basis) + 50 g urea/100 kg LW
RGUO: similar to RGU with oil drench at 6 ml/kg LW
RGR: 45% rice straw + 45% grass (DM basis) + 10% rice bran
RGRO: similar to RGR with oil drench at 6 ml/kg LW
Feed ingredients were supplied three times per day. To prevent selection, grass and rice straw were
chopped and mixed together and they were offered at 30% above the observed intake in the previous
day. Rice bran was prepared with some water so that cattle could eat it easily. Molasses and urea
were diluted in water and sprayed on the feeds given to individual cattle.
Measurements
Cattle were weighed (Photo 2) on consecutive mornings at the beginning and after 30, 60 and 90
days of the trial. Feed intake and residues were measured daily and representative samples were
collected and bulked weekly for chemical analysis including DM, CP and ash (AOAC 1990) and
NDF and ADF (Van Soest . At the end of the experiment, an economic estimation was drawn based
on the difference between benefit of cattle growth and other expenses during the fattening period.
Data analyses
All data were coded for subsequent statistical analysis using General Linear Model (GLM) in
Minitab Software (version 13.2). Sources of variation were treatments and errors.
Results
Diet composition
Chemical composition of the feed ingredients is presented in Table 1.
Table 1. Chemical composition of feeds used in the trial

% of DM
DM, %
CP NDF ADF Ash
Grass 21.4 11.7 62.2 33.1 17.5
Rice straw 91.7 4.59 65.0 35.9 15.5
Molasses 71.5 4.35 0.05 0.06 7.50
Rice bran 84.9 9.95 54.7 26.9 8.16
Feed intake and growth rate
Intake and changes in LW of cattle are shown in Table 2.
Table 2. Intake and changes in live weight of cattle during the experiment
Days No oil Oil drench P
after oil
drench MGU RGU RGR MGU RGU RGR Diet Oil Diet*oil
Intake, kg DM/day
0-30
5.48 4.31 4.67 5.11 4.13 4.21 0.001 0.11 0.85
days
31- 60
4.92 4.04 4.50 5.23 4.30 4.73 0.04 0.33 0.90
days
61-90
4.89 3.90 4.47 5.24 4.32 4.44 0.02 0.33 0.74
days
Average 5.09 4.08 4.54 5.19 4.25 4.46 0.007 0.79 0.90
Live weight, kg
Initial 132 136 143 134 144 137 0.51 0.83 0.61
Day 30 148 150 159 153 161 153 0.70 0.60 0.40
Day 60 164 163 173 175 177 169 0.90 0.20 0.40
Day 90 177 173 185 194 191 185 0.84 0.07 0.39
Daily gain, kg
0-30
0.542 0.451 0.513 0.609 0.571 0.516 0.26 0.90 0.40
days
31- 60
0.513 0.425 0.467 0.733 0.533 0.546 0.02 0.003 0.35
days
61-90
0.452 0.345 0.421 0.642 0.488 0.531 0.001 0.001 0.28
days
Average 0.502 0.407 0.467 0.661 0.521 0.531 0.001 0.001 0.07
Feed conversion ratio, kg DMI/ kg weight gain
0-30
10.3 9.5 9.1 8.6 7.6 8.3 0.54 0.04 0.76
days
31- 60
9.7 9.5 9.9 7.0 8.8 8.9 0.54 0.07 0.55
days
61-90
11.5 11.8 11.0 8.1 10.1 8.4 0.26 0.001 0.58
days
Average 10.3 10.0 9.9 7.7 8.2 8.4 0.90 0.001 0.47
In the first period (0-30 days) when cattle were still affected by a sudden supply of oil, there was a
tendency of lower feed intake in all treatments with oil drench. After 30 days of oil administration,
the trend of DM intake was changed to an opposite direction, in which oil drench has slightly
stimulated feed consumption. However, in both cases the difference did not reach the significant
level (p>0.05). Among treatments, inclusion of molasses and a higher proportion of grass in the diet
(Treatment MGU) resulted in higher DM intake (p<0.05) compared to urea (RGU) or rice bran
(RGR) supplementation in both factors: no oil (5.09 vs. 4.08 or 4.54 kg, respectively) and oil drench
(5.19 vs. 4.25 or 4.46 kg, respectively).
Changes in LW of cattle were not statistically different over the trial period although at the end of the
experiment, cattle received oil tended to growth faster than the other group (p=0.07). However, diets
and oil drench had strong effects on daily weight gain of cattle (Figure 1), excepting for the first
period where no significant difference found.
MGU: 30 % molasses + 70% grass + 50 g urea/100

kg LW
RGR: 45% rice straw + 45% grass + 10% rice bran
RGU: 50% rice straw + 50% grass + 50 g urea/100
kg LW
Figure 1. Effects of oil drench on daily gain of cattle
At day 60 and 90 and over the whole period, irrespective of oil factor, highest and lowest values of
average daily gain (ADG) (p<0.01) were on treatment MGU and RGU, respectively. If oil drench
was taken into account, its positive effects on ADG could be observed clearly at day 60, for example,
with the same ration MGU cattle in oil drench group gained 0.733 kg/day while this data in the other
group was 0.513 kg/day. On average of 90 days, ADG in defaunated cattle was higher (p<0.01) than
in normal animals.
It was the oil factor but not diet that most influenced the DM feed conversion (Figure 2).
MGU: 30 % molasses + 70% grass + 50 g urea/100 kg

LW
RGR: 45% rice straw + 45% grass + 10% rice bran
RGU: 50% rice straw + 50% grass + 50 g urea/100 kg
LW
Figure 2. Effects of oil drench on DM feed

conversion
In all treatments, cattle supplemented with soybean oil improved DM feed conversion from 15 to
25% (p<0.01).
Economic benefits
Cost of ingredients and the products sold at the end of the experiments are indicated in Table 3.
Table 3. Price of ingredients used and product sold (16,000 VND = 1

USD)
Item Unit price
Grass 100 VND/kg
Rice straw 200 VND/kg
Rice bran 2,500 VND/kg
Molasses 1,500 VND/kg
Urea 4,000 VND/kg
Cooking oil 15,000 VND/liter
Beef cattle 25,000 VND/kg LW
Based on changes and input and output, feed cost calculated per kg live weight gain is shown in
Figure 3.
Figure 3. Feed cost per kg live weight gain
Due to a high proportion of molasses in the diet, the cost of MGU treatment was highest. The
treatment with inclusion of only urea (RGU) offered a lowest cost and therefore higher benefit was
found in this group.
Discussion
Many studies reported so far on the effect of defaunation on feed intake and animal performances
have not led to the same results. The current findings are in line with those investigated by Ankrah et
al (1990) and Chaudhary and Srivastava (1995) that DM intake was not influenced by defaunation.
However, in the study of Ankrah et al (1990) defaunation did not affect growth rate and thus feed
conversion was also not different between faunated and normal groups, which are contradictory to
our study. Other authors (Santra and Karim 2000; Eugène et al 2004) seem to agree on the conclusion
of better feed conversion efficiency in defaunated compared to faunated animals.
In addition, it was hypothesized and confirmed by Eugène et al (2004) that better feed conversion
efficiency may lead to a higher yield of nutrients absorbed, which is in turn useful for maintenance
and growth of defaunated animals. In this study, an increase of 12 - 24% in growth rate was found
and comparable to many reports, for instance, in lambs (Bird and Leng 1985; Santra and Karim
2002) and in cattle (Nhan et al 2001; Seng et al 2001). The explanation for higher growth rate in all
treatments might have been due to improved DM digestibility (Nhan et al 2007) or reduced
methanogenesis as well as an increased microbial and dietary protein flow to the duodenum as
discussed by Santra and Karim (2002).
It is well known that responses of growth rate depend mainly on feed and supplements available for
the animals. Irrespective of oil factor, molasses - a source of readily fermentable carbohydrate has
shown its potential in improving cattle performance since it has provided a source of carbon
backbone as well as energy for fermentation activity of rumen bacteria that are capable of digesting
carbohydrate and balance the protein and volatile fatty acid (Preston et al 1967). The elimination of
protozoa also lead to a more efficiency of energy available in the rumen since protozoa require
energy for their maintenance (Coleman 1975). In addition, a combination of molasses and green
forage supplemented with urea has formed a large proportion of propionate and reduced butyric. All
of these factors have contributed to explain for a better growth rate of animals. Similar results were
also reported elsewhere by Khalili et al (1993) and Iwuanyanwu et al (1990). In contrast to molasses,
rice straw provided a high proportion of structural carbohydrate which were slowly fermentable in
the rumen and thus it took longer time to digest and more energy was needed (Leng 1990). Another
source of supplement in this study was rice bran, a source of bypass nutrients including protein,
starch and fat. Though most of starch from rice bran escape from rumen degradation and provide
nitrogen in the duodenum (Elliott et al 1978), its contribution to cattle growth was lower compared to
molasses.
To farmers, the efficiency of application a new technique is evaluated through the economic status.
Although they have to invest a little more at the start of the fattening period, after three months, an
increase of 14 - 28% benefits could be achieved due to an improved cattle grow performance.
Therefore, in term of economic effect, the RGU and RGR diets and an oil drench were suggested for
fattening cattle at house-hold level.
Conclusions
A single dose of soybean oil (6 ml/kg live weight) to cattle fed on grass supplemented with
molasses, rice bran or rice straw has improved growth rate and economic profitability.
Acknowledgements
The authors wish to acknowledge the support for this research from the MEKARN Regional Project,
financed by SidaSAREC of Sweden. This research was also supported by the International
Foundation for Sciences (IFS), Stockholm, Sweden, through a grant to the second author (Grant
Agreement No B/3369-1). The authors are also grateful to the farmers' cooperative in An Giang
province for providing the facilities and assistance during the trial.
References
Ankrah P, Loerch S C, Kampman K A and Dehority B A 1990 Effects of defaunation on in situ dry matter disappearance
in steers and growth of lambs. Journal of Animal Science, 68: 3330-3336. http://jas.fass.org/cgi/reprint/68/10/3330
AOAC 1984 Official Methods of Analysis. Association of Official Analytical Chemists. 15th edition. Arlington, USA
Bird S H and Leng R A 1985 Productivity responses to eliminating protozoa from the rumen of sheep. Reviews in Rural
Science, 6: 109-117.
Chaudhary L C and Srivastava 1995 Performance of growing murrah buffalo calves as affected by treatment of manoxol
and presence of ciliate protozoa in rumen. Animal Feed Science and Technology, 51: 281-286.
Coleman G S 1975 The interrelationships between rumen ciliate protozoa and bacteria. In: W McDonald and A C I Warner
(Editors), Digestion and Metabolism in the Ruminant. The University of New England Publishing Unit, 149-164.
Elliott R, Ferreiro H M, Priego A and Preston T R 1978 An estimate of the quantity of feed protein escaping degradation
in the rumen of steers fed chopped sugar cane, molasses/ urea supplemented with varying quantities of rice polishing.
Tropical Animal Production, 3: 36- 39 http://www.fao.org/ag/AGa/agap/FRG/tap31/3_1_8.pdf
Eugène M, Archimède H and Sauvant D 2004 Quantitative meta-analysis on the effects of defaunation of the rumen on
growth, intake and digestion in ruminants. Livestock Production Science, 85: 81-97.
Iwuanyanwu I E J, Umunna N N and Dim N I 1990 Effect of urea supplement with or without molasses on the intake,
digasribility and live weight changes of beef heifers fed native hay. Animal Feed Science and Technology, 31: 277-284.
Khalili H, Varvikko T and Osuji P O 1993 Supplementation of grass hay with molasses in crossbred (Bos taurus x Bos
indicus) non- lactating cows: effect of timing of molasses supplements on feed intake, digestion, DM degradation and rumen
fermentation. Animal Feed Science and Technology, 41: 39-50.
Leng R A 1990 Factors affecting the utilization of poor-quality forages by ruminants particularly under tropical conditions.
Nutrition Research Reviews, 3: 27-91.
Nhan N T H, Hon N V, Ngu N T, Hong N T T, Preston T R and Leng R A 2003 Effect of drenching with cooking oil on
performance of local "Yellow" cattle fed rice straw and cassava foliage. Livestock Research for Rural Development. Volume
15, Article # 157 from http://www.cipav.org.co/lrrd/lrrd15/7/nhan157.htm
NhanN T H, Hon N V, Ngu N T, Von N T, Preston T R and Leng R A 2001 Practical application of defaunation of cattle
on farms in Vietnam: response of young cattle fed rice straw and grass to a single drench of groundnut oil. Asian-
Australasian Journal Animal Science, 14 (4): 485-490.
Nhan N T H, Ngu N T, Thiet N, Preston T R and Leng R A 2007 Determination of the optimum level of a soybean oil
drench with respect to the rumen ecosystem, feed intake and digestibility in cattle. Livestock Research for Rural
Development. Volume 19, Article # 117 from http://www.cipav.org.co/lrrd/lrrd19/8/nhan19117.htm
Preston T R, Elias A, Willis W B and Sutherland T M 1967 Intensive beef production from molasses and urea. Nature
216: 721-722.
Santra A and Karim S A 2000 Growth performance of faunated and defaunated Malpura weaner lambs. Animal Feed
Science and Technology, 86: 251-260.
Santra A and Karim S A 2002 Nutrient utilization and growth performance of defaunated and faunated lambs maintained
on complete diets containing varying proportions of roughage and concentrate. Animal Feed Science and Technology, 101:
87-99.
Seng M, Preston T R, Leng R A and ter Meulen U 2001 . Effect of a single drench of cooking oil on the rumen ecosystem
and performance of young local "yellow" cattle fed rice straw and cassava foliage. Livestock Research for Rural
Development. Volume 13, Article # 134 from http://www.cipav.org.co/lrrd/lrrd13/4/seng134.htm
Trach N X and Thom M T 2004 Responses of growing beef cattle to a feeding regime combining road side grazing and
rice straw feeding supplemented with urea and brewers' grains following an oil drench. Livestock Research for Rural
Development. Volume 16, Article # 53 from http://www.cipav.org.co/lrrd/lrrd16/7/trac16053.htm
Received 22 July 2007; Accepted 19 August 2007; Published 5 September 2007
Go to top
2550;5(1):81-91.
Review article
ANIMAL BIOTECHNOLOGY: PIG MUSCLE PART I, FACTORS

AFFECTING MUSCLE FIBER TYPES IN PIGS
Nguyen Trong Ngu,1 Korakot Nganvongpanit2
Department of Agricultural Genetics and Breeding, College of Agriculture and

1
Applied Biology, Cantho University, Cantho, Vietnam,

2
Department of Veterinary Preclinical Science,
Faculty of Veterinary Medicine, Chiang Mai University, Chiang Mai, Thailand
Abstract Today, the study of muscle fibers is critical because they are responsible for the
variation of growth performance and meat quality traits in farm animals. There are several
factors that can contribute to alter the muscle fiber composition. Some of them geneti-
cally originate from individual, breed, gender, birth&slaughter weight and genetics,
while others are environmental factors such as prenatal and postnatal nutrition, tempera-
ture and physical activity. Chiang Mai Veterinary Journal 2007;5(1):81-91.
Keywords: pig, muscle fiber type, factor
The mammalian skeletal muscle is com- of the muscle growth and meat quality, which
posed of a heterogeneous collection of fiber are of important concerns in animal production.
types with polynucleated and elongated cells In this review, the effects of both genetics and
that can be classified according to their environments on the distribution of muscle
myosin heavy chain (MyHC) isoforms, contrac- fibers will be discussed with the emphasis on
tile elements (microfilaments), energy metabo- pigs.
lism, fiber color or cross-sectional area (CSA)
as showed in table 1.(1-3) In farm animals, the Genetic factors
structural and functional diversity of skeletal Muscle and individual
muscle is represented by the variety of myosin The composition of fiber types varies be-
isoforms. Understanding factors influencing tween anatomical muscles (Fig. 1). The distri-
muscle fibers will help to optimize the efficiency bution of pig muscles is unique and highly
Address request for reprints: Korakot Nganvongpanit, Department of Veterinary Preclinical Science, Faculty of
Veterinary medicine, Chiang Mai university, Chiang Mai 50100, Thailand; E-mail:korakot@chiangmai.ac.th
Article received date: August 21st, 2006
82 Nguyen Trong Ngu, Nganvongpanit K.
Figure 1. Percentage of muscle fiber types in different muscle areas of the pig (6,10,11)
organized, in which deep muscles contain more of high degree of type I and IIa fibers can be
type I fibers surrounded by an internal rosette seen in rhomboideus muscle.(9,10)
of type IIa fibers and an external ring of type IIb Animals of the same breed reared in the
fibers. (4)
Functionally, type I fibers are more same environment also show large variation in
involved in maintaining posture, while type IIb fiber type composition. An example is the varia-
fibers are responsible for rapid movement. (5)
In tion within litter of Danish Landrace x Large
commercial breeds, the proportions of type IIb White (LW) pigs, as described by Nissen et al.
and IIx fibers of longissimus dorsi and psoas (2004).(12) In this experiment, they slaughtered
muscle are highest compared with the other and grouped the animals by litter, at the same
fibers as pointed out by many research age, according to the body weight: heaviest,
groups. (6-10)
The same tendency was also middle and lightest weight. It was found that,
noticed in biceps femoris, quadriceps femoris (6)
intra-litter growth performance varied largely as
and adductor. (11)
On the other hand, examples a result of differences in both the number and
Animal biotechnology: pig muscle 83
growth rate of muscle fibers followed the trend which may support their increased weight and
that heavy pigs had higher total number of fiber accord with the hypothesis that at similar stage
(TNF) than middle and lightest weight pigs, of growth, there are great differences across
which did not differ from each other. breeds and fiber sizes. Finally, muscle of wild
pigs was reported to contain higher area
Breed percentage of type IIa and conversely lower
Breed covers probably the main proportion percentage area of type IIb fibers than those
of genetic factors affecting the muscle fiber from the same muscle of domestic pigs.(16)
composition of a certain muscle. The compo-
sition of muscle fiber types in different breeds Gender
is listed in table 2. Generally, the proportion of There have been contradictory documenta-
type IIb fibers is dominant in most modern and tions on the distinction between females and
traditional breeds. However, a dramatic change males in term of proportion of muscle fibers. In
in the relative expression profile was found in general, females have larger fibers than
our study. (13)
Mongcai is a Vietnamese local castrated males and as a result, sex has been
breed and known for its highly preferred meat mentioned to affect on the cross-sectional area
quality but unsatisfactory muscularity. Larger but not on the proportion of each fiber.(19-22)
loin eye muscle area offered higher proportion Moreover, Lefaucheur et al(1998)(23) demon-
of type IIb fibers(13) and this helps to explain the strated a significant decrease of relative fiber
difference of fiber distribution in Mongcai area of type I fiber in females compared to
compared to other breeds. Moreover, in com- intact LW males, which may indicate that
parison between the numbers and types of castration decreases relative area of type I
muscle fibers in large and small pig breeds, fibers. Nevertheless, Rehfeldt et al(2000)(24)
authors(14) announced that the responsible evidenced smaller values of type IIa and IIb
reasons for muscle size variation between LW fibers in boars in comparison to female pigs
and miniature pigs were due to the difference in and this implies a higher numbers of muscle
myofiber number, a factor fixed before postna- fiber in male pigs because the weight of the
tal growth. (15)
In addition, it appeared that pigs longissimus dorsi muscle was similar.
exhibiting postnatal increases in myofiber size
are more related to age than to live weight. The Birth weight
mechanism to which fewer muscle development The effect of birth weight on muscle fiber
in genetically small animals is different from performances has been mentioned in many
that exhibited by nutritional deprivation animals publications. Indeed, a tendency that lower
in utero (14)
and consequences of these differ- total fiber number in piglets is associated with
ences are therefore reflected in chemical prop- low birth weight was revealed.(10,25,26) Most of
erties of the constituent muscle fibers. In com- the variations were due to a difference in the
parison between miniature and LW pigs, a number of secondary myofibers that formed
higher content of type I fibers in the latter breed, around each primary. However, results from
other studies did not observe any association with enlarged muscle fiber area,(29) its influence
between birth weight and TNF and thereby on muscle fiber composition of longissimus
rejected this suggestion. (27,28)
Although birth dorsi and rhomboideus muscle was not estab-
weight was indicated to have an association lished.(10,22) Similarly, Rehfeldt et al(2006)(30)
stated that the ranking of fiber number at slaugh- oxidative fibers and the fast-twitch low-oxida-
ter was almost the same as at birth, with low tive fibers of pigs being crosses of Pietrain x
fiber numbers in low birth weight and high (Polish LW x Polish Landrace) and thereby also
numbers in high birth weight piglets. Because influence the metabolic properties of muscle.(38)
no differences were observed in the frequencies The other gene, myogenin, is expressed in all
of different fiber types, Rehfeldt and Kuhn (2006) myoblasts starts from differentiation to cell
(30)
concluded that postnatal fiber differentiation fusion and also marks the end of the myoblast
is independent of birth weight. proliferation. In deed, a significant difference of
two homozygous genotypes for birth weight,
Age and slaughter weight growth rate and lean weight was reported by te
At birth, muscle fibers are oxidative and the Pas et al. (1999).(39) The expression of the last
relative number of slow-twitch numbers contin- gene in the MyoD family, MYF6, also involves
ues to increase until 8 weeks after. (4)
The in the differentiation and maturation of myotubes
proportions of white fibers were observed to and highly expressed postnatally(40) but experi-
intensively increase up to 4 months of age, mental outcome demonstrating its effects on
together with the rapidly increased size and muscle fibers are still scare.
continue at a slower rate afterward. (31)
Surpris- It is well known that pigs homozygous for
ingly, although type IIa fibers are a minor in the halothane (HAL) sensitivity allele (nn) are
porcine skeletal muscle but their relative fiber highly stress susceptible and often induces
type-restricted expression was highest among accelerated pH-ultimate (pHu) decline post-
4 isoforms at both stages 6 weeks and 22 weeks mortem (p.m.) leading to a pale, soft and
postnatal. (32)
A relation of age and muscle exudative (PSE) meat. Different halothane
fibers was additionally recorded in such a way genotypes have been described to associate
that increasing weight and age at slaughter did with the content of muscle fibers and thereby
change the cross-sectional area but not the affect on meat quality. For instance, Depreux
numerical percentage of any fibers. (33,34)
et al. (2002)(41) showed a greater amounts of
type IIb but less slow fibers in pigs carrying the
Candidate genes “n” gene (Nn or nn), whereas the NN pigs
Muscle fiber formation occurs during embry- exhibited higher proportion of type IIax fibers.
onic development including two stages of Moreover, a positive correlation between the
primary and secondary generation. (35)
During relative abundance of type IIb fibers and pH
this period, the meiogenesis is under control of was observed in pigs free of “n” gene, but across
the MyoD gene family consisting of four struc- all genotypes, the relationship between type IIb
tural related genes MYOD1 (MYF3), myogenin fibers and pH45 was negative. This was curious
(MYOG or MYF4), MYF5 and MRF4 (MYF6). (36,37)
because, it is opposite with the whole assump-
The MYOD1 and MYF5 genes are involved in tion that type IIb isoform hydrolyzes ATP
myoblasts proliferation and they were found to rapidly and increases the glycolysis rate.(41) In
directly affect the proportion of fast-twitch the other hand, it was suggested that the rela-
tive amounts of individual fibers are not attrib- glycolytic fibers in a bundle was also concluded
uted by the effects of HAL, or in other words, to change the metabolic properties of muscles
the process of maturation from one fiber to an- and thereby meat quality. Although this locus
other is free from the HAL accelerated effect. (42)
is located in the 6th intron of the gene, this
Conversely but similar detrimental effect on intronic mutation should be considered both as
meat quality, the RN gene mainly increase the a marker for muscle microstructure character-
CSA of red fibers leading to a decrease in rela- istics and as the causal mutation itself.(48)
tive area of white muscle (IIx and IIb) and thus
the fibers are more to oxidative and less to Environmental factors
glycolytic metabolism. The RN effect, namely, Prenatal feeding
“acid meat” phenotype indicated a positive During gestation, prenatal muscle develop-
correlation between glycolytic potential and lac- ment includes two successive generations and
tate content and pHu. (43)
In fact, results from thus produces primary fibers (up to 50-55 days)
Marinova et al(1992) (44)
proved that pigs and secondary fibers (up to 90 days). In most
carrying RN gene have higher glycogen con- cases, the nutritional manipulation has little
tent in white muscles especially in glycolytic effect on the early period of myogensis, a stage
fibers. This was later confirmed by Lebret et involves in differentiation of primary muscle
al(1999), (45)
who concluded that white muscles fibers. However, nutrition may change the
are more affected than red muscles (I and IIa) number of primary fiber differentiation possibly
and that the glycogen content increase in long- because of indirect influence on the placenta
issimus muscle. Further findings from these development.(30,49) In pigs, between 25 to 90 days
authors also emphasized a higher enzyme of gestation, the differentiation and hyperplasia
activities and relative area of type II red fibers in of secondary fibers have been demonstrated
the dominant RN carriers. A causative muta-
-
as a cause for under-nutrition, which can lead
tion (R200Q) for the RN gene in the PRKAG3
-
to runting, a decrease in muscle fiber numbers,
gene encoding for a muscle-specific isoform of especially secondary fibers.(25,27,50) Likewise,
the regulatory(³) subunit of adenosine mono- findings on the relationship between over-nutri-
phosphat-acitvated protein kinase additionally tion and muscle fiber characteristics are still
reported. (46)
unclear. Over-nutrition of the sow between 25
Calpastatin (CAST) is a specific inhibitor of to 50 days of gestation might increase the TNF
calpain, a Ca -activated protease family,
2+
in developing pigs(51) whereas increased mater-
considered to be involved in the initiation of myo- nal nutrition of sows from day 25 to 50, or 25 to
fibrillar protein degradation in living muscle. (47)
70 of gestation did not give any benefits on
In a preliminary study, Klosowska et al(2005) (48)
muscle fiber number and area in the offspring.(52)
showed that longissimus lumborum diameters
of all types of muscle fibers are significantly Postnatal feeding
related to the Stamboek pigs’ genotype at There has been much attention on the role
locus CAST. The percentage of fast-twitch of nutrition on muscle development. Under-
nutrition was demonstrated to account for a relevant to spare energy.(23,57)

reduction of cross-sectional area of future fast-
twitch glycolytic fibers in longissimus dorsi Other factors
muscle. (53)
Chilibeck et al(2005) (54)
carried out Other factors that may have an impact on
an experiment on rapidly growing gilts, in which muscle fiber characteristics include physical
limited overfeeding at 75% more energy than activity, ambient temperature and growth-pro-
needed for weight maintenance were offered at moting agents. In fact, climate conditions and
two stages, from days 1-7 (early luteal phase) physical exercise can influence on pig perfor-
and from day 8-15 (late luteal phase) of the mance raised in an outdoor production system.
estrous cycle. Results showed that muscle Animals born outdoor at low temperature had a
fiber area and fiber type composition were higher percentage of type I, but lower percent-
independent on restricted overfeeding at any age of type IIa fibers in the longissimus muscle.
time exclusive of a significant decrease in type Interestingly, this difference changes in pigs
IIa fiber percentage over time. Partly opposite finished outdoor environment as Harrison et al.
results were presented by Chilibeck et al (1996)(58) indicated a higher proportion of type
(2005),(55) who failed to evaluate any effect of IIa fibers in both longissimus and semimem-
restricted feeding (approximatly 30%, started branosus muscle, and vice versa for type IIb/IIx
from 30 to 100 kg) on fiber number, CSA diam- fibers. An increase of type I fiber percentage in
eter and relative area of fast-twitch oxidative, pigs long-term exposing to cold temperature is
fast-twitch glycolytic fibers. However, a signifi- generally accompanied by an increase in
cant difference was noted in case of slow-twitch oxidative metabolism.(59) Moreover, outdoor
oxidative fibers, in which restricted pigs had pigs have more spontaneous activities leading
larger cross-sectional area, diameter and rela- to a shift of muscle fibers from type IIb to IIx to
tive area than those from ad libitum fed pigs. IIa and to I, respectively, which can explain the
Supportably, an association between postna- more type IIa and less type IIb/IIx in muscle
tal nutritional status and type I fiber expression compared with indoor pigs.(23) In addition to
both at mRNA and protein levels was unrav- some environmental factors, growth promoters
eled. (56)
Also, restricted feeding (50% of ad such as growth hormone, b-agonists and
libitum) at an early stage (between 3 and 7 steroids can influence muscle fiber composi-
weeks of age) had no influence in myofiber type tion of farm animals. An excellent review
composition in longissimus dorsi but led to a regarding to these promoting agents is avail-
remarked increase in type I fibers proportion in able.(60)
the red rhomboideus muscle.(57) An assump-
tion for these findings is, because the energy Conclusion
usage per unit tension is lower in type I fibers, It is clear that the distribution of skeletal
as a result, a selective increase in type I pro- muscle fibers is heterogeneous among individu-
portion in muscle during the period of reduced als. However, conclusions whether these
available energy would be physiologically differences are genetically determined or
consequence of environmental influences are 8. Chang KC, da Costa N, Blackley R, South-

wood O, Evans G, Plastow G, Wood JD,
still controversial. Among genetic factors, can-
Richardson RI. Relationships of myosin heavy
didate genes play an important role and have
chain fibre types to meat quality traits in tradi-
been used both inclusively and extensively in tional and modern pigs. Meat Science
industry. On the other hand, prenatal nutrition 2003;64:93-103.
is preferred in altering the fiber composition or 9. Lefaucheur L, Milan D, Ecolan P, Le Callennec
C. Myosin heavy chain composition of differ-
increasing the total number of fibers as this
ent skeletal muscles in Large White and
factor is fixed before birth and known to posi- Meishan pigs. J Anim Sci 2004;82:1931-41.
tively relate to postnatal muscle growth. 10. Gondret F, Lefaucheur L, Louveau I, Lebret B,
Pichodo X, Le Cozler Y. Influence of piglet birth
weight on postnatal growth performance, tis-
References
sue lipogenic capacity and muscle histologi-
1. Picard B, Lefaucheur L, Berri C, Duclos MJ.
cal traits at market weight. Livest Prod Sci
Muscle fibre ontogenesis in farm animal spe-
2005;93:137-46.
cies. Reprod Nutr Dev 2002;42:415-31.
11. Ruusunen M, Puolanne E. Comparison of his-
2. Lefaucheur L, Hoffman RK, Gerrard DE,
tochemical properties of different pig breeds.
Okamura CS, Rubinstein N, Kelly A. Evidence
Meat Science 1997;45:119-25.
for three adult fast myosin heavy chain
12. Nissen PM, Jorgensen PF, Oksbjerg N. Within-
isoforms in type II skeletal muscle fibers in
litter variation in muscle fiber characteristics,
pigs. J Anim Sci 1998;76:1584-93.
pig performance, and meat quality traits. J
3. Spangenburg EE, Booth FW. Molecular regu-
Anim Sci 2004;82:414-21.
lation of individual skeletal muscle fibre types.
13. Wimmers K, Ngu NT, Jennen D, Ponsuksili S,
Acta Physiol Scand 2003;178:413-24.
Tesfaye D, Murani E, Schellander K. Muscle
4. Lefaucheur L, Vigneron P. Post-natal changes
size-associated transcript abundance of myo-
in some histochemical and enzymatic char-
sin heavy chain isoforms in Longissimus
acteristics of three pig muscles. Meat Science
dorsi muscle in different pig breeds. Submit-
1986;16:199-216.
ted to Journal of Muscle Research and Cell
5. Ono Y, Solomon MB, Evockclover CM, Steele
Motility 2006.
NC, Maruyama K. Effects of porcine soma-
14. Stickland NC, Handel SE. The Numbers and
totropin administration on porcine muscles
types of muscle-fibers in large and small
located within different regions of the body. J
breeds of pigs. J Anat 1986;147:181-9.
Anim Sci 1995;73:2282-8.
15. Stickland NC, Goldspin G. Possible indicator
6. Karlsson A, Enfalt AC, Essengustavsson B,
muscle for fiber content and growth charac-
Lundstrom K, Rydhmer L, Stern S. Muscle
teristics of porcine muscle. Anim Prod 1973;
histochemical and biochemical-properties in
16:135-46.
relation to meat quality during selection for
16. Ruusunen M, Puolanne E. Histochemical prop-
increased lean tissue-growth rate in pigs. J
erties of fibre types in muscles of wild and
Anim Sci 1993;71:930-8.
domestic pigs and the effect of growth rate on
7. Muller E, Rutten M, Moser G, Reiner G,
muscle fibre properties. Meat Science 2004;
Bartenschlager H, Geldermann H. Fibre struc-
67:533-9.
ture and metabolites in M. longissimus dorsi
17. Fiedler I, Ender K, Wicke M, Maak S, Lengerken
of Wild Boar, Pietrain and Meishan pigs as
Gv, Meyer W. Structural and functional charac-
well as their crossbred generations. J Anim
teristics of muscle fibres in pigs with different
Breed Genet 2002;119:125-37.
malignant hyperthermia susceptibility (MHS)
and different meat quality. Meat Science 1999; 29. Gondret F, Lefaucheur L, Juin H, Louveau I,
53:9-15. Lebret B. Low birth weight is associated with
18. Ryu YC, Rhee MS, Kim BC. Estimation of cor- enlarged muscle fiber area and impaired
relation coefficients between histological pa- meat tenderness of the longissimus muscle
rameters and carcass traits of pig Longissi- in pigs. J Anim Sci 2006;84:93-103.
mus dorsi muscle. Asian-australas J Anim 30. Rehfeldt C, Kuhn G. Consequences of birth
Sci 2004;17:428-33. weight for postnatal growth performance and
19. Solomon MB, Campbell RG, Steele NC. Effect carcass quality in pigs as related to myoge-
of sex and exogenous porcine somatotropin nesis. J Anim Sci 2006;84 Suppl:E113-23.
on longissimus muscle fiber characteristics 31. Klosowska D, Klosowski B, Fiedler I, Wegner
of growing pigs. J Anim Sci 1990;68:1176-81. J. Changes in fiber type distribution and
20. Weiler U, Appell HJ, Kremser M, Hofacker S, muscle thickness in porcine m-longissimus
Claus R. Consequences of selection on dorsi during growth and relationships
muscle composition. A comparative study on between histological characters and carcass
gracilis muscle in wild and domestic pigs. parameters. Archiv fur Tierzucht 1985;28:171-
Anat Histol Embryol 1995;24:77-80. 80.
21. Larzul C, Lefaucheur L, Ecolan P, Gogue J, 32. da Costa N, Blackley R, Alzuherri H, Chang
Talmant A, Sellier P, Le Roy P, Monin G. Phe- KC. Quantifying the temporospatial expres-
notypic and genetic parameters for longissi- sion of postnatal porcine skeletal myosin
mus muscle fiber characteristics in relation heavy chain genes. J Histochem Cytochem
to growth, carcass, and meat quality traits in 2002;50:353-64.
large white pigs. J Anim Sci 1997;75:3126-37. 33. Candek-Potokar M, Lefaucheur L, Zlender B,
22. Bee G. Effect of early gestation feeding, birth Bonneau M. Effect of slaughter weight and/or
weight, and gender of progeny on muscle fi- age on histological characteristics of pig long-
ber characteristics of pigs at slaughter. J Anim issimus dorsi muscle as related to meat qual-
Sci 2004;82:826-36. ity. Meat Science 1999;52:195-203.
23. Lefaucheur L, Gerrard D. Muscle fiber plastic- 34. Correa JA, Faucitano L, Laforest JP, Rivest J,
ity in farm mammals. Proceedings of the Marcoux M, Gariepy C. Effects of slaughter
American Society of Animal Science. Denver, weight on carcass composition and meat
Colorado: American Society of Animal Sci- quality in pigs of two different growth rates.
ence, 1998:1-19. Meat Science 2006;72:91-9.
24. Rehfeldt C, Fiedler I, Dietl G, Ender K. Myoge- 35. Lefaucheur L, Edom F, Ecolan P, Butlerbrowne
nesis and postnatal skeletal muscle cell GS. Pattern of muscle fiber type formation in
growth as influenced by selection. Livest Prod the pig. Dev Dyn 1995;203:27-41.
Sci 2000;66:177-88. 36. Olson EN. MyoD family - a paradigm for devel-
25. Wigmore PMC, Stickland NC. Muscle develop- opment? Genes Dev 1990;4:1454-61.
ment in large and small pig fetuses. J Anat 37. Tepas MFW, Visscher AH. Genetic regulation
1983;137:235-45. of meat production by embryonic muscle for-
26. Dwyer CM, Stickland NC. Sources of variation mation - a veview. J Anim Breed Genet 1994;
in myofiber number within and between lit- 111:404-12.
ters of pigs. Anim Prod 1991;52:527-33. 38. Klosowska D, Kuryl J, Elminowska-Wenda G,
27. Handel SE, Stickland NC. Muscle cellularity Kapelanski W, Walasik K, Pierzchala M,
and birth weight. Anim Prod 1987;44:311-7. Cieslak D, Bogucka J. A relationship between
28. Dwyer CM, Fletcher JM, Stickland NC. Muscle the PCR-RFLP polymorphism in porcine
cellularity and postnatal growth in the pig. J MYOG, MYOD1 and MYF5 genes and micro-
Anim Sci 1993;71:3339-43. structural characteristics of m. longissimus
lumborum in Pietrain x (Polish Large White x Christiansen JA. Role of the calpain system
Polish Landrace) crosses. Czech J Anim Sci in muscle growth. Biochimie 1992;74:225-37.
2004;49:99-107. 48. Klosowska D, Kuryl J, Elminowska-Wenda G,
39. te Pas MFW, Soumillion A, Harders FL, Verburg Kapelanski W, Walasik K, Pierzchala M,
FJ, van den Bosch TJ, Galesloot P, Meuwissen Cieslak D, Bogucka J. An association between
THE. Influences of myogenin genotypes on genotypes at the porcine loci MSTN (GDF8)
birth weight, growth rate, carcass weight, and CAST and microstructural characteristics
backfat thickness, and lean weight of pigs. of m. longissimus lumborum : a preliminary
Journal of Animal Science 1999;77:2352-6. study. Archiv fur Tierzucht 2005;48:50-9.
40. Wyszynska-Koko J, Kuryl J. Porcine MYF6 gene: 49. Dwyer CM, Madgwick AJA, Ward SS, Stickland
Sequence, homology analysis, and variation NC. Effect of maternal undernutrition in early
in the promoter region. Anim Biotechnol gestation on the development of fetal
2004;15:159-73. myofibres in the guinea-pig. Reprod Fertil Dev
41. Depreux FFS, Grant AL, Gerrard DE. Influence 1995;7:1285-92.
of halothane genotype and body-weight on 50. Foxcroft GR, Dixon WT, Novak S, Putman CT,
myosin heavy chain composition in pig muscle Town SC, Vinsky MD. The biological basis for
as related to meat quality. Livest Prod Sci prenatal programming of postnatal perfor-
2002;73:265-73. mance in pigs. J Anim Sci 2006;84:105-12.
42. Eggert JM, Depreux FFS, Schinckel AP, Grant 51. Dwyer CM, Stickland NC, Fletcher JM. The in-
AL, Gerrard DE. Myosin heavy chain isoforms fluence of maternal nutrition on muscle fiber
account for variation in pork quality. Meat Sci- number development in the porcine fetus and
ence 2002;61:117-26. on subsequent postnatal growth. J Anim Sci
43. Monin G, Sellier P. Pork of low technological 1994;72:911-7.
quality with a normal rate of muscle pH fall in 52. Nissen PM, Danielsen VO, Jorgensen PF,
the Immediate post-mortem period - the case Oksbjerg N. Increased maternal nutrition of
of the hampshire breed. Meat Science sows has no beneficial effects on muscle fi-
1985;13:49-63. ber number or postnatal growth and has no
44. Marinova P, Lefaucheur L, Fernandez X, Monin impact on the meat quality of the offspring. J
G. Reletionship between metabolism and gly- Anim Sci 2003;81:3018-27.
cogen content in skeletal muscle fibers of 53. Lefaucheur L, Ecolan P, Barzic YM, Marion J,
Large White and Hampshire crossbred pigs Le Dividich J. Early postnatal food intake al-
J Muscle Foods 1992;3:91-7. ters myofiber maturation in pig skeletal
45. Lebret B, Le Roy P, Monin G, Lefaucheur L, muscle. J Nutr 2003;133:140-7.
Caritez JC, Talmant A, Elsen JM, Sellier P. In- 54. Chilibeck PD, Harber VJ, Bell G, Cegielski AC,
fluence of the three RN genotypes on chemi- Murdoch G, MacLean I. The effect of limited
cal composition, enzyme activities, and overfeeding during growth on muscle char-
myofiber characteristics of porcine skeletal acteristics: a pig model. Eat Weight Disord
muscle. J Anim Sci 1999;77:1482-9. 2005;10:13-8.
46. Milan D, Jeon JT, Looft C, Amarger V, Robic A, 55. Candek-potokar M, Bonneau M, Zlender B. Ef-
Thelander M, Rogel-Gaillard C, Paul S, fect of dietary restriction on Longissimus dorsi
Iannuccelli N, Rask L, Ronne H, Lundstrom muscle histochemical and morphometric
K, Reinsch N, Gellin J, Kalm E, Roy PL, properties in pig. Proceeding 6th Zavrnik Me-
Chardon P, Andersson L. A mutation in morial Meeting, Lipica 9-11 Nov. 1995.
PRKAG3 associated with excess glycogen 56. White P, Cattaneo D, Dauncey MJ. Postnatal
content in pig skeletal muscle. Science 2000; regulation of myosin heavy chain isoform ex-
288:1248-51. pression and metabolic enzyme activity by
47. Goll DE, Thompson VF, Taylor RG, nutrition. Br J Nutr 2000;84:185-94.
57. Harrison AP, Rowlerson AM, Dauncey MJ. Se- Ecolan P, Krauss D. Influence of environmen-
lective regulation of myofiber differentiation by tal temperature on growth, muscle and adi-
energy status during postnatal development. pose tissue metabolism, and meat quality in
Am J Physiol Regul Integr Comp Physiol swine. J Anim Sci 1991;69:2844-54.
1996;39:667-74. 60. Rehfeldt C, Stickland NC, Fiedler I, Wegner J.
58. Gentry JG, McGlone JJ, Miller MF, Blanton JR, Environmental and genetic factors as sources
Jr. Environmental effects on pig performance, of variation in skeletal muscle fibre number.
meat quality, and muscle characteristics. J Basic Appl Myol 1999;9:235-53.
Anim Sci 2004;82:209-17.
59. Lefaucheur L, Ledividich J, Mourot J, Monin G,
:

! 1: "#$$! % &'*+
,,1 3 46&2
1

! ". ! # ,
2
$ % &' ".&'
!"# $%'"() *!

+#/; <*! $*='"("> ;? *@ @<B<*@C ;! ;!> "#
> D '"( E" >B<>! '"( %* < C # B><
#F> " G> #'' ;H B<( B! > F >
B<F* @FCIC ;B! B< !
2550;5(1):81-91.
: #

เชียงใหมสตั วแพทยสาร 2550:5(2):159-166
Original article
ANIMAL BIOTECHNOLOGY: PIG MUSCLE PART II, SIGNIFICANCE

OF MUSCLE FIBER TYPES ON MUSCLE PERFORMANCE AND
MEAT QUALITY IN PIGS
Nguyen Trong Ngu1 Korakot Nganvongpanit 2
1
Department of Agricultural Genetics and Breeding, College of Agriculture and Applied
Biology, Cantho University, Cantho, Vietnam
2
Department of Veterinary Preclinical Science, Faculty of Veterinary Medicine,
Chiang Mai University, Chiang Mai, Thailand
Abstract Muscle fibers, represented by the content of four different myosin heavy chain isoforms,
are responsible for the variation of growth performance and meat quality traits in farm animals. While
total number of fibers is clearly evidenced to have a positive correlation with muscle mass, the
functions of cross-sectional area and myofiber size to muscle growth are still controversial or poorly
understood. For meat quality traits, although soft, pale and excudative pork contained the highest of
type IIx/IIb fiber proportion, effects of pure type IIx and IIb fibers on water-holding capacity still
deserve for further research. Results on the effect of fiber composition on ultimate pH, are
inconsistent due to different pig breeds and kinds of muscle used in the study. Also, it is still unclear
on the relationship between histological characteristics and sensory pork quality like intramuscular
fat. All together, in spite of contradictory results found, muscle fiber traits have been used as
additional selection criteria for muscle growth and meat quality in pigs. Chiang Mai Veterinary
Journal 2007;5(2):159-166
Keyword: muscle fiber, meat quality, pig
Four out of eight muscle fiber-isoforms IIb fibers(2,3). In the pig, type I fibers are found on
known in mammals have been identified in chromosome 7 in one cluster, whereas type IIa,
porcine muscle according to their specific IIx and IIb fibers are located on chromosome
expression of myosin heavy chain (MyHC)(1). 12(4). Different locations make them distinct
Based on their metabolic and myosin adenosine function, different contribution to muscle mass
triphosphatase(mAT Pase) activity, these fibers, and different effects on meat quality. Study on
each encoded by an individual gene, are the relationship between muscle fiber types,
categorized as slow-oxidative and fast-glycolytic muscle growth and meat quality traits are
(slow type I and IIb fiber, respectively),standing therefore needed in order to increase production
for extreme metabolic profiles. The type IIa and efficiency as well as improve meat quality
IIx fibers are defined as intermediates with the Significance of muscle fiber types for growth
transition that type IIa fibers are more similar to performance
type I and IIx fibers are more in relation to type
Address request for reprints: Korakot Nganvongpanit, Department of Veterinary Preclinical

Science,Faculty of Veterinary medicine, Chiang Mai University , Chiang Mai 50100, Thailand ;
E-mail:korakot@chiangmai.ac.th
Article received date: 20 December 2007
160 Korakot Nganvongpanit.
There have been attempts to investigate the Fiber cross-sectional area and muscle
relationships between muscle fiber frequencies performance
and muscle size or muscle performance in pigs On the other hand, the correlation between CSA
5,6)
. It is well documented that total number of and muscle mass is controversial probably
fibers (TNF), fiber cross-sectional area (CSA) because of the fact that lean meat content is
and muscle length are important parameters to mainly influenced by TNF, a highly variable
muscle characteristics as well as muscle trait(14). For example, Henckel et al. (1997)(6)
weight(7). reported a positive correlation between muscle
gain and the oxidative enzyme citrate synthesis
Total number of fibers and muscle growth and the muscle capillarity of Large White and
In most cases, the TNF, a factor positively Landrace pigs. Additionally, daily gain was found
related to muscle growth poten-tial in pigs, to have a tightly link with CSA of type I fiber(15).
remains unchanged after birth(8) and thus within Conversely, Larzul et al. (1997)(16) were not able
a muscle, muscle fiber hypertrophy is dependent to point out any significant connection between
on the TNF. Klosowska and Fiedler (2003)(9) CSA of individual fibers and average daily gain
suggested an evidence that higher level of within the Large White breed. In most studies,
hypoplasia of individual fibers or higher number glycolytic fibers are shown to exhibit the large
of TNF can be responsible for a higher meat CSA implying that, for a given TNF, an increase
content. This was in line with previously reported in muscle weight would be expected when the
data by 2 research groups(10,11), who found a proportion of glycolytic fibers increases(7).
positive corre-lation between TNF and carcass Moreover, the relationship between fiber
lean meat content. Supportably, Fiedler et al. diameters and perimeters were high and
(2004)(12) investigated that live weight and loin positively related to muscle fibers and hence it
muscle area are positively related to TNF and was concluded that fiber type proportion is more
frequency of white fibers. In Meishan pigs, a closely involved in their numerical abundance
lower TNF was shown to result in smaller than their CSA(17). Linear phenotypic correlation
semitendinosus muscle at birth and later affect coefficients among those elements are presented
on the proportion of white fibers(13). All together, it in Fig 1.
is clear that TNF is significantly important to
muscle size or muscle performance.
Fig 1. Relationships by linear phenotypic correlation coefficients between muscle cross-section area, muscle
(19)
fiber size and muscle fiber number per cross-section (Adapted from Rehfeldt et al., 2000 ).
Animal biotechnology: pig muscle part II 161
In this figure, it is clearly shown that muscle defined as a combination of fresh meat or the
cross-sectional area is positively correlated with degree of satisfaction of consumers to a given
both the size and the number of muscle fibers. variation or differences in the mechanical
However, these values are in a wide range, properties of muscle fibers.
which means that there is a large variation in the
number of total fibers as well as their growth
rates even within the same litter(18). Furthermore, Significant of muscle fibers on meat quality
the negative correlation between fiber number Muscle fiber composition is on one way
and fiber size can be explained by the equal affected by growth rate and, on the other, itself
distribution of energy in all fibers, but still there affects the muscle mass. Meat quality can be
are animals highly exhibited not only fast-growing meat. Meat quality is accessed by measuring
fibers but also fiber numbers as the value did not biophy-sical and chemical properties such as
reach -1.0(19). water holding capacity, color and light
reflectance, pH, pigment content, shear force,
Myofiber length and muscle mass intramuscular fat content and protein
(21)
Studies of myofiber length in different fibers extractability as well as eating quality and
have not been well documented, exclusive of a post-mortem maturation of the meat(7).The
recent research done by Christensen et al. correlation coefficients between muscle fibers
(2006)(20), who found shorter sarcomere in type and these factors appear in the wide ranges,
IIb than type I fibers isolated from longissimus some of which are listed in Table 1.
dorssi muscle. This might contribute to the
Table 1. Correlation coefficients (r) between proportion of muscle fibers and meat quality
traits(3,6,16,22,23)
Item Muscle fiber types

MyHC I MyHC IIa MyHC IIx MyHC IIb
pH24 -0.46 to 0.20 0.02 to 0.28 0.10 to 0.30 -0.23 to 0.11
Drip -0.04 to -0.06 -0.28 to 0.00 -0.40 -0.04 to 0.36
Shear force -0.34 to 0.23 -0.05 to 0.13 n.a -0.04 to -0.13
IMF 0.00 to 0.04 -0.04 to -0.31 -0.03 0.03 to 0.21
Lightness (L*) -0.12 to 0.02 -0.07 to 0.14 -0.09 to 0.10 -0.19 to 0.27
Redness (a*) -0.08 to 0.44 -0.10 to 0.62 0.03 -0.14 to -0.48
Yellowness (b*) -0.16 to 0.29 0.04 to 0.33 0.36 -0.35 to 0.07
Juiciness -0.01 to 0.09 -0.20 to 0.09 na 0.05
Tenderness -0.06 to 0.10 -0.22 to 0.05 na 0.01 to 0.06
na: not available
Water-holding capacity warm muscle, the biophysical properties of meat

are altered leading to PSE. A series of studies
A possible definition of water-holding capacity
have demonstrated the relation of fiber type
(WHC) is the ability of meat or meat systems to
compositions and the rate and extent of post-
retain all water or part of its own and/or added
mortem pH decline. In 1999, Karlsson et al.(21)
water(24). This ability relies on the handling
stated that high frequency of glycogen depleted
method and the state of the system, and is
in fibers at slaughter, in particular, type IIb fibers
important because muscle contains approxi-ately
will have an influence on meat quality.
75% water and other components such as
Unexpectedly, Larzul et al. (1997)(16) found no
protein (20%), lipids (5%), carbohydrate (1%)
significant correlation between fiber traits and
and vitamins and minerals (1%)(25). In highly
pHu although IIb fibers were investi-ated to
processed pork products, the higher the WHC,
contain more glycogen than other types of
the more valuable will the pork be. However, the
fibers(29,30). In contrast, Ryu and Kim (2005)(22)
levels of WHC vary among muscles likely
and Matin et al. (1997)(31) men-ioned a significant
because of the differences in postmortem
inverse relation between pHu, type IIb fibers as
degradation of intermediate filament proteins,
well as a positive link between pHu and the
and thus it was hypothesized that greater WHC
oxidative capacity and the area of slow fibers. In
would be achieved when rapid degra-dation of
the context of pHu values, the view that oxidative
intermyofibril linkages (des-min)occurred(26). The
fibers are esirable in meat quality was supported
understanding about the relationship between
by Chang et al. (2003)(3), who demonstrated
muscle fiber type distribution and WHC is still
greater abundance of type IIa and IIx fibers with
poor, although WHC is one of major factors
higher pHu in psoar muscle. Given these points,
directly related to fresh pork, with pale soft and
the inconsistency on the effects of fiber
exudative (PSE) and dark, firm and dry (DFD)
composition on pH changes may originally come
being the extreme types of meat. Accor-ing to
from different pig breeds and kinds of muscle
metabolic rate, Ryu and Kim (2006)(27) deter-
used in those studies. Indeed, in an attempt to
mined a difference in type I fiber composition
compare the changes of pH among pig muscles,
with an increased percentage from fast to slow
Lefaucheur (2006)(14) concluded that fiber type
metabolic group. A lower percent-tage of type IIa
composition is far related to the rate of post-
fibers in PSE than in DFD pork were also
mortem pH decline, but closely associated with
mentioned. Particularly, fast-glycolyzing PSE
the extent of post-mortem pH decline with the
pork contained the highest proportion of type
evidence of decreasing pHu when the proportion
IIx/IIb fiber, which may be more prone to
of fast glycolytic fibers increases.
undesirable pork because of its anaerobic
nature, greater glycogen content and lower pH at Intramuscular fat
24 h post-mortem (ultimate pH; pHu) (27,28).
The intramuscular fat is an important charac-
However, as suggested by Ryu and Kim (2006)
(27) teristic in evaluation of sensory quality. Intra-
, further research is needed to clarify the
muscular fat is composed of two major cons-
functions of pure type IIx and IIb fibers on meat
tituents triglycerides and phospholipids repre-
quality traits.
senting more than 50% of fresh pig longissimus
Acid-base (pH) muscle(32,33). Despite intensive research, it is still
unclear on the relationship between histological
Measurements of pH at 45 min post-mortem
characteristics and sensory pork quality. It was
(pH1) and pHu can indicate the rate and extent
observed that intramuscular fat values are
of post-mortem glycolysis and are good
closely related to triglyceride content in the
indicators of meat quality. After slaughter,
muscle, which in turn negatively associated with
glycogen is metaboliszed into lactic acid, which is
mean fiber area(21) and that neutral lipids are
accumulated in the muscle. As a result of
contained in all type I fibers but only in about
increasing lactic acid concentration in a still-
26% of type IIa and 1% of type IIb fibers. In a pigs(39) and cattle(40). In fact, increasing the
comparison on muscle fiber characteristics of proportion of type I fibers were considered to
eight different breeding populations, Maltin et al. improve tenderness and juiciness in cattle (41).
(1997)(31) indicated a significant contribution of Nevertheless, in normal cattle breeds, no
fast twitch oxidative glycolytic fibers to the correlations found between fiber characteristics
variation of meat tenderness. More specifically, and meat quality traits(42), including tender-
Essen-Gustavsson et al. (1994)(34) found lipids ness(43). Despite variable and sometimes
present mainly in type I and some type IIa fibers, controversial results, there is evidence
whereas Henckel et al. (1997)(6) reported the suggesting the relationship between muscle fiber
frequency of type IIb fiber and intramuscular fat characteristics and meat tenderness, especially
content are positively corre-lated and thus flavor in pork(30).
and tenderness, seemed to have a negative
Meat color
relationship with type IIa, but positive correlation
with type IIb fibers. Interestingly, in a sensory test Another important quality para-meter,
by taste panels, the meat from half-Chinese lightness, was discovered to be negatively
crossbred pigs offered more tender, juicy and related to type I and IIa fiber percentages
tasty than that from European pigs. However, in implying that a decrease in these two types
a consumer’s survey Touraille et al. (1989)(35) would lead to increasing lightness(22). Similarly, in
found no difference in the overall acceptability a F2 population Duroc x Berlin Miniature Pig, it
between two pork sources. In contrast to data was found that type IIb fibers are accom-panied
regarding total intramuscular fat content, muscle with a light color and high conductivity (44). These
fiber proportion is also related to the nature of two findings are also in agreement with results
phospholipids, which is shown to present more in from a study by Larzul et al. 1997 (45), who
oxidative than glycol-lytic muscles(32). Because demonstrated that lightness (L*) is positively
phosphor-lipids are determinants of cooked meat related to the percentage of white fibers and
flavor, muscle fiber is likely to have an effect on negatively to the percentage of red fibers which
flavor but further studies are encouraged to are in line with the their color cha-racteristics. Not
unravel this correlation. surprisingly, this may reflect the amount of
myoglobin found in the tissues as similar results
Meat tenderness
were additionally reported by Depreux et al.
Meat tenderness is influenced by many factors 2002(46). However, there was no evidence on the
including the physical size of muscle bundle and relationship between muscle fiber and fiber
the amount of connective tissue and fat. charac-teristics with both L* and a* (redness)
Historically, researches on pork tenderness have values(31). The discrepancy on the effect of
received little attention since it was considered to muscle fiber on L* data between two studies
be relatively tender, but in practice this trait might come from the selection of pigs with the
varied among muscle and animals(36). The extent presence of absence of halothane positive (nn)
to which meat tenderizes can be accessed by as this genotype offered a signify-cantly higher L*
shear force measurement because of their rather value(46). In short, these findings have evidenced
high correlation(37,38). In pigs, shear force has and clarified the effects of muscle fibers on meat
been detected to have low correlation with color accordingly with the metabolic charac-
muscle fiber percent-tage(6,23). However, when teristics of individual fiber.
taking only type I fibers into consideration, both a
Conclusion
nega-tive(3) and a positive(22) correlation between
this fiber type and shear force of cooked pork LD In most studies, muscle fiber size shows a positive
muscle have been reported. Previous findings relation with muscle weight and loin eye muscle
also demonstrated that fast glycolytic fibers (type area but is conversely related to properties of
IIb) are negatively related with toughness in meat post-mortem. The complex correlation among
muscle fiber size, cross-sectional area and fiber 9. Klosowska D, Fiedler I. Muscle fiber types in
number make animal breeders difficult in selection. pigs of different genotypes in relation to meat
However, it is possible to include muscle fiber quality. Animal Science Papers and Reports
2003-;21:49-60.
characteristics in breeding programs to improve
meat quality but preserve optimal production 10. Handel SE, Stickland NC. Catch-up growth in
traits(21). Results from a simulated selection on pigs-a relationship with muscle cellularity. Anim
the use of muscle fiber traits as additional Prod 1988-;47:291-5.
selection criteria for muscle growth and meat 11. Dwyer CM, Fletcher JM, Stickland NC. Muscle
quality(12) strongly support this view and thereby cellularity and postnatal growth in the pig. J
stimulate more detailed studies on muscle fiber Anim Sci 1993;71:3339-43.
type especially on physiological mechanisms so 12. Fiedler I, Dietl G, Rehfeldt C, Wegner J, Ender
that these characteristics can be effectively K. Muscle fibre traits as additional selection
exploited in animal breeding programs. criteria for muscle growth and meat quality in
pigs results of a simulated selection. Journal of
References
Animal Breed-ing and Genetics 2004;121:331-
1. Chang KC, Fernandes K. Develop-mental 44.
expression and 5' end cDNA cloning of the
13. Lefaucheur L, Ecolan P. Pattern of muscle fiber
porcine 2x and 2b myosin heavy chain genes.
for-mation in Large White and Meishan pigs.
DNA Cell Biol 1997-;16:1429-37.
Archiv Fur Tierzucht Archives of Animal
2. Pette D, Staron RS. Myosin isoforms, muscle Breeding 2005-;48:117-22.
fiber types, and transitions. Microsc Res Tech
14. Lefaucheur L. Myofibre typing and its
2000-;50:500-9.
relationships to growth performance and meat
3. Chang KC, da Costa N, Blackley R, Southwood quality. Archives of Animal Breeding
O, Evans G, Plastow G, Wood JD, Richardson 2006;49:04-17.
RI. Relationships of myosin heavy chain fibre
15. Ruusunen M, Puolanne E. Histochemical
types to meat quality traits in traditional and
properties of fibre types in muscles of wild and
modern pigs. Meat Science 2003;64:93-103.
domestic pigs and the effect of growth rate on
4. Davoli R, Fontanesi L, Zambonelli P, Bigi D, muscle fibre properties. Meat Science
Gellin J, Yerle M, Milc J, Brag-lia S, Cenci V, 2004;67:533-9.
Cagnazzo M, Russo V. Isolation of porcine
16. Larzul C, Lefaucheur L, Ecolan P, Gogue J,
expressed sequence tags for the construction of
Talmant A, Sellier P, LeRoy P, Monin G.
a first genomic trans-cript map of the skeletal
Phenotypic and genetic parameters for
muscle in pig. Animal Genetics 2002;33:3-18.
longissimus muscle fiber characteristics in
5. Swatland HJ. The radial distribution of succinate relation to growth, carcass, and meat quality
dehydrogenase activity in porcine muscle fibres. traits in large white pigs. J Anim Sci
Histochem J 1984;16:321-9. 1997;75:3126-37.
6. Henckel P, Oksbjerg N, Erlandsen E, Barton- 17. Ryu YC, Rhee MS, Kim BC. Estimation of
Gade P, Bejerholm C. Histo and bioche-mical correlation coefficients between histological
charac-teristics of the Longissimus dorsi muscle parameters and carcass traits of pig
in pigs and their relationships to performance Longissimus dorsi muscle. Asian-australas J
and meat quality. Meat Science 1997;47:311-21. Anim Sci 2004;17:428-33.
7. Lefaucheur L, Gerrard D. Muscle fiber plasticity 18. Nissen PM, Jorgensen PF, Oksbjerg N. Within-
in farm mammals. Procee-dings of the American litter variation in muscle fiber characteristics, pig
Society of Animal Science. Denver, Colorado: perfor-ance, and meat quality traits. J Anim Sci
American Society of Animal Science, 1998:1-19. 2004-;82:414-21.
8. Wigmore PMC, Stickland NC. Muscle 19. Rehfeldt C, Fiedler I, Dietl G, Ender K.
development in large and small pig fetuses. J Myogenesis and postnatal skeletal muscle cell
Anat 1983;137:235-45.
growth as influenced by selection. Livest Prod 31. Maltin CA, Warkup CC, Matthews KR, Grant
Sci 2000-;66:177-88. CM, Porter AD, Delday MI. Pig muscle fibre
charac-teristics as a source of variation in eating
20. Christensen M, Kok C, Ertbjerg P. Mechanical
quality. Meat Science 1997;47:237-48.
properties of type I and type IIB single porcine
muscle fibres. Meat Science 2006;In Press, Cor- 32. Leseigneur-Meynier A, Gandemer G. Lipid
rected Proof. compo-sition of pork muscle in relation to the
metabolic type of the fibres. Meat Science
21. Karlsson AH, Klont RE, Fernandez X. Skeletal
1991;29:229-41.
muscle fibres as factors for pork quality.
Livestock Production Science 1999;60:255-69. 33. Faucitano L, Rivest J, Daigle JP, Levesque J,
Gariepy C. Distribution of intramuscular fat
22. Ryu YC, Kim BC. The relationship between
content and mar-bling within the longissimus
muscle fiber characteristics, postmortem
muscle of pigs. Canadian Journal of Animal
metabolic rate, and meat quality of pig
Science 2004-84:57-61.
longissimus dorsi muscle. Meat Science
2005;71:351-7. 34. Essen-Gustavsson B, Karlsson A, Lundstrom K,
Enfalt AC. Intramuscular fat and muscle fibre
23. Gentry JG, McGlone JJ, Miller MF, Blanton JR,
lipid contents in halothane-gene-free pigs fed
Jr. Environmental effects on pig perfor-mance,
high or low protein diets and its relation to meat
meat quality, and muscle charac-teristics. J
quality. Meat Science 1994;38:269-77.
Anim Sci 2004;82:209-17.
35. Touraille C, Monin G, Legault C. Eating quality
24. Honikel KO. Muscle development of livestock
of meat from European x Chinese crossbred
animals–physiology, genetics and meat quality.
pigs. Meat Science 1989;25:177-86.
CABI, 2004.
36. Devol DL, McKeith FK, Bechtel PJ, Nova-kofski
25. Huff-Lonergan E, Lonergan SM. Mecha-nisms of
J, Shanks RD, Carr TR. Variation in composition
water-holding capacity of meat: The role of post-
and pala-tability traits and relationships between
mortem biochemical and structural changes.
muscle charac-teristics and palatability in a
Meat Science 2005-;71:194-204.
random sample of pork carcasses. J Anim Sci
26. Kristensen L, Purslow PP. The effect of ageing 1988-;66:385-95.
on the water-holding capacity of pork: role of
37. Boccard R, Buchter L, Casteels E, Cosentino E,
cytoskeletal proteins. Meat Science 2001;58:17-
Dransfield E, Hood DE, Joseph RL, Macdougall
23.
DB, Rhodes DN, Schon I, Tinbergen BJ,
27. Ryu YC, Kim BC. Comparison of histoche-mical Touraille C. Proce-dures for measuring meat
characteristics in various pork groups quality charac-teristics in beef produc-tion
categorized by postmortem metabolic rate and experi-ments. Report of a working group in the
pork quality. J Anim Sci 2006;84:894-901. commission of the Euro-pean Commu-nities
(Cec) Beef-Pro-duction Research-Program.
28. Solomon MB, Van Laack R, Eastridge JS.
Livestock Production Science 1981;8:385-97.
Biophy-sical basis of pale, soft, exudative (PSE)
pork and poultry muscle: A review. Journal of 38. Hovenier R, Kanis E, Verhoeven JAM.
Muscle Foods 1998;9:1-11. Repeatability of taste panel tender-ness scores
and their relationships to objective pig meat
29. Fernandez X, Lefaucheur L, Candek M.
quality traits. Jour-nal of Animal Science
Comparative study of two classi-fications of
1993;71:2018-25.
muscle fibres: Consequences for the
photometric deter-mination of glycogen 39. Karlsson A, Enfalt AC, Essengus-tavsson B,
according to fibre type in red and white muscle Lundstrom K, Rydhmer L, Stern S. Muscle histo-
of the pig. Meat Science 1995-;41:225-35. chemical and biochemical-properties in relation
to meat quality during selection for increased
30. Klont RE, Brocks L, Eikelenboom G. Muscle
lean tissue-growth rate in pigs. J Anim Sci
fibre type and meat quality. Meat Science 1998-
1993;71:930-8.
;49:S219-S29.
40. O'Halloran GR, Troy DJ, Buckley DJ, Reville WJ.
The role of endogenous proteases in the
tenderisation of fast glycolysing muscle. Meat 44. Fiedler I, Nurnberg K, Hardge T, Nurnberg G,
Science 1997-47:187-210. Ender K. Phenotypic variations of muscle fibre
and intra-muscular fat traits in Longi-ssimus
41. Maltin CA, Sinclair KD, Warriss PD, Grant CM,
muscle of F2 population Duroc x Berlin Miniature
Porter AD, Delday MI, War-kup CC. The effects
Pig and relationships to meat quality. Meat
of age at slaugh-ter, genotype and finishing
Science 2003-;63:131-9.
system on the biochemical properties, muscle
fibre type charac-teristics and eating quality of 45. Larzul C, Lefaucheur L, Ecolan P, Gogue J,
bull beef from suckled calves. Animal Science Talmant A, Sellier P, Le Roy P, Monin G.
1998;66:341-8. Phenotypic and genetic parameters for
longissimus muscle fiber characteristics in
42. Wegner J, Albrecht E, Fiedler I, Teuscher F,
relation to growth, carcass, and meat quality
Paps-tein HJ, Ender K. Growth-and breed-
traits in large white pigs. J Anim Sci
related changes of muscle fiber charac-teristics
1997;75:3126-37.
in cattle. Journal of Animal Science 2000-
;78:1485-96. 46. Depreux FFS, Grant AL, Gerrard DE. Influence of
halothane genotype and body-weight on myosin
43. Vestergaard M, Therkildsen M, Henckel P,
heavy chain composition in pig muscle as
Jensen LR, Andersen HR, Sejrsen K. Influence
related to meat quality. Livest Prod Sci
of feeding inten-sity, grazing and finishing
2002;73:265-73.
feeding on meat and eating quality of young
bulls and the relation-ship between muscle fibre
characteristics, fibre fragmen-tation and meat
tenderness. Meat Science 2000;54:187-95.
เทคโนโลยีชีวภาพทางสัตว: กลามเนื้อสุกร ตอนที่ 2: ชนิดของกลามเนื้อที่มี

ผลตอคุณภาพเนื้อสุกร
เหวง ทรอง เงอะ, 1 กรกฎ งานวงศพาณิชย 2
1
ภาควิชาพันธุศาสตรและการปรับปรุงพันธทางการเกษตรวิทยาลัยเกษตรศาสตรและชีวะวิทยาประยุกต
มหาวิทยาลัยคันโท จ. คันโท ประเทศเวียดนาม
2
สาขาวิชาพรีคลินิกทางสัตวแพทย คณะสัตวแพทยศาสตร มหาวิทยาลัยเชียงใหม จ.เชียงใหม
ประเทศไทย
บทคัดยอ เซลลกลามเนื้อในรางกายมีความแตกตางกัน เกิดจากการที่มีสัดสวนของเสนใยมัยโอซิน
แตกตางกัน ซึ่งความแตกตางของเซลลกลามเนื้อเหลานี้มีผลถึงความสามารถในการเจริญเติบโตและ
คุณภาพซากของสัตว พบวาจํานวนของเซลลกลามเนื้อทั้งหมดจะมีความสัมพันธตอน้ําหนักของกลามเนื้อ
ในขณะที่ความสัมพันธระหวางการเจริญเติบโตกับพื้นที่หนาตัดและขนาดของเซลลกลามเนื้อยังไมเปนที่
ทราบแนชัด นอกจากนั้นพบวาลักษณะตางๆ เชน กลามเนื้อซีด เหลว และไมคงรูป หรือความสามารถใน
การอุมน้ํา จะมีความสัมพันธกับสัดสวนของเซลลกลามเนื้อชนิด IIx และ IIb นอกจากนั้นยังพบอีกวาการ
เปลี่ยนแปลงของระดับกรดดางในเนื้อหลังจากสัตวตาย มีความสัมพันธกับชนิดของเซลลกลามเนื้อซึ่งมี
ความแตกตางกันในสุกรแตละสายพันธุ ซึ่งจากที่กลาวมาทั้งหมดชี้ใหเห็นวาลักษณะเซลลกลามเนื้อเปน
ปจจัย หนึ่ง ที่ จํา เป น สํา หรับ การคัด เลือ กสุ กรเพื่ อ ใหมี ก ารเจริญ เติบ โตและลั ก ษณะซากตามที่ต อ งการ
เชียงใหมสัตวแพทยสาร 2550;(2):159-166
คําสําคัญ : สุกร เซลลกลามเนื้อ ปจจัย
Journal of Volume 86
Number 4
Animal Science April 2008
CONTENTS
ANIMAL GENETICS
Molecular Genetics
Relationship between myosin heavy chain isoform expression and muscling in several diverse pig breeds.
K. Wimmers, N. T. Ngu, D. G. J. Jennen, D. Tesfaye, E. Murani, K. Schellander, and S. Ponsuksili.............. 795
Quantitative Genetics
Reproductive performance and genetic parameters in first cross ewes from different maternal genotypes.
R. A. Afolayan, N. M. Fogarty, A. R. Gilmour, V. M. Ingham, G. M. Gaunt, and L. J. Cummins..................... 804
Inheritance of pulmonary arterial pressure in Angus cattle and its correlation with growth. K. L. Shirley,
D. W. Beckman, and D. J. Garrick........................................................................................................................ 815
ANIMAL GROWTH, PHYSIOLOGY, AND REPRODUCTION

Growth and Developmental Biology
Baggs ewes adapt to maternal undernutrition and maintain conceptus growth by maintaining fetal
plasma concentrations of amino acids. W. S. Jobgen, S. P. Ford, S. C. Jobgen, C. P. Feng,
B. W. Hess, P. W. Nathanielsz, P. Li, and G. Wu.................................................................................................. 820
ANIMAL NUTRITION
Nonruminant Nutrition
Effects of dietary arginine supplementation during gestation and lactation on the performance
of lactating primiparous sows and nursing piglets. R. D. Mateo, G. Wu, H. K. Moon, J. A. Carroll,
and S. W. Kim......................................................................................................................................................... 827
Evaluation of alternatives to antibiotics using an Escherichia coli K88+ model of piglet diarrhea: Effects
on gut microbial ecology. S. K. Bhandari, B. Xu, C. M. Nyachoti, D. W. Giesting, and D. O. Krause............... 836
Nutrient digestibility and performance responses of growing pigs fed phytase- and xylanase-
supplemented wheat-based diets. T. A. Woyengo, J. S. Sands, W. Guenter, and C. M. Nyachoti..................... 848
Effect of low doses of Aspergillus niger phytase on growth performance, bone strength, and nutrient
absorption and excretion by growing and finishing swine fed corn-soybean meal diets deficient
in available phosphorus and calcium. T. L. Veum and M. R. Ellersieck............................................................. 858
Effects of adding fibrous feedstuffs to the diet of young pigs on growth performance, intestinal cytokines,
and circulating acute-phase proteins. T. E. Weber, C. J. Ziemer, and B. J. Kerr............................................... 871
Ruminant Nutrition
Effect of method of applying fibrolytic enzymes or ammonia to Bermudagrass hay on feed intake,
digestion, and growth of beef steers. N. A. Krueger, A. T. Adesogan, C. R. Staples, W. K. Krueger,
S. C. Kim, R. C. Littell, and L. E. Sollenberger..................................................................................................... 882
Effects of level and source of dietary selenium on maternal and fetal body weight, visceral organ mass,
cellularity estimates, and jejunal vascularity in pregnant ewe lambs. T. L. Neville, M. A. Ward,
J. J. Reed, S. A. Soto-Navarro, S. L. Julius, P. P. Borowicz, J. B. Taylor, D. A. Redmer,
L. P. Reynolds, and J. S. Caton............................................................................................................................. 890
The effects of ractopamine-hydrogen chloride (Optaflexx) on performance, carcass characteristics,
and meat quality of finishing feedlot heifers. M. J. Quinn, C. D. Reinhardt, E. R. Loe,
B. E. Depenbusch, M. E. Corrigan, M. L. May, and J. S. Drouillard.................................................................. 902
Relationship between myosin heavy chain isoform expression and muscling in several
diverse pig breeds
K. Wimmers, N. T. Ngu, D. G. J. Jennen, D. Tesfaye, E. Murani, K. Schellander and S.
Ponsuksili
J ANIM SCI 2008, 86:795-803.

doi: 10.2527/jas.2006-521 originally published online December 21, 2007
The online version of this article, along with updated information and services, is located on
the World Wide Web at:
http://www.journalofanimalscience.org/content/86/4/795
www.asas.org
Downloaded from www.journalofanimalscience.org by guest on June 3, 2013

Relationship between myosin heavy chain isoform expression
and muscling in several diverse pig breeds1
K. Wimmers,* N. T. Ngu,† D. G. J. Jennen,† D. Tesfaye,† E. Murani,*

K. Schellander,† and S. Ponsuksili*2
*Research Institute for the Biology of Farm Animals, Wilhelm-Stahl-Allee 2, 18196 Dummerstorf,
Germany; and †Institute of Animal Science, Animal Breeding and Husbandry Group,
University of Bonn, Endenicher Allee 15, 53115 Bonn, Germany
ABSTRACT: The objective of this study was to exam- The comparison among different breeds confirmed the
ine the relationship of the relative abundance of tran- trend of high MyHC IIb transcript abundance together
scripts of myosin heavy chain (MyHC) isoforms and with high muscularity. In Pietrain, Duroc, DUPI, and
muscling in several diverse pig breeds. The animals DUMI, MyHC IIb accounted for more than half of the
used were from 3 pure breeds (Pietrain, Duroc, and MyHC transcripts (65.4, 59.7, 54.0, and 54.0%). Mong-
Mongcai) and 2 crosses [Duroc × Pietrain (DUPI) and cai showed low MyHC IIb (11.4%) but high type I, IIa,
Duroc × Berlin Miniature pigs (DUMI)]. Real-time PCR and IIx relative RNA levels (24.1, 28.5, and 35.9%).
Frequencies of fibers, determined by muscle fiber stain-
quantification of MyHC isoforms I, IIa, IIx, and IIb
ing with ATPase, and relative abundance of MyHC iso-
showed that the relative expression of MyHC IIb was
forms, determined by quantitative reverse transcrip-
greater in pigs with large LM areas in both DUPI (69.6 tion-PCR, of corresponding pairs of type I, IIa, and IIx/
vs. 53.0%) and DUMI (60.5 vs. 47.5%). In DUPI, similar IIb were correlated (r = 0.71, 0.67, and 0.52, respec-
transcript levels of MyHC I were found in both large and tively). The study demonstrates that MyHC IIb fibers
small LM (14.7 and 15.2%), whereas in DUMI animals, are the most prominent in pigs having large LM area
these values were 18.4 and 33.5% (P < 0.05). The groups and implies that MyHC IIb is the determining fiber
of animals with large and small LM area in the DUPI contributing to the differentiation of large and small
also tended to differ in MyHC IIa and IIx transcripts. loin eye muscle area in the pig.
Key words: longissimus dorsi, myosin heavy chain, pig, real-time polymerase chain reaction
©2008 American Society of Animal Science. All rights reserved. J. Anim. Sci. 2008. 86:795–803
doi:10.2527/jas.2006-521
INTRODUCTION known in mammals have been identified in porcine

muscle (Chang and Fernandes, 1997).
Skeletal muscles are composed of several myofiber By real-time PCR, a large proportion of fast isoform
types, which exhibit differences in contractile and bio- IIb contributing to cross-sectional fiber area of pig lon-
chemical properties, contributing to their structural gissimus dorsi (LD) was uncovered (da Costa et al.,
and functional diversity (Schiaffino and Reggiani, 2002; Lefaucheur et al., 2004). Here, a question arises
1996). Accordingly, muscle fibers may be differentiated whether the differences in MyHC composition in pigs
by their metabolic, contractile, or both, properties as with small and large loin eye muscle area are due to
oxidative, oxido-glycolytic, and glycolytic fibers or as differences in IIb fibers. We aimed to address the hy-
slow-twitch oxidative, fast-twitch oxidative, and fast- pothesis that MyHC IIb is reflective for muscle
twitch glycolytic fibers (Ashmore et al., 1972; Picard et growth-hypertrophy.
al., 2002). The different fibers contain different myosin Therefore, relative proportions of MyHC isoform
heavy chain (MyHC) isoforms. Four out of 8 isoforms transcripts were determined by real-time PCR in ani-
mals from 3 pure breeds known to differ in muscularity
(Pietrain, Duroc, and Mongcai) and 2 crosses [Duroc ×
1
Pietrain (DUPI) and Duroc × Berlin Miniature pigs
This project was supported by the Federal Ministry of Education
(DUMI)] for comparisons between populations. More-
and Research, grant VNB02/B06, Germany.
2
Corresponding author: s.wimmers@fbn-dummerstorf.de over, within the 2 crosses (DUPI and DUMI), sib pairs
Received August 1, 2006. discordant for the trait longissimus area were examined
Accepted December 13, 2007. to provide comparisons of extreme phenotypes within
795

796 Wimmers et al.
populations. Results of relative MyHC isoform tran- Isolation of RNA and cDNA Synthesis
script quantification were compared with results from
histological profiling to assess the correlation between Tissue samples of all animals were taken from the
these 2 methods of determining the composition of skel- LD between the 13th and 14th ribs. All samples were
etal muscle. We intended to evaluate the application of processed for RNA isolation and cDNA synthesis by the
relative quantification of MyHC isoform transcripts by same person applying the same protocols either in the
real-time PCR as a new tool to reflect muscle fiber types advance laboratory of Cantho University, Vietnam, or
for further research toward understanding the signifi- in the laboratory of the Institute of Animal Science,
cance of muscle type in modulating muscle growth. University of Bonn, Germany. Total RNA was isolated
from LD muscle using Trizol Reagent (Invitrogen, Karl-
sruhe, Germany) according to the protocol of the manu-
MATERIALS AND METHODS facturer and treated with DNase I (Roche, Mannheim,
Germany) to decontaminate trace genomic DNA. The
Animals and Muscle Sampling RNA was then purified using the Qiagen RNeasy kit
(Qiagen, Hilden, Germany). The RNA was quantified
All handling of the animals was done in accordance by photospectrometry, and its integrity was evaluated
with German law for the protection of animals and was on 1% agarose gels containing formaldehyde and ethid-
approved by the institutional animal welfare protec- ium bromide.
tion commission. The RNA and corresponding cDNA were used as tem-
In this study, 3 pig breeds (Mongcai, Pietrain, and plates in the PCR reactions using intron-spanning
primers of the GAPDH gene to confirm the absence
Duroc) and 2 crosses (DUPI and DUMI) were examined.
of genomic DNA. First-strand cDNA were synthesized
All animals were free of the RYR1 mutation responsible
from individual RNA using Superscript II enzyme (In-
for malignant hyperthermia syndrome. From the pure-
vitrogen). In brief, the reaction was initiated by adding
bred Mongcai raised on a state farm in central Vietnam,
oligo (dT)15 primer and random primer to total RNA
6 finishing pigs with BW 33.8 ± 2.4 kg at the age of 215
and incubating at 68°C for 5 min followed by cooling
± 7 d were sampled. Fresh LD muscle samples taken
on ice for 5 min. A transcription mixture including first-
at the 13th to 14th ribs were stored in liquid N and
strand 5X buffer, DTT, deoxynucleoside triphosphate,
further processed for RNA and cDNA synthesis at the
SuperScript II reverse transcriptase, and RNasin ribo-
advanced laboratory of Cantho University, Vietnam,
nuclease inhibitor was prepared to make a final volume
as detailed below. All other animals were kept at the
of 20 ␮L. The reaction was incubated at 25°C for 5 min
research farm Frankenforst, University of Bonn, Ger- followed by 42°C for 1 h and stopped by heating at 70°C
many, where they were performance-tested according for 15 min. The cDNA were tested for their suitability
to the German performance test directives (ZDS, 2003). to amplify the housekeeping gene, 18S rRNA, and kept
From the commercial breeds (Pietrain and Duroc), 9 at −20°C until further use.
unrelated animals were sampled (Pietrain and Duroc:
carcass weight 83.5 ± 1.1 and 89.1 ± 3.1 kg, and age at Primer Design
slaughter 173 ± 6 and 197 ± 5 d, respectively). In addi-
tion, 2 F2 populations were generated and used in this Primer Express Software (version 2.0, Applied Bio-
study: a population based on reciprocal crossing of Du- systems, Darmstadt, Germany) was used to design
roc and Pietrain (DUPI) and a cross of Duroc and Berlin primers for amplification of the MyHC isoforms and the
Miniature pigs (DUMI), which resulted from crosses of 18S rRNA gene. The 4 MyHC isoforms share similar
Vietnamese pot belly pigs, saddle back pigs, and Ger- sequences. To obtain specific PCR products, these se-
man Landrace (Hardge et al., 1999). From the popula- quences were aligned, and primers were selected in
tion of 598 F2 DUPI pigs, 30 animals of 15 full-sib specific regions showing low similarity. Primer se-
families were used to compare the results of relative quences and PCR conditions are listed in Table 1.
MyHC isoform transcript quantification by real-time
PCR with the results from histological profiling. An Quantitative Real-Time PCR
additional 6 DUPI animals were selected that were Reverse transcription and PCR were performed on
discordant sibs of animals of the set of 30 animals, to samples from individuals from each group. Real-time
establish a set of 6 discordant sib pairs, balanced for sex, reverse transcription-PCR was performed on an ABI
representing extremes for traits related to muscularity Prism 7000 Sequence Detection System (Applied Bio-
and carcass composition. Thus, in total, 36 DUPI ani- systems) in the laboratory of the Institute of Animal
mals were used. Of 420 DUMI F2 animals, 6 discordant Science, University of Bonn, Germany. The reaction
sib pairs, balanced for sex, were also selected. In both mixture consisted of cDNA, 0.5 ␮M of upstream and
DUPI and DUMI resource populations, ranking of the downstream primers, and SYBR Green Universal PCR
animals was based on LM area, measured from digital Mastermix (Applied Biosystems) containing SYBR
images of a slice of LM taken between the 13th and Green I Dye, AmpliTaq Gold DNA Polymerase, deoxy-
14th ribs. nucleoside triphosphate with deoxyuridine triphos-

Myosin heavy chain isoforms in pig muscle 797
Table 1. List of primers used to quantify myosin heavy chain (MyHC) isoforms
Annealing GenBank
Gene Primer sequence (5′ to 3′) temperature, °C accession no.
MyHC I Forward: AAGGGCTTGAACGAGGAGTAGA 60 AB053226

Reverse: TTATTCTGCTTCCTCCAAAGGG
MyHC IIa Forward: GCTGAGCGAGCTGAAATCC 60 AB025260
Reverse: ACTGAGACACCAGAGCTTCT
MyHC IIx Forward: AGAAGATCAACTGAGTGAACT 60 AB025262
Reverse: AGAGCTGAGAAACTAACGTG
MyHC IIb Forward: ATGAAGAGGAACCACATTA 57 AB025261
Reverse: TTATTGCCTCAGTAGCTTG
18S RNA Foward: GAGCGAAAGCATTTGCCAAG 60 AF102857
Reverse: GGCATCGTTTATGGTCGGAAC
phate, passive reference, and buffer components. Ther- stained for mATPase activity after both acid (pH = 4.6
mal parameters used to amplify the template began and 4.3) and alkaline (pH = 9.4) preincubation. The
with initial denaturation at 95°C for 10 min, followed samples were examined to differentiate type I (slow, red
by 40 cycles of 95°C for 15 s denaturation, and 60°C muscle, oxidative), type IIa (fast, red muscle, oxidative),
for 1 min annealing and extension. A dissociation curve and type IIb/IIx (fast, white muscle, glycolytic) fibers.
was generated at the end of the last cycle by collecting In total, 30 samples taken from F2 animals of the DUPI
the fluorescence data at 60°C and taking measurements population were used. The determination of fiber type
every 7 s until the temperature reached 95°C. Final frequency was done on images captured with a CCD
quantification analysis was done by amplifying serial camera (Photometrix Sensys, Kew, Australia) and pro-
dilutions of target plasmid DNA. Using the ABI Prism cessed with IP-Lab Spectrum acquisition software (Sca-
7000 SDS software (Applied Biosystems), the concen- nalytics, Rockville, MD). Per sample, 400 fiber cross-
tration of unknown cDNA was calculated according to sections were independently scored by 2 investigators,
the standard curve, and expression levels of transcripts and fiber type frequencies were obtained from the ratio
were described relative to the transcript of the 18S of the number of each fiber type to the total number of
gene, which was found to be stable between the samples fibers counted (Wimmers et al., 2006).
containing equal amounts of analyzed cDNA. Based on
these data, the relative abundance of the 4 adult MyHC Statistical Analysis
isoforms was calculated as the ratio of the normalized The SAS package (SAS Inst. Inc., Cary, NC) was used
expression level of each MyHC isoform to the total ex- for statistical analyses. For each isoform, least squares
pression of MyHC. means of the relative expression within the individual
populations were estimated using PROC GLM of SAS
Histological Analysis and compared pairwise between populations using a t-
test that was adjusted for multiple comparisons using
To differentiate the 3 main fiber types, samples were
the Tukey-Kramer correction.
stained using the myosin ATPase (mATPase) method
(Brooke and Kaiser, 1970). In brief, cross-sectional sam- RESULTS
ples of 10 ␮m were cut in a cryostat at −20°C from
pieces of the center of a sample of the LD muscle taken Levels of expression of MyHC isoforms slow/I, IIa,
between the 13th and 14th ribs. These sections were IIx, and IIb were expressed relative to the transcript
Table 2. Muscle fiber typing (%) by ATPase staining and quantitative reverse transcription-
PCR (RT-PCR) assays1
Muscle fiber ATPase ATPase ATPase Real-time Correlation
type pH 4.3 pH 9.4 pH 4.6 RT-PCR coefficient2
I 18.4 ± 1.8 17.3 ± 1.6

II 81.6 ± 1.8 82.7 ± 1.6
MyHC I 16.1 ± 1.9 18.3 ± 1.8 0.72 (P = 0.004)
MyHC IIa 3.5 ± 0.6 12.8 ± 3.0 0.67 (P = 0.009)
HyMC IIx 16.5 ± 2.6
MyHC IIb 80.4 ± 1.93 52.4 ± 5.0 0.53 (P = 0.05)2
n = 30, means ± SE.

1
2
Coefficient of correlation between ATPase pH 4.6 and real-time RT-PCR values.
3
Values represent both myosin heavy chain (MyHC) IIx and MyHC IIb isoforms.

798 Wimmers et al.
Figure 1. Standard curves of 5 genes (18S, MyHC I, MyHC IIa, MyHC IIx, and MyHC IIb). Similar slopes suggest
similarity in amplification efficiencies.
abundance of the 18S rRNA gene. Standard curves were tively. Both methods showed that MyHC II fibers were
established to estimate the normalized transcript abun- predominant (Table 2).
dances. The standard curve gradients of all genes had Animals of 2 commercial breeds (Duroc and Pietrain)
similar slopes (3.75 ± 0.02), implying similar PCR am- and a native breed (Mongcai) were examined, because
plification efficiency (Figure 1). We aimed to evaluate they differ in traits related to muscularity and meat
the relationship between muscle fiber type composition
as examined by histochemistry, LM area measured at
the 13th/14th rib (suspected to be related to differences
in muscle fiber type proportions), and relative abun-
dance of MyHC isotype transcripts. Relative abundance
of transcripts of MyHC isoforms determined by real-
time PCR may be a new phenotype suitable as an alter-
native phenotype to muscle fiber typing based on histo-
logical methods in attempts to elucidate the relation-
ship of functional and structural muscle properties with
meat and carcass traits.
By ATPase staining after acidic preincubation (pH
4.6), 3 fiber types were distinguished (i.e., black type
I, white or unstained type IIa, and gray type IIb/IIx
fibers; Figure 2), whereas ATPase staining after prein-
cubation at pH 4.3 and pH 9.4 only allowed discrimina-
tion of type I and type II fibers. In the same samples,
by real-time reverse transcription-PCR with specific Figure 2. Muscle fiber composition of a DUPI (Duroc ×
primers for 4 adult MyHC isoforms, the relative abun- Pietrain) F2 pig with typical growth performance, carcass
dance of the transcripts was determined. Correlations composition, and muscle fiber type composition (slaugh-
between these phenotypes ranged from 0.53 to 0.72 and ter weight = 86.2 kg, loin eye muscle area = 46.1 cm2; type
were highly significant for the corresponding pairs of I = 20.6%, type IIa = 2.7%, type IIb/x = 76.7%) detected
muscle samples characterized by histochemistry and by myosin ATPase staining after acidic preincubation at
relative MyHC isoform transcript abundance, respec- pH 4.6.

Table 3. Percentage of myosin heavy chain isoforms (MyHC) in 5 breeds quantified by
real-time PCR1
Breed
Pietrain Duroc Mongcai DUPI2 DUMI3

Item (n = 6) (n = 3) (n = 6) (n = 36) (n = 12) P-value
MyHC I 9.4 ± 4.0b 10.0 ± 5.7bc 24.1 ± 4.0ac 17.3 ± 1.5bc 25.9 ± 2.8a <0.01
MyHC IIa 4.3 ± 2.5b 12.2 ± 3.5b 28.6 ± 2.5a 11.2 ± 1.3b 7.4 ± 1.7b <0.001
MyHC IIx 20.9 ± 3.0b 18.1 ± 4.3b 35.9 ± 3.0a 17.4 ± 1.4b 12.7 ± 2.1b <0.001
MyHC IIb 65.4 ± 4.8a 59.7 ± 6.7a 11.4 ± 4.8b 54.0 ± 2.4b 54.0 ± 3.4a <0.001
Within a row, means without a common superscript letter differ (P < 0.05).
a-c
1
Least squares means ± SE.
2
DUPI = Duroc × Pietrain.
3
DUMI = Duroc × Berlin Miniature.
quality. In both commercial breeds, MyHC type IIb ac- prolificacy of satellite cells. The proportion of different
counted for more than half of the MyHC transcripts muscle fibers, their structure, and functional properties
(59.7 and 65.4%, respectively). The native pig, Mongcai, affect the growth performance of the animal and are
showed very low MyHC IIb transcript abundance com- endogenous factors for postmortem meat quality traits
pared with the other breeds. However, the Mongcai (Lengerken et al., 1994). The dramatic improvement of
showed a much greater relative abundance of the other growth performance and lean content of pigs is sus-
MyHC isoforms. Also, in the crossbred pigs examined, pected to coincide with altered meat quality. Inconsis-
including the animals exhibiting small and large LM tency of results regarding the relationship of muscle
areas, the proportion of MyHC type IIb transcripts was fiber traits and meat quality and muscularity demon-
greater than 50% of the MyHC transcripts (DUPI = strates the difficulty in determining the most advanta-
54.0% and DUMI = 54.0%). In terms of slow fiber, DUMI geous muscle fiber types (Larzul et al., 1997; Fiedler et
had a significantly greater proportion of MyHC I iso- al., 1999, 2003; Lefaucheur et al., 2004). The fact that
form than the other breeds, with the exception of Mong- some muscle fibers cannot be assigned to a particular
cai (Table 3). type due to intermediate properties, and the recent
To further address the relationship between traits findings of 4 isotypes of adult MyHC protein in porcine
related to muscularity and relative abundance of MyHC muscle, whereas conventional muscle fiber typing only
isoforms, divergent sib pairs of 2 F2 populations based classifies 3 types of fibers, demonstrates the need to
on divergent founder breeds were used. Animals se- define new phenotypes to understand the relationship
lected for identification of the expression profile of 4 of muscle structural and functional properties with
MyHC isoforms were similar in birth weight, BW, and meat quality and quantity and genetic control mech-
slaughter weight, assuring that differences in the traits anisms.
of interest between them were not due to the different Breed probably accounts for most of the genetic fac-
stages of growth development. However, the loin eye tors affecting the muscle fiber composition of a certain
muscle area was statistically different (P < 0.01; Table muscle. Pietrain is well known for its muscularity and
4) between the 2 groups within both the DUPI and leanness, whereas Duroc has desirable meat quality in
DUMI populations. Owing to genetic characteristics, terms of marbling, tenderness, and juiciness. The third
larger LM areas were observed in DUPI than in DUMI breed, Mongcai, is a popular local breed in the Central
pigs. However, this does not affect the shift of direction coastline, the Red River Delta, and other northern prov-
of fiber type composition, as seen in Figures 3 and 4. inces of Vietnam with favored characteristics of high
Discordant sib pairs in the DUMI and the DUPI popula- prolificacy, good adaptation to poor-quality feed, and
tions differed significantly in the relative abundance of disease resistance but low performance with small body
MyHC type IIb transcripts. size and low growth rate. Genetically, Pietrain, Duroc,
In the DUPI resource population, similar transcript and Mongcai are ostensibly distinct breeds in growth
levels of MyHC I were found in both large and small and muscularity. Enormous genetic variation among
muscle (14.7 and 15.2%), whereas in DUMI animals, these breeds could account for the variation in MyHC
these values were 18.4 and 33.5%, respectively, and relative expression across breeds.
were different at P < 0.05. The extreme groups in the The relative number of white fibers (IIx and IIb types)
DUPI tended to differ in MyHC IIa and IIx transcripts. was indicated to contribute up to 85.2% of total fiber
number in Pietrain (Müller et al., 2002), whereas only
DISCUSSION 8.5% of muscle fibers were type I fibers. Moreover, in
Muscle Fiber Composition in Different Breeds Duroc muscle, the composition of muscle fiber types
was slightly different (i.e., 14.5% for type I and 81.5%
The growth and weight of muscle is mainly deter- for type IIx and IIb) from that of Pietrain (Chang et
mined by the number and size of the muscle fibers and al., 2003). Results from the current study are compara-

800 Wimmers et al.
Table 4. Performance of animals from F2 resource populations of 598 DUPI (Duroc ×

Pietrain), 420 DUMI (Duroc × Berlin Miniature) pigs and selected pigs with small and
large LM areas1
Small LM Large LM
Item All area area
DUPI
Animals, n 598 6 6
Birth weight, kg 1.5 ± 0.01 1.6 ± 0.14 1.7 ± 0.14
BW, kg 110.9 ± 0.2 111.1 ± 0.98 109 ± 1.2
Carcass weight, kg 85.2 ± 0.2 84.1 ± 0.99 84.8 ± 1.6
Age, d 178 ± 0.9 176 ± 11.0 181 ± 7.8
Loin eye muscle area, cm2 51.2 ± 0.2 43.3b ± 1.2 60.3a ± 1.8
DUMI
Animals, n 420 6 6
Birth weight, kg 0.9 ± 0.01 0.7 ± 0.13 0.9 ± 0.15
BW, kg 87.0 ± 0.6 79.7 ± 5.1 90.3 ± 5.2
Carcass weight, kg 67.4 ± 0.5 61.6 ± 4.1 69.1 ± 4.2
Age, d 201 ± 0.2 201 ± 0.1 203 ± 0.1
Loin eye loin, cm2 24.5 ± 0.2 17.7b ± 0.9 28.5a ± 0.7
Within a row, means without a common superscript letter differ (P < 0.001).
a,b
1
Means ± SE.
ble (86.3 and 77.8% for IIb + IIx in Pietrain and Duroc, 1997). In addition to the identification of muscle fiber
respectively) to those findings and, therefore, support composition in commercial pigs, the proportions of these
the statement that, in modern pig breeds, fiber composi- fibers were also determined for the native Mongcai
tion is directed to a greater proportion of larger type breed, in which a dramatic difference in relative expres-
IIb fibers (Ruusunen and Puolanne, 2004). Similar pro- sion profile was found. Indeed, the proportion of IIx and
files of muscle fiber types were reported in other com- IIb fibers in Mongcai pigs was lower (47.3%) compared
mercial pure breeds, including Large White (Lef- with other conventional breeds, as analyzed here and
aucheur et al., 2002, 2004; Chang et al., 2003) and in other studies involving breeds such as Berkshire
Landrace and Yorkshire (Ruusunen and Puolanne, (85.7%), Hampshire (75.3%), and wild boar (84.2%) (Ru-
Figure 3. Relative muscle expression of the 4 adult myosin heavy chain (MyHC) isomers (I, IIa, IIx, IIb) in large
and small LM of 6 discordant sib pairs of the DUPI (Duroc × Pietrain) pig resource population. a,bDifferent letters at
bars within MyHC isoform indicate differences of least squares means between the groups of animals as revealed by
pairwise t-test (P < 0.05; error bars show SE).

Figure 4. Relative muscle expression of the 4 adult myosin heavy chain (MyHC) isomers (I, IIa, IIx, IIb) in large
and small LM of 6 discordant sib pairs of the DUMI (Duroc × Berlin Miniature) pig resource population. a,bDifferent
letters at bars within MyHC isoform indicate differences of least squares means between the groups of animals as
revealed by pairwise t-test (P < 0.05; error bars show SE).
usunen and Puolanne, 1997; Müller et al., 2002; Chang Gustavsson et al. (1994) found lipids present mainly in
et al., 2003). When taking only IIb fiber into consider- type I/slow and some IIa fibers. Mongcai is known to
ation, the proportion in Meishan LD muscle (Lef- have high levels of i.m. fat and thereby shows highly
aucheur et al., 2004) was nearly in line with our findings preferred meat quality but unsatisfactory muscularity
in Mongcai (17.1 and 11.4%, respectively), but in Meis- in comparison with commercial breeds with high mus-
han, IIx fibers were shown to be most prominent (61.1%; cularity but inferior meat quality. Although the lipid
Lefaucheur et al., 2004), whereas in Mongcai, type I, content was not determined in the current study, the
IIa, and IIx were equally frequent. high percentage of MyHC IIa isoform from Mongcai
The percentage of MyHC IIb is an important feature, muscle suggests an important role in lipid storage. That
because it contributes to increases in muscle mass, high values of i.m. fat were found in a cross of Duroc
which is desired by animal breeders. Moreover, as × Berlin Miniature pigs additionally supports this view
shown in this and other studies, the IIb isoform is the (Fiedler et al., 2003).
predominant form in LD muscle and is most likely re-
sponsible for the formation of large muscle fiber types. Muscle Fiber Composition of Large
Kristensen et al. (2002) reported that large muscle fi- and Small Muscle Within Breed
bers and high growth rate are also associated with
greater protein turnover, which may increase the syn- Muscle fiber type distribution in commercial cross-
thesis of proteolytic enzymes and thereby have a posi- bred pigs is similar to that of pure breeds. As an exam-
tive effect on meat tenderness. Nevertheless, this con- ple, Ryu et al. (2004) showed that the greatest percent-
clusion is not always in agreement with results of other age of myofibers was white fiber IIx and IIb with a
experiments. For instance, Chang et al. (2003) con- value of 80.2% in a Duroc × (Yorkshire × Landrace)
cluded that color characteristics, better water-holding cross. A slightly lower proportion was previously re-
capacity, and better tenderness were positively related ported by Fiedler et al. (1999) for a Pietrain × Landrace
to the presence of oxidative fibers, and, hence, the main cross (75%). Results from our study indicated the trend
favorable fiber types were IIa and IIx. Sensory meat that the contributions of IIx and IIb fibers in DUPI
quality is closely related to the content of i.m. fat, but were lower compared with the pure breeds (Duroc and
various studies showed different outcomes regarding Pietrain) and vice versa for type I fibers, which were
the location of lipids in fiber types. Whereas Henckel elevated by up to 15% in the DUPI. However, differ-
et al. (1997) reported that the frequency of IIb fiber ences were not statistically different at P < 0.05. In the
and i.m. fat content were positively correlated, Essen- DUMI resource population, there was evidence that

802 Wimmers et al.
the genetic background of Berlin Miniature pigs led In summary, we have compared histological and
to decreased IIb fiber proportion (66.7%), whereas the quantitative real-time assays to estimate the propor-
relative expression of type I increased to 25.9%. Corres- tion of fiber types in LD porcine skeletal muscle. The
pondingly, muscle fibers detected by histochemical dif- highly significant correlations between the correspond-
ferentiation had contributions of 71% (type IIb and IIx) ing MyHC isoforms evidenced the consistency of results
and 15.3% (type I; Fiedler et al., 2003). between the 2 methods. The real-time PCR quantifica-
In this study, we examined relative MyHC isoform tion of MyHC isoform transcripts reveals an average
transcript levels as an alternative phenotype to assess value of the contribution of the different MyHC isoforms
muscle fiber composition of the same muscle (LD) be- to the muscle phenotypes. The formal classification into
tween 2 pig groups within 2 populations (DUPI and muscle fibers is artificial as shown by the slightly differ-
DUMI). Several factors potentially affect fiber propor- ent results depending on histological method used and
tion, including birth weight, growth rate, and slaughter the existence of hybrid fiber types. The real-time PCR
weight. Although birth weight was indicated to have assay represents a new phenotype close to the effect of
an association with enlarged muscle fiber area (Gondret genes, which is probably more suitable to unravel the
et al., 2006), its influence on muscle fiber composition genetic background in variation of traits related to mus-
of LD muscle and other muscles such as longissimus cle and meat properties depending on muscle fiber dis-
lumborum or rhomboideus was not found (Bee, 2004). tribution. However, this assay does not provide infor-
Growth rate also has an effect on the cross-sectional mation on fiber size and fiber number.
area of fibers, especially on IIa, which was shown to Moreover, we also observed that differences in fiber
increase with increasing growth rate (Ruusunen and composition between large and small muscle groups
Puolanne, 2004). However, the IIa fibers are a minor were due to type IIb, which is not surprising, because
fiber with low numbers shown in most studies; there- in most cases, it contributes greatly to the composition
fore, they may not have strong effects on muscle size. of muscle fiber. By analyzing well-selected sib pairs of
Ryu et al. (2004) discovered that muscle fiber composi- the experimental populations DUPI and DUMI, which
tion was not significantly associated with carcass were specifically discordant in the trait loin eye muscle
weight or loin eye area. Increasing BW and age at area but similar in other traits that are possible factors
slaughter significantly affected cross-sectional area but altering the fiber proportion (Table 4), we can, for the
did not change the numerical percentage of any fibers first time, demonstrate that IIb is the determining fiber
(Čandek-Potokar et al., 1999). Thus, combining avail- contributing to the differentiation of large and small
able findings with the controlled pig selection in our loin eye muscle area in the pig. The comparison among
study, these weight and growth traits can be excluded different breeds confirmed the trend of high MyHC IIb
as factors altering muscle fiber proportions. transcript abundance going together with high muscu-
larity. Further studies are encouraged to discover the
Muscle Fiber Typing by mATPase Staining genetic backgrounds or which genes are involved in
and the Consistency Between Real-Time this phenomenon.
PCR and Histochemistry Methods
LITERATURE CITED
Various methods of muscle fiber differentiation de-
scribe different phenotypes of the muscle. Muscle fiber Ashmore, C. R., G. Tompkins, and L. Doerr. 1972. Postnatal develop-
types are characterized by the content of different ment of muscle fiber types in domestic animals. J. Anim. Sci.
MyHC isoforms, enzymes, structural proteins, and or- 34:37–41.
Bee, G. 2004. Effect of early gestation feeding, birth weight, and
ganelles that warrant specific biochemical and biophys- gender of progeny on muscle fiber characteristics of pigs at
ical properties of the fibers. A combination of different slaughter. J. Anim. Sci. 82:826–836.
methods of examining the fiber types may yield the Brooke, M. H., and K. K. Kaiser. 1970. Muscle fiber types: How many
most comprehensive characterization of muscles and and what kind? Arch. Neurol. 23:369–379.
further analysis of the genetic mechanisms of muscle Čandek-Potokar, M., L. Lefaucheur, B. Žlender, and M. Bonneau.
1999. Effect of slaughter weight and/or age on histological char-
growth. Conventionally, histochemistry by mATPase acteristics of pig longissimus dorsi muscle as related to meat
stability has been used in most studies for many years. quality. Meat Sci. 52:195–203.
Using this methodology, porcine fibers can be classified Chang, K. C., N. da Costa, R. Blackley, O. Southwood, G. Evans, G.
into type I, IIa, and IIb (Lefaucheur et al., 1991; Fazar- Plastow, J. D. Wood, and R. I. Richardson. 2003. Relationships
inc et al., 1995). For more accurate muscle typing to of myosin heavy chain fiber types to meat quality traits in tradi-
tional and modern pigs. Meat Sci. 64:93–103.
distinguish pure IIx and IIb, and the hybrid of these 2 Chang, K. C., and K. Fernandes. 1997. Developmental expression
fibers, immunocytochemistry with specific antibodies and 5′ end cDNA cloning of the porcine 2x and 2b myosin heavy
and quantitative real-time PCR have been applied more chain genes. DNA Cell Biol. 16:1429–1437.
recently (Lefaucheur et al., 2004; Toniolo et al., 2004). da Costa, N., R. Blackley, H. Alzuherri, and K. C. Chang. 2002.
Quantifying the temporospatial expression of postnatal porcine
The fiber proportions in our research were similar to
skeletal myosin heavy chain genes. J. Histochem. Cytochem.
the findings reported by Chang et al. (2003) and Lef- 50:353–364.
aucheur et al. (2004), despite slight differences that Essen-Gustavsson, B., A. Karlsson, K. Lundstrom, and A. C. Enfalt.
were likely due to breed-specific effects. 1994. Intramuscular fat and muscle fiber lipid contents in halo-

thane-gene-free pigs fed high or low protein diets and its relation growth, muscle and adipose tissue metabolism, and meat quality
to meat quality. Meat Sci. 38:269–277. in swine. J. Anim. Sci. 69:2844–2854.
Fazarinc, G., G. Majdic, J. Lorger, A. Pogacnik, and S. V. Bavdek. Lefaucheur, L., D. Milan, P. Ecolan, and C. Le Callennec. 2004. Myo-
1995. Combined histochemical and immunohistochemical deter- sin heavy chain composition of different skeletal muscles in
mination of three muscle fiber types in a single section of porcine Large White and Meishan pigs. J. Anim. Sci. 82:1931–1941.
skeletal muscle. Eur. J. Histochem. 39:309–316. Lengerken, V. G., S. Maak, M. Wicke, I. Fiedler, and K. Ender. 1994.
Fiedler, I., K. Ender, M. Wicke, S. Maak, G. v. Lengerken, and W. Suitability of structural and functional traits of skeletal-muscle
Meyer. 1999. Structural and functional characteristics of muscle for the genetic-improvement of meat quality in pigs. Arch. Tierz.
fibers in pigs with different malignant hyperthermia susceptibil- 37:133–143.
ity (MHS) and different meat quality. Meat Sci. 53:9–15. Müller, E., M. Rutten, G. Moser, G. Reiner, H. Bartenschlager, and
Fiedler, I., K. Nuernberg, T. Hardge, G. Nuernberg, and K. Ender. H. Geldermann. 2002. Fiber structure and metabolites in M.
2003. Phenotypic variations of muscle fiber and intramuscular longissimus dorsi of wild boar, Pietrain and Meishan pigs as
fat traits in longissimus muscle of F2 population Duroc × Berlin well as their crossbred generations. J. Anim. Breed. Genet.
Miniature pig and relationships to meat quality. Meat Sci. 119:125–137.
63:131–139. Picard, B., L. Lefaucheur, C. Berri, and M. J. Duclos. 2002. Muscle
Gondret, F., L. Lefaucheur, H. Juin, I. Louveau, and B. Lebret. 2006. fiber ontogenesis in farm animal species. Reprod. Nutr. Dev.
Low birth weight is associated with enlarged muscle fiber area 42:415–431.
and impaired meat tenderness of the longissimus muscle in pigs. Ruusunen, M., and E. Puolanne. 1997. Comparison of histochemical
J. Anim. Sci. 84:93–103. properties of different pig breeds. Meat Sci. 45:119–125.
Hardge, T., K. Koepke, M. Reissmann, and K. Wimmers. 1999. Mater- Ruusunen, M., and E. Puolanne. 2004. Histochemical properties of
fiber types in muscles of wild and domestic pigs and the effect
nal influences on litter size and growth in reciprocal crossed
of growth rate on muscle fiber properties. Meat Sci. 67:533–539.
miniature pigs and Durocs. Arch. Tierz. 42:83–92.
Ryu, Y. C., M. S. Rhee, and B. C. Kim. 2004. Estimation of correlation
Henckel, P., N. Oksbjerg, E. Erlandsen, P. Barton-Gade, and C. Bejer-
coefficients between histological parameters and carcass traits
holm. 1997. Histo- and biochemical characteristics of the longis-
of pig longissimus dorsi muscle. Asian-austral. J. Anim.
simus dorsi muscle in pigs and their relationships to perfor-
17:428–433.
mance and meat quality. Meat Sci. 47:311–321.
Schiaffino, S., and C. Reggiani. 1996. Molecular diversity of myofibril-
Kristensen, L., M. Therkildsen, B. Riis, M. T. Sørensen, N. Oksbjerg,
lar proteins: Gene regulation and functional significance. Phys-
P. P. Purslow, and P. Ertbjerg. 2002. Dietary-induced changes
iol. Rev. 76:371–423.
of muscle growth rate in pigs: Effects on in vivo and postmortem
Toniolo, L., M. Patruno, L. Maccatrozzo, M. A. Pellegrino, M. Canep-
muscle proteolysis and meat quality. J. Anim. Sci. 80:2862–2871. ari, R. Rossi, G. D’Antona, R. Bottinelli, C. Reggiani, and F.
Larzul, C., L. Lefaucheur, P. Ecolan, J. Gogue, A. Talmant, P. Sellier, Mascarello. 2004. Fast fibers in a large animal: Fiber types,
P. Le Roy, and G. Monin. 1997. Phenotypic and genetic parame- contractile properties and myosin expression in pig skeletal mus-
ters for longissimus muscle fibre characteristics in relation to cles. J. Exp. Biol. 207:1875–1886.
growth, carcass, and meat quality traits in large white pigs. J. Wimmers, K., I. Fiedler, T. Hardeg, E. Murani, K. Schellander, and
Anim. Sci. 75:3126–3137. S. Ponsuksili. 2006. QTL for microstructural and biophysical
Lefaucheur, L., P. Ecolan, L. Plantard, and N. Gueguen. 2002. New muscle properties and body composition in pigs. BMC Genet.
insights into muscle fiber types in the pig. J. Histochem. Cyto- 7:15.
chem. 50:719–730. ZDS. 2003. Richtlinie fuer die Stationspruefung auf Mastleistung,
Lefaucheur, L., J. Ledividich, J. Mourot, G. Monin, P. Ecolan, and Schlachtkoerperwert und Fleischbe-schaffenheit beim Schwein.
D. Krauss. 1991. Influence of environmental temperature on 10. 12. 2003, Bonn, Germany.


Development

Issue 1 (January)
Issue 2 (February)
Issue 3 (March)
Issue 4 (April)
Issue 5 (May)
Supplement (May)
Issue 6 (June)
Issue 7 (July)
Issue 8 (August)
Issue 9 (September)
Issue 10 (October)
Issue 11 (November)
Issue 12 (December)
ISSN 0121-3784
Livestock Research for Rural Development, Volume 20, Number 7, July 2008
Singh
112. Comparative studies of reducing level of organic with inorganic trace minerals supplementation
on the performance, nutrient digestibility and mineral balance in cross-bred male calves; S
Mondal, S K Paul, B Bairagi, M C Pakhira and P Biswas
113. Effects of drenching soybean oil and fish oil on intake, digestibility and performance of cattle
fattening in the Mekong Delta, Vietnam; Nguyen Thi Hong Nhan, Nguyen Trong Ngu, T R
Preston and R A Leng
114. Non-genetic factors influencing post-weaning growth and reproductive performances of

Arsi-Bale goats; H Dadi, G Duguma, B Shelima, T Fayera, M Tadesse, T Woldu and T A Tucho
Administrative
LRRD News
Effects of drenching soybean oil and fish oil on intake, digestibility and performance of cattle fattening in the Mekong Delta, Vietnam
Guide for
Livestock Research for Rural Development 20 (7) Citation of
preparation of LRRD News
2008 this paper
papers
Effects of drenching soybean oil and fish oil on intake,

digestibility and performance of cattle fattening in the Mekong
Delta, Vietnam
Nguyen Thi Hong Nhan, Nguyen Trong Ngu, T R Preston* and R A Leng**
nthnhan@ctu.edu.vn ; ntngu@ctu.edu.vn
*
trpreston@mekarn.org
**
rleng@ozmail.com.au
Abstract
Three Sindhi-Yellow cattle were fed a basal diet of rice straw ad libitum and para grass (1% of LW on DM basis) and given a
single drench of 6 ml/kg LW of either soybean oil or fish oil. The experiment was carried out according to a 3*3 Latin
square design, beginning with 20 days of adaptation followed by 21 days of data collection, in which three sub-periods of
7-days were divided to measure feed intake and digestibility. In a second experiment, 15 Sindhi-Yellow growing cattle
(136-143 kg) at a cooperative farm were arranged into 3 treatments with 5 replicates. The cattle were fed on the same diets
as in experiment 1 and kept for 90 days after being given a single dose 6 ml/kg LW of soybean oil or fish oil.
In both oil treatments, apparent digestibility was improved from 54.4 (control) to 61.3 and 60.9% for soybean and fish oils.
In the on-farm trial, growth rate increased to 383 and 387g/day in cattle given the oil drench compared to the control animals
(338 g/day). Feed conversion ratio tended to be better in cattle given the oil drench. There were no differences between fish
oil and soybean oil in the degree of beneficial effects on the cattle. Both can be applied for fattening cattle under farm
conditions.
Key words: defaunation, feed conversion, grass, growth, on-farm, protozoa, rice straw
Introduction
The first research published on this subject (Nguyen Thi Hong Nhan et al 2001) was stimulated by
observations of farmer practice in Central Vietnam. Subsequent experiments in Cambodia (Mom
Seng et al 2003), in An Giang province of South Vietnam (Nguyen Thi Hong Nhan et al 2003) and in
Cantho University (Nguyen Thi Hong Nhan et al 2007a), confirmed that soybean oil eliminated the
protozoa from the rumen resulting in faster growth rate of the cattle.. In addition to soybean oil, fish
oil is also used by farmers in An Giang province for fattening their cattle about 3 months before
slaughtering. The use of fish oil originated from the fact that catfish oil is abundant in the region and
it is less competitive with human needs.
In all the trials done so far, there has been no detailed comparison between vegetable oil and fish oil.
It is not known if cattle responses are similar for both these sources of long chain fatty acids. In the
Mekong Delta (MD), many farmers have specialized in cattle fattening; they purchase lean cattle,
often from Cambodia, and fatten them with a combination of grass, rice straw and rice bran. It is
therefore of considerable interest for these farmers to know the relative advantages of the two sources
of oil as a means of improving the efficiency of their fattening system.
The objectives of this research were therefore to determine the effects of the two sources of oil on
digestibility and growth performance of cattle fed on rice straw and grass. .
Experiment 1
Treatments and design
Three growing crossbred Sindhi-Yellow cattle (145-160 kg) were allocated to three treatments
according to a Latin square design. The treatments were:
RG: Rice straw ad libitum plus natural grass (1% LW, DM basis)
RGSO: Similar to RG with a single dose drench of soybean oil at 6ml/kg LW
RGFO: Similar to RG with a single dose drench of fish oil drench at 6ml/kg LW
All cattle were given a rumen supplement containing 1.5% sulphur, 5% salt, 5% bone meal, 73.5%
rice bran. The oil was given orally (Photo 1).
Photo 1. Administering the oil drench
Experimental procedures
The animals were vaccinated against foot and mouth disease and de-wormed before the initiation of
the experiment. After 20 days of adaptation, the cattle were given a single dose of soybean oil or fish
oil (Photos 2 and 3) followed by three sub-periods of 7 days each to measure feed intake and
digestibility.
Data collection
Feeds offered and refused were recorded daily during each consecutive 7 day period. Feces were
collected daily and frozen at –18C for later analysis. The determination of dry matter (DM) was by
drying at 65ºC for 24 h. Analysis of crude protein (CP), ether extract, ADF and NDF were according
to AOAC (1990).
Experiment 2
Fifteen young beef cattle with initial live weight from 136 to 143 kg on a cooperative farm were
allotted to the same 3 treatments and the same basal diet as in Experiment 1. The cattle fed for 90
days after being drenched orally with the oil During this period, they were totally confined in a shed;
drinking water and rumen supplement were available all the time.
The cattle were weighed in 2 consecutive mornings at the beginning, and after 30, 60 and 90 days of
the trial. Feed intake and residues were measured daily and representative samples were collected
and bulked weekly for chemical analysis including DM, CP, NDF, ADF and ash.
Photo 2. Soybean oil is easy to buy in the local Photo 3. Catfish oil is abundant in the Mekong Delta,
market. Vietnam
Statistical analysis
Data on feed intake and digestibility were subjected to analysis of variance using the least squares
General Linear Model (GLM) procedure of the Minitab Statistical Software Release 13.2 (2000).
Sources of variation were treatment and error.
Experiment 1
The composition of the rice straw and grass is in Table 1.
Table 1. Chemical analysis of the feed components

% (DM basis)
DM, %
N*6.25 EE ADF NDF Ash
Rice straw 89.4 5.9 1.4 39.4 67.1 15.4
Para grass 17.7 11.6 4.0 31.7 59.6 11.9
There was a very slight indication (P=0.30) that intakes appeared to be depressed during the first 7
days following the oil drench (Table 2). Coefficients of apparent digestibility of DM and crude
protein were increased in days 8-15 and 16-21 by some 7 percentage units by both types of oil drench
(an overall increase of 16%).
Table 2. Mean values for intake and apparent digestibility of DM and crude protein by cattle drenched once with
soybean oil (RGSO)or fish oil (RGFO) or not drenched (RG)
RG RGSO RGFO SEM P
DM intake, % body weight
Day 1-7 2.84 1.93 1.91 0.20 0.30
Day 8 – 15 2.52 2.76 2.90 0.05 0.07
Day 16 – 21 2.55 3.00 2.78 0.08 0.10
CP intake, % body weight
Day 1-7 0.21 0.18 0.21 0.03 0.50
Day 8 – 15 0.23 0.31 0.30 0.02 0.30
Day 16 – 21 0.25 0.32 0.30 0.01 0.70
Coefficient of apparent digestibility, %
Dry matter
Day 1-7 53.1 53.1 54.1 0.70 0.06
Day 8 – 15 a b b 0.50 0.01
53.1 61.1 61.5
Day 16 – 21 54.4a 61.3b 60.9b 0.70 0.04
Crude protein
Day 1-7 53.2 56.8 60.0 1.40 0.20
a
Day 8 – 15 53.0 64.6b 62.3 b 0.60 0.09
Day 16 – 21 52.6a 64.6b 64.0b 0.40 0.03
a,b Means in the same row without common letter are different at P<0.05
The positive effects of soybean oil on apparent digestibility of DM and crude protein are similar to
what was reported by Nhuyen Thi Hong Nhan et al (2007b) for a similar basal diet of rice straw and
natural grass. There are no reports on the use of fish oil as a defaunating agent but the results are
similar to those obtained with soybean oil. Doreau and Chilliard (1997) concluded that fish oil
decreased feed intake and increased OM and fiber digestibility in dairy cows fed on maize silage.
Recently, Wistuba et al (2006) stated that supplementation of fish oil decreased feed intake of steers
consuming high concentrate diets. It is, however difficult to compare these results as in these latter
experiments the fish oil was fed continuously as a supplement.
Experiment 2
The oil drench depressed growth rates in the first 30 days but steadily increased them in subsequent
periods of 30-60 and 60-90 days (Table 3; Figure 1).
Table 3. Mean values for live weights and live weight change of cattle drenched once with soybean oil
(RGSO)or fish oil (RGFO) or not drenched (RG) in the on-farm trial
RG RGSO RGFO SEM P
Live weight, kg
Initial 141 140 139 1.28
Final 171 174 173 1.54
Live weight gain, g/day
0-30 days 327a 217b 246b 13 0.001
a b
30-60 days 347 427 420b 15 0.008
60-90 days a b b 30 0.003
340 507 493
0-90 days a b b 12 0.023
339 388 390
Responses were similar for both types of oil.
Figure 1. Growth rates during successive 30-day periods of cattle drenched once
with soybean oil (RGSO) or fish oil (RGFO) or not drenched (RG) in the on-farm trial
DM intake was lower from 0 to 30 days, in the cattle drenched with both types of oil (Table 4). In the
subsequent sub-periods intake was higher for the oil drench treatments with no differences between
types of oil.
Table 4. Mean values for DM intake and conversion of cattle drenched once with soybean oil
(RGSO) or fish oil (RGFO) or not drenched (RG) in the on-farm trial
RG RGSO RGFO SEM P
DM intake, % LW
0-30 day 2.53a 2.08b 2.0b 0.05 0.001
31-60 day a b b 0.07 0.001
2.56 3.05 3.08
61-90 day a b b 0.07 0.007
2.62 2.96 3.0
Overall 2.57 2.70 2.70 0.04 0.100
Feed conversion, kg DM/ kg LWG
0-30 day 11.7b 14.1a 12.0b 0.43 0.048
31-60 day 11.9 11.5 11.7 0.43 0.78
61-90 day a b b 0.26 0.024
12.3 10.3 10.6
Overall 12.0 11.3 11.4 0.39 0.16
Overall, there was a tendency (P=0.10) for a higher intake due to the oil treatment. DM feed
conversion in the first 30 days was worse on the soybean oil drench compared with fish oil and the
control (Table 4). In the next 30 days there were no differences among treatments, while from 60 to
90 days conversion was better for the oil drench than the control. Over the overall 90 period there
were no differences among treatments.
The results of the on-farm growth study confirmed the efficacy of both soybean oil and fish oil in
enhancing the nutritive value of the basal diet of rice straw and para grass for growing cattle. There
is now a considerable body of evidence for the beneficial effects of a single oil drench on growth
performance of cattle (Mom Seng et al 2003; Nguyen Thi Hong Nhan et al 2003, 2007a; Sypraseuth
Khonglalien et al 2008) and that this is mediated through the oil drench causing a reduction in the
population of the large protozoa (Nguyen Thi Hong Nhan et al 2001; Mom Seng et al 2003; Nguyen
Thi Hong Nhan et al 2007a; Sypraseuth Khonglalien et al 2008) and increasing the population of
bacteria (Nguyen Thi Hong Nhan et al 2007b). .
Conclusions
A single dose of either soybean or fish oil at 6 ml/kg live weight improved DM digestibility
and growth rates in Vietnamese Yellow cattle
The effects of soybean oil and fish oil on feed intake, digestibility and daily weight gain in
cattle were similar.
Acknowledgements
The authors are grateful to the MEKARN project , financed by SidaSAREC, for funding this study.
References
Doreau M and Chilliard 1997 Effects of ruminal or postruminal fish oil supplementation on intake and digestion in
dairy cows. Reproduction Nutrition Development 37: 113-124 http://rnd.edpsciences.org/index.php?option=article&
access=standard&Itemid=129&url=/articles/rnd/pdf/1997/01/RND_0926-5287_1997_37_1_ART0012.pdf
Mom Seng, Preston T R, Leng R A and ter Meulen U 2001 Effect of a single drench of cooking oil on the rumen
ecosystem and performance of young local "yellow" cattle fed rice straw and cassava foliage. Livestock Research for
Rural Development. Volume 13, Article # 134 http://www.lrrd.org/lrrd13/4/seng134.htm
Nhan N T H, Hon N V, Ngu N T, Von N T, Preston T R and Leng R A 2001 Practical application of defaunation of
cattle on farms in Vietnam: response of young cattle fed rice straw and grass to a single drench of groundnut oil. Asian-
Australasian Journal Animal Science 14 (4): 485-490
Nguyen Thi Hong Nhan, Nguyen Van Hon, Nguyen Trong Ngu, Nguyen Thi Thu Hong, Preston T R and Leng R A
2003 Effect of drenching with cooking oil on performance of local “Yellow” cattle fed rice straw and cassava foliage.
Livestock Research for Rural Development 15 (7) http://www.lrrd.org/lrrd15/7/nhan157.htm
Nguyen Thi Hong Nhan, Nguyen Trong Ngu, Vo Van Son, Preston T R and Leng R A 2007a Effects of oil drench on
growth rate of cattle fattened on grass, supplemented with molasses, rice bran or rice straw. Livestock Research for Rural
Development. Volume 19, Article #133. http://www.lrrd.org/lrrd19/9/nhan19133.htm
Nguyen Thi Hong Nhan, Nguyen Trong Ngu, Nguyen Thiet, Preston T R and Leng R A 2007b Determination of the
optimum level of a soybean oil drench with respect to the rumen ecosystem, feed intake and digestibility in cattle.
Livestock Research for Rural Development. Volume 19, Article #117 http://www.lrrd.org/lrrd19/8/nhan19117.htm
Sypraseuth Khonglalien, Bounlieng Khoutsavang, Phonepaseuth Phengsavanh and Preston T R 2008 Measuring
growth responses to an oil drench and cassava foliage in local (Yellow breed) cattle fed rice straw and a rumen
supplement. Proceedings MEKARN Regional Conference 2007: Matching Livestock Systems with Available Resources
(Editors: Reg Preston and Brian Ogle), Halong Bay, Vietnam, 25-28 November 2007
http://www.mekarn.org/prohan/seuth.htm
Wistuba T J, Kegley E B and Apple J K 2006 Influence of fish oil in finishing diets on growth performance, carcass
characteristics, and sensory evaluation of cattle. Journal of Animal Science 84: 902-909 http://jas.fass.org/cgi/reprint
/84/4/902
Received 18 April 2008; Accepted 15 May 2008; Published 3 July 2008
Tạp chí
KHOA HỌC VÀ PHÁT TRIỂN
Tạp chí khoa học kỹ thuật nông nghiệp

English issue 2 - Năm 2010
MỤC LỤC
CONTENTS
1. Assessment of zinc mobility in contaminated soils and mining materials in three study 129
sites of Northern Vietnam Đánh giá tính di động của Zn ở các đất bị ô nhiễm và khai
thác mỏ ở ba điểm nghiên cứu tại miền Bắc Việt Nam
Gaetan VERRIEST, NGUYEN Huu Thanh, Eléonore COUDER, TRAN Thi Le Ha,
NGUYEN Duc Hung, PHAN Quoc Hung, Anne ISERENTANT, Claudine
2. Study on diversity and chromosome numbers of edible allium crops in Vietnam 138
Nghiên cứu sự đa dạng và số lượng bộ nhiễm sắc thể của cây trồng ăn được chi hành
tỏi ở Việt Nam
Pham Thi Minh Phuong and Yosuke Tashiro
3. Gene expression and association analysis of ferritin heavy - chain with growth and 145
meat quality in pigs Biểu hiện và mối liên quan giữa gen ferritin heavy-chain với sự
tăng trưởng và chất lượng thịt lợn
Nguyen Trong Ngu, Danyel GJ Jennen, Karl Schellander and Klaus Wimmers
4. The analysis of investment climate in agriculture in hanoi province, Vietnam Phân tích 151
môi trường đầu tư vào nông nghiệp của Hà Nội (Việt Nam)
Tran Huu Cuong, Bui Thi Nga
5. A comparative analysis on business activities of agricultural cooperatives between 163

Japan and Vietnam Phân tích so sánh các hoạt động kinh doanh của các hợp tác xã
nông nghiệp ở Việt Nam và Nhật Bản
Nguyen Mau Dung
6. Spatial market integration of the soybean industry in Hanoi province, Vietnam Thị 175
trường đậu tương theo không gian tại Hà Nội, Việt Nam
Nguyen Dinh Tien and Mai Lan Phuong
J. Sci. Dev. 2010, 8 (Eng.Iss. 2): 145 - 150 HA NOI UNIVERSITY OF AGRICULTURE
GENE EXPRESSION AND ASSOCIATION ANALYSIS OF FERRITIN HEAVY - CHAIN

WITH GROWTH AND MEAT QUALITY IN PIGS
Biểu hiện và mối liên quan giữa gen ferritin heavy-chain
với sự tăng trưởng và chất lượng thịt lợn
Nguyen Trong Ngu1, Danyel GJ Jennen2, Karl Schellander3 and Klaus Wimmers4
1
College of Agriculture and Applied Biology, Can Tho University, Viet Nam
2
Department of Health Risk Analysis and Toxicology, University Maastricht, The Netherlands
3
Institute of Animal Science, University of Bonn, 53115 Bonn, Germany
4
Research Institute for the Biology of Farm Animals (FBN), 18196 Dummerstorf, Germany
Corresponding author: ntngu@ctu.edu.vn
TÓM TẮT
Protein dự trữ sắt, ferritin, đóng vai trò quan trọng trong việc trao đổi sắt và có liên quan đến khả
năng tăng trưởng và phát triển của lợn. Ferritin heavy-chain (FTH1) là một trong hai tiểu đơn vị được
điều hòa ở mức độ phiên mã và dịch mã. Mục tiêu của nghiên cứu là phân tích mối liên quan giữa gen
này đến sự tăng trưởng và các chỉ tiêu chất lượng thịt lợn. Tám cặp lợn F2 Duroc x Pietrain (DUPI)
được chọn để phân tích biểu hiện gen dựa trên sự khác biệt của từng cặp (cùng cha mẹ) về diện tích
cơ thăn. Kết quả cho thấy gen FTH1 biểu hiện cao hơn trên lợn có diện tích cơ thăn nhỏ (P < 0,05).
Nhằm nhận diện vị trí đa hình (Single Nucleotide Polymorphism, SNP) trên gen, phương pháp giải
trình tự so sánh đã được áp dụng và có 2 SNP được tìm thấy ở vùng 3’UTR tại vị trí 698 (T/C) và 714
(G/A) của đoạn gen FTH1 mã số D15071. Ngoài ra, phương pháp PCR-RFLP cũng được sử dụng để
xác định kiểu gen với sự tham gia của các enzyme cắt giới hạn MspI và BbuI tương ứng với hai điểm
đa hình trên. Tổng cộng có 334 gia súc đã được xác định kiểu gen. Kết quả cho thấy điểm đa hình thứ
hai (G/A) có liên quan với tăng trọng hàng ngày và độ mềm của thịt (P<0,05). Thêm vào đó, haplotype
của hai điểm đa hình này cũng liên quan có ý nghĩa với tăng trọng hàng ngày, màu và pH của thịt.
Tóm lại, gen FTH1 có thể là một gen ứng viên quan trọng cho sự tăng trưởng và độ mềm của thịt.
Từ khóa: Biểu hiện gen, chất lượng thịt, ferritin heavy-chain, lợn, tăng trưởng.
SUMMARY
The iron storage protein, ferritin, has a key role in iron metabolism involved in early growth and
development of pigs. The ferritin heavy-chain, FTH1, is one of two subunits that are regulated at the
transcriptional and translational levels. The objective of this study was to analyze association of this
gene with the growth and meat quality traits in pigs. In the present study, eight discordant sib-pairs
(DUPI - Duroc x Pietrain F2 resource population) were selected for gene expression based on their
extreme differences in loin eye muscle area. It was found that FTH1 gene is up-regulated in pigs
having small eye muscle area (P < 0.05). In order to identify single nucleotide polymorphism (SNP),
comparative sequencing was used and two SNPs were found within 3’ UTR at position 698 (T/C) and
714 (G/A) of the sequence (GenBank accession number D15071). For genotyping, PCR-RFLP
protocols were established using restriction enzymes MspI and BbuI for the first and the second SNP,
respectively. In total, 334 animals were genotyped. It was observed that the second SNP (G/A) was
closely associated with average daily gain and shear force (P < 0.05). The constructed haplotype also
showed significant effects on daily gain, meat color and pH. In conclusion, the FTH1 gene may be an
important gene influencing growth and meat tenderness.
Key words: Ferritin heavy-chain, gene expression, growth, meat quality, pig.
145
Gene expression and association analysis of ferritin heavy-chain with growth and meat quality in pigs
1. INTRODUCTION 2. MATERIALS AND METHODS

Ferritin heavy chain (FTH1) is a protein 2.1. Animals
expressed in many tissues and plays an important Eight discordant sib pairs representing
role in iron storage and metabolism. The two extremes for the loin eye muscle area trait were
subunits of ferritin namely light and heavy chain selected from 598 F2 pigs of an experimental cross
can be regulated at both transcriptional and of Duroc x Pietrain (DUPI) resource population.
translational levels (White et al., 2000). Due to its Animals were slaughtered at approximately 180
inherent ferroxidase activity participating in iron days of age, all samples including longisimuss dorsi
oxidation (Strube et al., 2002), ferritin heavy chain muscle were collected and immediately stored in
liquid nitrogen and later frozen at -80oC for further
is therefore necessary in mobilization of iron to and
use. Animal ranking was based on differences of
from the ferritin protein complex. However, little
eye muscle area, thereby high performance pigs are
documentation about the expression of this gene in those with large loin eye muscle area while low
animals, especially in relation to muscular performance animals are all reversed (Table 1).
characteristics, has been published. A study by
Kitahara et al., (1995) showed high expression of 2.2. Quantitative real-time RT-PCR
FTH1 in rat skeletal muscle after denervation, a To study gene expression, the real time PCR
factor resulting in atrophy of muscle fibers and (ABI Prism 7000 SDS instrument) was used. Specific
primers were picked up from literature. Primer
other contractile changes. In pigs, FTH1 was
sequences were 5’ TAAGCTGGCCTCCCGGAGAC
identified to be differentially expressed in the 3’ for forward primer and 5’ G G T A C A C T A A G G
anterior pituitary of sows, in which the level of A A A G AACT 3’ for reverse primer (gene accesion No
mRNA is reduced as a result of selection for D15071) (Rattink et al., 2001a). The real-time RT-
increased ovulation rate and embryo survival PCR was performed using SYBR green universal
(Bertani et al., 2004). Functionally, the expression PCR Mastermix (Applied Biosystems) which
of FTH1 appears to be associated with the contained SYBR Green I Dye, AmpliTaq Gold®
characteristics of muscle fiber types, particularly DNA Polymerase, dNTPs with dUTP, passive
with the presence of mitochondria in each fiber. In reference and optimized buffer components. A
standard curve was generated by amplifying serial
the present study FTH1 expression was performed
dilutions of target plasmid DNA. Abundance of
in pig discordant sib-pairs with superior and transcripts of the candidate genes were calculated
inferior loin eye muscle area and its association as transcript levels relative to the transcript of 18S
with muscle and meat quality traits were also gene that was found to be not regulated between the
investigated. samples of equal amounts of analyzed cDNAs.
Table 1. Description of F2-DUPI resource population used for real-time RT-PCR

(means ± standard deviation)
Loin eye muscle area

Trait P-value
Small (n = 8) Large (n = 8)
Age (day) 182 ± 25 179 ± 11 n.s
Slaughter weight (kg) 112 ± 5 111 ± 5 n.s
Carcass weight (kg) 85 ± 6 86 ± 6 n.s

2
Eye muscle area (cm ) 43 ± 3 58 ± 3 < 0.001
n.s: non- significant
146
2.3. Screening for SNPs and genotype analysis 3.1. Gene expression quantified by real-time RT-PCR
Forward and reverse primers used for The FTH1 was selected for gene expression
comparative sequencing to detect SNPs were 5’ study because in a microarray experiment it had
TAAGCTGGCCTCCCGGAGAC 3’ and 5’ been found to be up-regulated in pigs with small
GGTACACTAAGGAAAGAACT 3’, respectively muscle area (data not shown). The eight sib-pairs
(Rattink et al., 2001a). DNA samples from the DUPI chosen with the standard that age, slaughter weight
resource population were genotyped by PCR-RFLP and carcass weight were not significantly different
(Restriction Fragment Length Polymorphism) between two extreme groups. Thus, differences
technique. The restriction enzymes were selected between small or large muscle areas were
according to their recognition (http://tools.neb.com/ genetically originated. The relative mRNA
NEBcutter2/index.php) of the polymorphic sites. expression of FTH1 gene is shown in Figure 1. In
First, the fragment covers the SNP were amplified all animals, expression of mRNA were higher in
with a specific primer. Next, a digestion reaction pigs having small eye muscle area, as a result,
containing 1 unit of enzyme, 1 μl of 10x restriction average values for two extreme group were
buffer and 1 μg of DNA was incubated at 37oC statistically different (P < 0.05).
overnight for complete digestion. The digested The importance of iron in mitochondrial
product was checked by electrophoresis on 3% function is well known by a mechanism that
aragose gel, 90 V for 1 hour. Different fragment mitochondria mobilize iron from ferritin, and iron
lengths between non- and digested DNAs reflected is used for the synthesis of heme and the generation
the genotype of a specific sample. of iron-sulfur, which are important for the optimal
activity of electron transfer complexes (Lill and
2.4. Statistical analysis
Kispal, 2000; Ponka, 1997). Indeed, both iron
Analysis of variance using PROC MIXED of deficiency and iron excess could lead to damage of
SAS was performed to investigate the effect of mitochondria and mitochondrial DNA in rats
genotypes on body composition and meat quality (Walter et al., 2002). Muscle fibers type I and type
traits. All factors found to affect the phenotypes IIa contain more mitochondria than type IIx / IIb
included: genotype, sex, boar, and parity as fixed fibers and thus need more iron. In our previous
effects, mother as random factor and carcass weight study (Wimmers et al., 2008), low performance pig
as covariate. Mean separation for significant showed higher relative expression of type I fibers
difference (P<0.05) was accomplished by the than in high performance pigs. The established
PDIFF option of the least square procedure. relationship between iron content and mitochondria
can contribute to explain the result that FTH1 is up-
3. RESULTS AND DISCUSSION regulated in pigs having small eye muscle area.
0 .0 0 2
Small eye muscle area
0 .0 0 1 8
0 .0 0 1 6 Large eye muscle area
Relative FTH1 mRNA level
0 .0 0 1 4 P < 0.05
0 .0 0 1 2
0 .0 0 1
0 .0 0 0 8
0 .0 0 0 6
0 .0 0 0 4
0 .0 0 0 2
0
1 2 3 4 5 6 7 8 Means
Pig sib-pairs
Figure 1. Expression of FTH1 gene in pig muscle by quantitative real-time RT-PCR,

FTH1 is highly expressed in pigs with small compared to large eye muscle area
147
3.2. SNP detection and genotyping The overall daily gain of animals bearing
A 130-bp product of FTH1 was amplified and genotype G/G was also significantly higher (P =
two SNPs were discovered in this 3’UTR at 0.025) than those with genotype A/A (611 g vs. 589
position 698 (T Æ C) and 714 (G Æ A) in the F2- g, respectively). Finally, results showed that shear
DUPI resource population. In both SNPs, the allele force is statistically related to the genotypes,
frequencies were almost equally distributed (47% especially with homozygous pigs (P = 0.025).
vs. 53% for SNP1; 52% vs. 48% for SNP2). Lower shear force was found in animals with A/A
However, the range in genotype frequencies was genotype (33.9 N) and higher shear force was seen
large changing from 24% to 45% (SNP1) and 25% in G/G pigs (36.8N).
to 47% (SNP2). In both cases, the appearance of Previously, the FTH1 gene was mapped to
heterozygous genotypes was more frequent (>45%) SSC2 (Ponsuksili et al., 2002) between the loci
than those from the homozygous animals (Table 2). SW2443 (proximal) and SW240 (distal) with
Two restriction enzymes MspI and BbuI were distances of 42.8 and 20.2 cM, where several QTLs
used for genotyping. The MspI digested products related to ADG were reported (Lee et al., 2003;
had 94, 31 and 5 bp and the BbuI produced Malek et al., 2001). Particularly, Pietrain QTL
fragment sizes of 78 and 52 bp. alleles were associated with muscle, high daily gain
and low fat deposition (Lee et al., 2003). In a
3.3. Association analysis of FTH1 SNPs DUMI (Duroc x Miniature pig) resource
The FTH1 – SNP1 had no effects on any traits population, Wimmers et al., (2006) found QTLs for
analyzed. The effects of SNP2 genotypes on muscularity, i.e. lean meat content and loin eye area
phenotype are presented in Table 3. Among at position 20 cM for both QTLs on SSC2. These
parameters for body weight, SNP2 was associated (P QTL results together with different expression of
= 0.008) with animal weight at the start of the FTH1 in muscle with different fiber type
experiment (day 70th). Moreover, this SNP had an compositions may propose FTH1 as a functional
effect on the growing stage when piglets were weaned and probably a positional candidate gene for
until they were allocated in the test box (P = 0.01). muscle growth and meat quality.
Table 2. Allele and genotypes frequency of FTH1 gene (SNP1 and SNP2)
in the DUPI-F2 resource population
Allele frequency Genotype frequency

No of pigs
T C T/T T/C C/C
SNP1 335 0.47 0.53 0.24 0.45 0.31
G A G/G G/A A/A

SNP2 334 0.52 0.48 0.28 0.47 0.25
Table 3. Effect of FTH1 - SNP2 genotype on growth and meat quality traits
(least squares means ± standard error)
Genotype frequency
Trait P-Value
A/A G/A G/G
b ab a
Test start (kg) 24.8 ± 1.0 26.3 ± 0.9 27.3 ± 1.0 0.008
th b ab a
ADG 2 (birth – 70 day) (g) 324 ± 13 345 ± 11 357 ± 13 0.010
b ab a
ADG 4 (birth – slaughter) (g) 589 ± 9 602 ± 4 611 ± 8 0.025
b ab a
Shear force (N) 33.9 ± 1.4 34.8 ± 1.2 36.8 ± 1.3 0.025
a, b
Means in the same row with different supersripts are significantly different at P < 0.05
ADG: average daily gain
148
Table 4. Effect of FTH1 haplotype on growth and meat quality traits

(least squares means ± standard error)
Haplotype
Trait P-Value
GT/GT GT/AC CG/AC AC/AC CG/GT
a ab a b a
ADG 3 (g) 789 ± 16 776 ± 15 808 ± 22 757 ± 16 817 ± 25 0.037
ab b ab c a
ADG 4 (g) 610 ± 10 603 ± 9 620 ± 13 588 ± 10 628 ± 15 0.014
bc a b ac b
FCR (kg) 2.62 ± 0.05 2.69 ± 0.04 2.54 ± 0.07 2.69 ± 0.05 2.52 ± 0.08 0.026
a a a a b
Meat color (24h) 70.7 ± 0.8 69.5 ± 0.7 70.4 ± 1.4 69.0 ± 0.8 65.8 ± 1.5 0.026
a bc ab c c
pH (24h) 5.64 ± 0.03 5.60 ± 0.03 5.67 ± 0.04 5.58 ± 0.03 5.55 ± 0.04 0.014
a, b, c
Means in the same row with different supersripts are significantly different at, P < 0.05
ADG 3: average daily gain (70th day – slaughter)
ADG 4: average daily gain (birth – slaughter)
FCR: Feed conversion ratio
3.4. Association analysis of FTH1 haplotype combination of many factors such as the
Two SNPs found in FTH1 gene are located in concentration of heme fragments, the chemical
the 3’ UTR region. These polymorphic sites were state of these pigments and physical properties of
previously described (Ponsuksili et al., 2002; meat structure. It is possible that the stage of
Rattink et al., 2001a; Rattink et al., 2001b). From pigments is affected by meat pH, and the reaction
the two detected SNPs in the F2 DUPI resource of the heme with other reactants like O2 can
population, a construction of haplotype by using influence the stage of heme iron (Fernandez-Lopez
Merlin software (http://www.sph.umich.edu/csg/ et al., 2004), which partly depends on FTH1
abecasis/merlin/tour/ haplotyping.html) was expression.
performed resulting in 5 different haplotypes, of
which their associations are shown in Table 4. For 4. CONCLUSIONS
examples, haplotype AC/AC and CG/GT exerted
certain effects on ADG3 and ADG4 (P = 0.014). FTH1 gene is highly expressed in pigs with
High daily gain, especially in the last period of low muscularity and the association of FTH1 with
daily gain, shear force, meat color and pH,
growth made haplotype CG/GT the lowest value in
suggesting that it may be a candidate gene for
terms of FCR (2.52 kg) with the statistic level P =
growth and meat quality traits.
0.026. In addition, meat color was found to be
associated with haplotypes (P = 0.026), in which Acknowledgements
the GT/GT haplotype offered higher value than the
This project was supported by the Federal
CG/GT haplotype (70.7 and 65.8, respectively). Ministry of Education and Research, BMBF
Different haplotypes were also in association with (Bundesministerium fuer Bildung und Forschung)
pH24 value in Semimembranosus muscle (P = grant VNB02/B06, Germany.
0.014) with lowest pH in animals bearing CG/GT
haplotype (5.55) and highest pH value in the
GT/GT haplotype (5.64). REFERENCES
Iron is essential for the growth and Beard J. L. (2001). Iron biology in immune
development of most organisms and is present function, muscle metabolism and neuronal
within the cells either in a form of complex iron- functioning. J. Nutr 131, 568S-579S.
containing proteins and enzymes or in iron-storage Bertani G. R., C. D. Gladney, R. K. Johnson, and
proteins (Carrondo, 2003) that are crucial for D. Pomp (2004). Evaluation of gene expression
biological functions including electron transfer in pigs selected for enhanced reproduction using
reactions, gene regulation, oxygen metabolism and differential display PCR: II. Anterior pituitary. J
regulation of cell growth and differentiation (Beard, Anim Sci 82, 32-40.
2001; Ponka, 1999). Therefore, the level of FTH1 Carrondo M. A. (2003). Ferritins, iron uptake and
expression may affect iron storage and thereby storage from the bacterioferritin viewpoint.
animal performance. Moreover, meat color is a EMBO J 22, 1959-1968.
149
Fernandez-Lopez J., E. Sayas-Barbera, J. A. Perez- Rattink A. P., M. Faivre, B. J. Jungerius, M. A.

Alvarez, and V. Aranda-Catala (2004). Effect of M. Groenen, and B. Harlizius. (2001a). A
sodium chloride, sodium tripolyphosphate and high-resolution comparative RH map of
pH on color properties of pork meat. Color Res porcine chromosome (SSC) 2. Mamm Genome
Appl 29, 67-74. 12, 366 - 370.
Kitahara T., S. Kiryu, N. Takeda, T. Kubo, and H. Rattink A. P., B. J. Jungerius, M. Faivre, P.
Kiyama (1995). Up-regulation of ferritin heavy- Chardon, B. Harlizius, and M. A. M. Groenen.
chain messenger-RNA expression in the rat (2001b). Improving the comparative map of
skeletal-muscle after denervation - detected by SSC2p-q13 by sample sequencing of BAC
means of differential display. Neurosci Res 23, clones. Anim Genet 32, 274-280.
353-360. Strube Y. N. J., J. L. Beard, and A. C. Ross. (2002).
Lee S. S., Y. Chen, C. Moran, S. Cepica, G. Reiner, Iron deficiency and marginal vitamin a
H. Bartenschlager, G. Moser, and H. deficiency affect growth, hematological indices
Geldermann (2003). Linkage and QTL mapping and the regulation of iron metabolism genes in
for sus scrofa chromosome 2. J Anim Breed rats. J. Nutr. 132, 3607-3615.
Genet 120, 11-19. Walter P. B., M. D. Knutson, A. Paler-Martinez, S.
Lill R., and G. Kispal (2000). Maturation of cellular Lee, Y. Xu, F. E. Viteri, and B. N. Ames.
Fe-S proteins: an essential function of (2002). Iron deficiency and iron excess damage
mitochondria. Trends Biochem Sci 25, 352-356. mitochondria and mitochondrial DNA in rats.
Malek M., J. C. M. Dekkers, H. K. Lee, T. J. Baas, Proc Natl Acad Sci USA 99, 2264-2269.
and M. F. Rothschild (2001). A molecular White P., D. Cattaneo, and M. J. Dauncey. (2000).
genome scan analysis to identify chromosomal Postnatal regulation of myosin heavy chain
regions influencing economic traits in the pig. I. isoform expression and metabolic enzyme
Growth and body composition. Mamm Genome activity by nutrition. Br. J. Nutr. 84, 185-194.
12, 630-636. Wimmers K., I. Fiedler, T. Hardge, E. Murani, K.
Ponka P. (1997). Tissue-specific regulation of iron Schellander, and S. Ponsuksili. (2006). QTL for
metabolism and heme synthesis: distinct control microstructural and biophysical muscle
mechanisms in erythroid cells. Blood 89, 1-25. properties and body composition in pigs. BMC
Ponka P. (1999). Cellular iron metabolism. Kidney Genetics 7.
Int 55, S2-S11. Wimmers, K., N. T. Ngu, D. G. J. Jennen, D. Tesfaye,
Ponsuksili S., S. Chomdej, K. Schellander, and K. E. Murani, K. Schellander, and S. Ponsuksili.
Wimmers (2002). SNP detection and linkage (2008). Relationship between myosin heavy chain
mapping of the porcine ferritin heavy-chain isoform expression and muscling in several diverse
gene. Anim Genet 33, 325-326. pig breeds. J. Anim. Sci. 86, 795-803.
150
KHẢ NĂNG TĂNG TRƢỞNG VÀ TỈ LỆ TIÊU HÓA CỦA HEO SAU CAI SỮA NUÔI
BẰNG KHẨU PHẦN CÓ BỔ SUNG BIOLAC
Huỳnh Mỹ1, Nguyễn Trọng Ngữ2, Nguyễn Thị Hồng Nhân2*
1. MỞ ĐẦU 1,1 nước bằng vòi tự động. Heo được ăn 2 lần/

Trong chăn nuôi, kháng sinh (KS) được dùng ngày (8.00 giờ và 15.00 giờ).
khá phổ biến để phòng trị bệnh tiêu chảy, kích Heo được nuôi 30 ngày với khẩu phần (KP) thí
thích tăng trọng cho heo. Tuy nhiên việc sử nghiệm để theo dõi các chỉ tiêu về tăng trọng,
dụng KS nhiều là nguyên nhân tạo chủng vi TA, giá thành và vào 5 ngày của tuần thí
khuẩn (VK) nhờn thuốc và sự tích luỹ của KS nghiệm thứ hai sẽ lấy thêm lượng phân để tính
trong sản phẩm động vật là một trong những tác tỉ lệ tiêu hoá vật chất khô (VCK), chất hữu cơ
nhân quan trọng ảnh hưởng đến sức khoẻ con và protein thô theo AOAC (1990)
người. Do đó, người ta hạn chế dùng KS làm Các NT thí nghiệm:
chất bổ sung, mà thay vào đó bằng các chế - NT đối chứng (NTĐC): TA Higro - 352L
phẩm sinh học. Biolac là một chế phẩm vi sinh - NT 0,02%: TA Higro - 352L có trộn 0,02%
vật (VSV) sống do Viện Nghiên Cứu và Phát Biolac
triển công nghệ sinh học (VNC&PTCNSH)- - NT 0,06%: TA Higro - 352L có trộn 0,06%
Trường Đại học Cần Thơ sản xuất, khi bổ sung Biolac
cho heo sẽ tạo điều kiện tốt cho hệ VSV có lợi - NT 0,12%: TA Higro - 352L có trộn 0,12%
trong đường ruột cạnh tranh với các VK có hại, Biolac
hạn chế sự phát triển của VK gây bệnh. Xuất TA cho heo trong giai đoạn này là TA Higro-
phát từ yêu cầu thực tế trên, chúng tôi tiến hành 352-L của trại thực nghiệm và Biolac do
đề tài nghiên cứu có nội dung như tên bài đã VNC&PTCNSH (Trường ĐH Cần Thơ) sản
nêu nhằm khảo sát tác dụng của Biolac (chế xuất và cung cấp. Biolac chứa 1010 VK lactic/g,
phẩm lactic) đến tỷ lệ tiêu hóa, hệ số chuyển 105 Bacillus subtilis/g, 105 nấm men
hóa thức ăn (TA), góp phần giảm chi phí nuôi Saccharomyces spp/g.
dưỡng heo con và đạt tiêu chuẩn giống. Bảng 1: Thành phần dinh dƣỡng của thức ăn
2. NỘI DUNG VÀ PHƢƠNG PHÁP NGHIÊN Higro - 352L dạng bột
Protein thô 15% P(tối thiểu): 0,5%
CỨU (tối thiểu):
2.1- Bố trí thí nghiệm Xơ thô (tối 7% NaCl (tối 0,3 - 1%
Thí nghiệm được tiến hành tại Trại chăn nuôi đa): thiểu - tối
đa):
thực nghiệm khoa Nông Nghiệp, Trường ĐH
Ca (tối thiểu - 0,7 - ME (tối 2900
Cần Thơ từ tháng 3 đến tháng 6/2005. Mười hai tối đa): 1,1% thiểu): kcal/kg
heo đực thiến, giống Yorshire lai có trọng 2.2. Chỉ tiêu theo dõi:
lượng (TL) 26-28kg được bố trí theo khối hoàn Tăng trọng, tiêu tốn TA, hệ số chuyển hóa TA,
toàn ngẫu nhiên gồm 4 nghiệm thức (NT) và 3 tỉ lệ tiêu hoá dưỡng chất.
lần lặp lại. Mỗi đơn vị thí nghiệm là 1 heo, tất - Tăng trọng: heo được cân lúc sáng sớm chưa
cả heo được xổ lãi (tẩy giun sán), tiêm ngừa cho ăn lúc đầu và cuối thí nghiệm và chỉ dùng 1
trước khi thí nghiệm và được nuôi trên chuồng loại cân. Từ các kết quả cân được, chúng ta tính
ép có bố trí máng ăn cho từng ô chuồng, uống TL heo thí nghiệm theo công thức:
Tăng trọng (kg) = TL cuối thí nghiệm - TL đầu
thí nghiệm
1
Trạm Thú y thành phố Long Xuyên, tỉnh An Giang. - Tiêu tốn TA: TA được cân trước khi cho
2
Trường Đại học Cần Thơ. heo ăn lúc 7 giờ sáng và 15 giờ chiều mỗi ngày.

Tác giả để liên hệ: TS. Nguyễn Thị Hồng Nhân, Giảng Sớm hôm sau cân lại lượng TA thừa, từ đó tính ra
viên chính, Khoa Nông Nghiệp & Sinh học Ứng dụng-
Trường Đại học Cần Thơ. Điện thoại: 0919434989; E-
lượng TA heo ăn vào mỗi ngày theo công thức:
mail: nthnhan@ctu.edu.vn.
8 KHKT Chăn nuôi Số 10 – 2010
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
Lượng TA ăn vào/ ngày = Tổng TA cho ăn - tình trạng đi phân và nước tiểu ra ngoài hoặc
TA thừa vào máng ăn.
- Hệ số chuyển hoá TA: TA trong thí nghiệm của từng NT không thay
Tiêu tốn TA (kg)
Hệ số chuyển hóa TA = đổi. Các KP thí nghiệm được trộn với Biolac
Tăng trọng (kg)
- Tỉ lệ tiêu hoá: để xác định tỉ lệ tiêu hoá, mẫu theo tỉ lệ nhất định và bảo quản nơi khô ráo.
phân được lấy từ 8 giờ sáng hôm sau, cân tổng Nguồn nước dùng được bơm từ giếng.
số phân thải ra trong ngày và lấy trong 5 ngày 3.2. Tăng trọng bình quân của heo thí nghiệm
liên tục. Phân sau khi lấy mẫu được cất vào tủ TL đầu của các heo thí nghiệm tương đối đồng
đông lạnh -180C. Mẫu phân của 5 ngày được xả đều, chênh lệch không có ý nghĩa thống kê nên
đông và cũng trộn chung để xác định VCK, tro thí nghiệm đồng nhất (Bảng 2). Kết quả thí
bằng phương pháp phân tích phỏng định nghiệm cho thấy tăng trọng bình quân của heo
Weende. Riêng protein thô thì phân tích trên trong ngày ở NT 0,12% là cao nhất (0,66 kg) kế
mẫu tươi. đến là NT 0,06% (0,62 kg); NT 0,02% (0,54
Lượng DC ăn vào - kg) và thấp nhất là NT ĐC (0,51 kg). Tăng
lượng DC trong phân trọng bình quân của heo thí nghiệm trong các
%TLTH (DC ) =  100 NT này sai khác có ý nghĩa thống kê (P=0,001).
Lượng DC ăn vào
Ghi chú: TLTH: tỉ lệ tiêu hoá (%); DC: dưỡng chất (g) Theo Hội đồng hạt cốc Hoa Kỳ (1999), tăng
2.3. Xử lý số liệu trưởng là quá trình sinh học bị ảnh hưởng bởi
Số liệu được xử lý theo mô hình tuyến tính tổng lượng TA ăn vào. Khi gia súc ăn vào, TA trải
quát (General Linear Model) và được thực hiện qua quá trình tiêu hóa và các dưỡng chất sẽ
trên Minitab (Minitab Release 13.2, 2000). Độ được hấp thu, nếu vượt quá tổng nhu cầu cần
khác biệt ý nghĩa của các giá trị trung bình thiết cho sự sống thì được tích lũy lại trong cơ
trong và giữa các NT được xác định theo thể và phần dinh dưỡng thừa được thải ra ngoài
Turkey, với alpha <0,05. qua nước tiểu và phân.
3. KẾT QUẢ VÀ BÀN LUẬN
Theo kết quả thu được thì tăng trọng của heo
3.1. Nhận xét tổng quát
giữa NT 0,02% và NT ĐC cũng như giữa giữa
Thí nghiệm được thực hiện từ giữa tháng 3 đến
NT 0,06% và NT 0,12% đều sai khác nhau
cuối tháng 6/2005 là thời điểm giao mùa giữa
không có ý nghĩa thống kê. Nhưng NT 0,06%
mùa nắng và mùa mưa. Thời tiết lúc nắng gắt từ
11 giờ đến 16 giờ chiều rất nóng (35-370C). và NT 0,12% sai khác có ý nghĩa thống kê đối
Ngược lại, buổi chiều và tối có gió lùa, lúc trời với NT ĐC và NT 0,02%. Tuy nhiên, NT có
mưa nên heo lạnh. mức tăng trọng bình quân tốt nhất là NT 0,06%
Cấu trúc chuồng hở hoàn toàn, chuồng lồng, vì có hiệu quả kinh tế lại tốt hơn. NT 0.12%
nền bằng tấm lưới sắt lỗ tròn (đường kính phải trộn nhiều Biolac hơn và giá thành về kinh
6mm), chuồng được bao quanh bằng khung sắt tế cao hơn NT 0,06%.
nên heo không quay đầu được và tránh được
Bảng 3. Trọng lƣợng và tăng trọng bình quân (kg/con) của heo thí nghiệm
Chỉ tiêu ĐC NT 0,02% NT 0,6% NT 0,12% P
Số heo thí nghiệm (con) 3 3 3 3 -
Thời gian thí nghiệm (ngày) 30 30 30 30 -
TL đầu kỳ (kg) 26,73 28,23 27,57 27,7 0,65
TL cuối kỳ (kg) 42,17a 44,53ab 46,08b 47,39b 0,008
Tăng trọng suốt thí nghiệm(kg/con) 15,45a 16,3a 18,51b 19,69b 0,001
Tăng trọng bình quân (kg/con/ngày) 0,51a 0,54a 0,62b 0,66b 0,001
Ghi chú: a,b các giá trị ở cùng hàng mang ít nhất một chữ ký hiệu chung không sai khác nhau ở P= 0,05.
Kết quả thí nghiệm phù hợp với qui luật và phát đàn F1(Yorshire x Địa phương) nuôi ở điều kiện
triển bình thường của heo, theo Võ Ái Quấc và cs tập trung có thể tăng trọng bình quân 515
(1985), khả năng tăng trọng của heo lai cải tiến g/con/ngày. Ngoài ra nguồn TA đáp ứng được
nhu cầu dinh dưỡng của heo ở giai đoạn thí thụ chất dinh dưỡng để tăng trọng tốt hơn khi
nghiệm và nếu có bổ sung Biolac với các mức độ không bổ sung.
khác nhau thì chúng giúp cho heo tiêu hóa và hấp 3.3. Tiêu tốn thức ăn của heo thí nghiệm
Bảng 4. Tiêu tốn và hệ số chuyển hoá thức ăn của heo thí nghiệm
Mức ăn bình quân suốt thời gian thí nghiệm (kg/con) 57,62a 54,48ab 53,7b 54,3b 0,03
a ab b
Tiêu tốn thức ăn (kg/con/ngày) 1,92 1,82 1,79 1,81b 0,03
Hệ số chuyển hóa TA 3,73a 3,36a 2,91b 2,76b 0,001
Bảng 4 và Hình 1 cho thấy tiêu tốn TA hằng ngày của các NT lần lượt là 1,92; 1,82; 1,79 và 1,81
có sự khác biệt giữa các NT thí nghiệm (P=0,03).
Kg/con
50 4
45
3.5
40
3
35
2.5
30
25 2
20
1.5
15
1
10
0.5
5
0 0
Đối chứng NT 0,02% NT 0,06% NT 0,12%
Trọng lượng đầu TN Trọng lượng cuối TN HSCH thức ăn

Hình 1. Trọng lƣợng và hệ số chuyển hoá thức ăn của heo thí nghiệm
Hệ số chuyển hóa TA ở NT ĐC là cao nhất cũng được sử dụng, hoặc riêng lẻ hoặc phối hợp
(3,73), kế đến là NT 0,02% (3,36); NT 0,06% với Lactobacillus và Streptococcus đều cho kết
(2,91) và NT 0,12% thấp nhất là (2,76). Sự quả tốt trên tăng trọng và cải thiện hệ số chuyển
khác biệt giữa các NT này có ý nghĩa thống kê. hóa thức ăn.
(P=0,001). Theo Võ Ái Quấc và cs (1985), heo Năm 1980, Pollmann tổng kết những thí
lai Yorshire x Ba Xuyên có chỉ số TA trên tăng nghiệm bổ sung các loại Bacillus subtilis cho
trọng là 5,51, do đó kết quả thí nghiệm cho thấy heo thịt, nhận thấy đối với heo sau cai sữa,
việc bổ sung Biolac vào KP heo con sau cai sữa trong 18 thí nghiệm thì 13 thí nghiệm cho kết
là có hiệu quả rõ rệt. quả tốt.
Theo Kozasa (1989), bổ sung Bacillus cereus 3.4. Tỉ lệ tiêu hóa các dƣỡng chất
cho heo lúc mới sinh và heo sau cai sữa, đã làm Tỉ lệ tiêu hoá các dưỡng chất là chỉ tiêu quan
giảm số lượng E.coli độc ở đường ruột heo và trọng góp phần thể hiện chất lượng KP, theo
làm tăng Lactobacilli, bên cạnh đó cũng nâng quan điểm hiện nay KP không những chỉ đủ về
cao tăng trọng. Ngoài việc bổ sung các loài số lượng mà nó còn phải bảo đảm chất lượng.
Lactobacillus và Streptococcus cho heo, enzym
Bảng 5: Tỉ lệ tiêu hóa (%) các dƣỡng chất của khẩu phần thí nghiệm
Vật chất khô 67,83a 70,05ab 73,5b 73,69b 0,009
Chất hữu cơ 71,12a 72,82ab 76,47bc 77,64c 0,003
Protein thô 73,87a 75,28ab 76,56b 77,24b 0,005
Kết quả thí nghiệm cho thấy heo nuôi với KP nhất là NT 0,12% (73,69%). Kết quả về tỉ lệ
bình thường không bổ sung Biolac thì tỉ lệ tiêu tiêu hoá chất hữu cơ và tỉ lệ tiêu hoá protein thô
hóa VCK thấp nhất (67,83%) kế đến là NT cũng tương tự: 71,12%; 72,82%; 76,47%;
0,02% (70,05%), NT 0,06% (73,5%) và cao 77,64% và 73,87%; 75,28%; 76,56 %; 77,24%.
Tỉ lệ tiêu hoá VCK, chất hữu cơ và protein giữa còn tiết ra những sản phẩm hữu cơ được gia súc
các NT thí nghiêm đều có khác biệt có ý nghĩa hấp thu vào máu và trở thành chất dinh dưỡng
thống kê (P=0,009; 0,003 và 0,005). Không có cho gia súc. Chúng kích thích quá trình tiêu hóa
sai khác giữa các mức độ bổ sung Biolac trong và hấp thu, kích thích tăng trưởng nhanh và
KP heo thí nghiệm. hiệu quả sử dụng TA (Fuller, 1992). Theo
Điều này là do khi bổ sung Biolac vào KP giúp Savage (1992), các VK lactic trong quá trình
cho hệ VSV đường ruột được cân bằng, ức chế lên men, còn tiết ra những sản phẩm hữu cơ
các VSV gây hại, qua đó giúp cho heo không được gia súc hấp thu vào máu và trở thành chất
bệnh, khỏe mạnh, giúp chúng tiêu hóa tốt. Kết dinh dưỡng cho gia súc. Chế phẩm Biolac có
quả này rất phù hợp với thực tế khi nuôi heo chứa VSV sống thuộc nhóm Bacillus có khả
thí nghiệm: heo ĐC thường ăn ít khi có trời năng phát triển trong đường ruột của heo làm
mưa hay gió lùa còn heo nuôi ở NT 0,06% và tăng khả năng tiêu hoá dưỡng chất và ngăn
NT 0,12% do heo khỏe sức đề kháng cao nên ngừa sự phát triển của VK gây bệnh.
thích nghi và chống chịu được với thay đổi Ngoài ra nó còn giúp tăng cường sản xuất lyzin,
thời tiết của môi trường. tiết ra acidophilin kích thích sinh trưởng giúp
Theo Savage (1992), những sản phẩm này có gia súc non tăng trọng nhanh. Tăng hoạt tính
khả năng khống chế Salmonella, Shigella, tiêu hóa, tăng hệ số chuyển hóa TA, hấp thu tốt
Staphylococcus, Proteus, Klebsiella, Bacillus, các dưỡng chất giúp cho heo tăng trọng tốt hơn.
E.coli gây nhiễm bệnh đường ruột. Ngoài ra 4. KẾT LUẬN
những VSV trong probiotic cũng cho ra những Bổ sung Biolac ở tỉ lệ 0,06% trong KP heo sau
sản phẩm phụ là những chất hữu cơ được cơ thể cai sữa mang lại hiệu quả kinh tế hơn qua việc
gia súc hấp thu vào máu và trở thành chất dinh heo có tăng trọng tốt, hệ số chuyển hoá TA thấp
dưỡng của gia súc. Khi gia súc bị stress về môi và tỷ lệ tiêu hoá dưỡng chất cao hơn.
trường, dinh dưỡng, tốc độ tăng trưởng giảm, Dùng Biolac để kích thích tăng trọng và khống
hiệu quả sử dụng TA kém; cung cấp VSV kích chế bệnh đường ruột là một trong những biện
thích tăng trưởng nhanh và cải thiện hiệu quả pháp tích cực.
TA .Những VK nầy trong quá trình lên men,
SUMMARY
Effects of supplementation of Biolac on performance and digestibility of weaning pigs
Huynh My, Nguyen Trong Ngu, Nguyen Thi Hong Nhan
Twelve growing Yorkshire crossbred pigs between 26- 28 kg live weight were used in a feeding
and digestibility trial in complete randomized design with 4 treatments (0; 0,02; 0,06 and 0,12% Biolac)
and 3 replications.
The results indicated that with 0,06% level of Biolac was brought diference in weight gain, feed
conversion ratio.The cost of production tended to be lower for diets with 0,06% Biolac. Especially,
improved the digestion of nutrients in feed as comparision with those of different treatments in this trial.
It is conclude that biolac proved to increase of weight gain, stimulate absorption, digestion of
nutrients in feed weaning pigs.
Key words: Biolac, performance, digestion, weaning pigs.
TÀI LIỆU THAM KHẢO
1. AOAC,1990. Official Methods of Analysis, 15th edition. Association of Official Analytical Chemists, Arlington,Virginia
2. Fuller. R, 1992. Probiotic: The Scientific Basis, Chapman & .Lisa Darling. 1994. Veterinary Pharmaceuticals aand
Biologicals. Publisher: Veterinary Medicine Publishing company Hall, 2-6 Bounday Row, London SE 1& HN.
3. Hội đồng hạt cốc Hoa Kỳ, 1999. Dinh dưỡng cho lợn và cách quản lý. NXB Nông Nghiệp Hà Nội.
4. Kozasa. M, 1989. Probiotics for animal use in Japan. Rev. Sci. tech. Off. Int. Epiz.
5. Minitab, 2000. Minitab Reference Manual, PC Version, Release 13.2. Minitab Inc., State College, PA
6. Pollman. D.S, 1980. Probiotics in pig diet. Recent advances in animal nutrition.
7. Savage Dwayne C, 1992. Gastrointestinal microbial ecology; Possible models of action of direct fed mirobials in animal
production. University of Microbiology, M 409 Walters Life Sciences Building.
8. Võ Ái Quấc, Trịnh Hữu Phƣớc, Võ Văn Sơn, 1985 Nghiên cứu giống heo Ba Xuyên 1981- 1985. Hội nghị tổng kết
nghiên cứu khoa học Đại Học Cần Thơ.
ISSN: 0886 - 8566
HỘI DI TRUYỀN HỌC VIỆT NAM

GENETICS SOCIETY OF VIETNAM
DI TRUYỀN HỌC
&
ỨNG DỤNG
GENETICS AND APPLICATIONS
CHUYÊN SAN
CÔNG NGHỆ SINH HỌC
SỐ 6 - 2010
MỤC LỤC
Trang
1. Đào Thị Lương, Nguyễn Thị Anh Đào, Nguyễn Thị Kim Quy, Trần Thị Lệ 01
Quyên, Dương Văn Hợp
Phân lập và tuyển chọn vi khuẩn Lactic dùng trong chế biến và bảo
quản thức ăn thô xanh và phụ phẩm nông nghiệp cho gia súc nhai lại
2. Trần Thị Lệ Quyên, Đào Thị Lương 07
Phân loại và nghiên cứu điều kiện nuôi thích hợp cho sinh trưởng và
tổng hợp CoQ10 ở chủng nấm men Pl5-2
3. Đào Thị Lương, Hà Thị Hằng, Trần Thị Lệ Quyên, Dương Văn Hợp 14
Phân tích mối quan hệ họ hàng trên cây phả hệ của các chủng vi khuẩn
phân lập từ Rong sụn Kappaphicus alvarezii
4. Hoàng Văn Vinh, Nguyễn Mạnh Hùng, Dương Văn Hợp 21
Bước đầu nghiên cứu sàng lọc Ningnanmycin – Một loại kháng sinh
dùng trong bảo vệ thực vật được sản xuất từ xạ khuẩn
5. Đỗ Võ Anh Khoa, Klaus Wimmers 30
Sự định vị của những thành phần bổ thể cuối cùng trên nhiễm sắc thể ở
lợn
6. Đỗ Võ Anh Khoa, Nguyễn Huy Tưởng, Lương Thị Nhuận Hảo 35
Đặc điểm sinh lý máu, sinh hoá máu, sinh trưởng và chất lượng thịt của
nhóm lợn lai Yorkshire x Landrace
7. Nguyễn Thị Kim Khang, Lâm Phúc Hải, Võ Công Thành, Võ Văn Sơn 46
Thăm dò khả năng kháng bệnh của các giống gà địa phương bằng điện
di SDS-PAGE
8. Nguyễn Trọng Ngữ, Nguyễn Thị Hồng Nhân, Mai Thị Ngọc Hương 49
Ảnh hưởng của đa hình gen growth hormone (gh-mspi) đến năng suất
và chất lượng sữa của giống bò lai Holstein friesian
9. Nguyễn Thị Bích Thùy, Trịnh Tam Kiệt 55
Nghiên cứu đặc điểm sinh học và kỹ thuật nuôi trồng nấm Vân chi
Trametes versicolor
10. Vi Minh Thuận, Nguyễn Thị Bích Thùy, Trịnh Tam Kiệt 59
Nghiên cứu đặc điểm sinh học và kỹ thuật nuôi trồng nấm Sò vua
Pleurotus eryngii (Dc. ex Fr.) Quel.
Di truyền học và ứng dụng – Chuyên san Công nghệ sinh học Số 6 – 2010
ẢNH HƯỞNG CỦA ĐA HÌNH GEN GROWTH HORMONE (GH-MspI) ĐẾN

NĂNG SUẤT VÀ CHẤT LƯỢNG SỮA CỦA GIỐNG BÒ LAI HOLSTEIN
FRIESIAN
Nguyễn Trọng Ngữ1,*, Nguyễn Thị Hồng Nhân1, Mai Thị Ngọc Hương2
1
Khoa Nông nghiệp và Sinh học Ứng dụng, Trường Đại học Cần Thơ
2
Khoa Nông nghiệp, Trường Đại học Bạc Liêu
TÓM TẮT
Thí nghiệm được tiến hành để xác định đa hình trên gen Growth Hormone và phân tích
mối liên kết của điểm đa hình này đến các chỉ tiêu năng suất và chất lượng sữa của giống bò
lai Holstein Friesian (HF). Tổng cộng có 206 bò sữa được xác định kiểu gen và dùng trong
phân tích. Năng suất sữa được theo dõi và ghi nhận trong suốt chu kỳ cho sữa. Các tính trạng
chất lượng sữa được phân tích bằng máy phân tích sữa tự động Milko Tester. DNA tách từ
mẫu máu và được sử dụng trong kỹ thuật PCR-RFLP với sự tham gia của enzyme giới hạn
MspI để xác định kiểu gen. Kết quả cho thấy có một điểm đa hình (C/T) trên intron 3 của
đoạn gen GH ở vị trí 1547 với tần số kiểu gen CT xuất hiện cao nhất (61%) và tần số allele C
và T tương ứng là 57% và 43%. Kết quả phân tích mối liên quan giữa kiểu gen và kiểu hình
cho thấy, bò mang kiểu gen CC cho sữa nhiều hơn (P < 0,01) so với bò có các kiểu gen CT và
TT (3451; 3139 và 2778 kg/chu kỳ/con). Đối với các chỉ tiêu chất lượng sữa, không có mối liên
kết nào được tìm thấy giữa kiểu gen với thành phần đạm, mỡ, đường và chất rắn không mỡ
trong sữa. Tóm lại, điểm đa hình GH-MspI có thể được sử dụng trong các chương trình chọn
giống để nâng cao năng suất sữa trên giống bò lai HF.
Từ khóa: Gen Growth Hormone, đa hình GH-MspI, năng suất và chất lượng sữa, bò lai HF
MỞ ĐẦU MspI trên các giống bò lai HF nuôi tại một số

Trong công tác giống bò sữa, hai yếu tố địa phương ở Đồng Bằng Sông Cửu Long
quan trọng đầu tiên thường được đề cập đến (ĐBSCL) và tìm ra mối liên quan giữa điểm
là việc cải thiện năng suất và thành phần của đa hình này với các tính trạng năng suất và
sữa. Bên cạnh các phương pháp chọn lọc chất lượng sữa nhằm góp phần gia tăng hiệu
truyền thống dựa vào gia phả hay kiểu hình, quả trong công tác chọn giống bò sữa.
thì việc tìm ra các gen có ảnh hưởng đến các VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN
tính trạng trên cũng được quan tâm nhiều CỨU
trong thời gian gần đây. 1. Gia súc thí nghiệm
Gen Growth Hormone (GH, Genbank Thí nghiệm được tiến hành trên 206 bò
M57764) ở bò nằm trên nhiễm sắc thể số 19 sữa lai HF (lai Sind x Holstein Friesian) nuôi
(1) bao gồm năm exon được xen kẽ bởi bốn tại trại bò sữa Nông trường Sông Hậu, Hợp
intron (2, 3). Gen này có ảnh hưởng đến các tác xã bò sữa Long Hòa (Cần thơ) và các trại
chức năng sinh học quan trọng như tăng bò sữa của Hợp tác xã bò sữa EverGrowth,
trưởng, sự phát triển của tế bào tuyến vú và sự Sóc Trăng.
tiết sữa (4). Ở bò, hai điểm đa hình trên intron 2. Phương pháp nghiên cứu
3 và exon 5 được cho là có liên quan đến các - Xác định các chỉ tiêu của sữa: năng suất
chỉ tiêu năng suất và chất lượng sữa, đặc biệt sữa được theo dõi trong cả chu kỳ cho sữa của
dạng đồng hợp tử của một điểm đa hình trên bò (305 ngày). Năng suất tiêu chuẩn có tỷ lệ
intron 3 (GH-MspI) dẫn đến sự cải thiện của mỡ sữa 4% được qui đổi theo công thức của
năng suất sữa (5, 6). Như vậy, việc nghiên Đặng Vũ Bình (7): sản lượng sữa tiêu chuẩn =
cứu và ứng dụng các đa hình gen GH hứa hẹn 0,4S + 0,15F (trong đó, S: sản lượng sữa thực
sẽ mang lại hiệu quả về mặt kinh tế thông qua tế trong toàn chu kỳ, kg; F: tỷ lệ mỡ sữa, %;
các chương trình chọn giống. Mục tiêu của đề 0,4 và 0,15: hệ số quy đổi).
tài là khảo sát tính đa hình của locus GH-
J. Genetics and Applications – Special Issue: Biotechnology 49

Institute of Microbiology and Biotechnology, Vietnam National University, Hanoi
- Thu thập mẫu máu: máu được lấy ở tĩnh được ủ với enzyme giới hạn MspI ở 37oC
mạch cổ, sau đó cho vào ống falcon 15 ml có trong 15 phút và quan sát trên agarose gel 2%.
chứa chất chống đông EDTA và được trữ ở - 3. Phân tích số liệu
20oC. Tất cả các số liệu được xử lý theo mô hình
- Tách DNA mẫu máu: sử dụng phương tuyến tính General Linear Model của chương
pháp phenol/chloroform và kết tủa DNA bằng trình thống kê Minitab 13.20, trong đó các
ethanol, sau cùng hòa tan trong đệm TE (Tris yếu tố có ảnh hưởng đến năng suất sữa như cơ
EDTA) và trữ DNA ở 4oC. sở, giống, lứa đẻ và kiểu gen đều được sử
- Phát hiện đột biến và xác định kiểu gen: dụng trong mô hình.
sử dụng phương pháp giải trình tự so sánh và KẾT QUẢ VÀ THẢO LUẬN
PCR-RFLP (Polymerase Chain Reaction - 1. Phát hiện đa hình và xác định kiểu gen
Restriction Fragment Length Polymorphism). Trong thí nghiệm hiện tại, phương pháp
Cặp mồi dùng trong PCR được thiết kế dựa giải trình tự so sánh phát hiện được một
theo Li Zhou et al. (5) với trình tự 5’- điểm đột biến (C/T) trên intron 3 ở vị trí
CCCACGGGCAAGAATGAGGC-3’ (mồi 1547 của gen GH. Kết quả này phù hợp với
xuôi) và 5’- báo cáo của nhiều tác giả khác nhau như Li
TGAGGAACTGCAGGGGCCCA-3’ (mồi Zhou et al. (5) trên giống bò Beijing
ngược). Nhiệt độ bắt cặp của mồi là 58oC, sản Holstein và Yardibi et al. (8) trên giống bò
phẩm PCR (327 bp) sau đó được kiểm tra tính địa phương Anatolian Red của Thổ Nhĩ Kỳ.
đặc hiệu và giải trình tự để tìm ra vị trí đa Đây cũng là locus trước đó được đề cập bởi
hình. Ngoài ra, để xác định kiểu gen theo Hilbert et al. (9) và Zhang et al. (10). Kết
phương pháp PCR-RFLP, sản phẩm PCR quả giải trình tự được thể hiện qua Hình 1.
Hình 1. Kết quả giải trình tự so sánh phát hiện Hình 2. Sản phẩm điện di RFLP GH-MspI
đột biến điểm (C/T) ở vị trí 1547 của gen GH trên gel 2%
M: thang chuẩn DNA 100 bp, Fermentas
Enzyme MspI có vị trí cắt là Holstein. Ngoài ra, kết quả thu được cũng
5’...CCGG…3’. Sản phẩm PCR khi cắt phù hợp với các nghiên cứu khác như của
bằng MspI thu được 2 allele C và T với 3 Zakizadeh et al. (11) trên giống bò Holstein
kiểu gen tương ứng là CC, CT và TT. Trên của Iran, của Pawar et al. (6) trên các giống
gel điện di, kiểu gen CC thể hiện 2 băng có bò Gyr, Kankrej và Holstein và gần đây nhất
kích thước là 222 bp và 105 bp; kiểu gen CT là báo cáo của Yardibi et al. (12) trên những
thể hiện 3 băng (327 bp, 222 bp và 105 bp) giống bò South Anatolian Red và North
và cuối cùng là kiểu gen TT, do không bị cắt Anatolian Red của Thổ Nhĩ Kỳ.
nên thể hiện một băng duy nhất 327 bp (Hình 2. Tần số kiểu gen và tần số allele của đa
2). Kết quả này tương tự với nghiên cứu của hình GH-MspI
Li Zhou et al. (5) trên giống bò Holstein Bắc Biểu đồ 1 thể hiện tần số kiểu gen và tần số
Kinh, theo đó tác giả cũng cho rằng sử dụng allele của gen GH, theo đó số lượng bò với
enzyme MspI cắt đoạn gen GH cho ra 3 kiểu kiểu gen dị hợp tử CT chiếm tỷ lệ cao nhất
gen với kích thước tương ứng như trên. (61%), tiếp theo là bò mang kiểu gen CC (27%)
Trước đó, Lagziel et al. (4) cũng đã trình bày và thấp nhất là dạng đồng hợp tử TT (12%).
về điểm đa hình này trên giống bò sữa Israel

(a) Tần số (b) Tần số

0.8 0.8
0.61
0.57
0.6 0.6
0.43
0.4 0.4
0.27
0.2 0.12 0.2
0 0.0
CC CT TT
C T
Kiểu gen Allele
Biểu đồ 1. Tần số kiểu gen (a) và tần số allele (b) của đa hình GH-MspI
Kết quả cho thấy đàn bò sữa lai nuôi tại đàn là không cao, dao động từ 0,13-0,26 (10,
ĐBSCL có tần số kiểu gen dị hợp tử CT khá 15, 16). Nhóm tác giả Zakizadeh et al. (11)
cao và điều này cũng phù hợp với khảo sát cũng kết luận rằng tần số kiểu gen TT trong
của các nghiên cứu khác trong nước. Ví dụ, các giống bò địa phương của Iran cao hơn
trên các giống bò sữa lai nuôi tại Trung Tâm giống bò Holstein. Điều này chứng tỏ quá
Nghiên Cứu Bò và Đồng Cỏ Ba Vì, Trần trình chọn lọc các bò Holstein có năng suất
Xuân Hoàn et al. (13) cũng đưa ra một kết cao đã làm giảm số lượng gia súc với kiểu
luận tương tự, theo đó tỷ lệ kiểu gen dị hợp tử gen TT trong quần thể. Kết quả trong thí
trong đàn là cao nhất và thấp nhất là dạng nghiệm hiện tại tương tự với các báo cáo trên,
đồng hợp tử TT (<10%). Cũng trong báo cáo trong đó sự xuất hiện của các cá thể mang
trên, các tác giả còn xác định kiểu gen của 14 kiểu gen TT trong đàn không quá 12%.
bò đực giống và kết quả là 100% số bò này 3. Ảnh hưởng của đa hình GH-MspI đến
đều mang kiểu gen dị hợp tử, và đó cũng là lý năng suất sữa
do tại sao kiểu gen này xuất hiện cao nhất Đối với locus GH-MspI, trên tất cả các chỉ
trong đàn bò sữa lai. tiêu năng suất sữa (NSS) đều có sự khác biệt
Cũng trên điểm đa hình này, các nghiên thống kê (P < 0,01) giữa bò mang kiểu gen
cứu cho thấy tần số allele T dao động mạnh CC (3451 kg/chu kỳ/con) và bò mang 2 kiểu
giữa các giống, từ 0,00 trên bò Hereford đến gen còn lại CT (3139 kg/chu kỳ/con) và TT
0,81-0,89 trên giống bò Gyr (10, 14). Trên (2778 kg/chu kỳ/con). Khuynh hướng về sự
giống bò Holstein kết quả thí nghiệm của khác biệt này cũng không đổi đối với các chỉ
Zakizadeh et al. (11) và nhiều kết quả nghiên tiêu khác như NSS trung bình (kg/ngày/con)
cứu khác cho thấy tần số kiểu gen TT trong hay NSS4% trong cả chu kỳ (Bảng 1).
Bảng 1. Ảnh hưởng của đa hình GH-MspI đến năng suất sữa (LSM ± SE)
NSS/CK NSSTB NSS4%/CK NSS4%TB
Kiểu gen n
(kg/con) (kg/ngày/con) (kg/con) (kg/ngày/con)
CC 55 3451 ± 104a 11,3 ± 0,3a 3475 ± 105a 11,4 ± 0,3a
b b b
CT 126 3139 ± 75 10,3 ± 0,2 3076 ± 75 10,1 ± 0,2b
TT 25 2778 ± 148b 9,1 ± 0,5b 2739 ± 150b 9,0 ± 0,5b
P < 0,01 < 0,01 < 0,01 < 0,01
a, b
Những chữ khác nhau trên cùng một cột thể hiện sự khác biệt ý nghĩa ở mức 5%
NSS/CK: Năng suất sữa/chu kỳ; NSSTB: Năng suất sữa trung bình; NSS4%/CK: Năng suất
sữa 4%/chu kỳ; NSS4%TB: Năng suất sữa 4% trung bình
Mối liên quan giữa đa hình GH-MspI với CC cho năng suất sữa cao hơn (P < 0,05) bò
tính trạng NSS đã được nghiên cứu trên nhiều mang các kiểu gen còn lại và không có sự
giống bò khác nhau trên thế giới. Pawar et al. khác biệt nào được tìm thấy trên các bò mang
(6) nghiên cứu trên 3 giống bò Kankrej, Gyr kiểu gen CT và TT. Thêm vào đó, Li Zhou et
và Holstein kết luận rằng bò mang kiểu gen al. (5) cũng nhận định rằng bò HF mang kiểu

gen CC có năng suất sữa cao hơn so với các khác nhau (19). Đây có thể là lý do giải thích
cá thể có kiểu gen CT và TT. Tuy nhiên, cho mối liên kết giữa đa hình MspI trên intron
cũng có nhiều báo cáo khác cho thấy locus 3 với NSS trong thí nghiệm này.
GH-MspI không có ảnh hưởng đến NSS ở 4. Ảnh hưởng của đa hình GH-MspI đến
giống bò Italian HF, thay vào đó là sự gia chất lượng sữa
tăng phần trăm đạm và mỡ sữa (4, 17). Qua Bảng 2 nhận thấy tỷ lệ phần trăm các
Ngoài ra, công trình của Yao et al. (18) cho chỉ tiêu chất lượng sữa giữa các kiểu gen
thấy allele T làm giảm NSS, năng suất đạm đều gần như nhau (P > 0,05) ngoại trừ tỷ lệ
và mỡ sữa trên bò đực Holstein, trong khi đường có khuynh hướng cao hơn ở kiểu gen
đó bò Ba Lan Black-and-White đồng hợp tử CC (4,84%) so với kiểu gen CT (4,73%) và
CC cho NSS cao hơn bò dị hợp CT, nhưng TT (4,66 %) (P = 0,09). Kết quả này khác
các bò dị hợp này lại có phần trăm mỡ sữa với kết luận của Sabour et al. (16) và Li
cao hơn. Tổng hợp các kết quả trên cho thấy Zhou et al. (5) cho rằng phần trăm đạm và
allele C có mối tương quan với năng suất sữa mỡ sữa thấp hơn có ý nghĩa ở kiểu gen CC
cao và sự chênh lệch về năng suất giữa gia so với 2 kiểu gen còn lại. Ngoài ra, kết quả
súc với kiểu gen dị hợp tử CT và đồng hợp tử về thành phần đạm trong thí nghiệm này
TT có thể là do tính trội hoàn toàn của allele cũng tương tự với báo cáo của Lagziel et al.
C đối với allele T trên locus GH-MspI. (4). Đối với thành phần đường lactose trong
Sự biến đổi ở mức độ DNA góp phần rất lớn sữa, theo Shahbazkia et al. (20) lactose hoạt
trong việc xác định đặc điểm di truyền của động trước tiên như là một cơ chất thẩm thấu
đàn gia súc. Những đột biến trên các exon của trong sữa, do đó việc tăng tổng hợp lactose
gen có thể dẫn đến sự thay đổi các acid amin trong sữa làm cho sữa có khuynh hướng
và do đó thay đổi biểu hiện protein. Bên cạnh chứa nhiều nước hơn. Vì vậy việc tổng hợp
đó, mặc dù đột biến trên intron không làm lactose càng nhiều, thì sản lượng sữa được
biến đổi trật tự chuỗi acid amin trên phân tử tạo ra tăng lên và quá trình này không ảnh
protein tương ứng nhưng nó có thể đóng vai hưởng đến các thành phần khác như đạm và
trò quan trọng trong quá trình cắt nối gen khoáng sữa. Nhận định trên cũng phù hợp
hoặc liên kết với các protein điều hòa trong với kết quả thu được, theo đó kiểu gen CC có
quá trình phiên mã. Trên gia súc, những điểm hàm lượng đường cao nhất ở nhóm bò sữa có
đột biến như vậy có thể liên quan tới những năng suất cao.
tính trạng kinh tế được điều hòa bởi nhiều gen
Bảng 2. Ảnh hưởng của đa hình GH-MspI đến chất lượng sữa (LSM ± SE)
Chất lượng sữa
Kiểu
n Đạm Đạm Mỡ Mỡ Đường Chất rắn
gen
(%) (kg/chu kỳ) (%) (kg/chu kỳ) (%) không mỡ (%)
CC 55 3,58 ± 0,03 123,3 ± 3,8a 4,04 ± 0,07 139,7 ± 4,5a 4,84 ± 0,05 9,23 ± 0,07
CT 126 3,59 ± 0,02 112,5 ± 2,8b 3,89 ± 0,05 121,4 ± 3,2b 4,73 ± 0,04 9,30 ± 0,05
TT 25 3,67 ± 0,04 102,0 ± 5,5b 3,91 ± 0,10 108,5 ± 6,4b 4,66 ± 0,07 9,38 ± 0,09
P 0,16 < 0,01 0,23 < 0,01 0,09 0,42
a, b
Những chữ khác nhau trên cùng một cột thể hiện sự khác biệt ý nghĩa ở mức 5%
Các kiểu gen của điểm đa hình GH-MspI kiểu gen TT (102,0 kg và 108,5 kg). Tuy
ảnh hưởng có ý nghĩa đến năng suất đạm và nhiên, sản lượng mỡ sữa ở 2 kiểu gen CT và
mỡ sữa toàn kỳ, trong đó năng suất đạm và TT không khác biệt thống kê. Kết quả này
mỡ của kiểu gen CC là cao nhất tương ứng ủng hộ kết luận của Dybus et al. (21) rằng tỷ
với 123,3 kg và 139,7 kg; kế đến là kiểu gen lệ đạm và béo của mỡ sữa cao hơn trong cá
CT (112,5 kg và 121,4 kg) và cuối cùng là thể đồng hợp tử CC. Tuy nhiên, kết quả trong

thí nghiệm hiện tại khác với báo cáo của its association with lactation yield in dairy
Lagziel et al. (4), theo đó thành phần đạm sữa cattle", Indian Journal of Animal Sciences
cao hơn ở gia súc dị hợp tử. 77, pp. 884-888.
KẾT LUẬN 7. Đặng Vũ Bình. 2005. Giống vật nuôi.
Một điểm đa hình (C/T) ở vị trí 1547 của Nhà xuất bản Đại học sư phạm, pp. 55-56.
gen GH đã được xác định trên các giống bò lai 8. Yardibi H., G.T. Hosturk., I. Paya., F.
HF nuôi tại ĐBSCL. Bò mang kiểu gen CC Kaygisiz., G. Ciftioglu., M. A., and O. K.
cho năng suất sữa toàn kỳ cao hơn bò có kiểu 2009, "Associations of Growth Hormone
gen CT và TT. Đối với các tính trạng chất gene polymorphisms with milk production
lượng sữa, không có sự khác biệt về mặt kiểu traits in South Anatolian and East Anatolian
gen trên các chỉ tiêu đạm, mỡ sữa và chất rắn Red Cattle", Journal of Animal and
không mỡ. Kết quả đề tài có thể được sử dụng Veterinary Advances 8 (5), pp. 1040-1044.
trong công tác giống bò sữa đặc biệt là chọn 9. Hilbert, P., A. Marcotte, A. Schwers, R.
lọc bê ngay từ sơ sinh, qua đó góp phần làm Hanset, G. Vassart, and M. Georges. 1989,
giảm chi phí thức ăn, chi phí chọn giống, nâng "Analysis of genetic variation in the Belgian
cao lợi nhuận trong chăn nuôi bò sữa. Blue cattle breed using DNA sequence
polymorphism at the growth hormone, low
density lipoprotein receptor, alpha-subunit of
1. Hediger, R., S. E. Johnson, W. Barendse, R. glycoprotein hormones and thyroglobulin
D. Drinkwater, S. S. Moore, and J. Hetzel. loci", Animal Genetics 20(4), pp. 383-393.
1990, "Assignment of the growth hormone 10. Zhang, H. M., D. R. Brown, S. K.
gene locus to 19q26-qter in cattle and to DeNise, and R. L. Ax. 1993, "Rapid
11q25-qter in sheep by in situ hybridization", communication: polymerase chain reaction-
Genomics 8(1), pp. 171-174. restriction fragment length polymorphism
2. Gordon, D. F., D. P. Quick, C. R. analysis of the bovine somatotropin gene", J
Erwin, J. E. Donelson, and R. A. Maurer. Anim Sci 71(8), pp. 2276.
1983, "Nucleotide sequence of the bovine 11. Zakizadeh, S., G. Rahimi, A. Nejati-
growth hormone chromosomal gene", Javaremi, M. Moradi-Shahrbabak, P.
Molecular and Cellular Endocrinology Reinecke, M. Reissmann, A. A. Masoudi,
33(1), pp. 81-95. C. Amirinia, and A. A. Mirhadi. 2006,
3. Woychik, R. P., S. A. Camper, R. H. "Analysis of Bovine Growth Hormone Gene
Lyons, S. Horowitz, E. C. Goodwin, and F. Polymorphisms in Three Iranian Native
M. Rottman. 1982, "Cloning and nucleotide Breeds and Holstein Cattle by RFLP-PCR",
sequencing of the bovine growth hormone Biotechnology 5(3), pp. 385-390.
gene", Nucleic Acids Research 10(22), pp. 12. Yardibi, H., G. T. Hosturk, I. Paya, F.
7197-7210. Kaygisiz, G. Ciftioglu, A. Mengi, and K.
4. Lagziel, A., E. Lipkin, E. Ezra, M. Oztabak. 2009, "Associations of Growth
Soller, and J. I. Weller. 1999, "An MspI Hormone gene polymorphisms with milk
polymorphism at the bovine growth production traits in South Anatolian and
hormone (bGH) gene is linked to a locus East Anatolian Red Cattle", Journal of
affecting milk protein percentage", Animal Animal and Veterinary Advances 8 (5), pp.
genetics 30(4), pp. 296-299. 1040-1044.
5. Li Zhou, G., H. G. Jin, C. Liu, S. Li 13. Trần Xuân Hoàn, Đinh Đoàn Long,
Guo, Q. Zhu, and Y. H. Wu. 2005, Nguyễn Thị Quỳnh Châu, Phạm Phương
"Association of genetic polymorphism Mai và Trần Xuân Toàn. 2008, "Đa hình
inGH gene with milk production traits in gen hormone sinh trưởng của một số giống
Beijing Holstein cows", Journal of bò nuôi ở Việt Nam", Tạp chí Khoa học
biosciences 30(5), pp. 595-598. Công nghệ Chăn nuôi 4(14), pp. 53-58.
6. Pawar, R. S., K. R. Tajane, C. G. Joshi, 14. Lagziel, A., S. DeNise, O. Hanotte, S.
D. N. Rank, and B. P. Bramkshtri. 2007, Dhara, V. Glazko, A. Broadhead, R. Davoli,
"Growth hormone gene polymorphism and
V. Russo, and M. Soller. 2000, "Geographic 18. Yao, J., S. E. Aggrey, D. Zadworny, J.
and breed distribution of an Msp I PCR- F. Hayes, and U. Kuhnlein. 1996,
RFLP in the bovine growth hormone (bGH) "Sequence variations in the bovine growth
gene", Animal Genetics 31(3), pp. 210-213. hormone gene characterized by single-
15. Yao, J., D. Zadworny, U. Kuhnlein, S. strand conformation polymorphism (SSCP)
E. Aggrey, and J. F. Hayes. 1996, "A MspI analysis and their association with milk
polymorphism in the bovine ornithine production traits in Holsteins", Genetics
decarboxylase gene and its possible 144(4), pp. 1809-1816.
association with selection for milk 19. Choudhary, V., P. Kumar, K. Tarun,
production in Holstein bulls", Animal B. B. B., and A. Sharma. 2005, "DNA
Genetics 27(4), pp. 283-284. polymorphism of leptin gene in Bos indicus
16. Sabour, M. P., C. Y. Lin, and C. and Bos taurus cattle", Genetics and
Smith. 1997, "Association of genetic Molecular Biology 28(4), pp. 740-742.
variants of bovine growth hormone with 20. Shahbazkia, H. R., M. Aminlari, A.
milk production traits in Holstein cattle", Tavasoli, A. R. Mohamadnia, and A.
Journal of Animal Breeding and Genetics Cravador. "Associations among milk
114, pp. 435-442. production traits and glycosylated
17. Falaki, M., N. Gengler, M. Sneyers, haemoglobin in dairy cattle; importance of
A. Prandi, S. Massart, A. Formigoni, A. lactose synthesis potential", Veterinary
Burny, D. Portetelle, and R. Renaville. research communications 34(1), pp. 1-9.
1996, "Relationships of polymorphisms for 21. Dybus, A. 2002, "Association of
growth hormone and growth hormone growth hormone and prolactin genes
receptor genes with milk production traits polymorphisms with milk production traits
for Italian Holstein-Friesian bulls", Journal in Polish Black and White cattle", Animal
of Dairy Science 79(8), pp. 1446-1453. Science 20, pp. 203-212.
SUMMARY
ASSOCIATION OF GROWTH HORMONE GENE POLYMORPHISM (GH-
MSPI) WITH MILK YIELD AND MILK QUALITY TRAITS IN CROSSBRED
HOLSTEIN FRIESIAN COWS
The current study was undertaken to identify the polymorphism of Growth Hormone gene and
its association with milk yield and milk quality traits in crossbred Holstein Friesian (HF) cows. In
total, 206 cows were included for genotyping and for association study. Milk yield was recorded for
the whole lactation period. Milk quality traits were analyzed using automatic milk analyzer (Milko
Tester). DNA isolated from blood was used in PCR-RFLP technique with the presence of MspI
restriction enzyme for genotyping. A polymorphism in intron 3 at position 1547 of the gene was
found with highest frequency in CT genotype (61%) and allele frequencies of C and T were 57%
and 43%, respectively. In addition, the CC cows yielded more milk (P < 0.01) than those with CT
and TT genotype (3451; 3139 and 2778 kg/lactation/head). The association between this locus with
milk quality traits such as protein, fat, lactose and solid-non-fat content could not be established. In
brief, it is suggested that the GH-MspI locus can be of valuable parameter for milk yield selection in
crossbred HF cows.
Key words: Growth Hormone gene, GH-MspI polymorphism, milk yield and milk quality
traits, crossbred HF cows
Lời cảm ơn
Công trình được hoàn thành với sự hỗ trợ kinh phí của Bộ Giáo dục và Đào tạo, mã số B2009-16-
120.

VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi - Số 31 - Tháng 8 - 2011
SỬ DỤNG NGUỒN THỨC ĂN TỪ DÃ QUỲ (TITHONIA DIVERSIFOLIA),

RAU MUỐNG (IPOMOEA AQUATICA) ĐỂ NUÔI THỎ THỊT LAI
Nguyễn Thị Hồng Nhân1, Nguyễn Trọng Ngữ1, Nguyễn Văn Phú2 và Vũ Chí Cương3
1
Trường Đại học Cần Thơ; 2Công Ty TNHH Thuốc Thú Y Á Châu; 3Viện Chăn nuôi
Tác giả liên hệ: Nguyễn Thị Hồng Nhân. Tel: 0919434989; E-mail: nthnhan@ctu.edu.vn
ABSTRACT
Use of Tithonia diversifolia and Ipomoea aquatica for growing crossbred rabbits
An experiment aimed at determing the suitable propotion of Tithonia diversifolia and Ipomoea aquatica in
rations for growing crossbred rabbits was conduced at the experimental farm of the College of Agriculture and
Applied Biology, Cantho University. Fourty eight growing rabbits were used in a completely randomized design
experiment with 4 treatments and 3 replications for each treatment. The four dietary treatments were 100%
Tithonia diversifolia, 50% Tithonia diversifolia + 50% Para grass, 100% Ipomoea aquatica, and 50% Ipomoea
aquatica + 50% Para grass (based on DM). Growth rates of rabbit seemed to be higher in groups fed 100% of
Tithonia diversifolia or Ipomoea aquatica. The feed conversion ratio (FCR) was not significantly different
among treatments. The carcass and meat quality did not show significant difference amongs the treatments.
Tithonia diversifolia and Ipomoea aquatica can be used as a feed source for growing rabbits under farm
conditions.
Key words: Tithonia diversifolia, Ipomoea aquatica, Para grass, growing rabbit, carcass, meat quality.
ĐẶT VẤN ĐỀ
Những năm gần đây, tình hình dịch bệnh trên đàn gia súc, gia cầm diễn biến phức tạp, ngành
chăn nuôi gặp rất nhiều khó khăn. Nhiều hộ gia đình bỏ trống chuồng trại, khiến số lượng đàn
gia cầm giảm sút. Do đó, đầu tư nuôi thỏ thực sự là một nghề mới, có thể tận dụng những phụ
phẩm trong nông nghiệp làm thức ăn, góp phần giải quyết việc làm, tăng thu nhập và nâng cao
đời sống của người dân. Nguồn thức ăn xanh cho thỏ nuôi ở hộ gia đình chủ yếu từ cỏ thiên
nhiên, Rau Muống là một nguồn tài nguyên thức ăn có giá trị cho thỏ theo nghiên cứu của
Hongthong Phimmmasan và cs (2004). Bên cạnh đó những báo cáo từ Olabanji và cs (2007),
cho thấy có thể sử dụng nguồn Dã quỳ làm thức ăn bổ sung cho thỏ. Các kết quả này cho thấy
việc dùng Dã quỳ chăn nuôi gia súc có thể làm giảm được chi phí thức ăn nhưng vẫn cho kết
quả tăng khối lượng tốt, song những nghiên cứu từ cây Dã quỳ vẫn còn rất hạn chế ở nước ta.
Vì vậy chúng tôi tiến hành nghiên cứu “Sử dụng nguồn thức ăn từ Dã qùy (Tithonia
diversifolia), rau Muống (Ipomoea aquatica) để nuôi thỏ thịt lai”.
VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU
Địa điểm và thời gian thí nghiệm
Thí nghiệm được thực hiện ở Trại Nghiên Cứu và Thực Nghiệm Nông Nghiệp Trường Đại
học Cần Thơ. Thời gian tiến hành thí nghiệm tháng 7 đến tháng 10 năm 2010
Bố trí thí nghiệm
48 thỏ lai Newzealand x địa phương thí nghiệm được bố trí hoàn toàn ngẫu nhiên (3 lần lập lại
và bốn nghiệm thức). Mỗi đơn vị thí nghiệm có 4 thỏ lai gồm 2 đực và 2 cái cai sữa ở 8 tuần
tuổi và có khối lượng 800 ± 33 g/con nuôi trong chuồng lồng. Thời gian thí nghiệm 08 tuần
với bốn khẩu phần thí nghiệm:
DQ: 100% Dã quỳ
DQCLT: 50% Dã quỳ và 50% cỏ lông tây (tính trên VCK)
RM: 100% rau Muống
RMCLT: 50% rau Muống và 50% cỏ lông tây (tính trên VCK)
66
NGUYỄN THỊ HỒNG NHÂN – Sử dụng nguồn thức ăn từ dã quỳ ...
Thức ăn thí nghiệm

Dã quỳ và rau Muống được trồng tại trại nghiên cứu và thực nghiệm nông nghiệp của trường.
Cỏ lông tây được cắt hằng ngày ở khu vực quanh trường. Tất cả thức ăn xanh sẽ được cho ăn
phần thân lá, ngọn. Thức ăn hỗn hợp viên Proconco C225 được bổ sung 5- 15g viên thức
ăn/con/ngày tùy giai đoạn.
Bảng 1. Thành phần hóa học và giá trị dinh dưỡng của khẩu phần thí nghiệm
Khẩu phần thí nghiệm
Chỉ tiêu
DQ DQCLT RM RMCLT
CP, % 24,4 19,1 20,3 17,0
CF, % 16,5 14,2 15,6 13,7
NDF, % 27,3 42,4 25,1 41,2
ME MJ/kg VCK 10,5 10,0 9,7 9,6
Chăm sóc nuôi dưỡng

Thỏ con được cách ly, theo dõi tình trạng sức khoẻ, được tiêm phòng những bệnh thường gặp
ở thỏ như cầu trùng, ghẻ … Chuồng được che chắn ánh nắng, lồng nuôi, máng ăn được phun
xịt thuốc sát khuẩn cẩn thận trước khi đưa vào thí nghiệm. Quy trình chăm sóc nuôi dưỡng
được thực hiện đồng đều trên các đơn vị thí nghiệm. Quét dọn vệ sinh chuồng lồng và nền
chuồng sạch sẽ. Rửa máng đựng nước và thay nước uống.
Các chỉ tiêu theo dõi
Thành phần hóa học của thực liệu thức ăn: DM, OM, CP, và Tro theo phương pháp AOAC
(2001); ADF, NDF theo qui trình Van Soest và cs (1991).
Lượng thức ăn hàng ngày được xác định bằng cách cân khối lượng thức ăn mỗi lần cho ăn.
Sáng hôm sau cân lại thức ăn thừa và thức ăn rơi vãi, lấy mẫu phân tích hàm lượng vật chất
khô từ đó ta tính được mức ăn thật sự mỗi ngày.
Xác định lượng thức ăn ăn vào: Thức ăn được cân vào buổi sáng và buổi chiều trước khi cho
thỏ ăn đảm bảo cho thỏ ăn dư so với nhu cầu rồi cân lại thức ăn thừa vào sáng hôm sau. Thức
ăn ăn vào và thức ăn thừa được xác định vật chất khô để tính tiêu tốn. Lượng thức ăn thỏ được
tính như sau: Lượng TĂ ăn vào/ngày = lượng TĂ trước khi cho ăn - lượng thức ăn thừa
Mỗi tuần cân khối lượng thỏ một lần vào buổi sáng trước khi cho ăn để theo dõi tăng khối lượng.
Cuối 8 tuần nuôi dưỡng mỗi lô thí nghiệm sẽ chọn 2 thỏ (1 đực và 1 cái) để mỗ khảo sát với các
chỉ tiêu: khối lượng sống, khối lượng thân thịt, khối lượng thịt đùi sau, khối lượng thịt tinh,
dài ruột non, dài manh tràng, dài ruột già và thành phần dưỡng chất của thịt thỏ.
Xử lý số liệu:
Số liệu được xử lý theo mô hình tuyến tính tổng quát (General Linear Model) và được thực
hiện trên Minitab (Minitab Release 13.2) (2000). Độ khác biệt ý nghĩa của các giá trị trung
bình trong và giữa các NT được xác định theo Tukey, với alpha < 0,05.
67
KẾT QUẢ VÀ THẢO LUẬN

Thức ăn và dưỡng chất tiêu thụ trong thí nghiệm nuôi dưỡng
Từ kết quả thu được cho thấy hàm lượng vật chất khô của Dã quỳ khá cao so với rau Muống,
trong khi đó hàm lượng protein thô tương đương nhau, chứng tỏ trong Dã quỳ có hàm lượng
nước thấp hơn so với rau Muống, đây là yếu tố rất tốt giúp cho thỏ thu nhận một lượng thức
ăn có hàm lượng vật chất khô cao mà không cần ăn một lượng lớn thức ăn như rau Muống.
Bảng 2. Thành phần hóa học thức ăn sử dụng trong thí nghiệm
Tính trên % DM
Chỉ tiêu DM
CP CF NDF ADF Ash
Dã quỳ 14,59 21,18 16,54 30,4 23,97 12,38
Rau Muống 9,86 21,7 17,4 30,3 26,3 15,3
Cỏ lông tây 20,2 11,9 28,1 55,5 34,8 13,6
TA hỗn hợp 90,9 19,9 4,57 24,4 7,64 11,6
Ghi chú: DM: vât chất khô, CP: protein thô,CF: xơ thô, NDF: xơ trung tính, ADF xơ acid, Ash: khoáng tổng số
Lượng vật chất khô ăn vào giữa nghiệm thức rau Muống và Dã quỳ thì giống nhau nhưng
khác với nghiệm thức có bổ sung cỏ lông tây. Đồng thời lượng vật chất khô ăn vào giữa
nghiệm thức đều tăng dần theo tuần cũng như tăng theo tăng khối lượng của thỏ. Lượng vật
chất khô ăn vào ở tuần 2 của nghiệm thức Dã quỳ có sự chựng lại đều này là do có một số thỏ
chưa quen với khẩu phần Dã quỳ nhưng sang các tuần tiếp theo thỏ đã quen dần. Lượng vật
chất khô ăn vào trung bình cao nhất ở nghiệm thức Dã quỳ là 86,69 g/ngày, thấp nhất là ở
nghiệm thức RMCLT là 74,44 g/ngày. Kết quả này phù hợp với nghiên cứu của Nguyễn Văn
Thu (2007) là lượng vật chất khô ăn vào của thỏ trong giai đoạn tăng trưởng trung bình là 80
g/ngày. Lượng vật chất khô ăn vào trung bình cao ở nghiệm thức Dã quỳ nhưng tỷ lệ cao
không khác biệt với rau Muống. Điều đó chứng tỏ khẩu phần rau Muống có lượng vật chất
khô ăn vào là tương đương.
Bảng 3. Lượng DM ăn vào (g/con/ngày) của thỏ thí nghiệm
Nghiệm thức
Thời gian SEM P
DQ DQCLT RM RMCLT
Tuần 1 70,12a 58,14b 69,82a 55,73b 1,07 0,001
a b a ab
Tuần 2 69,92 60,17 67,18 65,67 1,24 0,003
a bc ab c
Tuần 3 71,78 65,97 68,94 62,58 1,00 0,001
a b a b
Tuần 4 80,81 70,00 82,40 65,26 1,96 0,001
a b a b
Tuần 5 89,08 74,64 86,29 75,25 1,50 0,001
a b a b
Tuần 6 99,64 87,63 95,35 84,85 1,49 0,001
a b a b
Tuần 7 99,57 88,48 99,74 88,32 1,88 0,002
a b a b
Tuần 8 112,55 101,84 110,23 97,84 1,39 0,001
a b a b
Trung bình 86,69 75,86 84,99 74,44 0,49 0,001
Ghi chú: a, b các giá trị ở cùng hàng mang ít nhất một chữ ký hiệu chung không sai khác nhau ở P > 0,05.
68
Lượng protein thô ăn vào giữa các nghiệm thức khác biệt có ý nghĩa thống kê (P< 0,05).
Lượng protein thô ăn vào giữa nghiệm thức Dã qùy và rau Muống thì giống nhau nhưng khác
với nghiệm thức có bổ sung cỏ lông tây. Giống với lượng vật chất khô ăn vào ở tuần 2 lượng
protein thô ăn vào có sự khác biệt giữa các nghiệm thức và có sự chựng lại ở nghiệm thức Dã
qùy và rau Muống. Tuy nhiên sang các tuần tiếp theo lượng protein thô ăn vào ổn định và đều
tăng theo tuần, do thỏ đã quen với khẩu phần thức ăn trong thí nghiệm nên lượng ăn vào nhiều
hơn dẫn theo lượng protein thô ăn vào cũng tăng lên, lượng protein thô ăn vào trong ngày
trung bình cao nhất là nghiệm thức Dã quỳ với 19,97 g, thấp nhất là ở nghiệm thức RMCLT
với 15,30g, do hai nghiêm thức Dã quỳ và rau Muống có hàm lương protein thô cao hơn hai
nghiệp thức còn lại. Kết quả này cao hơn kết quả của Nguyễn Văn Thu (2007) là lượng
protein thô ăn vào của rau Muống trung bình là 13,4 g/ngày và RMCLT trung bình là 10,6
g/ngày và thấp hơn kết quả nghiên cứu của Nguyễn Văn Điền (2007) với lượng protein thô ăn
vào từ 17,4-23,9 g/ngày.
Bảng 4. Lượng CP ăn vào (g/con/ngày) của thỏ thí nghiệm
Nghiệm thức
Thời gian SEM P
DQ DQCLT RM RMCLT
Tuần 1 16,65a 11,98b 16,64a 11,51b 0,22 0,001
Tuần 2 16,05a 12,33b 15,43a 13,50b 0,26 0,001
Tuần 3 16,66a 13,55b 16,02a 12,88b 0,24 0,001
a b a b
Tuần 4 18,17 14,29 18,61 13,33 0,42 0,001
a b a b
Tuần 5 20,20 15,25 19,57 15,41 0,34 0,001
a b a b
Tuần 6 23,18 18,0 22,21 17,47 0,34 0,001
Tuần 7 22,85a 18,13b 22,97a 18,14b 0,45 0,001
Tuần 8 26,02a 20,90b 25,54a 20,12b 0,32 0,001
a b a b
Trung Bình 19,97 15,55 19,63 15,30 0,13 0,001
Ghi chú: a, b các giá trị ở cùng hàng mang ít nhất một chữ ký hiệu chung không sai khác nhau ở P = 0,05.
Tăng khối lượng và hệ số chuyển hóa thức ăn của thỏ thí nghiệm nuôi dưỡng
Bảng 5. Khối lượng đầu, khối lượng cuối và hệ số chuyển hoá thức ăn trong thí nghiệm
Nghiệm thức
Chỉ tiêu SEM P
DQ DQCLT RM RMCLT
KLĐTN (g) 790,0 813,6 791,1 805,4 21,15 0,83
ab bc a c
KLCTN (g) 1893,2 1765,2 1916,1 1738,7 30.26 0.007
a b a b
Tăng khối lượng 19,70 16,99 20,09 16,67 0,33 0,001
(g/ngày)
HSCHTĂ 4,40 4,47 4,23 4,48 0,08 0,26
69
Khối lượng đầu thí nghiệm giữa các nghiệm thức khác biệt không có ý nghĩa thống kê dao
động từ 790 g- 813,6 g. Khối lượng cuối thí nghiệm và tăng khối lượng trung bình giữa các
nghiệm thức khác biệt rất có ý nghĩa (P<0,05) khối lượng cao nhất là rau Muống (1.916,1 g)
kế đến là Dã qùy (1893,2 g). Khối lượng cuối thí nghiệm giữa 02 nghiệm thức Dã quỳ và rau
Muống không có sự khác biệt, tuy nhiên có sự khác biệt với nghiệm thức có bổ sung cỏ lông
tây kết quả này phù hợp với Nguyễn Văn Thu (2007) là nghiệm thức RM khác biệt với
nghiệm thức RMCLT (RM 2.538g và RMCLT 2.080g).
Hệ số chuyển hóa thức ăn giữa các nghiệm thức DQ, DQCLT, RM, RMCLT lần lượt là 4,40;
4,47; 4,23; 4,48 và khác biệt không có ý nghĩa thống kê, kết quả này cao hơn của Nguyễn Văn
Thu (2007) là RM 3,76, RMCLT 4,97. Tuy nhiên hệ số chuyển hóa thức ăn của thỏ trong thí
nghiệm của chúng tôi thấp hơn kết quả nghiên cứu của Đào Hùng (2006) với thí nghiệm thỏ
được nuôi bằng khẩu phần rau lang, cỏ lông tây và thức ăn hỗn hợp có hệ số chuyển hóa thức
ăn biến động từ 4,65-4,87. Hệ số chuyển hoá thức ăn của thỏ trong thí nghiệm cũng thấp hơn
kết quả của Ranchurn và cs (2000) có giá trị biến động từ 6,1 – 10,9 nhưng tương đương với
kết quả của Olabanji (2007) trong khỏang 4,53 – 4,87 khi nuôi thỏ thịt với khẩu phần 0%; 5%;
10% và 20% Dã quỳ trong khẩu phần (tính theo DM).
Bảng 6. Tăng trọng trong tuần (g/con/ngày) của thỏ thí nghiệm
Nghiệm thức
Thời gian SEM P
DQ DQCLT RM RMCLT
Tuần 1 15,29 14,47 14,74 14,41 0,52 0,36
a c b bc
Tuần 2 17,78 12,66 15,20 14,33 0,53 0,001
Tuần 3 19,18a 16,66b 19,38a 16,51b 0,73 0,04
Tuần 4 18,97ab 17,15b 21,28a 16,65b 0,77 0,01
a b a b
Tuần 5 21,15 17,33 21,74 16,84 0,63 0,001
a b a b
Tuần 6 21,45 18,34 22,05 17,08 0,53 0,001
Tuần 7 22,61a 18,90b 22,77a 17,92b 0,57 0,001
Tuần 8 21,18 20,44 23,56 19,60 0,90 0,065
Trung bình 19,70a 17,00b 20,10a 16,67b 0,33 0,001
Trong tuần đầu bố trí thí nghiệm tăng trọng giữa các nghiệm thức khác biệt không có ý nghĩa
thống kê. Tuy nhiên ở tuần 2, tuần 3 có sự khác biệt giữa các nghiệm thức điều này chứng tỏ
thỏ đã quen với điều kiện chăm sóc nuôi dưỡng và thức ăn. Đến tuần 5 trở về sau có sự khác
biệt này rõ và ổn định giữa nghiệm thức rau Muống và Dã quỳ với nghiệm thức bổ sung cỏ
lông tây. Tăng khối lượng trung bình trong ngày cao nhất là 20,1g ở nghiệm thức RM, kế đến
là Dã quỳ 19,7g và thấp nhất là 16,67g ở nghiệm thức RMCLT. Kết quả tăng khối lượng của
thỏ ăn rau Muống tương đương với kết quả của Nguyễn Văn Thu (2007) là RM 21,7 và
RMCLT 16,7 g/ngày và báo cáo của Chiv và Kaensombanth (2006) với tăng trọng thỏ đạt từ
16,2 – 21,4 g/ngày.
70
Từ kết quả trên cho thấy với việc sử dụng cây Dã quỳ làm thức ăn cho thỏ trong thí nghiệm
giúp thỏ phát triển, tăng khối lượng tốt, tương đương với việc cho thỏ ăn rau Muống. Trong
khi đó là loại cây dễ trồng, thích nghi với điều kiện khô hạn, nơi đất hoang hóa, lại không
cạnh tranh với thức ăn của con người, vì vậy nó mang lại hiệu quả kinh tế cao.
Chỉ tiêu thân thịt và cơ quan nội tạng của thỏ thí nghiệm nuôi dưỡng
Phần trăm thân thịt trên khối lượng sống của thỏ trong thí nghiệm biến động trong khoảng
46,53 - 47,64% cao nhất ở nghiệm thức RM và DQ kết quả này gần tương đương khi nuôi thỏ
bằng khẩu phần rau lang, cỏ lông tây và lúa với tỷ lệ thân thịt biến động từ 41,6 – 47,4% . Tỷ
lệ phần trăm trên thân thịt biến động từ 68,88 – 71,55 % kết quả này gần tương đương với thí
nghiệm của Nguyen Thi Kim Dong and Nguyen Van Thu (2005) với giá trị biến động từ 67,8
– 79,2%.
Bảng 7. Các chỉ tiêu năng suất thịt và nội tạng của thỏ thí nghiệm
Nghiệm thức
Chỉ tiêu SEM P
DQ DQCLT RM RMCLT
Khối lựơng sống (g) 1967,5ab 1867,6b 1980,9a 1889,7ab 23,71 0,02
Khối lượng thân thịt (g) 926,9 872,4 943,3 878,5 20,20 0,09
KL Thân thịt/KL sống (%) 47,12 46,72 47,64 46,53 1,14 0,9
KL Thịt tuột (g) 662,4 601,6 671,7 607,8 19,44 0,07
KLThịt tuột/Thân thịt (%) 71,55 68,88 71,22 69,21 1,70 0,61
Tỷ lệ thịt tuột/ xương(%) 3,44 3,22 3,61 3,39 0,20 0,60
KL đùi sau (g) 350,1 305,9 354,2 316,9 14,72 0,12
KL đùi sau/thân thịt (%) 37,81 35,06 37,56 36,08 1,53 0,57
Chiều dài ruột non (cm) 260,8 251,0 271,8 269,2 8,30 0,35
Chiều dài manh tràng (cm) 49,33 48,83 50,50 49,00 1,80 0,91
Chiều dài manh tràng/ruột non (%) 18,97 19,45 18,58 18,19 0,51 0,40
Chiều dài ruột già (cm) 109,8 103,0 118,7 113,2 4,5 0,18
Thành phần dưỡng chất của thịt thỏ
DM% 24,36 27,07 23,86 24,19 0.56 0,93
CP% 19,33 19,47 19,77 18,91 0,23 0,14
Ash% 5,02 5,25 4,93 5,09 0,21 0,73
Tỷ lệ thịt tuột và xương của thỏ ở các nghiệm thức trong thí nghiệm khác biệt không có ý
nghĩa thống kê (P > 0,05) giá trị biến động từ 3,22 – 3,61%. Chỉ tiêu này thường dùng để đánh
giá khả năng cho thịt của thỏ, theo Nguyễn Quang Sức và Đinh văn Bình (2000) thì tỷ lệ thịt/
xương phù hợp là 4 – 5. Kết quả của chúng tôi phù hợp với nghiên cứu của Nguyễn Thị Xuân
Linh (2008) với thí nghiệm ảnh hưởng của các mức độ rau Muống thay thế cỏ lông tây có giá
71
trị từ 3,04 - 4,11 và cũng phù hợp với Lâm Thanh Bình (2009) với thí nghiệm bổ sung bã đậu
nành có giá trị từ 3,35 – 3,96, tuy nhiên cao hơn kết quả của Ranchurn (2000) là 3,2.
Khối lượng đùi sau biến động từ 305,9 – 354,2 g khác biệt không có ý nghĩa thống kê (P >
0,05), tỷ lệ phần trăm đùi sau trên thân thịt không khác biệt và giá trị biến động từ 35,06 –
37,81%, kết quả này phù hợp nghiên cứu của Nguyễn Thị Xuân Linh (2008) với giá trị từ 32,4
– 36,6% và Lâm Thanh Bình (2009) với giá trị từ 34,5 – 36,1%.
Chiều dài manh tràng giữa các nghiệm thức khác nhau không có ý nghĩa thống kê (P> 0,05)
có giá trị từ 48,83 – 50,5 cm kết này tương đối cao so với kết luận của Nguyễn Quang Sức và
Đinh Văn Bình (2000) là thỏ trưởng thành có độ dài manh tràng khoảng 38 cm. Tỷ lệ chiều
dài manh tràng/ ruột non khác biệt không có ý nghĩa thống kê (P > 0,05) giá trị từ 18,19 –
19,45 %.
Qua kết quả mổ khảo sát chỉ tiêu thân thịt và cơ quan nội tạng của thỏ thí nghiệm như: Khối
lượng sống, khối lượng thân thịt, thịt tuột, khối lượng đùi sau, chiều dài manh tràng không có
sự khác biệt giữa các nghiệm thức. Điều này chứng tỏ khẩu phần Dã quỳ tương đương khẩu
phần rau Muống.
Giá trị dinh dưỡng của thỏ thịt trong thí nghiệm cho thấy hàm lượng DM khá cao thay đổi từ
23,86-24,36%. Sự khác biệt giữa các nghiệm thức về % DM thịt không có ý nghĩa thống kê
(P=0,93) Gía trị này phù phợp so với báo cáo của Nguyen Van Thu and Nguyen Thi Kim
Dong (2008) khi cho thỏ ăn rau Muống có hoặc không có cỏ mồm hay cúc dại có DM từ 24-
24,3%. Hàm lượng CP trong thịt thỏ đạt từ 18,91- 19,77% , kết quả thấp hơn nghiên cứu của
Nguyễn Chu Chương (2003) với lượng CP của thịt thỏ là 22,5%. Điều này cho thấy với việc
sử dụng cây Dã quỳ làm thức ăn cho thỏ vẫn giúp thỏ phát triển tương đương với khẩu phần
rau Muống về khối lượng thân thịt, đùi, cũng như chiều dài của ruột, và các thành phần dưỡng
chất có trong thịt thỏ.
KẾT LUẬN VÀ ĐỀ NGHỊ
Tăng khối lượng trên ngày giữa các nghiệm thức khác biệt không có ý nghĩa thống kê ở cả
giai đoạn nuôi dưỡng và tiêu hóa, tăng khối lượng đạt mức cao ở nghiệm thức 100% Dã
quỳ và rau Muống. Dã quỳ và rau Muống có hàm lượng dinh dưỡng tương đương nhau và
có thể sử dụng Dã quỳ vào để làm thức ăn cho thỏ giống như rau Muống.
Tiếp tục nghiên cứu việc dùng Dã quỳ làm thức ăn cho thỏ sinh sản và thỏ con.
Lâm Thanh Bình (2009), Ảnh hưởng của bổ sung bả đậu nành và các nguồn thức ăn năng lượng trong khẩu phần
trên tăng trọng, tiêu hoá dưỡng chất và hiệu quả kinh tế của thỏ lai, Luận văn thạc sĩ ngành chăn nuôi,
Khoa Nông Nghiệp và Sinh Học Ứng Dụng, Trường Đại học Cần Thơ.
Nguyễn Chu Chương (2003), Hỏi đáp về nuôi thỏ, Nhà xuất bản Nông nghiệp Hà Nội.
Nguyễn Văn Điền (2007), Ảnh hưởng của cỏ đậu (spophocarpus scandens) thay thế cỏ lông tây trên sự tăng
trọng và tiêu hóa của thỏ, Luận văn tốt nghiệp đại học, Khoa Nông Nghiệp và Sinh Học Ứng Dụng,
Trường Đại học Cần Thơ.
Đào Hùng (2006), Đặc điểm, tính năng sản xuất và ảnh hưởng các mức độ đạm thô trên tăng trưởng, khả năng ăn
vào, tỷ lệ tiêu hóa và tích lũy đạm của thỏ lai, Luận văn thạc sĩ ngành chăn nuôi, Khoa Nông Nghiệp và
Sinh Học Ứng Dụng, Trường Đại học Cần Thơ.
Nguyễn Thị Xuân Linh (2008), Ảnh hưởng của rau Muống (Ipomoea aquatica) trong khẩu phần cơ bản cỏ lông tây
(Brachiaria Mutica) trên năng suất thịt và sinh sản của thỏ thịt lai tại Đồng Bằng Sông Cửu Long, Luận văn
thạc sĩ ngành chăn nuôi, Khoa Nông Nghiệp và Sinh Học Ứng Dụng, Trường Đại học Cần Thơ.
72
Nguyễn Quang Sức và Đinh Văn Bình (2000), Cẩm nang chăn nuôi thỏ, Thông tin trang wed-Viện Chăn Nuôi
Việt Nam, http://www.vcn.vnn.vn/vcn.
Nguyễn Văn Thu (2007), Ảnh hưởng của việc sử dụng rau lang, rau Muống trên khả năng sản xuất thịt và tiêu
hóa của thỏ lai, Tạp chí Nghiên cứu khoa học, Trường Đại học Cần Thơ.
Viện Chăn Nuôi (2001) Thành phần và giá trị dinh dưỡng thức ăn gia súc - gia cầm Việt nam, Nxb Nông nghiệp.
AOAC (2001), Official methods of analysis, Association of official Analytical chemists, Washington D.C, Page
255- 275.
Chiv Phiny and Lampheuy Kaensombath (2006), Effect on feed intake and growth of depriving rabbits access to
soft faeces. Livestock Research for Rural Development. Volume 18, Article # 34. Retrieved ,
http://www.lrrd.org/lrrd18/3/phin18034.htm
Hongthong Phimmmasan , Siton Kongvongxay, Chhay Ty and Preston TR (2004), Water spinach (Ipomoea
aquatica) and Stylo 184 (Stylosanthes guianensis CIAT 184) as basal diet for growing rabbits. Livestock
Research for Rural Development 16 (5) 2004
Minitab. (2000), Minitab Reference Manual, PC Version, Release 13.2. Minitab Inc., State College, PA.
Nguyen Thi Kim Dong, and Nguyen Van Thu (2005), Effect of different proportions of para grass (Branchiaria
mutica) and sweet potato vines on feeed utilization, growth rate and carcass quality of crossbred rabbit
in the Mekong Dalta, Viet Nam”
Nguyen Van Thu, and Nguyen Thi Kim Dong (2008) A study of associated fresh forages for feeding growing
crossbred rabbits the Mekong delta of Vietnam. MEKARN Workshop 2008: Organic rabbit production
from forages
Olabanji, R.O., G.O. Farinu, J.A. Akinlade and O.O. Ojebiyi, (2007) Growth performance, organ characteristics
and carcass quality of weaner rabbits fed different levels of wild sunflower (Tithonia diversifolia Hemsl
A. Gray) leaf-blood meal mixture. Int. J. Agric. Res., 2: 1014-1021.
Ranchurn R., Z, B. Dullull, A.Ruggoo, and J.Roggoo (2000), Effects of feeding star grass (Cynodon
plectostachyus) on growth and digestibility of nutrients in the domestie rabbit, University of Mauritius,
Reduit, Mauritius.
Van Soest, P.J, J. B. Robertson and B. A. Lewis (1991), Carbohydrate methodology, metabolism and nutritional
implications in dairy cattle: methods for diatary fibre, and nonstarch polysaccharides in relation to
animal nutrition, J. Dairy sci. 74: 3585 - 3597.
Người phản biện: TS. Nguyễn Ngọc Anh và ThS. Lê Diệp Long Biên
73
NGUYỄN THỊ HỒNG NHÂN - Ảnh hưởng của khoảng cách trồng đến sinh trưởng, phát triển ...
ẢNH HƯỞNG CỦA KHOẢNG CÁCH TRỒNG ĐẾN SINH TRƯỞNG, PHÁT TRIỂN
VÀ NĂNG SUẤT CỦA CỎ PASPALUM ATRATUM TRONG ĐIỀU KIỆN NGẬP
NGOÀI ĐỒNG RUỘNG
Nguyễn Thị Hồng Nhân1, Nguyễn Văn Hớn1, Nguyễn Trọng Ngữ1và Đỗ Thị Thúy Diễm2
1
Trường Đại học Cần Thơ; 2Trường Đại Học An Giang
Tác giả liên hệ: Nguyễn Thị Hồng Nhân - Trường Đại học Cần Thơ;
Tel: 0919434989; E-mail: nthnhan@ctu.edu.vn
ABSTRACT
Effect of plant spacing on growth, development and yield of Paspalum atratum on waterlogged soils
The Paspalum grass was cultivated in the wet land with approximate 20 cm in depth to to examine the
productivity, quality and persistence of Paspalum atratum on waterlogged soils. Four different plant spacings
(20 x 50cm; 30 x 50cm; 40 x 50cm; 50 x 50cm) were investigated in a randomized complete design experiment,
in which 4 replicates for each spacing were used. The first cutting was in day 60th after planting and re-growth
cuttings were at 45-day intervals. The result showed that the smallest plant spacing gave the highest fresh and
dry yield. However, the qualitative parameters of grass were not different significantly among four different
plant spacings. The Paslalum grass can grow under waterlodgged condition.
Key words: Paspalum atratum, waterlogged soils, plant spacing, growth, development, yield.
ĐẶT VẤN ĐỀ
Chăn nuôi trâu bò là ngành kinh tế quan trọng trong cơ cấu nông nghiệp nước ta và mang lại
nhiều lợi ích thiết thực cho người nông dân. Để tăng nhanh sản lượng và chất lượng đàn bò
nhà nước đã có những chương trình khuyến nông, xoá đói giảm nghèo, cho vay vốn và tập
huấn kỹ thuật cho các hộ nuôi bò. Chính do việc phát triển của đàn gia súc ngày càng nhanh
mà nguồn thức ăn ngày càng kham hiếm và mất cân đối. Qua các điều tra cho thấy có sự mất
cân đối giữa cung và cầu thức ăn thô xanh, đặc biệt là cỏ xanh trong mùa khô và mùa nước
ngập. Khả năng cung cấp cỏ xanh từ những thảm cỏ tự nhiên là không ổn định. Bên cạnh đó
điều kiện tự nhiên ở một số tỉnh thuộc Đồng Bằng Sông Cửu Long hàng năm vào khoảng
tháng 8 đến tháng 11 dương lịch thì nước lũ tràn về làm cho nguồn thức ăn trong chăn nuôi
trở nên khan hiếm. Do đó muốn phát triển chăn nuôi gia súc được lâu dài và ổn định trong
tương lai thì cần phải phát triển thêm về số lượng và chủng loại cỏ thức ăn để đảm bảo được
nguồn thức ăn phục lứa cho ngành chăn nuôi. Vì thế việc tìm ra giống cỏ có khả năng sinh
trưởng mạnh, cho năng suất cao, giá trị dinh dưỡng tốt đồng thời thích nghi được điều kiện
ngập úng đang rất cần thiết. Tuy nhiên hiện nay vẫn còn chưa có các số liệu nghiên cứu về
khả năng đánh giá sự thích nghi, sinh trưởng và tính năng sản xuất của giống cỏ Paspalum
atratum trong điều kiện ngập úng. Chính vì thế chúng tôi thực hiện đề tài "Ảnh hưởng của
khoảng cách trồng đến sinh trưởng, phát triển và năng suất của cỏ Paspalum atratum trong
điều kiện ngập ngoài đồng ruộng”
VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU
Thời gian và địa điểm: Thí nghiệm thực hiện từ tháng 10/2007 đến tháng 4/2008 tại Thành
phố Cần Thơ. Chân ruộng thí nghiệm luôn ngập nước khoảng 20 cm, vào những thời điểm
nước lớn mực nước có thể lên đến 50 cm
Bố trí thí nghiệm
Thí nghiệm bố trí theo thể thức hoàn toàn ngẫu nhiên với 4 nghiệm thức (4 khoảng cách
trồng) và 4 lần lập lại. Diện tích mỗi lô thí nghiệm là 60 m2 (4m x 15m)
Nghiệm thức 1: Trồng 20cm x 50cm
Nghiệm thức 2: Trồng 30cm x 50 cm
81
Nghiệm thức 3: Trồng 40 cm x 50 cm

Nghiệm thức 4: Trồng 50 cm x 50 cm
Phương pháp thực hiện
Chuẩn bị đất và trồng cỏ: đất trước khi trồng được làm sạch cỏ, xới lên và phân lô thí
nghiệm. Sau khi làm đất và phân lô thí nghiệm xong bón lót bằng phân chuồng với lượng là
10 tấn/ha. Khi đất chuẩn bị xong trên mỗi lô sẽ tiến hành trồng hom cỏ Paspalum atratum
theo khoảng cách đã vạch sẵn, mỗi hốc được trồng 3 hom, trồng vùi sâu trong đất 10 cm.
Bón phân: Áp dụng công thức bón phân của hoà thảo (100 kg N, 60 kg P2O5, 30 kg K2O/ha).
Sau khi trồng được 10 ngày thì chúng ta bắt đầu bón phân lần 1, với lượng là (50 kg N, 60 kg
P2O5, 30 kg K2O/ha) và trước khi thu họach 15 ngày
Thời điểm lấy chỉ tiêu: các chỉ tiêu nông học và sinh lý được lấy vào thời điểm trước khi thu
hoạch lứa thứ nhất là 60 ngày sau khi trồng, thời gian của mỗi lứa tái sinh là 45 ngày.
Chỉ tiêu theo dõi: Trên mỗi lô chọn 5 điểm theo phương pháp đường chéo để theo dõi chỉ
tiêu nông học và sinh lý.
Số chồi/bụi: đếm tất cả số chồi/bụi ở 5 vị trí đã chọn
Chiều cao cây: Đo chiều cao ở 5 diểm đã chọn trên mỗi lô
Đo lượng oxy hòa tan: Đo 3 vị trí/lô, Dùng thiết bị đo lượng oxy hoà tan với điện cực đặt
cách mặt đất 5 cm.
Quan sát cấu trúc, hình thái của bẹ lá và rễ: Sau khi thu hoạch xong lứa 3, lấy mẫu để quan
sát Dùng lưỡi lam cắt ngang bẹ lá và rễ thành những lát thật mỏng, sau đó cho mẫu lên miếng
lame rồi nhỏ lên 1- 2 giọt dung dịch aceto carmin và đưa lên kính hiển vi quan sát. Quan sát
mẫu rễ, bẹ lá ngập nước và mẫu rễ, bẹ lá không ngập nước.
Quan sát sự phóng thích oxy từ rễ: Quan sát 3 mẫu/lô (Cách quan sát giống thí nghiệm trong
chậu) quan sát trên mẫu rễ ngập nước và mẫu rễ không ngập nước.
Sau khi thu hoạch, lấy một đoạn thân của cỏ Paspalum atratum còn rễ và cố định bằng kẹp
sau đó cho vào trong chậu chứa dung dịch quan sát (dung dịch quan sát bao gồm: 0,1% agar +
12 mg/l dd methylene blue + 130 mg/l Na2S2O4) để quan sát sự tiết oxy của rễ (Lê Văn Hòa,
2005). Cách ghi nhận kết quả là dựa sự chuyển từ không màu sang màu xanh của dung dịch
quan sát thông qua các phản ứng khử và phản ứng oxy hóa xảy ra ở các chất có trong dung
dịch làm thí nghiệm, các phản ứng xảy ra như sau:
Khi hòa tan methylene blue vào dung dịch agar 0,1% dung dịch sẽ có màu xanh. Khi cho
sodium dithionite (Na2S2O4) tiếp vào dung dịch sẽ trở nên không màu,
Dung dịch MeBH không màu, nhưng khi có oxy sẽ chuyển sang màu xanh như lúc ban đầu,
theo phương pháp của Lê Văn Hòa (2005)
Năng suất chất xanh, năng suất chất khô, năng suất protein thô: cắt và cân toàn bộ cỏ trên
lô để tính năng suất chất xanh, qui đổi ra tấn/ha. Cắt lúc 8-9 giờ sáng khi trời nắng ráo.
Năng suất chất khô: Lấy 1 kg mẫu cỏ tươi trong phần cỏ đã thu hoạch trong từng lô và cắt
ngắn xử lý mẫu để lấy 300 g mẫu phân tính hàm lượng vật chất khô (VCK). Năng suất chất
khô = %VCK x năng suất chất xanh. Năng suất protein thô được tính bằng năng suất chất khô
x % CP
82
Chỉ tiêu thành phần hóa học của cỏ: Lấy 1 kg mẫu tươi ngẫu nhiên trong phần cỏ đã cân, xử
lý mẫu này để lấy 300g mẫu phân tích vật chất khô, protein thô (CP), xơ thô (CF) theo qui
trình tiêu chuẩn của AOAC (2001). Xơ acid (ADF), xơ trung tính (NDF) theo qui trình của
Van Soest và cs (1991). Tỉ lệ tiêu hóa invitro: dựa vào qui trình của của Goering và Van Soest
(1970).
Xử lý số liệu: Quản lý và xử lý số liệu bằng phần mềm Microsoft Exel, SPSS 15.0.
KẾT QUẢ VÀ THẢO LUẬN
Ghi nhận tổng quát
Thí nghiệm thực hiện trên địa bàn phường Hưng Lợi – thành phố Cần Thơ. Khu đất thí
nghiệm là khu đất trồng lúa trước đây, chân đất thấp do đó mặt ruộng luôn bị ngập nước
quanh năm. Vì thế trước khi bố trí thí nghiệm chúng tôi phải rút cạn nước mới tiến hành trồng
cỏ Paspalum, sau đó khoảng 30 ngày sau khi trồng (NSKT) chúng tôi bắt đầu cho nước vào
ruộng với độ sâu khoảng 20 cm. Ở ruộng thí nghiệm này chúng tôi có thể chủ động được điều
kiện ngập nước 20 cm, nhưng không thể giữ cố định được độ sâu 20 cm vì đôi lúc mực nước
trong ruộng có thể lên trên mức 20 cm vào những thời điểm nước lớn.
Với 4 khoảng cách trồng khác nhau trong điều kiện ngập nước ngoài đồng ruộng và theo dõi
qua 3 lứa liên tiếp.
Ảnh hưởng của khoảng cách trồng của Paspalum atratum đến chỉ tiêu nông học Số
chồi/bụi
Bảng 1. Ảnh hưởng của khoảng cách trồng đến số chồi/bụi của cỏ Paspalum
Số chồi/bụi
Khoảng cách trồng
Lứa 1 Lứa 2 Lứa 3
20 x 50 cm 7,98 b 9,06 b 9,85 b
30 x 50 cm 9,67 ab 9,95 b 9,96 b
40 x 50 cm 10,96 ab 11,42 ab 11,75 ab
50 x 50 cm 14,90 a 14,17 a 14,25 a
P (*) (*) (*)
Ghi chú: (*): khác biệt ở mức ý nghĩa 5% (P<0,05)
Sự thành lập chồi chịu ảnh hưởng bởi nhiều yếu tố như đất, nước, phân bón, khí hậu, … Số
chồi của cỏ Paspalum trong suốt 3 lứa được trình bày trong bảng 1. Từ kết quả này cho thấy
sự thành lập chồi của cỏ Paspalum trong lứa thứ nhất (60 NSKT) cao nhất ở nghiệm thức
trồng với khoảng cách 50 x 50 cm là 14,9 chồi/bụi và thấp nhất là nghiệm thức trồng với
khoảng cách 20 x 50 cm là 7,98 chồi/bụi. Tuy nhiên chỉ có nghiệm thức trồng với khoảng
cách 20 x 50 cm và nghiệm thức trồng với khoảng cách 50 x 50 cm là có sự khác biệt có ý
nghĩa. Các nghiệm thức còn lại tuy số chồi có sự chênh lệch nhau nhưng sự khác biệt này
không có ý nghĩa thống kê. Sở dĩ sự thành lập chồi ở nghiệm thức trồng với khoảng cách 20 x
50 cm thấp hơn nghiệm thức trồng với khoảng cách 50 x 50 cm là do ở nghiệm thức trồng với
khoảng cách 50 x 50 cm thì khoảng cách giữa hàng cách hàng rộng, vì thế cây sẽ hấp thu
được đầy đủ dưỡng chất cũng như ánh sáng và các yếu tố khác thuận lợi cho sự thành lập
chồi. Khi đạt số chồi tối đa thì chồi/bụi không thay đổi trên cùng một nghiệm thức trong suốt
3 lứa.
83
Chiều cao cây

Bảng 2. Ảnh hưởng của khoảng cách trồng đến chiều cao của cỏ
Chiều cao cây (cm)
20 x 50 cm 90,06 a 92,24 94,38
30 x 50 cm 78,44 b 87,61 93,62
40 x 50 cm 80,33 ab 86,96 92,42
50 x 50 cm 77,69 b 89,12 86,66
P (*) ns ns
Ghi chú: ns: không có sự khác biệt có ý nghĩa (P>0,05); (*): khác biệt ở mức ý nghĩa 5%(P<0,05)
Qua 3 lứa quan sát ta thấy chiều cao của cỏ tăng dần theo thời gian và tỷ lệ nghịch với khoảng
cách trồng. So với chiều cao cây thực hiện trong chậu thì ở thí nghiệm ngoài đồng này cỏ
Paspalum chiều cao cây thấp hơn chút ít. Có lẽ ở thí nghiệm đồng có những lúc nước lớn mực
nước dâng cao hơn 20 cm nên đã ảnh hưởng đến sự sinh trưởng của cỏ.
Oxy hòa tan
Oxy hoà tan trong nước sẽ tham gia vào quá trình trao đổi chất, duy trì năng lượng cho quá
trình phát triển, sinh sản, tái sản xuất cho các sinh vật sống trong nước. Hàm lượng oxy hòa
tan của cỏ Paspalum thí nghiệm được trình bày trong bảng 3.
Bảng 3. Ảnh hưởng của khoảng cách trồng đến hàm lượng oxy hòa tan
Oxy hòa tan (mg/lít)
20 x 50 cm 1,65 b 1,50 b 1,02
30 x 50 cm 1,95 ab 1,97 ab 1,06
40 x 50 cm 2,13 ab 2,23 a 1,01
50 x 50 cm 2,48 a 2,58 a 1,03
P (*) (*) ns
Ghi chú: ns: không có sự khác biệt có ý nghĩa (P>0,05); (*): khác biệt có ý nghĩa (P<0,05)
Hàm lượng oxy hòa tan trong nước tăng dần khi khoảng cách trồng càng tăng. Điều này
chứng tỏ rằng khi mật số cây/đơn vị diện tích tăng thì mật độ rễ cũng gia tăng theo và chính
hệ thống rễ là nơi tiêu thụ oxy làm cho oxy hòa tan trong nước bị giảm. Ví dụ, khoảng cách
trồng 50 x 50 cm lượng oxy hòa tan còn trong nước nhiều hơn có ý nghĩa so với nghiệm thức
trồng với khoảng cách 20 x 50 cm, tuần tự là 2,48 so với 1,65 mg/lít. Tương tự như vậy ở lứa
thứ 2. Riêng lứa thứ 3 thì hàm lượng oxy hòa tan trong nước giảm một cách đáng kể so với 2
lứa trước đó, điều này được giải thích là do hệ thống rễ phát triển mạnh trong đất nên tiêu thụ
lượng oxy càng nhiều.
Như vậy, oxy hoà tan trong nước thay đổi theo khoảng cách trồng. Trồng càng dày thì rễ tiêu
thụ nhiều oxy, hàm lượng oxy hòa tan càng giảm. Tuy nhiên, hàm lượng oxy hoà tan trong
nước ở tất cả khoảng cách trồng của lứa thứ 3 trung bình 1,01-1,06 mg/lít so với lượng oxy
84
hoà tan trong nước của thí nghiệm trong chậu vẫn còn cao hơn (vào ngày thứ 30 sau khi ngập
lượng oxy hoà tan trong nước giảm rất thấp 0,32 mg/lít của nghiệm thức ngập nước sâu 20 cm
vào ngày thứ 30 sau khi trồng). Có lẽ là do trong chậu có đường kính nhỏ (60 cm) trồng 3
hom/chậu. Hơn nữa, nước trong chậu không di chuyển, không có gió, tiếp xúc với ánh sáng ít
nên lượng oxy hoà tan thấp là điều tất yếu. Riêng màu nước ở thí nghiệm ngoài đồng thì
không bị đen như thí nghiệm trong chậu.
Quan sát cấu trúc của bẹ lá và rễ
Thân cây bao gồm nhiều thành phần trong đó có lỗ khí giúp sự trao đổi oxy từ rễ lên thân và
ngược lại. Trong điều kiện không bị ngập nước, quan sát vỏ rễ thấy ít có lỗ khí. Ống dẫn khí
tạo thành sẽ dẫn khí từ chồi thoáng khí đến rễ yếm khí. Ngược lại ở cây ngập nước có nhiều lỗ
khí hơn và tạo thành những mảng lớn ở vỏ rễ. Khi bị ngập nước thường xuyên để dễ dàng vận
chuyển oxy hơn, những lỗ khí đã tự động chuyển từ đơn vị riêng lẽ sang một hình thức mới.
Đó là hịên tượng các màng ngăn tế bào biến mất để hình thành hệ thống dẫn khí. Krame
(1988) cho rằng một trong những con đường mà một số loài cây thích nghi với ngập úng là
thành lập mô khí để chuyển oxy xuống rễ, hay một ít oxy khuếch tán từ bề mặt môi trường
ngập nước rễ thông qua hệ thống gian bào (Armstrong, 1971). Đây là cơ chế tự nhiên phản
ứng lại cây khi bị ngập nước.
Qua quan sát giữa mẫu rễ cỏ Paspalum trồng trong điều kiện ngập nước và mẫu rễ cỏ trồng
trên cạn trong phòng thí nghiệm cho thấy như sau:
- Sự thành lập hệ thống dẫn khí bên trong
Qua quan sát bẹ lá của mẫu cỏ trồng trong điều kiện ngập nước và mẫu rễ cỏ trồng trên cạn rễ
(sau khi thu hoạch xong lứa 3, lấy mẫu để quan sát).
+ Bẹ lá ở mẫu cỏ không ngập nước: sự xuất hiện của mô dẫn khí (aerenchyma) chưa rõ.
+ Bẹ lá ở mẫu cỏ ngập nước: thì sự xuất hiện của aerenchyma rất rõ, nhiều và đường kính của
các aerenchyma rộng.
Hình 1. Bẹ lá cỏ Paspalum không ngập nước Hình 2. Bẹ lá cỏ Paspalum ngập nước
85
Qua quan sát rễ của mẫu cỏ trồng trong điều kiện ngập nước và mẫu rễ cỏ trồng trên cạn
(chúng tôi quan sát trên rễ già của mẫu cỏ Paspalum trồng trong điều kiện ngập nước ngoài
ruộng và trồng trên cạn). Mẫu cỏ sau khi thu hoạch lứa thứ 3 xong chúng tôi tiến hành thu
mẫu rễ đem về phòng thí nghiệm để quan sát. Qua mẫu quan sát ở hình cho thấy: Rễ không
ngập nước sự hình thành mô dẫn khí vẫn còn rất ít chỉ một vài cái nhưng chưa rõ. Rễ ngập
nước sự hình thành nhiều mô dẫn khí (aerenchyma) và kích thước của các mô dẫn khí hình
thành cũng to hơn so với rễ cỏ trồng trên cạn.
Sự khác nhau này là do khi trồng trên cạn cây có khả năng trao đổi khí thông qua khí khẩu ở
lá để lấy oxy trong không khí nuôi cây nên không cần phát triển hệ thống dẫn khí nên
aerenchyma không phát triển nhưng trong điều kiện ngập nước khẩu đóng lại nên giới hạn
mọi trao đổi khí qua con đường khẩu, do đó cây trồng bị thiếu oxy trầm trọng (Tsukarahara và
Kozlowski, 1986) nên phải hình thành hệ thống ống dẫn khí (aerenchyma) để vận chuyển oxy
xuống cung cấp cho rễ chính vì thế mà hệ thống ống dẫn khí ở mẫu cỏ trồng trong điều kiện
ngập nước lại phát triển mạnh. Điều này để giải thích cho sự hình thành nhiều mô khí do phải
chịu ngập nước thường xuyên.
Hình 3. Rễ già của cỏ Paspalum không ngập Hình 4. Rễ già của cỏ Paspalum ngập nước
nước
Quan sát khả năng phóng thích oxy của rễ
Khi bị ngập nước một thời gian, qua quan sát cây bị thối rễ, rễ có màu sậm sau đó rễ thối đen,
tương tự như thí nghiệm của Ponnamperuma (1964). Đối với đất ngập nước, oxygen ở rễ cây
thiếu trầm trọng, nếu cây có khả năng vận chuyển oxygen từ trên xuống thì rễ vẫn hô hấp bình
thường (Jackson và Drew, 1984). Qua quan sát cho thấy:
Đối với dung dịch chứa mẫu rễ cỏ Paspalum không ngập nước quan sát thấy dung dịch quan
sát không có sự chuyển màu. Sau thời gian quan sát khoảng 30 phút thì ở rễ không có sự định
vị màu xanh xung quanh rễ, chứng tỏ khi trồng trên cạn ở rễ không có sự phóng thích oxy.
Điều này cũng hơp lí vì khi trồng trên cạn cây không hình thành hệ thống dẫn khí.
Đối với dung dịch chứa mẫu rễ cỏ Paspalum trồng trong điều kiện ngập nước của thí nghiệm
chúng tôi cũng nhận thấy dung dịch chứa mẫu rễ Paspalum ngập nước đã có sự chuyển màu
dung dịch quan sát. Sau thời gian quan sát khoảng 30 phút thì ở rễ có sự định vị màu xanh ở
86
xung quanh các chóp rễ và dung dịch chuyển từ không màu sang xanh nhưng nhạt. Điều này
cho thấy rễ cỏ Paspalum khi trồng trong điều kiện ngập nước khả năng phóng thích oxy nhiều
hơn rễ trồng trên cạn bởi vì trong điều kiện ngập nước, rễ đã phát triển hệ thống dẫn khí rất rõ
như đã được trình bày trong phần quan sát hình thái và cấu trúc của rễ.
Ảnh hưởng của khoảng cách trồng đến năng suất cỏ Paspalum
Bảng 4. Ảnh hưởng của khoảng cách trồng đến năng suất chất xanh (NSCX) năng suất chất
khô (NSCK) và năng suất protein thô (NSCP) của cỏ Paspalum
Khoảng cách Năng suất (tấn/ha)

Lứa
trồng (cm) Chất xanh Chất khô Proteinthô
1 20 x 50 c 26,58 a 6,26 a 0,5
30 x 50 21,13 ab 5,00 ab 0,41
40 x 50 16,64 b 4,50 b 0,36
50 x 50 17,55 b 4,05 b 0,32
P * * ns
2 20 x 50 25,86 a 5,36 a 0,54
30 x 50 24,60 a 5,53 a 0,6
40 x 50 22,38 ab 4,77 ab 0,49
50 x 50 20,07 b 4,73 b 0,5
P * * ns
3 20 x 50 26,11 5,64 0,62
30 x 50 25,66 5,18 0,54
40 x 50 25,05 5,2 0,52
50 x 50 22,07 4,61 0,49
P ns ns ns
Ghi chú: ns: không có sự khác biệt có ý nghĩa (P>0,05); *: khác biệt có ý nghĩa (P<0,05)
Mục đích của việc thâm canh đồng cỏ là đạt được năng suất cao trên cùng một đơn vị diện
tích. Trong cùng điều kiện như nhau, khoảng cách trồng có ảnh hưởng đến năng suất chất
xanh, mỗi loại cây trồng thì có khoảng cách trồng phù hợp nhất định, giữa các loại cây trồng
thì khoảng cách này thường không giống nhau. Khi cây trồng được trồng với khoảng cách
thích hợp, cây trồng sẽ nhận được đầy đủ các yếu tố như dưỡng chất, ánh sáng,… từ đó có thể
cho năng suất tối đa.
Đối với cỏ Paspalum trồng trong điều kiện ngập nước ngoài đồng thì khoảng cách trồng 20 x
50 cm là khoảng cách trồng tỏ ra thích hợp nhất và đều cho năng suất cao nhất sau ba lứa thu
hoạch. Tổng năng suất cỏ qua 3 lần thu hoạch 78,55 tấn/ha. Ước tính mỗi năm thu hoạch 7
lứa, như vậy tổng sản lượng đạt được là 183 tấn/năm. Mặc dù trồng trong điều kiện ngập nước
nhưng chúng ta thấy rằng năng suất cỏ Paspalum vẫn cho năng suất tương đương với năng
suất cỏ Paspalum trồng trên cạn được chăm sóc tốt như năng suất chất tươi trong thí nghiệm
87
của Nguyễn Tường Cát (2005), 200 tấn/ha/năm; Nguyễn Thị Mùi và ctv (2005) là 179 tấn/ha
và Nguyễn Văn Phú (2006) là 110 tấn/ha/năm.
Các loại thức ăn xanh để đánh giá chính xác giá trị dinh dưỡng người ta thường dựa vào năng
suất chất khô hơn là năng suất chất xanh. Năng suất chất khô trung bình qua 3 lứa cao nhất ở
nghiệm thức trồng với khoảng cách 20 x 50 cm (5,75 tấn/ha); kế đến nghiệm thức trồng với
khoảng cách 30 x 50 cm (5,24 tấn/ha); nghiệm thức trồng với khoảng cách 40 x 50 cm (4,82
tấn/ha) và thấp nhất là nghiệm thức trồng với khoảng cách 50 x 50 cm (4,46 tấn/ha). Cũng
tương tự như năng suất chất xanh, năng suất chất khô thu được cũng giảm dần theo khoảng
cách trồng và khoảng cách trồng 20 x 50 cm cũng được xem là khoảng cách trồng hiệu quả
nhất. Với khoảng cách trồng 20 x 50 cm thì năng suất chất khô đạt được khoảng 40,3 tấn chất
khô/ha/năm (ước tính thu hoạch 7 lần/năm).
Năng suất protein thô của cỏ Paspalum ở cả 3 lứa có khuynh hướng giảm dần theo khoảng
cách trồng, tuy nhiên sự chênh lệch không khác biệt có ý nghĩa thống kê. Như vậy trong điều
kiện ngập nước ngoài đồng thì khoảng cách trồng không ảnh hưởng đến năng suất protein thô
của cỏ Paspalum. Nếu tính bình quân thu hoạch 7 lứa/năm thì năng suất protein thô đạt được
trung bình khoảng 3,88 tấn/ha/năm.
Tóm lại, qua kết quả về năng suất cỏ Paspalum thu được chúng tôi thấy rằng cỏ Paspalum
trồng trong điều kiện ngập nước vẫn đạt được năng suất chất xanh, năng suất chất khô và
protein thô tương đương với các thí nghiệm khi trồng trên cạn, điều này cho thấy cỏ Paspalum
atratum là giống cỏ có khả năng chịu ngập tốt.
Ảnh hưởng của khoảng cách trồng đến giá trị dinh dưỡng của cỏ Paspalum
Giá trị dinh dưỡng của cỏ Paspalum phân tích được giữa các nghiệm thức không có sự khác
biệt có ý nghĩa. Chứng tỏ trong điều kiện ngập nước ngoài ruộng khoảng cách trồng không
ảnh hưởng đến giá trị dinh dưỡng của cỏ Paspalum. Giá trị dinh dưỡng của cỏ Paspalum phân
tích đuợc cụ thể như sau:
Tỷ lệ vật chất khô của cỏ Paspalum trung bình ở lứa thứ nhất là 24,3%, nhưng sang lứa thứ 2
và lứa thứ 3 thì vật chất khô giảm xuống. Ở lứa thứ 2 tỷ lệ vật chất khô trung bình khoảng
21,7% và đến lứa thứ 3 thì tỷ lệ vật chất khô còn 20,9%. Tỷ lệ vật chất khô ở lứa đầu cao là do
chúng tôi thu hoạch chậm 60 ngày sau khi trồng trong khi 2 lứa tiếp theo thu hoạch lúc 45
ngày.
Hàm lượng protein thô trung bình thu được qua 3 lứa ở khoảng cách trồng 20 x 50 cm là
10,4%, so với thí nghiệm của chúng tôi tiến hành trong chậu thì kết quả ở thí nghiệm ngoài
đồng cao hơn rất nhiều, hơn gấp đôi (10,4% so với 4,3%), giá trị này cũng phù hợp với ghi
nhận của Barcellos (1997), hàm lượng protein thô của cỏ Paspalum nằm trong khoảng từ 6 –
12%. Kết quả này cũng tương đương với kết quả thí nghiệm về cỏ Paspalum bố trí trên cạn
như: kết quả protein thô thu được trong thí nghiệm của Dương Hoàng Phúc (2004) là 11,56%,
kết quả protein thô qua phân tích của Nguyễn Thị Mộng Nhi (2006) là 8,02%.
Hàm lượng xơ thô ở các nghiệm thức thí nghiệm không chênh lệch nhau nhiều và ở cả 3 lứa
cắt hàm lượng xơ thô ở các nghiệm thức cũng tương đương nhau. Giá trị xơ thô trung bình
của ba lứa cắt lần lượt là: lứa 1 (30,42%), lứa 2 (29,56%) và lứa 3 (29,11%). So sánh với hàm
lượng xơ thô phân tích được trong thí nghiệm của các nghiên cứu trước thì hàm lượng xơ thô
trong thí nghiệm của chúng tôi cao hơn bởi vì thời gian thu hoạch của chúng tôi chậm hơn 60
ngày sau khi trồng ở lứa 1 và 45 ngày sau khi cắt lứa thứ nhất ở 2 lứa tái sinh tiếp theo.
88
Tỷ lệ tiêu hóa in vitro trung bình ở lứa thứ nhất là 51,36%, lứa thứ 2 là 56,79 % và lứa thứ 3
là 56,41%. Tóm lại qua 3 lứa thu hoạch thì tỉ lệ tiêu hóa in vitro trong tất cả các nghiệm thức
đều cao hơn 45%, do đó cỏ Paspalum có thể sử dụng làm thức ăn thô xanh cho gia súc nhai
lại. Thức ăn có tỷ lệ tiêu hóa in vitro (≥ 45%) thì có thể sử dụng làm thức ăn xanh cho gia súc.
Kết quả trong bảng 5 cho thấy tỷ lệ tiêu hóa in vitro thu được ở lứa 1, lứa 2 và lứa thứ 3 không
chênh lệch nhau nhiều.
Bảng 5. Ảnh hưởng của khoảng cách trồng đến giá trị dinh dưỡng của cỏ Paspalum
% Vật chất khô

khoảng cách VCK
Lứa Tiêu hoá in
trồng (%) CP CF Tro ADF NDF
vitro
20 x 50 cm 23,67 9,13 31,47 9,71 37,75 72,57 50,11
30 x 50 cm 23,67 9,21 31,62 9,22 40,04 77,23 50,86
1 40 x 50 cm 24,33 7,95 29,90 8,23 39,71 75,67 51,76

50 x 50 cm 25,67 8,09 28,67 7,96 40,30 76,36 52,70
Trung bình 24,34 8,60 30,42 8,78 39,45 75,46 51,36
20 x 50 cm 20,71 10,90 29,03 6,35 32,87 69,03 57,54

30 x 50 cm 22,46 11,77 28,96 4,75 32,73 68,70 57,18
2 40 x 50 cm 20,89 11,13 30,51 5,34 33,12 68,73 55,22

50 x 50 cm 22,86 11,38 29,74 5,05 31,86 69,88 57,21
Trung bình 21,7 11,30 29,56 5,37 32,65 69,09 56,79
20 x 50 cm 19,83 11,85 30,13 6,90 32,85 67,31 56,02

30 x 50 cm 21,96 11,20 29,14 5,01 32,21 66,21 55,53
3 40 x 50 cm 20,89 10,89 28,41 5,31 30,40 67,59 54,68
50 x 50 cm 20,89 11,41 28,77 6,15 31,38 64,87 59,40
Trung bình 20,9 11,34 29,11 5,84 31,71 66,50 56,41
KẾT LUẬN VÀ ĐỀ NGHỊ

Kết luận
Khoảng cách trồng có ảnh hưởng đến chiều cao cây, sự hình thành chồi, hàm lượng oxy hòa
tan. Trong bốn khoảng cách trồng này, khoảng cách 20 x 50 cm có năng suất chất khô, năng
suất chất xanh cao nhất. Giá trị dinh dưỡng phân tích ghi nhận được ở khoảng cách trồng này
không thay đổi so với các nghiệm thức còn lại.
89
Cỏ Paspalum atratum là giống cỏ còn khá mới ở nước ta, bước đầu cho thấy cỏ Paspalum là
giống cỏ có nhiều triển vọng, có khả năng thích nghi và phát triển tốt trong điều kiện ngập
nước.
Đề nghị
Tiếp tục nghiên cứu ở những vùng đất khác như: đất phèn, đất nhiễm mặn để có số liệu phong
phú hơn về loài cỏ này.

Nguyễn Tường Cát (2005), Khảo sát khả năng sinh trưởng và tính năng sản xuất của cỏ sả, cỏ voi và cỏ
Paspalum atratum, Luận văn tốt nghiệp đại học, Khoa Nông Nghiệp & SHƯD, Đại học Cần Thơ.
Lê Văn Hòa (2005), Bài giảng thực tập Sinh Lý Stress, Bộ môn Sinh lý- Sinh hoá, Khoa Nông Nghiệp, Đại học
Cần Thơ, Tài liệu lưu hành nội bộ.
Nguyễn Thị Mùi, Nguyễn Văn Lợi, Đặng Đình Hanh và Lê Hòa Bình (2005), Kết quả ứng dụng mô hình thâm
canh, xen canh cỏ hòa thảo, cỏ đậu trong hệ thống canh tác phục lứa nuôi bò thịt trong nông hộ ở tỉnh
Thái Nguyên, Trang Khoa học công nghệ nông nghiệp và phát triển nông thôn 20 năm đổi mới, Tập 2,
Chăn nuôi thú y, Nhà xuất bản chính trị quốc gia Hà Nội. Trang 347 - 353.
Nguyễn Thị Mộng Nhi (2006), Xác định thành phần hoá học, giá trị dinh dưỡng của một số giống cỏ và đậu
trồng thí nghiệm tại Thành phố Cần Thơ, Luận văn tốt nghiệp đại học, Khoa Nông Nghiệp & SHƯD,
Đại Học Cần Thơ.
Nguyễn Văn Phú (2006), Khảo sát ảnh hưởng của khoảng cách và phân bón lên đặc tính sinh trưởng, năng suất
và giá trị dinh dưỡng của Paspalum atratum, LVTN ĐHCT.
Dương Hoàng Phúc (2004), Khảo sát đặc tính sinh trưởng và tính năng sản xuất của cỏ Paspalum atratum và đậu
Macroptilium gracile, Luận văn tốt nghiệp, Đại học Cần Thơ.
Ponnamperuma, F. N. (1964), Hóa học của đất ngập nước và mối quan hệ sinh trưởng với lúa, Bản tiếng Việt,
Nhà xuất bản Khoa Học.
AOAC (2001), Official methods of analysis, Association of official Analytical chemists, Washington D.C, Page
255- 275.
Armstrong, W. (1971), Radial oxygen losses from intact rice roots as affected dy distance from the apex,
respiration and waterlogging, Plant physiol 25:192 - 197.
Barcellos, A.O., Pizarro, E.A. and Costa, N.L. (1997), Agronomic evaluation of novel germplasm under grazing:
Arachis pintoi BRA-031143 and Paspalum atratum BRA-009610, Proceedings XVII International
Grassland conggress Vol.2:22 -47-48.
Goering, R.J. and Van Soest P.J. (1970), Forage fiber analysis (apparatus reagent and some application), USDA
Agriculture, Handbook, No. 397, National academic, Washington DC. pp.1-19.
Jaskson, M.B. and Drew, M.C. (1984), Effects of flooding on growth and metabolism of herbaceous plant, pp.
47-128. In: T.T. Kozlowski, Flooding and plant growth, Academic Press, Orlando, Florida.
Krame, P. J. (1988), Water relations of plant, Pp. 157 – 186 and 258 – 259.
Tsukarahara H., and Kozlowski, T.T. (1986), Effect of flooding and temperature regime on growth and stomatal
resistance of Betula platyphylla var. Japonica seeding, Plant and soil. 92: 103 - 112.
Van Soest, P.J; Robertson, J. B. and Lewis, B. A. (1991), Carbohydrate methodology, metabolism and nutritional
implications in dairy cattle: methods for diatary fibre, and nonstarch polysaccharides in relation to
animal nutrition, J. Dairy sci. 74: 3585 - 3597.
Người phản biện: TS: Lê Xuân Đông và TS. Nguyễn Ngọc Anh.
90
PHÂN TÍCH SỰ TƯƠNG QUAN GIỮA CÁC ðỒNG PHÂN CHUỖI NẶNG
MYOSIN ðẾN CHẤT LƯỢNG THỊT LỢN MÓNG CÁI
Nguyễn Trọng Ngữ
Khoa nông nghiệp và sinh học ứng dụng, Trường ðại học Cần Thơ
Ngày nhận bài 15-11-2011 / Ngày sửa bài 5-12-2011 / Ngày ñồng ý ñăng bài 15-12-2011
TÓM TẮT
Nghiên cứu ñược tiến hành với mục tiêu (i) xác ñịnh thành phần các ñồng phân chuỗi nặng
myosin (MyHC) trên cơ thăn của lợn Móng Cái và (ii) thiết lập mối tương quan giữa các ñồng
MyHC với nhau và với các chỉ tiêu chất lượng thịt. Mẫu cơ thăn của 30 lợn Móng Cái ñược thu
thập ñể ñánh giá biểu hiện mRNA của ñồng phân MyHC I, IIa, IIx, IIb bằng real time RT-PCR.
ðồng thời, ñặc ñiểm chất lượng thịt của những lợn này cũng ñược ghi nhận. Kết quả cho thấy, có
mối tương quan âm giữa phần trăm sợi I với phần trăm sợi IIx (r = -0,701) và phần trăm sợi IIa với
phần trăm sợi IIb (r = -0,704) và mối tương quan dương giữa tỷ lệ phần trăm của sợi IIx ñến ñộ rỉ
nước 24 giờ (r = 0,358). Tuy nhiên, không tìm thấy sự tương quan giữa các ñồng phân MyHC và
các chỉ tiêu chất lượng thịt khác. Kết quả của nghiên cứu cung cấp một số bằng chứng về sự ảnh
hưởng của các ñồng phân MyHC ñến các chỉ tiêu chất lượng thịt nhằm phục vụ cho công tác lai tạo
và chọn giống ở lợn Móng Cái.
Từ khóa: Chuỗi nặng myosin (MyHC), tương quan, chất lượng thịt, lợn Móng Cái
với mùi vị của thịt [7]. Ngoài ra, Kang et al.
1. ðẶT VẤN ðỀ
[8] cũng chứng minh ñược mối tương quan
Chất lượng thịt là tính trạng kinh tế quan dương giữa sợi MyHC I với pH 24 giờ và
trọng trong chăn nuôi lợn, nó ñược quy ñịnh tương quan âm với tỉ lệ rỉ dịch.
bởi nhiều yếu tố, trong ñó thành phần sợi cơ
là một trong những yếu tố chính [1].Trong Ở Việt Nam, các giống lợn ñịa phương
những năm qua, ñã có nhiều nghiên cứu rất phong phú, chúng ñược phân bố rộng
chứng minh mối liên quan giữa chất lượng khắp các vùng sinh thái. Trong số ñó, giống
thịt và những ñặc tính của cơ trên các giống lợn Móng Cái là giống lợn bản ñịa có khả
lợn khác nhau [2, 3]. Theo Kim et al. [1], cơ năng thích nghi cao với ñiều kiện khí hậu và
của ñộng vật có vú sau khi sinh bao gồm tập quán chăn nuôi của người dân ñịa
bốn loại sợi: sợi oxy hóa (loại I), sợi thủy phương, có khả năng sử dụng tốt các loại
phân (loại IIb) và sợi trung gian (loại IIa và thức ăn thô nghèo dinh dưỡng, tính chống
IIx). Mỗi loại sợi cơ có ñặc tính sinh hóa chịu bệnh tật tốt, ñặc biệt là có thịt mềm và
khác nhau, vì vậy thành phần loại sợi cơ có thơm ngon (Nguyễn Văn ðức, 2005).
Nghiên cứu này ñược thực hiện nhằm xác
ảnh hưởng ñến màu sắc, pH và ñộ mềm của
thịt. Thật vậy, sau khi giết mổ sự thủy phân ñịnh thành phần sợi cơ và thiết lập mối
của sợi IIb diễn ra cao hơn sợi I và những tương quan giữa các ñồng phân MyHC ñến
cơ có phần trăm sợi IIb cao thì pH sẽ giảm các chỉ tiêu chất lượng thịt ở lợn Móng Cái,
nhanh [4]. Bên cạnh ñó, sợi cơ loại I chứa qua ñó cung cấp thêm những dữ liệu cần
nhiều lipid hơn sợi IIb do ñó cũng góp phần thiết cho quá trình lai tạo và chọn giống.
làm tăng mùi vị của thịt [5]. Các nghiên cứu 2. VẬT LIỆU VÀ PHƯƠNG PHÁP
gần ñây cho thấy có sự tương quan giữa NGHIÊN CỨU
thành phần các ñồng phân chuỗi nặng
2.1. Gia súc thí nghiệm
myosin và chất lượng thịt như sự tương
quan dương giữa sợi IIb với ñộ sáng và ñộ rỉ Thí nghiệm ñược tiến hành trên 30 cá
dịch [6] hay sự tương quan âm giữa sợi IIb thể lợn Móng Cái với trọng lượng sống 33,8

± 6 kg ở ñộ tuổi 215 ± 16 ngày (mẫu thu h sau khi giết mổ bằng máy pH cầm tay (pH
thập tại trại lợn giống Móng Cái thuần 630, Jenco Electronics Inc, Taiwan). ðộ rỉ
thuộc công ty cổ phần giống vật nuôi và cây dịch 24 giờ và 48 giờ ñược xác ñịnh theo
trồng ðông Triều - Quảng Ninh). Các cá thể phương pháp túi của Honikel [12]. ðể tính
lợn ñược nuôi với cùng chế ñộ dinh dưỡng tỷ lệ hao hụt sau khi nấu, lấy 40 g thịt thăn
và ñiều kiện chăm sóc như nhau. cho vào nước ñun ở nhiệt ñộ 75oC trong 30
phút, sau ñó cân lại khối lượng và tính phần
2.2. Phương pháp nghiên cứu
trăm hao hụt. ðộ dai của thịt ñược xác ñịnh
Mẫu cơ thăn ngoại ñược thu thập từ 30 qua máy TA–XT2i (Texture Analyzer
lợn Móng Cái, lấy khoảng 2 g cho vào tube Specifications), mẫu cơ thăn ñược nấu ở
2ml có chứa 0,4 ml RNA-later sau ñó trữ 70oC trong 30 phút, sau ñó cắt miếng thịt
lạnh ở -4oC và mang về phòng thí nghiệm thành những viên hình lập phương có cạnh
trữ ở -80oC. RNA tổng số ñược phân lập từ 1 cm, mỗi mẫu lập lại 4 - 6 lần. Glucose
cơ thăn bằng cách sử dụng Trizol pH8 trong máu ñược ño bằng máy ño glucose SD
(Invitrogen, Karlsruhe, Germany) và thực CodeFree (Standard diagnostics, INC,
hiện theo quy trình ly trích của Invitrogen. Korea). Vật chất khô (VCK), protein thô
Sau ñó, RNA ñược làm sạch bằng cách sử (CP), béo thô (EE), khoáng tổng số theo qui
dụng PurelinkTM RNA mini kit (Qiagen). trình của AOAC (1998) [13].
Mẫu RNA sau khi tinh sạch ñược tổng hợp
Các số liệu ñược xử lý bằng phần mềm
thành cDNA bằng cách sử dụng bộ Kit High
thống kê Minitab 13.20.
Capacity RNA to cDNA (Applied
Biosystems). Cuối cùng thành phần các 3. KẾT QUẢ VÀ THẢO LUẬN
ñồng phân MyHC ñược xác ñịnh trên mẫu
3.1. Sự biểu hiện của ñồng phân MyHC
cDNA thông qua phương pháp realtime RT-
PCR [9]. Sự biểu hiện các ñồng phân MyHC Khảo sát sự biểu hiện của các ñồng phân
ñược tính toán theo công thức 2-,,Ct của MyHC I, IIa, IIx và IIb ở lợn Móng Cái
Livak [10] và Guo et al. [11]. ñược thực hiện bằng phương pháp real time
RT-PCR với những cặp primer ñặc hiệu cho
Màu sắc thịt ñược ñánh giá bằng máy ño
từng loại sợi cơ. Kết quả sự biểu hiện của
màu Minolta thông qua 3 giá trị L*, a* và các ñồng phân myosin ñược thể hiện ở Biểu
b* tương ứng trong không gian màu
ñồ 1.
CIELAB. pH ñược ño ở thời ñiểm 1 h và 24
%
50
40
30
20 38.5
23.2 26.7
10
11.6
0
Biểu ñồ 1. Thành phần sợi cơ trên cơ thăn của lợn Móng Cái
Biểu ñồ 1 cho thấy sự biểu hiện các và sợi IIx là cao nhất (38,5%). Sự biểu hiện
ñồng phân MyHC trên cơ thăn ở giống lợn của MyHC I trong cơ thăn của lợn Móng
Móng Cái là khác nhau (P < 0,01). Trong ñó, Cái cao hơn sự biểu hiện của MyHC IIb, vì
sự biểu hiện của sợi IIb là thấp nhất (11,6%) vậy cơ thăn của lợn Móng Cái thể hiện một

sự trao ñổi chất thủy phân ít hơn và oxy hóa hơn và sợi oxy hóa (MyHC I) thấp hơn dẫn
nhiều hơn. Kết quả của thí nghiệm hiện tại tới hoạt ñộng thủy phân nhiều hơn và tốc ñộ
cũng chỉ ra rằng thành phần sợi IIx và IIb ở tăng trưởng cao hơn.
giống lợn Móng Cái (50,1%) thấp hơn một
3.2. Các chỉ tiêu chất lượng thịt của lợn
số giống lợn ñịa phương khác chẳng hạn
Móng Cái
như lợn Berkshire (94,1%) [8], Meishan
(78,2%) [14], Tamworth (80,8%) [15]. Nếu Giá trị pH 1 giờ hay 45 phút sau khi giết
xét riêng về sợi IIb và IIx, nhận thấy phần mổ là một yếu tố của chất lượng thịt lợn
trăm sợi IIb ở lợn Meishan gần như tương thường ñược dùng ñể phân loại thịt cho quá
ñương với lợn Móng Cái (17,1% và 11,6%) trình xử lý sau khi giết mổ [18]. Giá trị pH
[14] nhưng ở lợn Meishan sợi IIx biểu hiện của thịt lợn Móng Cái thí nghiệm ñược trình
cao nhất (61,1%) trong khi ở lợn Móng Cái bày qua Bảng 1. Theo PIC [19] thịt lợn bình
ñóng góp của sợi IIx trong tổng các ñồng thường khi giá trị pH ban ñầu khoảng 6,7
phân là 38,5%. Trái ngược với giống lợn ñến 6,3 và pH sau 24 giờ khoảng 6,1 ñến
Móng Cái, theo Ruusunen và Puolanne [16], 5,7. Theo như nhận ñịnh trên thì thịt lợn
thành phần của sợi IIb ở giống lợn thương Móng Cái nằm trong giới hạn thịt tốt. So
phẩm cao hơn các sợi còn lại. như trên lợn sánh với kết quả của Hau (2008) khi nghiên
Duroc (52,6%) [15], Pietrain (85,2%) [17], cứu trên giống lợn Móng Cái ở Sơn La cho
Large White (62,9%) [14]. ðiều này cho thấy pH 1 giờ là 6,7, tương ñương với lợn
thấy, việc tập trung lựa chọn cho sự phát Móng Cái thí nghiệm, riêng giá trị pH 24
triển cơ ở lợn thương phẩm ñã dẫn ñến sự giờ của lợn Móng Cái ở Sơn La thì thấp hơn
thay ñổi thành phần của sợi cơ, cụ thể là (5,7).
phần trăm sợi thủy phân (MyHC IIb) cao
Bảng 1. Trung bình và ñộ lệch chuẩn của các tính trạng ño ñạc (n = 30)
Chỉ tiêu Trung bình ðộ lệch chuẩn
ðặc ñiểm chất lượng thịt

pH 1 giờ 6,69 0,18
pH 24 giờ 6,09 0,18
ðộ rỉ dịch 24 giờ (%) 2,1 1,0
ðộ rỉ dịch 48 giờ (%) 2,8 1,2
Hao hụt khi nấu (%) 24,4 4,5
ðộ dai (kg) 5,0 2,1
Màu sắc
L* (ñộ sáng) 49,5 1,7
a* (ñộ ñỏ) 5,8 2,9
b* (ñộ vàng) 8,0 1,3
Giá trị dinh dưỡng
Vật chất khô (%) 25,9 1,4
Protein thô (%) 22,5 1,1
Béo thô (%) 2,7 0,6
Chất hữu cơ (%) 98,9 0,3

Khả năng giữ nước cũng là một yếu tố quan thịt là một trong những ñặc tính cấu trúc
trọng ñể ñánh giá chất lượng thịt lợn, nó quan trọng ảnh hưởng ñến chất lượng ăn của
ñược thể hiện qua ñộ rỉ dịch của thịt trong thịt lợn. Kết quả về ñộ dai của thịt trong thí
quá trình bảo quản và chế biến. Dựa theo ñộ nghiệm hiện tại cao hơn giống lợn
rỉ dịch của cơ thăn sau 24 giờ Lengerken và Hampshire (4,5 kg) nhưng thấp hơn các
Pfeiffer [20] phân loại chất lượng thịt thành giống lợn khác như Large White (5,4 kg),
các loại như sau: ñộ rỉ dịch 2-5%: thịt bình Berkshire (5,7 kg) và Duroc (6,0 kg) [15].
thường; ñộ rỉ dịch <1%: thịt DFD (sậm màu,
3.3. Hệ số tương quan tương quan giữa các
khô, cứng); ñộ rỉ dịch >5%: thịt PSE (nhạt
ñồng phân MyHC
màu, nhão, rỉ nước). ðộ rỉ dịch 24 và 48 giờ
ở lợn Móng Cái thể hiện ở Bảng 1 là 2,1% Mối tương quan giữa các thành phần của
và 2,8%. Theo tiêu chuẩn trên, lợn thí sợi myosin ñược thể hiện ở Bảng 2. Kết quả
nghiệm có ñộ rỉ dịch nằm trong khoảng bình cho thấy mối tương quan âm rất có ý nghĩa
thường, tuy nhiên kết quả này thấp hơn thống kê (P < 0,001) giữa phần trăm sợi cơ I
nghiên cứu của Hau [21] với ñộ rỉ dịch trên và sợi cơ IIx (r = -0,701). Depreux et al. [25]
giống lợn Móng Cái ở Sơn La là 3,8%. khi nghiên cứu trên lợn mang gen Halothane
cũng cho kết quả tương tự. Bên cạnh ñó, kết
Màu sắc của thịt phụ thuộc vào nồng ñộ quả cũng cho thấy mối tương quan âm chặt
sắc tố và các ñặc tính phản xạ ánh sáng của chẽ (P < 0.001) giữa các ñồng phân MyHC
thịt. Dựa vào chỉ số L* (ñộ sáng), Kuo và IIa với MyHC IIb (r = -0,704). Báo cáo của
Chu [22] chia thịt thành 3 loại: L* > 50: thịt Larzul et al. [26] trên giống lợn thuần Large
PSE, L* = 50-37: thịt bình thường, L* < 37: White cũng thể hiện sự tương quan âm tính
thịt DFD. Kết quả phân tích về các chỉ tiêu giữa sợi IIb và IIa (r = −0,94). Ngoài ra, kết
màu sắc thịt ở Bảng 1 cho thấy giá trị L* quả này cũng phù hợp với nghiên cứu của
nằm trong giá trị tốt (49,2). Trên giống lợn Kim et al. [1] trên ba giống lợn (Yorkshire,
lai 3 máu Landrace × (Yorkshire × Móng Landrace và Meishan) (r = -0,75). Các kết quả
Cái) cũng cho kết quả tương tự (L*: 47,9; trên cũng phù hợp với nhận ñịnh rằng sự biểu
a*: 5,7; b*: 9,0) [23]. hiện của mỗi loại ñồng phân MyHC có thể bị
Theo Warriss [24], cấu trúc là một trong ảnh hưởng bởi yếu tố giống, trong ñó khi một
những yếu tố quan trọng ảnh hưởng ñến ñồng phân này giảm sẽ ñược cân bằng bởi sự
chất lượng thịt, có ba yếu tố chính ảnh gia tăng của một ñồng phân khác và sự
hưởng ñến cấu trúc của thịt là chiều dài của chuyển ñổi giữa các sợi cơ dưới ñiều kiện
cơ, số lượng mô liên kết và mức ñộ liên kết sinh lý bình thường theo thứ tự I←→IIa
của chúng, và mức ñộ thủy phân protein xảy ←→IIx←→IIb [27].
ra trong suốt quá trình giết mổ. ðộ dai của
Bảng 2. Sự tương quan giữa các ñồng phân MyHC
Sợi cơ MyHC IIa MyHC IIx MyHC IIb

***
MyHC I -0,334 -0,701 0,235
MyHC IIa -0,294 -0,704***
MyHC IIx -0,107
***
: P <0,001
ñiểm này thay ñổi tùy theo giống [26]. Ở
3.4. Mối tương quan giữa sợi cơ và chất
giống lợn Móng Cái, sự tương quan giữa các
lượng thịt trên lợn Móng Cái
ñồng phân MyHC ñến các chỉ tiêu pH, màu
Mỗi loại sợi có những ñặc tính sinh hóa sắc, hàm lượng mỡ trong cơ, ñộ rỉ dịch 48 giờ,
khác nhau và thành phần của sợi cơ ñược cho ñộ dai và các thành phần hóa học của cơ thể
là có tương quan ñến chất lượng thịt và ñặc
hiện không có ý nghĩa thống kê (P > 0,05) (Yorkshire x Landrace) cho thấy việc gia tăng
(Bảng 3). Tuy nhiên, có sự tương quan dương tỉ lệ phần trăm của sợi IIb và giảm tỉ lệ phần
(P ≤ 0,05) giữa sợi IIx với ñộ rỉ dịch 24 giờ. trăm của sợi I và IIa sẽ làm gia tăng ñộ rỉ dịch
Sợi IIx là sợi trung gian nằm giữa sợi ñỏ và ảnh hưởng xấu ñến chất lượng thịt. Theo Ruy
sợi trắng, vì vậy sợi IIx có cả hai khả năng và Kim [6], ở ñộng vật nuôi chứa phần trăm
oxy hóa và thủy phân [28]. Trong trường hợp sợi IIb cao thường thể hiện chất lượng thịt
này, có thể enzyme thủy phân ñã chuyển thấp. Kết quả thí nghiệm hiện tại cũng ngụ ý
glycogen thành acid lactic làm giảm pH và rằng cơ thăn của lợn Móng Cái chứa nhiều
dẫn ñến ñộ rỉ dịch gia tăng. Chang et al. [15] phospholipid và myoglobin hơn, thể hiện khả
kết luận rằng khả năng giữ nước tốt thường năng oxy hóa cao hơn và ñây cũng có thể một
tương quan dương với sự hiện diện của sợi trong những nguyên nhân hình thành chất
oxy hóa (IIa và IIx). Ryu và Kim [29] khi lượng thịt tốt trên lợn Móng Cái.
nghiên cứu trên giống lợn lai Duroc x
Bảng 3. Mối tương quan giữa sợi cơ và các ñặc ñiểm chất lượng thịt
Sợi cơ
Chỉ tiêu
pH 1giờ -0,107 -0,056 0,033 0,193
pH 24 giờ 0,023 -0,060 -0,083 0,198
*
ðộ rỉ dịch 24 giờ(%) -0,191 -0,184 0,358 0,005
ðộ rỉ dịch 48 giờ (%) -0,201 0,274 0,021 -0,199
Hao hụt khi nấu (%) 0,019 -0,224 0,027 0,302
L* -0,198 -0,002 0,086 0,152
a* 0,005 -0,094 0,060 0,053
b* -0,031 -0,031 0,044 0,026
ðộ dai (kg) 0,119 0,132 -0,156 -0,140
Vật chất khô (%) 0,235 -0,051 -0,103 -0,089
Protein thô (%) 0,032 -0,185 0,110 0,085
Chất hữu cơ (%) 0,120 -0,123 0,070 -0,082
*
: P < 0,05
Bên cạnh ñó qua Bảng 3 cũng chỉ ra máu ño tại thời ñiểm giết mổ. Trong các loại
khuynh hướng tương quan dương giữa ñồng sợi cơ khảo sát, thành phần của sợi MyHC IIb
phân MyHC IIb và chỉ tiêu hao hụt khi nấu (r thể hiện mối tương quan dương với hàm
= 0,302). Kết quả này cũng phù hợp với nhận lượng glucose (r = 0,46). ðiều này có thể
ñịnh của Ruy và Kim [29], theo ñó thành ñược giải thích là do ở ñộng vật hữu nhũ,
phần sợi IIb càng cao thì ñộ rỉ dịch càng cao nguồn glucose chính cho sự thủy phân là
glucose trong máu và glycogen dự trữ trong
và kết luận của Bulotiene và Jukna [30] rằng
thịt có ñộ rỉ dịch cao sẽ có xu hướng giảm cơ [31]. Sự tổng hợp glycogen có liên quan
trọng lượng sau khi nấu. ñến quá trình trao ñổi glucose trong cơ, do ñó
ñây là một chỉ số liên quan tới thành phần của
3.5. Mối tương quan giữa sợi cơ và hàm các sợi cơ [32]. Kết quả trong thí nghiệm hiện
lượng glucose trong máu tại cũng ủng hộ kết luận của Choe et al. [8]
Bảng 4 trình bày mối tương quan giữa trên giống lợn lai 3 máu Landrace x Yorkshire
thành phần sợi cơ và hàm lượng glucose trong x Duroc, theo ñó những cá thể với phần trăm

sợi IIb cao hơn thì lượng glucose trong máu IIa và IIb tương ứng là 9,6% - 12,1%; 12,6%
cao hơn, cụ thể khi nồng ñộ glucose thay ñổi - 14,5% và 73,4% - 77,8%.
từ thấp ñến cao thì thành phần sợi cơ loại I,
Bảng 4. Hệ số tương quan giữa thành phần sợi cơ và hàm lượng glucose
Hàm lượng glucose

Sợi cơ P-Value
(mg/dl)
MyHC I -0,09 0,623
MyHC IIa -0,09 0,636
MyHC IIx 0,04 0,821
MyHC IIb 0,46 0,064
Russo, Identification of SNPs, mapping

4. KẾT LUẬN
and analysis of allele frequencies in two
Trên cơ thăn của lợn Móng Cái, tìm thấy candidate genes for meat production
mối tương quan âm giữa sợi cơ MyHC I và traits: the porcine myosin heavy chain 2B
MyHC IIx (r = -0,701); MyHC IIa và MyHC (MYH4) and the skeletal muscle myosin
IIb (r = -0,704). regulatory light chain 2 (HUMMLC2B).
ðối với sự tương quan giữa các ñồng phân Animal genetics, 2003. 34(3): p. 221-225.
và chất lượng thịt, tồn tại mối tương quan 4. Monin, G. and A. Ouali, Muscle
dương giữa sợi IIx và ñộ rỉ dịch 24 giờ (r = differentiation and meat quality.
0,358) và mối tương quan dương giữa hàm Development in meat science. Vol. 5, R.
lượng glucose với sợi IIb (r = 0,46). A. Lawrie (Ed.). 1991, London: Elsevier
Tuy nhiên, không tìm thấy sự tương quan Applied Science.
giữa các ñồng phân MyHC và các chỉ tiêu
5. Alasnier, C., H. Remignon, and G.
chất lượng thịt khác.
Gandemer, Lipid characteristics
Có thể sử dụng kết quả về sự biểu hiện associated with oxidative and glycolytic
thành phần sợi cơ và sự tương quan giữa các fibres in rabbit muscles. Meat Science,
thành phần sợi cơ với các chỉ tiêu chất lượng 1996. 43(3-4): p. 213-224.
thịt ở lợn Móng Cái ñể làm cơ sở cho quá
trình lai tạo và chọn giống. 6. Ryu, Y.C. and B.C. Kim, Comparison of
histochemical characteristics in various
pork groups categorized by postmortem
TÀI LIỆU THAM KHẢO metabolic rate and pork quality. J Anim
1. Kim, N.K., J.H. Lim, M.J. Song, O.H. Kim, Sci, 2006. 84(4): p. 894-901.
B.Y. Park, M.J. Kim, I.H. Hwang, and C.S. 7. Taylor, R.G., Muscle fiber types and meat
Lee, Comparisons of longissimus muscle quality. Encyclopedia of meat sciences
metabolic enzymes and muscle fiber types in (pp. 876–882). 2004: Oxford, UK:
Korean and western pig breeds. Meat Elsevier.
Science, 2008. 78(4): p. 455-460.
8. Kang, Y.K., Y.M. Choi, S.H. Lee, J.H.
2. Huff-Lonergan, E., T.J. Baas, M. Malek, Choe, K.C. Hong, and B.C. Kim, Effects
J.C. Dekkers, K. Prusa, and M.F. of myosin heavy chain isoforms on meat
Rothschild, Correlations among selected quality, fatty acid composition, and
pork quality traits. J Anim Sci, 2002. sensory evaluation in Berkshire pigs.
80(3): p. 617-27. Meat science, 2011. 89(4): p. 384-389.
3. Davoli, R., L. Fontanesi, M. Cagnazzo, E.
Scotti, L. Buttazzoni, M. Yerle, and V.
9. Wimmers, K., N.T. Ngu, D.G.J. Jennen, D. 18. Kusec, G., G. Kralik, A. Petricevic, H.
Tesfaye, E. Murani, K. Schellander, and S. Gutzmirtl, and D. Grguric, Meat quality
Ponsuksili, Relationship between myosin indicators and their correlation in two
heavy chain isoform expression and crosses of pigs. Agriculturae Conspectus
muscling in several diverse pig breeds. J. Scientificus, 2003. 68(2): p. 115-119.
Anim Sci., 2008. 86(4): p. 795-803.
19. PIC, Meat quality - Understanding
10. Livak, K.J. and T.D. Schmittgen, Analysis Industry Measurements and Guidelines.
of relative gene expression data using PIC Technical Update, 2003.
real-time quantitative PCR and the 2-
20. Lengerken, G.V. and H. Pfeiffer, Stand
[Delta][Delta] CT method. Methods,
und Entwicklungstendezen der
2001. 25(4): p. 402-408.
Anwendung von Methoden zur Erkennung
11.Guo, J., T. Shan, T. Wu, L.N. Zhu, Y. Ren, der Stressempfindlichkeit und
S. An, and Y. Wang, Comparisons of Fleischqualitaet beim Schwein. Inter-
different muscle metabolic enzymes and Symp. Zur Schweinezucht, Leipzig, 1987:
muscle fiber types in Jinhua and Landrace p. 1972-1979.
pigs. Journal of Animal Science. 89(1): p.
21. Hau, N.V., On farm performance of
185-191.
Vietnamese ig breeds and its relation to
12. Honikel, K.O., Reference methods for the candidate genes. 2008: Cuvillier.
assessment of physical characteristics of
22. Kuo, C.C. and C.Y. Chu, Quality
meat. Meat Science, 1998. 49(4): p. 447-457.
characteristics of Chinese sausages made
13.AOAC, Official Methods of Analysis 16th ed. . from PSE pork. Meat science, 2003.
Assoc. Anal. Chem., Arlington, VA., 1998. 64(4): p. 441-449.
14. Lefaucheur, L., D. Milan, P. Ecolan, and 23. Tôn, V.ð., P.V. Chung, and N.V. Duy,
C. Le Callennec, Myosin heavy chain Kết quả nuôi vỗ béo, chất lượng thân thịt
composition of different skeletal muscles và hiệu quả chăn nuôi lợn lai 3 giống
in Large White and Meishan pigs. J Anim Landrace × (Yorkshire × Móng Cái)
Sci, 2004. 82(7): p. 1931-41. trong ñiều kiện nông hộ. Tạp chí khoa học
15. Chang, K.C., N. da Costa, R. Blackley, O. và phát triển. Trường ðại Học Nông
Southwood, G. Evans, G. Plastow, J.D. Nghiệp I, 2008. VI(1): p. 56-61.
Wood, and R.I. Richardson, Relationships 24. Warriss, P.D., Meat Science An
of myosin heavy chain fibre types to meat Introductory Text. 2000: School of
quality traits in traditional and modern pigs. Veterinary Science University of Bristol
Meat Science, 2003. 64(1): p. 93-103. UK. CABI Publishing.
16. Ruusunen, M. and E. Puolanne, 25. Depreux, F.F.S., A.L. Grant, and D.E.
Histochemical properties of fibre types in Gerrard, Influence of halothane genotype
muscles of wild and domestic pigs and the and body-weight on myosin heavy chain
effect of growth rate on muscle fibre composition in pig muscle as related to
properties. Meat Science, 2004. 67(3): p. meat quality. Livestock Production
533-539. Science, 2002. 73(2-3): p. 265-273.
17. Müller, E., M. Rutten, G. Moser, G. 26. Larzul, C., L. Lefaucheur, P. Ecolan, J.
Reiner, H. Bartenschlager, and H. Gogue, A. Talmant, P. Sellier, P. Le Roy,
Geldermann, Fibre structure and and G. Monin, Phenotypic and genetic
metabolites in M. longissimus dorsi of parameters for longissimus muscle fiber
Wild Boar, Pietrain and Meishan pigs as characteristics in relation to growth,
well as their crossbred generations. carcass, and meat quality traits in large
Journal of Animal Breeding and Genetics, white pigs. J Anim Sci, 1997. 75(12): p.
2002. 119(2): p. 125-137. 3126-37.

27. Lefaucheur, L., P. Ecolan, L. Plantard, 30. Bulotiene, G. and V. Jukna, The influence
and N. Gueguen, New insights into muscle of muscle fiber area on pork quality.
fiber types in the pig. Journal of Veterinarija ir Zootechnika, 208. 42: p.
Histochemistry & Cytochemistry, 2002. 34-37.
50(5): p. 719-730.
31. Poso, A.R. and E. Puolanne,
28. Dubowitz, V. and A.G. Pearse, Reciprocal Carbohydrate metabolism in meat
relationship of phosphorylase and animals. Meat science, 2005. 70(3): p.
oxidative enzymes in skeletal muscle. 423-434.
Nature, 1960. 185: p. 701. 32. Gunawan, A.M., S.K. Park, J.M. Pleitner,
29. Ryu, Y.C. and B.C. Kim, The relationship L. Feliciano, A.L. Grant, and D.E. Gerrard,
between muscle fiber characteristics, Contractile protein content reflects
postmortem metabolic rate, and meat myosin heavy-chain isoform gene
quality of pig longissimus dorsi muscle. expression. J Anim Sci, 2007. 85(5): p.
Meat Science, 2005. 71(2): p. 351-357. 1247-56.
SUMMARY
CORRELATION ANALYSIS BETWEEN MYOSIN HEAVY CHAIN
ISOFORMS AND MEAT QUALITY TRAITS OF MONG CAI PIGS
Nguyen Trong Ngu
College of Agriculture and Applied Biology, Cantho University, Vietnam
The study was conducted with the aim to (i) determine the composition of myosin heavy
chain isoform (MyHC) in Longissimus dorsi muscle of Mong Cai pigs and (ii) establish correlations
among MyHC compositions and between the MyHC with meat quality traits. Muscle samples were
collected in 30 Mong Cai pigs to assess mRNA expression of MyHC isoforms I, IIa, IIx, IIb by real
time RT-PCR. Meat quality parameters of these pigs were additionally recorded. Among muscle
fiber types, negative correlations were found between MyHC I and IIx (r = -0.701) and MyHC IIa
and IIb (r = -0.704). In addition, MyHC IIx percentage was significantly correlated with driploss
24h (r = 0.358) but none of other correlations was found between muscle fiber composition and
other meat quality traits. The results yield information on the influence of MyHC isoforms to some
meat traits of interest that may serve for selection and breeding programs in Mong Cai pigs.
Keywords: Myosin Heavy Chain (MyHC), correlation, meat quality, Mong Cai
Lời cảm ơn
Công trình ñược hoàn thành với sự tài trợ của Quỹ phát triển khoa học và Công nghệ quốc gia
(NAFOSTED), mã số 106.06.62.09.
Người thẩm ñịnh: TS. ðỗ Võ Anh Khoa


Bai Bao KH 2001-2011 (01-20)

Uploaded by

Document Information

Original Description:

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Bai Bao KH 2001-2011 (01-20)

Uploaded by

Copyright:

Available Formats

Catalog

Not logged in.

Home About AJAS Registration Subscription E-Submission Article Search

Print ISSN : 1011-2367

Publication Schedule of AJAS (... [2012.12.05] Current Issue

ERRATUM (AJAS 22(1):107-112) [2009.09.30]

Retraction of a Published Pape... [2009.09.30]

Deletion of a published paper [2008.05.09]

PUBLICATION OFFICE Asian-Australasian Association of Animal Societies

Not logged in. Contact | Links

2010 2011 2012 2013

N. T. Yen, C. Tai, Y. S. Cheng, M. C. Huang

J. C. Ju, Y. C. Chang, W. T. Huang, P. C. Tang, S. P. Cheng

M. J. Lee, O. Han, K. Back, Y. J. Choi, M. G. Baik

M. S. Yahaya, A. Kibon, E. M. Aregheore, S. A. Abdulrazak, J. Takahashi, S. Matsuoka

M. S. Yahaya, A. Kibon, E. M. Aregheore, S. A. Abdulrazak, J. Takahashi, S. Matsuoka

Damry, J. V. Nolan, R. E. Bell, E. S. Thomson

Livestock Research for Rural

The international journal for research into

Published by Fundación CIPAV, Cali, Colombia

Volume 15, On-line Edition

Back to LRRD Home page

Pastoralists’ perception of livestock production systems and opportunities for improvement in

Effect of drenching with cooking oil on performance of

Materials and methods

The experiment lasted 90 days.

Photo 1. Local "Yellow" cattle consuming fresh cassava

Photo 3: Taking the rumen samples with a stomach

Results and discussion

Received 28 March; accepted 30 July 2003

Not logged in.

Home About AJAS Registration Subscription E-Submission Article Search

Print ISSN : 1011-2367

Publication Schedule of AJAS (... [2012.12.05] Current Issue

ERRATUM (AJAS 22(1):107-112) [2009.09.30]

Retraction of a Published Pape... [2009.09.30]

Deletion of a published paper [2008.05.09]

PUBLICATION OFFICE Asian-Australasian Association of Animal Societies

Not logged in. Contact | Links

2010 2011 2012 2013

K. J. Lee, G. W. Jang, K. H. Cho, T. H. Kim, S. J. Oh, I. C. Cheong

P. K. Singh, Dhirendra Kumar, S. K. Varma

P. K. Naik, Usha R. Mehra, Kalicharan , V. P. Varshney, R. S. Dass

C. S. Ahuja, Neeraj Sharma, S. P. S. Singha

Inger Ledin, Nguyen Trong Ngu

B. H. Paek, S. W. Kang, Y. M. Cho, W. M. Cho, C. J. Yang, S. G. Yun

Effects of Feeding Wastes from Brassica Species on Growth of Goats and

Nguyen Trong Ngu and Inger Ledin*

INTRODUCTION survey by Ngu et al. (2001), the waste of leaves from

Table 1. Chemical composition of the diet components*

Table 2. Feed intake of the experimental diets*

Table 4. Pesticide/insecticide content in feeds and animal products, Exp. 2

REFERENCES General Statistical Office. 1999. Statistical data of agriculture,

PAGES abstract PDF

OKSBJERG, N.; TE PAS, M.F.W.; STICKLAND, N.; WIMMERS, K.:

LEFAUCHEUR, L.: Myofibre typing and its relationships to growth

KARUNARATNE, J.F.; ASHTON, C.J.; C. STICKLAND, N.C.: Prenatal

CODINA, M.; MONTSERRAT, N.; GARCÍA DE LA SERRANA, D.;

ALAMI-DURANTE, H.; OLHASQUE, V.; ASHTON, C.; STICKLAND,

MAU, M.; VIERGUTZ, T.; REHFELDT, C.: Influence of estrogens and

PICKOVA, J.; BRÄNNÄS, E.: Egg quality in Arctic charr (Salvelinus

THERKILDSEN, M.; SØRENSEN, I.L.; OKSBJERG, N.: Use of casein

SARROPOULOU, E.;. POWER, D.M.; MAMURIS, Z.; MOUTOU, K.A.: