Cytometry Part B (Clinical Cytometry) 94B:652–659 (2018)

Original Article
The Monoclonal Anti-CD157 Antibody Clone
SY11B5, Used for High Sensitivity Detection of
PNH Clones on WBCs, Fails to Detect a
Common Polymorphic Variant Encoded
by BST-1
Johanna Blaha,1 Klaus Schwarz,1,2 Claudia Fischer,2 Peter Schauwecker,2
ochsmann,1,2 Hubert Schrezenmeier,1,2 and Markus Anliker2*
Britta H€
1
Institute for Transfusion Medicine, University of Ulm, Ulm, Germany
2
Institute for Clinical Transfusion Medicine and Immunogenetics Ulm,
German Red Cross Blood Service Baden-W€ urttemberg-Hessen, Ulm, Germany

Background: CD157, encoded by BST-1, has been described as a useful flow cytometric marker
for the analysis of paroxysmal nocturnal hemoglobinuria (PNH) as it is a glycosylphosphatidylinositol
(GPI)-linked molecule highly expressed on normal monocytes and neutrophils. We and others observed
isolated CD157 signal dropouts during intended PNH analysis. We hypothesize that these negative popu-
lations occur due to an antibody failure. To investigate the reason for this finding, we compared two dif-
ferent anti-CD157 antibody clones for PNH analysis.
Methods: We sequenced BST-1 of CD157-negative probands that are not suffering from PNH and expressed
wild type and a discovered variant form of CD157 in HEK293 cells. We compared the binding patterns of two
different anti-CD157 antibody clones (SY11B5 and RF3) by flow cytometry and western blot analysis.
Results: When sequencing two CD157-negative probands we detected a common SNP (p.Arg145Gln) in
exon 3 of BST-1. We found that only anti-CD157 antibody clone RF3 but not the more widely used clone
SY11B5 was able to detect both, the wild type and the variant form of CD157 in flow cytometric experiments.
Conclusion: The failure of anti-CD157 antibody clone SY11B5 to detect a common SNP can explain
some CD157-negative cytometric data. This provides crucial knowledge for laboratories performing PNH
analyses as such results can potentially lead to false-positive PNH interpretation. Our results confirm the
importance of published PNH guidelines. V C 2018 International Clinical Cytometry Society

Key terms: CD157; monoclonal antibody; PNH; flow cytometry; single nucleotide polymorphism

How to cite this article: Blaha J, Schwarz K, Fischer C, Schauwecker P, H€

ochsmann B, Schrezenmeier H and
Anliker M. The Monoclonal Anti-CD157 Antibody Clone SY11B5, Used for High Sensitivity Detection of PNH
Clones on WBCs, Fails to Detect a Common Polymorphic Variant Encoded by BST-1. Cytometry Part B 2018;
94B: 652–659.

INTRODUCTION
Paroxysmal nocturnal hemoglobinuria (PNH) is a
hematological disorder with a non-malignant but life-
threatening character (1). The disease is caused by a
clonal expansion of a hematopoietic stem cell that
acquired a somatic mutation, most often in the PIG-A
gene, leading to a deficiency of glycosylphosphatidylino-
sitol (GPI)-linked or -anchored proteins on the cell sur-
face of its offspring cells (2). Among others, two of the
missing molecules are the complement regulatory
*Correspondence to: Markus Anliker, Institute for Clinical
Transfusion Medicine and Immunogenetics Ulm, German Red Cross
€rttemberg-Hessen, Ulm, Helmholtzstraße 10,
Blood Service Baden-Wu
89081 Ulm, Germany. Email: markus.anliker@tirol-kliniken.at
Grant sponsor: International Graduate School in Molecular Medicine,
Ulm University.
Received 10 July 2017; Revised 28 December 2017; Accepted
8 January 2018
Published online 23 January 2018 in Wiley Online Library (wileyon-
linelibrary.com).
DOI: 10.1002/cyto.b.21625

C 2018 International Clinical Cytometry Society

V

ANTI-CD157 ANTIBODIES FOR PNH ANALYSIS
molecules CD55 and CD59 which are essential for pro-
tecting autologous cells from the complement system
(1). If those molecules are missing on the cell surfaces
the complement system is activated, eventually leading
to cell lysis. Cell lysis is the cause for intravascular
hemolysis which is one of the three main clinical fea-
tures of PNH. The other main symptoms belonging to
the classical clinical triad of PNH are bone marrow fail-
ure and thrombosis especially at unusual sites which is
the single most frequent cause of death in PNH patients
(3–5). However, the occurrence of the clinical features
of PNH varies a lot in patients and makes the disease dif-
ficult to diagnose (6). Flow cytometry is the gold stan-
dard for identification and quantification of PNH pheno-
types (7–9). Using this method even small populations
of GPI-deficient cells can be detected, which allows a
quantitative assessment of the PNH population. Further-
more, flow cytometry is preferentially used for follow-up
of PNH patients or patients that were suffering from
other bone marrow failures like aplastic anemia or
refractory cytopenia with unilineage dysplasia (RCUD)
(3,8) as there is a well-known association between
PNH and these other bone marrow diseases (10–14).
Diverse markers and staining strategies for PNH testing
are discussed in different manuscripts (7,9,11,15–19).
Published PNH guidelines emphasize the use of two
GPI-specific reagents for the analysis of leukocytes (gran-
ulocytes and monocytes) and red blood cells. These
guidelines seem even more important considering some
cases of antibody failure to recognize antigen due to
existing polymorphic variants or rare cases of single
marker deficiencies, for example, CD55, CD59, and
CD16 (7,20–26).
The multifunctional molecule CD157, encoded by the
bone marrow stromal cell antigen BST-1, is a GPI-
anchored molecule with a molar weight of 40–46 kDa
(27). The molecule is highly conserved and acts as
receptor and ectoenzyme. As homologue of CD38
(27,28) it shares 36% of its protein sequence (29). Due
to the fact that CD157 belongs to the ADP-ribosyl
cyclase gene family it exhibits diverse functions (27). It
was reported that BST-1 promotes pre-B-cell growth and
is involved in early T-cell development (30). CD157 is a
crucial factor for the mobility of human neutrophils
(31,32) and is involved in the transmigration of mono-
cytes (29). As reported by Morone et al. CD157 plays a
crucial role in cell–extracellular matrix interaction (33).
In mesenchymal stem cells BST-1 has pivotal regulatory
functions (34). It further has been found to play a role
in several human diseases like Parkinson’s disease (35)
and rheumatoid arthritis (36) or diverse cancer types
such as acute myeloid leukemia (37), ovarian carcinoma
(38), and malignant pleural mesothelioma (32).
Recently, Hernandez-Campo screened diverse GPI-
anchored proteins and showed for the first time that
CD157 could potentially be used as additional marker
for PNH testing (39–41). In humans, CD157 is highly
expressed on peripheral blood monocytes and granulo-
cytes but absent from erythrocytes (27), which includes
Cytometry Part B: Clinical Cytometry
15524957, 2018, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/cyto.b.21625 by Cochrane Portugal, Wiley Online Library on [21/12/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
653
it as a potentially useful GPI-anchored marker for PNH
analysis. In 2014, CD157 became more important for
PNH testing as Sutherland and colleagues introduced
two high-sensitivity assays for PNH cell detection that
included CD157 (16). The good applicability of CD157
in PNH testing was further confirmed by Marinov et al.
in assays for simultaneous evaluation of granulocytes
and monocytes (42,43). However, some rare cases of
CD157-negative, non-PNH have been reported sugges-
ting to use two GPI-specific reagents per lineage to
avoid misinterpretation (43). Out of 1,113 patients that
were analyzed for PNH via flow cytometry (11) as part
of routine workup in our laboratory we found two iso-
lated CD157 failures. In order to reveal the discrepant
result between CD157 and other GPI-anchored markers
in these cases we examined these two CD157-negative,
non-PNH cases concerning their BST-1 genetics. We
showed a common SNP to be the origin of the binding
failure of the anti-CD157 antibody clone SY11B5 which
is often used for PNH analysis.
MATERIALS AND METHODS
Genomic DNA Isolation and Sanger Sequencing
Following informed consent genomic DNA was iso-
lated from the patients’ granulocytes or mononuclear
cells using the Wizard Genomic DNA Purification Kit
(Promega, Madison, WI, #A1120). BST-1 was amplified
using primers (50 -TTGTTGTGCAGCAGGTCAGAGTTG-30
and 50 -CAGAGGACTTGGAGAGGATCAAGTG-30 ), pre-
R
pared for Sanger Sequencing using the Big DyeV Termi-
nator v1.1 Cycle Sequencing PR-100 Kit (Applied Biosys-
tems, Foster City, CA, #4337450) and sequenced with
primers (Sequ#1_BST-1_Ex1/F: 50 -ATGGCGGCCCAGG
GGTGCG-30 , Sequ#2_BST-1_Ex3/F: 50 -GTTCTGTATGGC
AGGGTTGC-30 , Sequ#3_BST-1_Ex8/F: 50 -GGACCACAGCA
CCCATCCTG-30 , Sequ#4_BST-1_Ex3/R: 50 -GCAACCCTG
CCATACAGAAC-30 , Sequ#5_BST-1_Ex8/R: 50 -TTACAGTT
GAGTCCTGGAAG-30 ). After precipitation with Hi-DiTM
Formamide (Applied Biosystems, #4311320) sequences
R
were detected using the ABI PrismV Genetic Analyzer
3130xl (Applied Biosystems).
Cloning
The plasmid pEF1a-IRES-Neo was a gift from Thomas
Zwaka (Addgene plasmid #28019) (44). Plasmid DNA
was prepared with the QIAprep Spin Miniprep Kit
(Qiagen, Hilden, Germany, #27104) according to the
manufacturer’s protocol. gBlocks Gene fragments for
BST-1 wild type and BST-1 SNP (c.434G>A) were pur-
chased from IDT (Coralville, IA):
Wild type BST-1/SNP (c.434G>A) BST-1: 50 -
CCGCTCGAGCACCATGGCGGCCCAGGGGTGCGCGGCA
TCGCGGCTGCTCCAGCTGCTGCTGCAGCTTCTGCTTCT
ACTGTTGCTGCTGGCGGCGGGCGGGGCGCGCGCGCGG
TGGCGCGGGGAGGGCACCAGCGCACACTTGCGGGACAT
CTTCCTGGGCCGCTGCGCCGAGTACCGCGCACTGCTGA
GTCCCGAGCAGCGGAACAAGAACTGCACAGCCATCTGGG
AAGCCTTTAAAGTGGCGCTGGACAAGGATCCCTGCTCCG

654 BLAHA ET AL.
TGCTGCCCTCAGACTATGACCTTTTTATTAACTTGTCCAG
GCACTCTATTCCCAGAGATAAGTCCCTGTTCTGGGAAAA
TAGCCACCTCCTTGTTAACAGCTTTGCAGACAACACCCGT
CGTTTTATGCCCCTGAGCGATGTTCTGTATGGCAGGGTT
GCAGATTTCTTGAGCTGGTGTC
G/A
ACAGAAAAATGACTCTGGACTCGATTACCAATCCTGCC
CTACATCAGAAGACTGTGAAAATAATCCTGTGGATTCC
TTTTGGAAAAGGGCATCCATCCAGTATTCCAAGGATAGT
TCTGGGGTGATCCACGTCATGCTGAATGGTTCAGAGCC
AACAGGAGCCTATCCCATCAAAGGTTTTTTTGCAGATTA
TGAAATTCCAAACCTCCAGAAGGAAAAAATTACACGAAT
CGAGATCTGGGTTATGCATGAAATTGGGGGACCCAATG
TGGAATCCTGCGGGGAAGGCAGCATGAAAGTCCTGGAA
AAGAGGCTGAAGGACATGGGGTTCCAGTACAGCTGTAT
TAATGATTACCGACCAGTGAAGCTCTTACAGTGCGTGGA
CCACAGCACCCATCCTGACTGTGCCTTAAAGTCGGCAG
CAGCCGCTACTCAAAGAAAAGCCCCAAGTCTTTATACAG
AACAAAGGGCGGGTCTTATCATTCCCCTCTTTCTGGTG
CTGGCTTCCAGGACTCAACTGTAAGCGGCCGCTAAACT
AT-30 .
After overnight digestion of gBlock Gene fragments
and plasmid DNA with NotI and XhoI (New England
Biolabs, Ipswich, MA, #R0189L, R0146L) in the NEBuffer
3.1 (New England Labs, #B7203S) at 378C the plasmid
was treated with alkaline phosphatase (Roche, Basel,
Switzerland, #10108138001) before both were ligated
with the Fast-LinkTM DNA Ligation Kit (epicenter, Madi-
son, WI, #LK0750H) according to the manufacturer’s
protocol. Plasmids harboring BST-1 wild type or SNP or
the empty vector were transformed in One Shot TOP10
bacteria (Invitrogen, Carlsbad, CA, #C404010) according
to the manufacturer’s protocol. Plasmid DNA was
extracted from overnight bacterial cultures via the High-
Speed Plasmid Maxi Kit (Qiagen, #12663) according to
the manufacturer’s protocol. All plasmid constructs
were verified by digestion with restriction enzymes and
fragment size verification on agarose gels and by Sanger
sequencing.
Cell Culture, Transfection, and Selection
HEK293 cells were cultured in IMDM (Gibco by life
technologies, Carlsbad, CA, #21980-032) supplemented
with 10% FCS (PAA, #A15–101, Lot#10108-0961). The
cells were transfected using the AmaxaV R Cell Line
NucleofectorVR Kit V (Lonza, Basel, Switzerland, #VACA-
1003) according to the manufacturer’s protocol using
the Nucleofector Program A23. Two days post transfec-
tion 1.5 mg/mL Geneticin (Thermo Fisher Scientific,
Waltham, MA, #11811064) was added to the media for
selection until day 10 when the concentration was
reduced to 0.5 mg/mL. Medium was changed every 2–3
days. Cells were negative for mycoplasma and squirrel
monkey retrovirus.
Flow cytometric PNH test
Routine panel. Following informed consent 100 mL
EDTA-blood from the probands were stained with 10 mL
15524957, 2018, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/cyto.b.21625 by Cochrane Portugal, Wiley Online Library on [21/12/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
anti-CD45-PC7 (clone J.33 #IM3548U, 100 mg/mL), 10 mL
anti-CD15-PC5 (clone 80H5, #IM2641U, 7 mg/mL), and
10 mL anti-CD64-ECD (clone 22, # A98434, 25 mg/mL)
(all from Beckman-Coulter, Brea, CA) for identification
of leukocytes, granulocytes, and monocytes, respec-
tively. For PNH clone detection cells were stained with
5 mL of FLAER-Alexa Fluor 488 proaerolysin (Cedarlane,
Burlington, Canada, #FL1A, 1026 mol/L) and 5 mL anti-
CD157-PE clone SY11B5 (eBioscience, San Diego, CA, #
90121579120, 25 ng/mL) or 20 mL anti-CD157-FITC
clone RF3 (Beckman Coulter, #IM2557, 0.5 mg/mL). After
15–30 min of incubation at room temperature (RT)
R
2 mL of an IOTestV 3 Lysing Solution (Beckman Coulter,
#A07799) was added, that prior was diluted 1/10 in
water. Cells were incubated for 10 min at RT, washed in
PBS, resuspended in 500 mL PBS and analyzed with a
Cytomics FC500 flow cytometer (Beckman Coulter). All
centrifugation steps were performed at 300g for 5 min.
In vitro verification. HEK293 cells were detached
using Accutase Solution (Sigma-Aldrich, St. Louis, MO,
#A6964) and 2 3 105 cells were resuspended in 20 mL
PBS and stained with 0.5 mL anti-CD157-PE (clone
SY11B5) or 0.5 mL anti-CD157-FITC (clone RF3). Cells
were incubated for 10 min at RT and washed in PBS. All
centrifugation steps were performed at 2,000 rpm for 5
min at RT. Cells were resuspended in 200 mL PBS,
stained with 7-aminoactinomycin D (0.5 mg, Sigma-
Aldrich, #A9400) and analyzed on a BD Accuri C6 Flow
Cytometer.
Western blot analysis
Proteins were isolated using 100–300 mL lysis buffer
(50 mM Tris HCl, pH 8.0; 62.5 mM EDTA, pH 7.96; 1%
NP 40, 0.4% natrium desoxycholate.) Cells were incu-
bated for 30 min at 48C and centrifuged for 5 min at RT.
Protein concentrations were analyzed with DCTM Pro-
tein Assay (BIO-RAD, Hercules, CA), the MARS Data
Analysis Software and a POLARstar Omega ELISA-Reader
(BMG Labtech, Ortenberg, Germany). About 30 mg pro-
tein lysate were separated on 10% sodium dodecyl sul-
fate polyacrylamide gels and transferred to a nylon mem-
brane (Immobilon P PVDF Transfer Membran Millipore,
Billerica, MA). The membrane was probed with the anti-
bodies [anti-CD157-PE 1:800, anti-CD157-FITC 1:100 and
anti-Ku-86 (Santa Cruz, Dallas, TX, #SC5280) 1:1500] in
5% milk powder in 1x TBST (10 mM Tris pH 7.2–8,
0.15 M NaCl, 0.05% Tween 20) and incubated overnight
at 48C. After washing with 13 TBST, the membrane was
probed with HRP-conjugated goat anti-mouse IgG
(H 1 L) antibody (BIO-RAD, #1706516) 1:3,000 in 5%
milk powder in 13 TBST for 2 h at RT and developed
with the SuperSignalTM West Pico Chemiluminescent
Substrate (Thermo Scientific, #34080) according to the
manufacturer’s protocol. Chemiluminescence signals
were detected with the FusionCapt Advance SL2 Xpress
software on a Fusion SL (Vilber Lourmat, Eberhardzell,
Germany).
Cytometry Part B: Clinical Cytometry
 15524957, 2018, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/cyto.b.21625 by Cochrane Portugal, Wiley Online Library on [21/12/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
ANTI-CD157 ANTIBODIES FOR PNH ANALYSIS 655

FIG. 1. Routine PNH staining for CD157. Monocytes (green) and granulocytes (purple) were stained with FLAER and anti-CD157 antibody clone
SY11B5. In the healthy control sample all cells are FLAER- and CD157-positive. In the representative PNH-positive control (PNH-patient) 73.5% of
the monocytes and 74% of the granulocytes are negative for FLAER and CD157. In samples from both presented probands almost 100% of mono-
cytes as well as of granulocytes are only positive for FLAER but negative for CD157.

RESULTS received a bone marrow transplantation from his sister.

Absent CD157 Signal in Two Non-Related
Non-PNH Probands
Here we present two non-PNH cases, both with miss-
ing anti-CD157 clone SY11B5 signal on their monocytes
and granulocytes.
The first proband is of Asian (Turkish) ancestry and
suffers from cyclic neutropenia for several years. In the
context of the standard evaluation of patients with bone
marrow failures the patient was tested for PNH. Strik-
ingly, all PNH panel markers were inconspicuous except
for CD157 (Fig. 1). No significant CD55 and/or CD59-
deficient erythrocyte and reticulocyte population was
detected (data not shown) and no signs of hemolysis or
thrombophilia were reported.
The second proband, who is of Philippine ancestry,
initially presented with a severe aplastic anemia,
Upon follow-up, the proband was investigated for the
presence of a PNH clone. The analyzed cells were nega-
tive for CD157 using the monoclonal antibody clone
SY11B5 (Fig. 1). However, the proband was not diag-
nosed with PNH because all other molecules tested in
the PNH routine panel were present and the proband
showed no clinical symptoms. Upon STR-analysis the
investigated cells were noted to be of female origin,
thus, originated from the bone marrow donating sister.
The sister is inconspicuous in her hematopoiesis.
CD157 Protein is Present as Polymorphic Variant on the
Cell Surface of Both Probands
In order to explain the inconclusive staining results
we performed further experimental work up. Both pro-
bands were tested again for the expression of CD157

FIG. 2. A polymorphic CD157 variant is present on the probands monocytes and granulocytes. A. 99.3% of the monocytes and 96.4% of the
granulocytes of proband 1 are positive for CD157 when using the anti-CD157 antibody clone RF3. This representative staining pattern of proband 1
indicates type I cells (normal expression of GPI-anchored molecules). B. Wild type sequence of exon 3 of BST-1 compared with both probands. Both
probands carry the SNP rs2302464.

Cytometry Part B: Clinical Cytometry

 15524957, 2018, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/cyto.b.21625 by Cochrane Portugal, Wiley Online Library on [21/12/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
656 BLAHA ET AL.

with a second monoclonal anti-CD157 antibody clone

Probands
(RF3). Interestingly, this antibody clone was able to

Yes

Yes
Yes
detect CD157 on the probands’ cell surfaces (Fig. 2A).

No
No

No
No
No
No
After genetic examination of the BST-1 gene in both
cases, a common SNP (p.Arg145Gln, rs2302464) in
frequency exon 3 was found (Fig. 2B). The SNP has an allele fre-
0.36%
0.50%
0.27%
0.31%
0.32%
1.01%
0.35%
0.25%
1.49%
Allele

quency of 4.85%, with an especially high incidence in

Homozygous

East Asia (20.57%) and an overall homozygous allele

occurrence of 0.27% according to the Exome Aggrega-
Observed SNPs in BST-1 with an allele incidence of >1% according to the Exome Aggregation Consortium database (45)

tion Consortium database (ExAC) (45) (Table 1). Addi-

tionally, we found two identical synonymous SNPs in
Allele

1573
count

609
332

124

303
both probands. The SNP p.Ser156Ser (rs2302463) has
43

33
34

43
an overall homozygous allele incidence of 0.25% and a
high homozygous occurrence in East Asia (1.83%). With
an overall allele frequency of 52.55% in East Asia the
frequency

variant p.Arg315Arg (rs1058212) is very common among

6.46%
9.58%
4.85%
6.88%
6.93%
12.74%
7.13%
4.97%
12.01%
Allele

this population (Table 1). We hypothesized the SNP

Heterozygous

(p.Arg145Gln) in exon 3 of BST-1 to be the reason for

the antibody failure of anti-CD157 antibody clone
SY11B5.
11633

12704
5890

1567

6026

The Anti-CD157 Antibody Clone SY11B5 Fails to Detect a

Allele

783

740
745

877
count

Common Polymorphic Variant of CD157 (p.Arg145Gln)

Datasets with a total allele number of <10,000 or mutations in introns or the 30 UTR were excluded.

To test whether the SNP p.Arg145Gln is causative for

the observed antibody failure we stably expressed the
Total allele

wild type form or the polymorphic variant of CD157 in

121412
121394

121380
105754
number
12122

10756
10748
12296
12304

HEK293 cells and analyzed them by staining with both

antibody clones in flow cytometric experiments (Fig.
Table 1

3A). An empty vector backbone served as negative con-

trol. HEK293 cells that were transfected with the empty
vector were negative for both anti-CD157 antibody
p.Ter98CysextTer5†

clones. Both antibody clones detected the molecule on

Consequence

cells expressing the wild type form of CD157. Strikingly,

p.Leu94Leu†
p.Prol50Ser†
p.Argl53His†

p.Arg315Arg

on HEK293 cells expressing the polymorphic variant of

p.Argl45Gln
p.Argl25His

p.Serl55Ser
p.Gly36Ala

CD157 (p.Arg145Gln) only the anti-CD157 antibody

clone RF3 was able to detect the present molecule. In
order to validate both antibodies in a second approach
western blot experiments were performed (Fig. 3B).
Similar to what was observed in flow cytometry results,
antibody clone SY11B5 detected only the wild type
4:15737732 G/A (rs28404156)
4:15737722 C/T (rs28641514)
4:15704874 G/C (rs2302468)

4:15739415 G/C (rs3900588)

4:15739428 A/T (rs4320134)
4:15709192 G/A (rs2302465)
4:15709252 G/A (rs2302464)

4:15713446 C/T (rs2302463)

form of CD157 in western blot experiments. However,

4:15733454 A/C (rsl058212)

in western blot analyses the second antibody clone

Annotation is for a non-canonical transcript.

(RF3) failed to detect the polymorphic variant of

CD157. We proved the presence of both CD157 variants
Variant

on the blot with a polyclonal antibody excluding the

absence of the polymorphic protein due to, for exam-
ple, miscompartmentalization (Fig. 3C).
We were able to show that the wild type form of
CD157 (p.Arg145) is detectable with both common anti-
CD157 antibody clones (SY11B and RF3) in flow cytom-
etry as well as in western blot analyses. However, the
polymorphic CD157 variant (p.Arg145Gln) was only
detectable in flow cytometry experiments using the anti-
Synonymous >1%

body clone RF3.

Missense >1%

Stop lost >1%

DISCUSSION
Several different PNH analysis panels of flow cytometric
†

staining strategies have been proposed (7–9,11,16,17,46),

but an overall consensus PNH analysis protocol does not

Cytometry Part B: Clinical Cytometry

 15524957, 2018, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/cyto.b.21625 by Cochrane Portugal, Wiley Online Library on [21/12/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
ANTI-CD157 ANTIBODIES FOR PNH ANALYSIS 657

FIG. 3. In vitro validation of anti-CD157 antibody clone SY11B5 and RF3 in flow cytometry and western blot experiments. A. In the empty vector
control no CD157 signal is obtained. The wild type CD157 is detectable with both antibody clones. The polymorphic variant is only detectable using
the clone RF3. B. Both antibody clones detect only wild type CD157 in western blot experiments. C. The polyclonal anti-CD157 antibody detects the
wild type as well as the variant CD157 protein. Ku-86 was used as loading control in western blot experiments. [Color figure can be viewed at
wileyonlinelibrary.com]

exist. Both, cell type and molecules addressed differ
among these PNH panels as well as detection sensitiv-
ity of applied reagents. It is important for PNH analysis
that even small PNH clones are detectable. However,
even in individuals without clinical symptoms of PNH
few PNH-like cells have been found (47,48). Here we
report on two cases out of 1113 with negative CD157
staining on monocytes and granulocytes using the anti-
body clone SY11B5 for PNH testing. All other GPI-
anchored markers were normally expressed on periph-
eral blood cells of these patients. As part of our qual-
ity management of PNH flow cytometry we further
analyzed these cases to elucidate the reason for the
discrepancy between CD157 (SY11B5) staining and
other GPI-anchored markers. CD157 has been
described to be a potent alternative marker for PNH
testing in diverse antibody panels based on both
FLAER- and non-FLAER approaches. In this study we
show that application of CD157 as a marker for PNH
might be challenging, since its binding site can be
affected by a SNP that impairs detection by at least
one anti-CD157 antibody clone. Those rare CD157-
negative cases have also emerged in other laboratories
before. It was suggested that this phenomenon may be
an isolated CD157 deficiency, because all cases with
lack of CD157 staining expressed GPI anchored mole-
cules normally on red blood cells (Type I PNH) (43).
Although the existence of such deficiencies cannot be
excluded, we are the first to show that an isolated
CD157 deficiency is not the reason for failing CD157
detection in our laboratory. Rather, we identified an
antibody detection problem due to a changed amino
acid sequence of the antigen. The underlying SNP
(p.Arg145Gln) is among the most common SNPs in
BST-1 listed in the ExAC Browser. Indeed, 2.3% of the
East Asian populations carry this SNP homozygously
whereas the polymorphism has lower frequencies in
other populations. It remains to be tested whether
patients carrying this SNP variant of CD157 have even-
tually a higher prevalence of bone marrow diseases
other than PNH. Whether also other SNPs in BST-1 are
leading to false negative signals in flow cytometry has
never been examined, however, we consider the SNP
(p.Arg145Gln) as leading cause for CD157-negative
cases. In the future, it will be worth testing the per-
formances of both anti-CD157 antibody clones when
other missense SNPs of BST-1 or combinations of other
SNPs with p.Arg145Gln are investigated. In our opin-
ion CD157 is still a valid molecule for PNH routine
testing. However, CD157-based identification of GPI-
deficient populations must be confirmed by another
GPI-specific reagent. Investigators can either decide to
use other anti-CD157 antibody clones than clone
SY11B5, which always has been used for establishment
of PNH analysis guidelines, or they must be aware of
non-PNH, CD157-negative individuals. Of note, in our
experiments the antibody clone RF3 was less sensitive
than clone SY11B5. Thus, clone RF3 needs to be

Cytometry Part B: Clinical Cytometry


658 BLAHA ET AL.
validated for PNH testing independently and cannot
simply replace clone SY11B5. Other PNH panel mole-
cules also need to be addressed critically. For example
CD16 polymorphisms (25), as well as CD16 single
marker deficiencies have been described (7). In addi-
tion, CD16 and CD58 have been mentioned to be
problematic markers as those molecules are also pre-
sent as transmembrane molecules which may prove
difficult to interpret (49,50). Furthermore, congenital
CD55 (11) and CD59 deficiencies are known (21,26)
and some immature monocytes do exist where CD14
is absent (7). This makes PNH testing even more chal-
lenging. Our observation again emphasizes that flow
cytometric analysis of PNH cells must not be based on
lack of expression of just a single GPI-anchored
marker. Rather a consistent deficiency of at least two
markers on at least two different cell types is required.
Due to the rare incidence of PNH, as well as rare
genetic variations such as CD157, we suggest PNH-
positive cases to be confirmed in specialized laborato-
ries. We were not able to confirm the flow cytometry
results in western blot experiments, because both
clones did not detect the SNP variant of CD157. This
finding needs further investigation, however, one expla-
nation may be a not confirmation independent epitope
of anti-CD157 antibody clone RF3.
SUMMARY
We found that isolated cases of CD157-negative
expression are caused by antibody failure in flow cyto-
metric analysis. We showed that the anti-CD157 anti-
body clone SY11B5, standardly used in routine PNH
panels, fails to detect the present molecule on the cell
surfaces due to the common SNP p.Arg145Gln. This
SNP has an overall allele frequency of 4.85% and a
homozygous frequency of 0.27% according to the
Exome Aggregation Consortium database.
ACKNOWLEDGMENTS
The authors would like to thank Ingrid Janz, Gabriele
Keller, Myriam Lorenz, PhD, Eva-Maria Rump and Ulrich
Pannicke, PhD for technical and advisory support, and
Kerstin Felgentreff, MD for proof-reading.
GRANT SUPPORT
JB is a fellow of the International Graduate School in
Molecular Medicine, Ulm University.
CONFLICT OF INTEREST
The authors declare that they have are no conflicts of
interest related to this article.
LITERATURE CITED
1. Brodsky RA. Paroxysmal nocturnal hemoglobinuria. Blood 2014;
124:2804–2811.
2. Luzzatto L. Paroxysmal nocturnal hemoglobinuria: An acquired X-
linked genetic disease with somatic-cell mosaicism. Curr Opin
Genet Dev 2006;16:317–322.
3. Schrezenmeier H, H€ochsmann B. Eculizumab opens a new era of
treatment for paroxysmal nocturnal hemoglobinuria. Expert Rev
Hematol 2009;2:7–16.
15524957, 2018, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/cyto.b.21625 by Cochrane Portugal, Wiley Online Library on [21/12/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
4. Socie G, Mary JY, de Gramont A, Rio B, Leporrier M, Rose C,
Heudier P, Rochant H, Cahn JY, Gluckman E. Paroxysmal nocturnal
haemoglobinuria: Long-term follow-up and prognostic factors. French
Society of Haematology. Lancet Lond Engl 1996;348:573–577.
5. de Latour RP, Mary JY, Salanoubat C, Terriou L, Etienne G, Mohty M,
Roth S, de Guibert S, Maury S, Cahn JY, et al. Paroxysmal nocturnal
hemoglobinuria: Natural history of disease subcategories. Blood
2008;112:3099–3106.
6. Schrezenmeier H, Muus P, Soci e G, Szer J, Urbano-Ispizua A,
Maciejewski JP, Brodsky RA, Bessler M, Kanakura Y, Rosse W, et al.
Baseline characteristics and disease burden in patients in the Inter-
national Paroxysmal Nocturnal Hemoglobinuria Registry. Haemato-
logica 2014;99:922–929.
7. Borowitz MJ, Craig FE, DiGiuseppe JA, Illingworth AJ, Rosse W,
Sutherland DR, Wittwer CT, Richards SJ. Guidelines for the diagno-
sis and monitoring of paroxysmal nocturnal hemoglobinuria and
related disorders by flow cytometry. Cytom B Clin Cytom 2010;78:
211–230.
8. Parker C, Omine M, Richards S, Nishimura J-I, Bessler M, Ware R,
Hillmen P, Luzzatto L, Young N, Kinoshita T, et al. Diagnosis and
management of paroxysmal nocturnal hemoglobinuria. Blood 2005;
106:3699–3709.
9. H€ochsmann B, Rojewski M, Schrezenmeier H. Paroxysmal nocturnal
hemoglobinuria (PNH): Higher sensitivity and validity in diagnosis
and serial monitoring by flow cytometric analysis of reticulocytes.
Ann Hematol 2011;90:887–899.
10. Raza A, Ravandi F, Rastogi A, Bubis J, Lim SH, Weitz I, Castro-
Malaspina H, Galili N, Jawde RA, Illingworth A. A prospective multi-
center study of paroxysmal nocturnal hemoglobinuria cells in
patients with bone marrow failure: PNH cells in bone marrow dys-
function: Explore. Cytom B Clin Cytom 2014;86:175–182.
11. Schrezenmeier H, Bettelheim P, Panse J, Schubert J, H€ ochsmann B,
R€oth A, Nebe T. Empfehlungen zur Diagnostik der Paroxysmalen
n€achtlichen H€amoglobinurie: Deutsch – o €sterreichischer Konsen-
sus/Recommendations for the diagnosis of paroxysmal nocturnal
hemoglobinuria: A German-Austrian consensus. LaboratoriumsMedi-
zin 2011;35:315–327.
12. Sugimori C, Mochizuki K, Qi Z, Sugimori N, Ishiyama K, Kondo Y,
Yamazaki H, Takami A, Okumura H, Nakao S. Origin and fate of
blood cells deficient in glycosylphosphatidylinositol-anchored pro-
tein among patients with bone marrow failure. Br J Haematol 2009;
147:102–112.
13. Donohue RE, Marcogliese AN, Sasa GS, Elghetany MT, Redkar AA,
Bertuch AA, Curry CV. Standardized high-sensitivity flow cytometry
testing for paroxysmal nocturnal hemoglobinuria in children with
acquired bone marrow failure disorders: A single center US study.
Cytom B Clin Cytom 2017;00B:000–000.
14. Morado M, Freire Sandes A, Colado E, Subira D, Isusi P, Soledad
Noya M, Bel en Vidriales M, Sempere A, A ngel Dıaz J, Minguela A,
et al. Diagnostic screening of paroxysmal nocturnal hemoglobinuria:
Prospective multicentric evaluation of the current medical indica-
tions. Cytom B Clin Cytom 2016;92:361–370.
15. Sutherland DR, Keeney M, Illingworth A. Practical guidelines for the
high-sensitivity detection and monitoring of paroxysmal nocturnal
hemoglobinuria clones by flow cytometry. Cytom B Clin Cytom
2012;82:195–208.
16. Sutherland DR, Acton E, Keeney M, Davis BH, Illingworth A. Use of
CD157 in FLAER-based assays for high-sensitivity PNH granulocyte
and PNH monocyte detection: Use of CD157 in Flaer-Based Assays.
Cytom B Clin Cytom 2014;86:44–55.
17. Sugimori C, Chuhjo T, Feng X, Yamazaki H, Takami A, Teramura M,
Mizoguchi H, Omine M, Nakao S. Minor population of CD55-CD59-
blood cells predicts response to immunosuppressive therapy and
prognosis in patients with aplastic anemia. Blood 2006;107:1308–
1314.
18. Fletcher M, Whitby L, Whitby A, Barnett D. Current international
flow cytometric practices for the detection and monitoring of par-
oxysmal nocturnal haemoglobinuria clones: A UK NEQAS survey.
Cytom B Clin Cytom 2017;92:266–274.
19. Sutherland DR, Illingworth A, Keeney M, Richards SJ. High-sensitiv-
ity detection of pnh red blood cells, red cell precursors, and white
blood cells. Curr Protoc Cytom 2015;72:6.37.1–30.
20. Anliker M, von Zabern I, H€ ochsmann B, Kyrieleis H, Dohna-
Schwake C, Flegel WA, Schrezenmeier H, Weinstock C. A new
blood group antigen is defined by anti-CD59, detected in a CD59-
deficient patient: New Blood Group Antigen CD59. Transfusion
(Paris) 2014;54:1817–1822.
Cytometry Part B: Clinical Cytometry

ANTI-CD157 ANTIBODIES FOR PNH ANALYSIS
21. H€ochsmann B, Dohna-Schwake C, Kyrieleis HA, Pannicke U,
Schrezenmeier H. Targeted therapy with eculizumab for inherited
CD59 deficiency. N Engl J Med 2014;370:90–92.
22. Holguin MH, Martin CB, Bernshaw NJ, Parker CJ. Analysis of the
effects of activation of the alternative pathway of complement on
erythrocytes with an isolated deficiency of decay accelerating fac-
tor. J Immunol (Baltim Md 1950) 1992;148:498–502.
23. Merry AH, Rawlinson VI, Uchikawa M, Daha MR, Sim RB. Studies
on the sensitivity to complement-mediated lysis of erythrocytes
(Inab phenotype) with a deficiency of DAF (decay accelerating fac-
tor). Br J Haematol 1989;73:248–253.
24. Reid ME, Mallinson G, Sim RB, Poole J, Pausch V, Merry AH, Liew
YW, Tanner MJ. Biochemical studies on red blood cells from a
patient with the Inab phenotype (decay-accelerating factor defi-
ciency). Blood 1991;78:3291–3297.
25. Wang L, Wells DA, Deeg HJ, Loken MR. Flow cytometric detection
of nonneoplastic antigenic polymorphisms of donor origin after allo-
geneic marrow transplant: A report of two cases. Am J Clin Pathol
2004;122:135–140.
26. Yamashina M, Ueda E, Kinoshita T, Takami T, Ojima A, Ono H,
Tanaka H, Kondo N, Orii T, Okada N. Inherited complete deficiency
of 20-kilodalton homologous restriction factor (CD59) as a cause of
paroxysmal nocturnal hemoglobinuria. N Engl J Med 1990;323:
1184–1189.
27. Deaglio S, Malavasi F. The CD38/CD157 mammalian gene family: An
evolutionary paradigm for other leukocyte surface enzymes. Puriner-
gic Signal 2006;2:431–441.
28. Quarona V, Zaccarello G, Chillemi A, Brunetti E, Singh VK, Ferrero
E, Funaro A, Horenstein AL, Malavasi F. CD38 and CD157: A long
journey from activation markers to multifunctional molecules:
CD38 and CD157. Cytom B Clin Cytom 2013;84B:207–217.
29. Lo Buono N, Parrotta R, Morone S, Bovino P, Nacci G, Ortolan E,
Horenstein AL, Inzhutova A, Ferrero E, Funaro A. The CD157-
integrin partnership controls transendothelial migration and adhe-
sion of human monocytes. J Biol Chem 2011;286:18681–18691.
30. Okuyama Y, Ishihara K, Kimura N, Hirata Y, Sato K, Itoh M, Ok LB,
Hirano T. Human BST-1 expressed on myeloid cells functions as a
receptor molecule. Biochem Biophys Res Commun 1996;228:838–
845.
31. Malavasi F, Deaglio S, Ferrero E, Funaro A, Sancho J, Ausiello CM,
Ortolan E, Vaisitti T, Zubiaur M, Fedele G, et al. CD38 and CD157
as receptors of the immune system: A bridge between innate and
adaptive immunity. Mol Med (Camb. Mass) 2006;12:334–341.
32. Ortolan E, Giacomino A, Martinetto F, Morone S, Buono NL, Ferrero
E, Scagliotti G, Novello S, Orecchia S, Ruffini E, et al. CD157 enhan-
ces malignant pleural mesothelioma aggressiveness and predicts
poor clinical outcome. Oncotarget 2014;5:6191–6205.
33. Morone S, Augeri S, Cuccioloni M, Mozzicafreddo M, Angeletti M,
Lo Buono N, Giacomino A, Ortolan E, Funaro A. Binding of CD157
protein to fibronectin regulates cell adhesion and spreading. J Biol
Chem 2014;289:15588–15601.
34. Aomatsu E, Takahashi N, Sawada S, Okubo N, Hasegawa T, Taira M,
Miura H, Ishisaki A, Chosa N. Novel SCRG1/BST1 axis regulates self-
renewal, migration, and osteogenic differentiation potential in mes-
enchymal stem cells. Sci Rep 2014;4:3652.
35. Lopatina O, Yoshihara T, Nishimura T, Zhong J, Akther S, Fakhrul
AAKM, Liang M, Higashida C, Sumi K, Furuhara K, et al. Anxiety- and
depression-like behavior in mice lacking the CD157/BST1 gene, a risk
factor for Parkinson’s disease. Front Behav Neurosci 2014;8:133.
36. Higashida H, Liang M, Yoshihara T, Akther S, Fakhrul A, Stanislav C,
Nam T-S, Kim U-H, Kasai S, Nishimura T, et al. An
Cytometry Part B: Clinical Cytometry
15524957, 2018, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/cyto.b.21625 by Cochrane Portugal, Wiley Online Library on [21/12/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
659
immunohistochemical, enzymatic, and behavioral study of CD157/
BST-1 as a neuroregulator. BMC Neurosci 2017;18:35.
37. Krupka C, Lichtenegger FS, K€ ohnke T, B€ ogeholz J, B€
ucklein V, Roiss
M, Altmann T, Do TU, Dusek R, Wilson K, et al. Targeting CD157 in
AML using a novel, Fc-engineered antibody construct. Oncotarget
2017;8:35707–35717.
38. Ortolan E, Arisio R, Morone S, Bovino P, Lo-Buono N, Nacci G,
Parrotta R, Katsaros D, Rapa I, Migliaretti G, et al. Functional role
and prognostic significance of CD157 in ovarian carcinoma. JNCI J
Natl Cancer Inst 2010;102:1160–1177.
39. Hernndez-Campo PM, Almeida J, Acevedo MJ, Snchez ML, Alberca I,
Vidriales B, Martnez E, Romero JR, Orfao A. Detailed immunopheno-
typic characterization of different major and minor subsets of
peripheral blood cells in patients with paroxysmal nocturnal hemo-
globinuria. Transfusion (Paris) 2008;48:1403–1414.
40. Hernandez-Campo PM, Almeida J, Matarraz S, de Santiago M,
Sanchez ML, Orfao A. Quantitative analysis of the expression of
glycosylphosphatidylinositol-anchored proteins during the matura-
tion of different hematopoietic cell compartments of normal bone
marrow. Cytom B Clin Cytom 2007;72:34–42.
41. Hernandez-Campo PM, Almeida J, Sanchez ML, Malvezzi M, Orfao A.
Normal patterns of expression of glycosylphosphatidylinositol-
anchored proteins on different subsets of peripheral blood cells: A
frame of reference for the diagnosis of paroxysmal nocturnal hemo-
globinuria. Cytom B Clin Cytom 2006;70:71–81.
 ermak J, Cetkovsky
42. Marinov I, Kohoutova M, Tkačova V, Pesek A, C
P. Clinical relevance of CD157 for rapid and cost-effective simulta-
neous evaluation of PNH granulocytes and monocytes by flow
cytometry. Int J Lab Hematol 2015;37:231–237.
43. Marinov I, Illingworth AJ, Benko M, Sutherland DR. Performance
characteristics of a non-fluorescent aerolysin-based paroxysmal noc-
turnal hemoglobinuria (PNH) assay for simultaneous evaluation of
PNH neutrophils and PNH monocytes by flow cytometry, following
published PNH guidelines. Cytom B Clin Cytom 2016;00B:000–000.
44. Dejosez M, Levine SS, Frampton GM, Whyte WA, Stratton SA,
Barton MC, Gunaratne PH, Young RA, Zwaka TP. Ronin/Hcf-1 binds
to a hyperconserved enhancer element and regulates genes
involved in the growth of embryonic stem cells. Genes Dev 2010;
24:1479–1484.
45. http://exac.broadinstitute.org/. Accessed May 31, 2017.
46. Nebe1 T, Schubert J, Gutensohn K, Schrezenmeier H. Flow cytomet-
ric analysis of gpi-deficient cells for the diagnosis ofparoxysmal noc-
turnal hemoglobinuria (PNH). Durchflusszytometrische Analyse GPI-
defizienter Zellen zur Diagnose der paroxysmalen nachtlichen
Hamoglobinurie (PNH). Lab Med 2003;27:257–265.
47. Araten DJ, Nafa K, Pakdeesuwan K, Luzzatto L. Clonal populations
of hematopoietic cells with paroxysmal nocturnal hemoglobinuria
genotype and phenotype are present in normal individuals. Proc
Natl Acad Sci U S A 1999;96:5209–5214.
48. Risitano AM. Anti-complement treatment in paroxysmal nocturnal
hemoglobinuria: Where we stand and where we are going. Transl
Med UniSa 2014;8:43–52.
49. Ariel O, Kukulansky T, Raz N, Hollander N. Distinct membrane
localization and kinase association of the two isoforms of CD58.
Cell Signal 2004;16:667–673.
50. Navenot JM, Bernard D, Harousseau JL, Muller JY, Blanchard D.
Expression of glycosyl-phosphatidylinositol-linked glycoproteins in
blood cells from paroxysmal nocturnal haemoglobinuria patients: A
flow cytometry study using CD55, CD58 and CD59 monoclonal
antibodies. Leuk Lymph 1996;21:143–151.