Available online at www.studiesinmycology.org Studies in Mycology 104: 87–148 (2023).

Fusarium diversity associated with diseased cereals in China, with an updated

phylogenomic assessment of the genus

S.L. Han1,2, M.M. Wang1, Z.Y. Ma1,2, M. Raza1, P. Zhao1, J.M. Liang1, M. Gao1,2, Y.J. Li1,2, J.W. Wang3, D.M. Hu4, L. Cai1,2*
1
State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, P. R. China; 2College of Life Science, University
of Chinese Academy of Sciences, Beijing 100049, P. R. China; 3Institute of Biology Co., Ltd., Henan Academy of Science, Zheng Zhou 450008, Henan, P. R.
China; 4College of Bioscience & Engineering, Jiangxi Agricultural University, Nanchang 330045, Jiangxi, P. R. China

*Corresponding author: L. Cai, cail@im.ac.cn

Abstract: Fusarium species are important cereal pathogens that cause severe production losses to major cereal crops such as maize, rice, and wheat.
However, the causal agents of Fusarium diseases on cereals have not been well documented because of the difficulty in species identification and the
debates surrounding generic and species concepts. In this study, we used a citizen science initiative to investigate diseased cereal crops (maize, rice,
wheat) from 250 locations, covering the major cereal-growing regions in China. A total of 2 020 Fusarium strains were isolated from 315 diseased samples.
Employing multi-locus phylogeny and morphological features, the above strains were identified to 43 species, including eight novel species that are described
in this paper. A world checklist of cereal-associated Fusarium species is provided, with 39 and 52 new records updated for the world and China, respectively.
Notably, 56 % of samples collected in this study were observed to have co-infections of more than one Fusarium species, and the detailed associations are
discussed. Following Koch’s postulates, 18 species were first confirmed as pathogens of maize stalk rot in this study. Furthermore, a high-confidence species
tree was constructed in this study based on 1 001 homologous loci of 228 assembled genomes (40 genomes were sequenced and provided in this study),
which supported the “narrow” generic concept of Fusarium (= Gibberella). This study represents one of the most comprehensive surveys of cereal Fusarium
diseases to date. It significantly improves our understanding of the global diversity and distribution of cereal-associated Fusarium species, as well as largely
clarifies the phylogenetic relationships within the genus.

Key words: Cereal pathogens, citizen science, co-infection, new taxa, pathobiome, phylogeny, species complexes, systematics.
Taxonomic novelties: New species: Fusarium erosum S.L. Han, M.M. Wang & L. Cai, Fusarium fecundum S.L. Han, M.M. Wang & L. Cai, Fusarium
jinanense S.L. Han, M.M. Wang & L. Cai, Fusarium mianyangense S.L. Han, M.M. Wang & L. Cai, Fusarium nothincarnatum S.L. Han, M.M. Wang & L. Cai,
Fusarium planum S.L. Han, M.M. Wang & L. Cai, Fusarium sanyaense S.L. Han, M.M. Wang & L. Cai, Fusarium weifangense S.L. Han, M.M. Wang & L. Cai.

Citation: Han SL, Wang MM, Ma ZY, Raza M, Zhao P, Liang JM, Gao M, Li YJ, Wang JW, Hu DM, Cai L (2023). Fusarium diversity associated with diseased
cereals in China, with an updated phylogenomic assessment of the genus. Studies in Mycology 104: 87–148. doi: 10.3114/sim.2022.104.02
Received: 14 September 2022 ; Accepted: 17 January 2023; Effectively published online: 22 February 2023
Corresponding editor: Pedro W. Crous
Studies in Mycology

INTRODUCTION has undergone numerous significant changes based on different

Cereal crops, including maize (Zea mays), rice (Oryza sativa) and
wheat (Triticum aestivum), are primary staple foods worldwide
(http://www.fao.org/faostat/en). The total grain output of China in
2020 was 658 million tons, of which 595 million tons were maize,
rice and wheat (Ma 2020). The significant factors diminishing
the value and yield of these crops were phytopathogens and
pests, especially fungi (e.g., Puccinia striiformis and Fusarium
graminearum) (Trail 2009, Matny 2015, Savary et al. 2019).
Fusarium pathogens are notorious, and not only cause yield losses,
but also produce mycotoxins threatening human and animal health
(Desjardins 2006, Leslie & Summerell 2006, Renev et al. 2021).
For instance, the annual loss due to wheat scab in China was up to
3.41 million tons from 2000 to 2018 (Su et al. 2021), and from 1993
to 2001, Fusarium diseases on crops caused economic losses up
to $7.7 billion in the United States (Nganje et al. 2004). Therefore,
the investigation of species diversity, distribution patterns, host
range and pathogenicity of Fusarium is of great significance for
cereal disease diagnosis and management.
Accurate species identification is the first step in Fusarium
disease diagnosis and management (O’Donnell et al. 2015,
2018, 2022). However, the taxonomic framework of Fusarium
criteria (Crous et al. 2021, Wang et al. 2022a), including eras
dominated by morphology (Booth 1971, Nelson et al. 1983),
or phylogenetic inference (Gräfenhan et al. 2011, O’Donnell
et al. 2018, Lombard et al. 2019a). These different taxonomic
frameworks are not necessarily consistent in inferring Fusarium
species diversity. Historically, species within the F. graminearum
clade (Fg clade) have for long been considered as a single species
using the morphological species concept, until the application of the
genealogical concordance phylogenetic species recognition in the
last two decades (O’Donnell et al. 2000a). Furthermore, for many
decades users had favoured systems with fewer species, such
as the system proposed by Snyder & Hansen (1940, 1941, 1945,
1954), which reduced the number of Fusarium species to nine with
many formae speciales. In addition, there are several dilemmas
in the delimitation of Fusarium species: i) the morphological
characteristics of Fusarium species are greatly influenced by
environmental factors, and often overlap with each other; ii) the
fungal universal barcode, the internal transcribed spacer region
cistron (ITS) has a low resolution of Fusarium species; iii) most
of the current Fusarium sequences in the public database are still
under the species complex name or even under wrong species or
genus names (Aoki et al. 2014, Lombard et al. 2019b, Wang et al.

© 2023 Westerdijk Fungal Biodiversity Institute. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/bync-nd/4.0/).

87
Han et al.
2019a, Xia et al. 2019, Crous et al. 2021, Yilmaz et al. 2021). These
dilemmas, together with the changes in the taxonomic system
have resulted in difficulties in the diagnosis and management of
Fusarium diseases of cereal crops.
To solve the species delimitation and identification dilemma,
a polyphasic approach has gradually been applied and several
online databases (Fusarium-ID, Fusarium MLST and FUSARIOID-
ID) have been established (O’Donnell et al. 2012, Crous et al.
2021, Torres-Cruz et al. 2022). Evolutionary relationships of
several important Fusarium species complexes, e.g., F. fujikuroi
species complex (FFSC), F. incarnatum-equiseti species complex
(FIESC), and F. oxysporum species complex (FOSC) were also
published (Aoki et al. 2014, Lombard et al. 2019b, Wang et al.
2019a, Xia et al. 2019, Crous et al. 2021, Yilmaz et al. 2021).
Despite these significant contributions, debates surrounding the
generic delimitation of Fusarium, especially whether the genus
Neocosmospora (also known as F. solani species complex, FSSC)
belongs to Fusarium was disputed (Crous et al. 2021, Geiser et al.
2021, Wang et al. 2022a).
According to the USDA fungal database (Farr & Rossman 2022),
more than 20 % of cereal-associated Fusarium species belong to
the F. sambucinum species complex (FSAMSC). Nevertheless,
the species relationships within this complex remain to be further
clarified, as several sister species cannot be distinguished based
on only RNA polymerase second largest subunit (rpb2) and
translation elongation factor 1-alpha (tef1) phylogenetic analyses
(Laraba et al. 2021). Recently, the phylogenomic approach has
been increasingly shown to be able to provide more information
towards understanding species evolution and boundaries
(Haridas et al. 2020, Liu et al. 2022a). In the case of Fusarium,
a phylogenomic approach has also been used to assess generic
boundaries (Geiser et al. 2021), but still suffered from imbalanced
generic sampling, and lack of data derived from ex-type cultures.
Previously, Fusarium associated with cereals in China were
identified mainly based on morphological features, preliminary
nucleotide BLAST, or phylogenetic analyses using single locus
datasets (either ITS or tef1) (Huang et al. 2011, Zhang et al. 2012,
2015, Xu et al. 2016, Hao et al. 2017). These studies, particularly
those applying subspecies, varieties and formae speciales names,
proved to be insufficient to identify Fusarium species (Lombard et
al. 2019b, Xia et al. 2019, Yilmaz et al. 2021, Wang et al. 2022a).
For instance, the pathogen of rice bakanae diseases in China has
been identified as three Fusarium species and varieties, i.e., F.
moniliforme, F. moniliforme var. subglutinans and F. moniliforme
var. intermedium, based on morphological features (Booth 1971,
Ye et al. 1990). However, these epithets have been revealed to
be synonyms of F. fujikuroi (O’Donnell et al. 1998a, Crous et al.
2021). Thus, species diversity and distribution of this group require
amendment in accordance with the currently used taxonomic
system and names.
The purpose of this study was therefore to examine the Fusarium
species associated with diseased cereals in China. Specifically to:
i) understand the diversity, distribution patterns, host preference
and pathogenicity of Fusarium species associated with diseased
cereals; ii) reassess the boundaries of Fusarium s. str. and allied
genera, and assess species boundaries within the FSAMSC; iii)
sequence the genomes of new and several known species and
provide an updated phylogenomic overview of Fusarium.
88
MATERIALS AND METHODS
Sample collection
Diseased cereals associated with Fusarium spp. were investigated
in China from July 2020 to October 2021, including maize ear
rot (Fig. 1), maize stalk rot (Fig. 2), wheat scab (Fig. 3), wheat
crown rot (Fig. 4), rice spikelet rot and rice bakanae disease
(Fig. 5). Geographically, 315 diseased samples (172 diseased
maize samples, Fig. 6A; 105 diseased wheat samples, Fig. 6B;
and 38 diseased rice samples, Fig. 6C) were collected from 250
sampling sites (several diseased samples were collected from
various hosts at the same location) which covered 21 provinces,
four autonomous regions and two municipalities (Fig. 6D). Parts
of these samples were collected by local farmers (Supplementary
Fig. S1, Supplementary Table S1) who followed a directive protocol
in our Citizen Science Initiative of “Collecting Diseased Cereals”
posted on social media. Diseased samples in good condition were
dried and stored in the Fungarium of the Institute of Microbiology,
Chinese Academy of Sciences, Beijing, China (HMAS).
Strain isolation, preservation and selection
A total of 2 600 fungal strains were isolated from symptomatic tissues
(i.e., kernels, stems, roots; Figs 1–5) of diseased cereals using single
spore isolation or direct hyphal isolation (Zhang et al. 2013, Raza et
al. 2019). Of these, 2 020 strains were assigned to Fusarium based on
colony morphology and tef1 sequences. Strains were further selected
following three steps: firstly, for strains with 100 % tef1 similarity from
the same symptomatic tissue of the same host species in each
location, only one strain was retained for subsequent analyses.
Secondly, the genus level phylogenetic analysis was conducted using
tef1-rpb2 sequences, and the above selected strains were assigned
to six Fusarium species complexes. For each complex, a tef1-rpb2
phylogeny was re-analysed, and only one isolate in each subclade
(without sequence variation) was selected if multiple isolates from the
same symptomatic tissue of each host species in each location were
available. Thirdly, different loci were amplified for the above selected
strains, and phylogenetic analyses of Fusarium species complexes
were conducted using different multi-locus datasets, i.e., calmodulin
(CaM), RNA polymerase largest subunit (rpb1), rpb2, tef1 and beta-
tubulin (tub2) for FFSC; CaM, rpb2 and tef1 for the FIESC and
FOSC; histone (H3), rpb1, rpb2 and tef1 for the FSAMSC; rpb1, rpb2
and tef1 for the FNSC and FTSC. Only one isolate of a particular
species from each symptomatic tissue of the same host species in
each location was selected. After the above selection steps, 608
representative strains were included (Supplementary Table S1).
The type specimens of new species described in this study were
deposited in the Fungarium of the Institute of Microbiology, Chinese
Academy of Sciences, Beijing, China (HMAS), and the living ex-type
cultures were deposited in the China General Microbiological Culture
Collection Centre (CGMCC). All isolates examined in this study were
deposited in Lei Cai’s personal culture collection (LC), the Institute
of Microbiology, Chinese Academy of Sciences, Beijing, China.
Taxonomic novelties, descriptions and nomenclature were deposited
in MycoBank (Crous et al. 2004).
DNA extraction and amplification
Total genomic DNAs were extracted from fresh fungal mycelia
grown on potato dextrose agar (PDA; DifcoTM, Becton, Dickinson and
 Fusarium spp. on cereals in China

Fig. 1. Field symptoms of maize ear rot (MER). A. Kernels covered with salmon-coloured powdery molds and accompanied by insect injury. B. Kernels
covered with white moulds. C. Kernels covered with orchid-coloured mycelia. D, F. Ears covered with whitish or a mixture of pinkish and blackish powdery
moulds coexist with symptoms caused by other fungi. E. Kernels covered with white moulds or violet mycelia. G. Kernels covered with salmon-coloured
powdery moulds. Note: Maize ear rot caused by Fusarium was referred to as Fusarium ear rot of maize (Zhang et al. 2014a), Fusarium maize ear rot (Zhang
et al. 2014b), Gibberella/red ear rot (Lana et al. 2022) and Fusarium/pink ear rot (Zhang et al. 2016) in various previous studies. To avoid confusion, in this
study we refer to this disease as maize ear rot (MER).

www.studiesinmycology.org 89
Han et al.

Fig. 2. Field symptoms of maize stalk rot (MSR). A, B. Maize ear drooping without shedding. C. Stalks turn grey green; internodes turn straw-coloured or
dark brown. D. Stalks covered with whitish mycelia. E, F. Stalks were covered with salmon-coloured powdery moulds and snapped at the nodes. G. Rotted
and brownish stalks. Note: Maize stalk rot caused by Fusarium, known as Fusarium stalk rot (Jiang et al. 2021), Gibberella stalk rot in maize (Ye et al. 2013)
in previous literature, is herein universally referred to as maize stalk rot (MSR) in this paper.

90

Fig. 3. Field symptoms of Fusarium head blight of wheat (FHB). A–E. Head blight of wheat accompanied by pinkish mould and/or whitish mycelia. Note:
The disease name Fusarium head blight (FHB) is adopted in this paper, which was also called wheat head blight and wheat scab in literature (O’Donnell et
al. 2000a).
Company, Sparks, MD, USA) using the cetyltrimethylammonium
bromide (CTAB) method (Porebski et al. 1997) and stored at -20 °C
until polymerase chain reaction (PCR). PCR amplifications were
performed in a reaction mixture consisting of 12.5 μL 2 × Taq PCR
Master Mix (Vazyme Biotech Co., Ltd, Nanjing, China), 1 μL each
of 10 μM primers, 2 μL of the undiluted genomic DNA, adjusted to
a final volume of 25 μL with distilled deionised water. Seven loci,
including ITS (White et al. 1990), tef1 (O’Donnell et al. 1998b), CaM
(O’Donnell et al. 2000b), rpb1 (O’Donnell et al. 2010), rpb2 (Liu et
al. 1999; Reeb et al. 2004), tub2 (O’Donnell & Cigelnik 1997), and
H3 (Roux et al. 2001) were amplified and sequenced. The PCR
primer pairs and amplification conditions are listed in Table 1. The
PCR products were visualised using 1 % agarose electrophoresis
gels. Sequencing was done by the Tianyi Huiyuan Company
(Beijing, China) and the SinoGenoMax Company (Beijing, China).
www.studiesinmycology.org
Fusarium spp. on cereals in China
Phylogenetic analyses
Consensus sequences were obtained using MEGA v. 7 software
(Kumar et al. 2016), and sequences for each locus were aligned
using MAFFT v. 7 (Katoh & Standley 2013). Misalignments were
corrected manually where necessary. Phylogenetic analyses were
performed based on individual and combined datasets, using
Maximum-Likelihood (ML) and Bayesian Inference (BI) methods
through the CIPRES Science Gateway portal (https://www.phylo.
org/; Miller et al. 2012).
The ML analyses were carried out using RAxML-HPC v. 8.2.12
(Stamatakis 2014), with 1 000 replicates under the GTR+GAMMA
model. The Bayesian analyses were carried out using MrBayes v.
3.2.7a (Huelsenbeck & Ronquist 2001, Ronquist & Huelsenbeck
2003), incorporating the best evolutionary models for each marker
as determined by MrModelTest v. 2.4 (Nylander 2004). Bayesian
analyses were computed with four simultaneous Markov Chain
91
Han et al.

Fig. 4. Field symptoms of Fusarium crown rot of wheat (FCR). A, B. “White-head” of wheat tillers. C, D. Reddish-brown discoloration on the lower stems.
E. Dark brown to black discolouration on the crowns and roots. Note: The disease name Fusarium crown rot of wheat (FCR) is adopted in this paper, which
was also referred to as wheat crown rot (Zhang et al. 2015), crown rot of wheat in previous literature (Li et al. 2016).

92
 Fusarium spp. on cereals in China

Fig. 5. Field symptoms of Fusarium diseases on rice. A. Rice bakanae disease (RBD), caused by F. fujikuroi, showing elongated barren seedlings. B–E.
Rice spikelet rot (RSR), caused by multiple Fusarium species, showing reddish or brown discoloration on the glumes, sometimes with salmon-coloured and/
or whitish powdery mould. Note: The disease name rice spikelet rot (RSR) is adopted in this paper, which was also known as Fusarium head blight in rice
in literature (Liu et al. 2022d).

www.studiesinmycology.org 93
Han et al.

Fig. 6. Maps showing sampling sites in China, generated by ArcGIS v. 10.5 software (Esri, Redlands, CA, USA). A. Map showing the distribution of 172
diseased maize samples collected in this study. B. Map showing the distribution of 38 diseased rice samples collected in this study. C. Map showing the
distribution of 105 diseased wheat samples collected in this study. D. Map showing the overall distribution of a total of 315 diseased samples collected in
this study.

Monte Carlo chains, 10 M generations, and a sampling frequency of
1 000 generations for the first datasets and 100 generations for the
other two datasets, ending the run automatically when the standard
deviation of split frequencies fell below 0.01. The burn-in fraction
was set to 0.25, after which the 50 % majority rule consensus trees
and posterior probability (PP) values were calculated.
The clade is supported when its RAxML Bootstrap support
value is ≥ 70 %, and the Bayesian PP value is ≥ 0.9. The resulting
trees were plotted using FigTree v. 1.4.2 (http://tree.bio.ed.ac.uk/
software/figtree). All sequences and their alignments generated
from 2 020 Fusarium strains in this study were deposited in
GenBank (Supplementary Table S1) and TreeBASE (submission
ID 30020), respectively.
Phylogenetic analyses of different Fusarium species complexes
were performed using different multi-locus datasets in accordance
with previous studies (Sarver et al. 2011, O’Donnell et al. 2013,
Gräfenhan et al. 2016, Laurence et al. 2016, Sandoval-Denis et
al. 2018b, Torbati et al. 2018, Lombard et al. 2019c, Maryani et al.
2019b, Wang et al. 2019a, Xia et al. 2019, Yilmaz et al. 2021). The
composition of the multi-locus datasets, outgroup taxa, number of
characters and the best models are listed in Supplementary Table
S2. Specifically, the combined CaM, rpb1, rpb2, tef1 and tub2
datasets were constructed for phylogenetic analyses for the FFSC,
rooted with F. nirenbergiae CBS 744.97. Phylogenetic analyses of
the FIESC were performed by using the combined CaM, rpb2 and
tef1 datasets, rooted with F. concolor NRRL 13459. Phylogenetic

94
 Table 1. Primers used in this study, with originating loci, sequences program and references.
Gene/DNA regions Primers

Name Abbreviation Name Direction Sequence (5’→3’) PCR amplification procedures References
Beta tubulin tub T1 Forward AACATGCGTGAGATTGTAAGT 95 °C 3 min; 35 cycles of 94 °C 30 s, 54 °C 45 s, 72 °C 15 s; 72 O’Donnell & Cigelnik (1997)
°C 10 min; 10 °C soak
T2 Reverse TAGTGACCCTTGGCCCAGTTG

Calmodulin CaM CL1 Forward GARTWCAAGGAGGCCTTCTC 95 °C 1 min; 35 cycles of 94 °C 30 s, 55 °C 30 s, 72 °C 15 s; 72 O’Donnell et al. (2000b)
°C 10 min; 10 °C soak
CL2A Reverse TTTTTGCATCATGAGTTGGAC

Histone H3 H3-la Forward ACTAAGCAGACCGCCCGCAGG 96 °C 2 min; 30 cycles of 92 °C 1 min, 60 °C 1 min, 72 °C 10 s; Roux et al. (2001)
72 °C 5 min; 10 °C soak

www.studiesinmycology.org
H3-lb Reverse GCGGGCGAGCTGGATGTCCTT

Internal transcribed spacer region of the ITS ITS1 Forward CCGTAGGTGAACCTGCGG 95 °C 5 min; 35 cycles of 95 °C 30 s, 52 °C 30 s, 72 °C 10 s; 72 White et al. (1990)
rDNA °C 5 min; 10 °C soak
ITS4 Reverse TCCTCCGCTTATTGATATGC

RNA polymerase largest subunit rpb1 F7 Forward CRACACAGAAGAGTTTGAAGG 95 °C 5 min; 5 cycles of 95 °C 2 min, 58 °C 45 s, 72 °C 20 s; 5 O’Donnell et al. (2010)
cycles of 95 °C 2 min, 57 °C 45 s, 72 °C 20 s; 35 cycles of 95
G2R Reverse GTCATYTGDGTDGCDGGYTCDCC °C 2 min, 56 °C 45 s, 72 °C 20 s; 72 °C 10 min; 10 °C soak

RNA polymerase second largest subunit rpb2 5f2 Forward GGGGWGAYCAGAAGAAGGC 94 °C 90 s; 35 cycles of 94 °C 45 s, 57 °C 45 s, 72 °C 20 s; 72 Reeb et al. (2004)
°C 5 min; 10 °C soak
7cf Forward ATGGGYAARCAAGCYATGGG Liu et al. (1999)

7cr Reverse CCCATRGCTTGYTTRCCCAT

11ar Reverse GCRTGGATCTTRTCRTCSACC

translation elongation factor 1-alpha tef1 EF-1 Forward ATGGGTAAGGARGACAAGAC 94 °C 90 s; 35 cycles of 94 °C 45 s, 55 °C 45 s, 72 °C 15 s; 72 O’Donnell et al. (1998b)
°C 10 min; 10 °C soak
EF-2 Reverse GGARGTACCAGTSATCATG

95
Fusarium spp. on cereals in China
Han et al.

Fig. 7. Pathogenicity test of maize stalk rot (MSR) fulfilling Koch’s postulates. A. Diagram of a three-leaf-old seedlings of maize. B. Typical symptoms
of disease severity (0–4). C. Blank control treated with sterile water. D–U. Maize seedlings treated with different Fusarium suspensions. The conidial
concentration (CC) of Fusarium strains and disease severity index (DSI) of infected plants were listed. DSI (%) = [sum (class frequency × score of rating
class)/(total number of plants × maximal disease severity score)] × 100.

96

analyses of the F. nisikadoi species complex (FNSC) were
performed by using the combined rpb1, rpb2 and tef1 datasets,
rooted with F. concolor NRRL 13994. Phylogenetic analyses of the
FOSC were performed by using the combined CaM, rpb2 and tef1
datasets, rooted with F. udum CBS 177.31. Phylogenetic analyses
of the FSAMSC were performed by using the combined H3, rpb1,
rpb2 and tef1 datasets, rooted with F. nelsonii NRRL 13338.
Phylogenetic analyses of the F. tricinctum species complex (FTSC)
were performed by using the combined ITS, rpb1, rpb2 and tef1
datasets, and rooted with F. concolor NRRL 13459.
Morphological observations
Fungal isolates were studied morphologically based on their
macroscopic and microscopic features (Crous et al. 2021). Petri
plates were incubated for 7 d at 25 °C. Agar pieces of approximately
5 × 5 mm were taken from edge of colonies on synthetic nutrient-
poor agar (SNA; Nirenberg 1976) and transferred onto media for
morphological characterisation. For morphological observations,
PDA and oatmeal agar (OA) media were used. The culture
characteristics of the colony, including pigmentation and odour,
were observed after 7 d of incubation in the dark on PDA and OA
(Crous et al. 2021). Colours were rated according to the colour
charts of Kornerup & Wanscher (1978).
For morphological comparisons, carnation leaf agar (CLA;
Fisher et al. 1982) was used. Micromorphological characteristics,
including sporodochia, conidiophores, phialides, conidia
(sporodochial and aerial conidia) and chlamydospores, were
observed after 7–14 d of incubation under a 12/12 h near-ultraviolet
light/dark cycle at 25 °C (Leslie & Summerell 2006, Crous et al.
2021). Morphological characteristics were examined and photo-
documented with water as mounting medium under a Nikon 80i
compound microscope with differential interference contrast
(DIC) optics, and a Nikon SMZ1500 dissecting microscope. For
each species, 30 phialides and chlamydospores, and 50 conidia
were randomly measured to calculate the mean value, standard
deviation, and minimum–maximum values.
Whole-genome sequencing, assembly and gene
annotation
Whole-genome sequences were generated for eight ex-type
strains of new species (i.e., F. erosum, F. fecundum, F. jinanense,
F. mianyangense, F. nothincarnatum, F. planum, F. sanyaense, and
F. weifangense) and 32 strains of known species (Supplementary
Table S3). All strains were purified using a single-spore isolation
method (Zhang et al. 2013). Hyphae of 7-d-old colonies growing on
PDA were collected and then stored at -80 °C. Genome extraction
and sequencing were done by the Annoroad Gene Technology
Company (Beijing, China). The DNA libraries were sequenced
as 150 bp pair-end reads using Illumina NovaSeq 6000 platform.
Reference genomes were retrieved from the public database
(Supplementary Table S3).
The genome assembly and gene annotation were conducted
following the protocol of Ma et al. (2021). Specifically, read quality was
assessed by using FastQC v. 0.11.8 (Andrews & Babraham 2010).
Clean reads were assembled with SPAdes v. 3.12.0 (Bankevich et
al. 2012), using the “careful” mode and various kmers (21, 33, 55,
77, 99). Genome assembly quality was assessed using QUAST v.
5.0.2 (Alexey et al. 2013). Genome completeness was assessed
using genome mode in BUSCO v. 5.3.2 (Seppey et al. 2019), with
www.studiesinmycology.org
Fusarium spp. on cereals in China
the Sordaromyceta_odb9 gene set. Gene predictions were made
using the Funannotate pipeline v. 1.7.0 (Palmer 2016); repetitive
elements were initially soft-masked using default parameters;
funannotate predict was implemented using Sordariomycetes
BUSCO database and Fusarium graminearum as seed species.
Genome assemblies were deposited in the National Microbiology
Data Centre (NMDC) under BioProject NMDC10018280.
Phylogenomic tree construction
Predicted proteins were clustered into orthologous groups by
using Orthofinder v. 2.3.3 (Emms & Kelly 2015, 2019). Amino acid
sequences of single-copy orthologs were aligned using MAFFT
v. 7 (Katoh & Standley 2013). Conserved sites in the alignment
were extracted using Gblocks v. 0.91b (Castresana 2000). The
substitution model and maximum-likelihood tree were inferred
by IQ-TREE v. 2.2.0.8 (Kalyaanamoorthy et al. 2017, Hoang et
al. 2018, Minh et al. 2020a), and the clade is supportive when its
ultrafast bootstrap (UFBoot) support value is ≥ 95 %. In addition,
gene concordance factors (gCF) and site concordance factors
(sCF) were calculated using the “–gcf” and “–scf” options in IQ-
TREE v. 2.2.0.8 (Minh et al. 2020b), to quantify genealogical
concordance. For every branch of a species tree, gCF is defined
as the percentage of “decisive” gene trees containing that branch,
and sCF is defined as the percentage of decisive alignment sites
supporting that branch (Minh et al. 2020b).
Diversity and distribution analyses
The richness of Fusarium species was defined as recorded species
number associated with different hosts and climate regions (hosts:
maize, rice, wheat; climate regions: regions affected by plateau
mountain, subtropical monsoon, temperate continental, temperate
monsoon, and tropical monsoon climate). Co-infection was defined
as a single diseased cereal sample (e.g., a single wheat head,
maize ear) from which more than one Fusarium species was
isolated. The relative percentage was calculated by counting the
number of each Fusarium species presented in different groups,
and was visualised by the ggplot2 package in R v. 4.1.0 (Wickham
2016). The diversity of Fusarium species and distribution patterns
across different hosts and geographic regions were performed
using GraphPad Prism v. 8.0.2.
Pathogenicity assays
Pathogenicity tests were performed to determine whether the
species isolated from the symptomatic tissues of diseased cereals
are pathogens. The Fusarium species isolated from maize stalk rot
were used as examples, because maize is the largest grain crop in
China (http://www.stats.gov.cn/), and maize stalk rot has been one
of the primary diseases that threaten maize production in recent
years (Wang et al. 2010). In brief, we completed pathogenicity
tests fulfilling Koch’s postulates of all Fusarium species isolated
from maize, which have not yet been reported as causal agents of
maize stalk rot in previous studies.
Specifically, representative isolates were inoculated on
seedlings of the maize cultivar Zhengdan 958, as Ye et al. (2013)
and Han et al. (2022) described but with slight modifications.
Hyphae of 7-d-old colonies growing on SNA were transferred to 400
mL of carboxymethylcellulose sodium fluid medium, and cultivated
for 3–7 d at 25 °C at 180 rpm. Then the conidial concentration
97
Han et al.

LC18483
0.009 LC18740
LC18518
LC18623
FFSC LC18416
CaM-rpb1-rpb2-tef1-tub2 LC18470
LC18838
LC18468
CBS 734.97
New Chinese record LC18434
LC18389
New host record (maize) 75/-
LC18645
LC18746
New host record (rice) LC18624
LC18408
LC18490
New host record (wheat) LC18755
LC18430
LC18736
LC18797
LC18491
LC18587
LC18707
LC18836
LC18479
LC18296
LC18830
African clade

LC18754
LC18842
LC18466
LC18495
-/0.98 LC18839
LC18431
LC18599
LC18834
LC18469
Asian clade

LC18519
LC18841
LC18651
LC18843
African clade C
LC18471
LC18388
LC18604
American clade

0.01
LC18760
LC18547
LC18482
LC18500
African clade B LC18526 F. verticillioides
LC18562
LC18418
LC18586
76/0.99
LC18735
LC18494

African clade
LC18433
LC18437
LC18757
LC18465
LC18751
LC18616
LC18467
LC18714
LC18248
LC18459
LC18462
LC18741
LC18615
LC18503
CBS 218.76 ET
LC18729
LC18394
77/-
LC18461
LC18460
LC18399
86/- LC18498
74/-
LC18464
LC18475
LC18391
87/1 LC18730
88/1
-/1 LC18725
LC18607
83/- LC18598
LC18450
LC18525
LC18828
2× LC18456
100/1 LC18727
LC18432
LC18613
76/0.99 LC18458
LC18463
LC18827
LC18489
-/0.97 CBS 119825
100/1 CBS 624.87 T
NRRL 28893 F. musae

Fig. 8. Phylogeny inferred based on the combined CaM-rpb1-rpb2-tef1-tub2 gene regions of the Fusarium fujikuroi species complex (FFSC). Fusarium
nirenbergiae (CBS 744.97) was used as an outgroup. Strains isolated in this study were indicated in red. Pathogenetic strains from previous studies were
indicated in green. The RAxML Bootstrap support values (ML-BS > 70 %) and Bayesian posterior probabilities (BI-PP > 0.9) were displayed at the nodes
(ML-BS / BI-PP). Ex-type, ex-epitype and ex-neotype strains were indicated in bold with T, ET, and NT, respectively.

98
 Fusarium spp. on cereals in China

PPRI 20386
0.009 98/1 PPRI 20458 T F. curculicola
92/1 PPRI 20464
FFSC 100/1 98/1 NRRL 25615 F. volatile
CaM-rpb1-rpb2-tef1-tub2 CBS 143874 T
NRRL 66233 T F. coicis
86/1 CMM 3557 T F. gigantea
New Chinese record LC18578
87/1
76/- LC15876 T
LC18411
New host record (maize) R34
86/- F. planum sp. nov.
95/1
LC18487
New host record (rice) LC18445
91/1
LC18541
New host record (wheat) 100/- LC18737
98/1 CBS 119856
CBS 119857 T F. andiyazi
CML 2756
100/1 100/1 CBS 146656
-/0.99 -/0.99 CBS 146669 T F. madaense
100/1 CML 2813
CML 2791
African clade

CML 3858
78/1 CML 3871
CML 3872 F. mirum
CML 3859 T
88/- PPRI 2188.3 T
-/0.97 100/1 PPRI 20462 F. casha
83/1 PPRI 20468
Asian clade

NRRL 66243 T F. tjaetaba

100/1 CBS 135139
99/1
CBS 748.97 T F. napiforme
African clade C 100/1 CBS 526.97 F. ramigenum

African clade
CBS 418.97 T
100/1 CBS 776.96 T F. thapsinum
0.01
American clade

CBS 100312
100/1 CBS 404.97 T F. brevicatenulatum
100/1 CBS 100196
100/1 CBS 414.97 T
African clade B 92/1 CBS 745.97 F. pseudoanthophilum
100/1 CBS 484.94
93/1 CBS 417.97 T F. pseudonygamai
CPC 30825
99/1
CBS 146498 T F. prieskaense
100/1
100/1 CBS 125181 F. ficicrescens
CBS 125178 T
100/1 CBS 675.94 F. sudanense
74/1 CBS 454.97 T
100/1 CBS 119850
92/1 CBS 483.94 T F. terricola
95/-
100/1 CBS 139387 F. nygamai
CBS 749.97 T
100/1 NRRL 66890 F. xyrophilum
NRRL 62721 T
100/1 CBS 449.97 T F. pseudocircinatum
CBS 455.97
100/1 CBS 407.97 T F. denticulatum
86/0.98 CBS 406.97
100/1 CBS 420.97 F. lactis
CBS 411.97 ET
100/1 CML 3163 F. brachiariae
CML 3032 T
100/1 CML 3657 T F. caapi
CML 3658
100/1 RGB5717 T F. mundagurra
99/1 NRRL 25221 T
100/1 NY 001B5 F. chinhoyiense
100/1 CBS 749.79 F. xylarioides
-/0.98 CBS 258.52 T
71/- CBS 216.76 T F. phyllophilum
CBS 246.61
100/1 NRRL 52712 F. longicornicola
100/1 NRRL 52706 T
100/1 LC7502 T F. aquaticum
70/1 LC13615
NRRL 25199 ET F. udum
86/1 CBS 178.32
100/1 NRRL 62594 F. secorum
99/1 NRRL 62593 T
100/1 CBS 402.97 T F. acutatum
CBS 137545

Fig. 8. (Continued).

www.studiesinmycology.org 99
Han et al.

LC18602
0.009 LC18804
LC18512
FFSC LC18622
CaM-rpb1-rpb2-tef1-tub2 LC18802
LC18497
LC18492
New Chinese record LC18807
LC18756
New host record (maize) LC18655
LC18743
New host record (rice) LC18496
LC18818
New host record (wheat) LC18571
LC18677
LC18753
LC18811
LC18528
LC18405
LC18398
LC18786
LC18355
African clade

88/1 LC18390
LC18809
LC18798
LC18806
LC18392
LC18781
ITEM 2341
LC18654
Asian clade

24ALH “F. proliferatum ” in Wulff et al. (2010);

LC18658 causing rice bakanae disease
African clade C
LC18439
LC18829
NRRL 25089
LC18517
American clade

0.01

LC18480
LC18527
LC18706
African clade B CBS 139739
LC18762
LC18734
LC18424 F. annulatum
LC18511
LC18501

Asian clade
F1 “F. proliferatum ” in Okello et al. (2019);
LC18493 causing corn root rot
LC18406
CBS 115.97
LC18417
LC18600
LC18821
LC18627
CBS 217.76 representative isolate of
LC18478 “F. proliferatum ” in previous studies
LC18502
LC18717
LC18521
LC18589
LC18790
-/1 LC18646
LC18653
84/0.99 LC18448
LC18657
-/0.97 LC18472
LC18831
98/1 LC18647
LC18833
97/-
LC18538
CBS 258.54 T
-/0.97
LC18817
LC18803
P2 “F. proliferatum ” in Okello et al. (2019);
NRRL 62905 causing corn root rot
90/1 51ALH “F. proliferatum ” in Wulff et al. (2010);
LC18566 causing rice bakanae disease
LC18591
79/-
LC18713
LC18728
LC18548
CBS 143605
80/1
LC18414
100/1 95/1 LC18726
CBS 792.91
CBS 137537
LC18801
Azerbaijan 71-3 “F. proliferatum ” in Özer et al. (2020);
LC18481 causing wheat crown and root rot
91/-
LC18473
84/1
100/1 LC13644 T F. hechiense
LC13645

Fig. 8. (Continued).

100
 Fusarium spp. on cereals in China

0.009 100/1 LC18579

LC15877 T F. erosum sp. nov.
100/1 LC18581
FFSC 88/1 CPC 27189
CBS 142222 T F. siculi
CaM-rpb1-rpb2-tef1-tub2 92/1
CBS 430.97
98/1 CBS 429.97
CBS 431.97 F. globosum
New Chinese record
CBS 428.97 T
LC18791
New host record (maize) LC18819
LC18776
New host record (rice) LC18626
100/1 LC18788
New host record (wheat) LC18789
-/0.96
LC18611
-/0.99 LC18824
LC18446
76/0.98 CBS 221.76 T
CBS 265.54 F. fujikuroi
84/- LC18569
NRRL 13289
LC18814
African clade

LC18499
100/0.99 LC18601
-/0.99 LC18656

Asian clade
96/1 LC18413
LC18367
LC18588
81/1 LC18564
99/1 LC18597
Asian clade

LC18606
-/0.99
LC18590
LC13628
African clade C LC13627 T F. elaeagni
99/1 LC18815
CBS 119853
American clade

0.01
100/1 NRRL 25226
100/1 96/1
F. mangiferae
CBS 120994 T
CBS 480.96 ET
100/1
F026 F. proliferatum
African clade B
LC18540
100/1 LC15882 T F. sanyaense sp. nov.
LC18537
InaCCF872 T
InaCCF993 F. lumajangense
91/1 LC18523
CBS 453.97
-/1 LC18820
100/1 F. concentricum
95/1 CBS 450.97 T
LC18575
90/0.99 LC13656 T F. panlongense
100/1 MUCL 55950
100/1 CBS 148464 T F. chuoi
ZHKUCC_22_0079
100/1 ZHKUCC_22_0078 F. aglaonematis
100/1 ZHKUCC_22_0077 T
NRRL 28852 T F. fractiflexum
LC18574
87/-
LC18536
CBS 139376
99/1 72/1
LC18563 F. sacchari
100/1 LC18533
100/1 CBS 223.76 ET
LC18522
clade C
African

BRIP 71717 T F. dhileepanii

100/1 CBS 146497 T
CBS 146496 F. echinatum

Fig. 8. (Continued).

(CC) of Fusarium suspension were adjusted to 106~107 conidia/mL
by haemocytometer, and the suspension were stored at 4 °C until
maize seedlings became three-leaf-old. The maize kernels were
soaked in water for 24 h, moisturised in a wet chamber for 48 h,
and then incubated in sterilised soil under 16 h of light and 8 h of
darkness at 25 °C. After 7 d, the roots (three-leaf-old seedlings, Fig.
7A) were immersed into the prepared suspension and incubated for
6 h at 25 °C, then transferred to soil (25 °C, 16 h light/25 °C, 8 h
dark). As a negative control, seedlings were inoculated with sterile
water. For each tested fungal strain, eight plant replicates were
used for the pathogenicity test. Pathogenicity was evaluated based
on leaf symptoms of the tested maize plants 3 d post-inoculation.
Koch’s postulates were fulfilled by re-isolating the fungus from
symptomatic plants.
Disease severity was estimated visually on a 0 to 4 scale as
described in previous studies (Jin et al. 1994). Disease severity
was displayed in Fig. 7B and categorised as follows: 0, no visible
symptoms; 1, the dry area of the first leaf under 50 %, and the dry
area of the second leaf under 25 %; 2, the dry area of the first leaf
over 50 % but under 100 %, and the dry area of the second leaf
under 50 %; 3, the first leaf was completely withered, the dry area
of the second leaf over 50 % but under 100 %, and the dry area
of the third leaf was under 25 %; 4, the three leaves of inoculation
plants were completely withered. The disease severity index (DSI)
was calculated based on Chiang et al. (2017). Specifically, DSI (%)
= [sum (class frequency × score of rating class)/(total number of
plants × maximal disease severity score)] × 100.

www.studiesinmycology.org 101
Han et al.

NRRL 66333
0.009 LC18808
LC18573
73/-
FFSC LC18810
LC18603
CaM-rpb1-rpb2-tef1-tub2 LC18840
LC18532
LC18731 F. subglutinans
New Chinese record 100/1
LC18457
LC18484
New host record (maize) LC18837
74/1 CBS 747.97 NT
New host record (rice) LC18835
84/- LC18249
New host record (wheat) LC18783
LGMF 1930 T F. awaxy
88/0.98 LC18488
LC18785
LC18813
-/1 LC18531
LC18812 F. temperatum
99/1
MUCL 52463 T
African clade

100/1
100/1
CBS 135539
98/-
LC18577
LC18455
98/1 NRRL 20476
CBS 100057 T F. bactridioides
-/1 90/- CBS 222.76 ET
F. anthophilum

American clade
CBS 119858
CBS 187.34
Asian clade

98/1 CBS 219.76 ET

F. succisae
2×
NRRL 25807 T F. babinda
African clade C
CBS 125535 T F. werrikimbe
100/1 CBS 139383
CBS 119849 T F. konzum
CMW 25245 T F. fracticaudum
American clade

0.01

CMW 25267 T F. parvisorum

96/1 NRRL 53984 T F. tupiense
CMW 25243 T F. pininemorale
African clade B CMW 25512 T F. marasasianum
CBS 119864
70/1 100/1 CBS 405.97 T F. circinatum
-/1 CBS 137242 T F. sororula
100/1 NRRL 29123
F. pilosicola
100/1 -/1 NRRL 29124 T
CBS 220.76 T F. bulbicola
100/1 100/1 CBS 118516 T
-/0.96 F. ananatum
100/1 CMW 28598
CBS 409.97 T F. guttiforme
99/1
CBS 452.97 T
CBS 403.97 F. begoniae
100/1
NRRL 25623 T F. sterilihyphosum
2× CBS 118515
F. ophioides
100/1 CBS 118512 T
NRRL 53147 T F. mexicanum
NRRL 53580
100/1 CBS 100193
F. agapanthi
clade B
NRRL 54463 T African
100/1 CBS 119860 T
CBS 481.94 F. dlaminii
CBS 144209 T F. fredkrugeri
CBS 744.97 F. nirenbergiae Outgroup

Fig. 8. (Continued).

RESULTS FNSC (Supplementary Fig. S5), FOSC (Supplementary Fig. S6),

Phylogenetic analyses
The preliminary phylogenetic analyses based on combined rpb2
and tef1 loci revealed that the 608 representative isolates were
distributed over six Fusarium species complexes (Supplementary
Fig. S2). Phylogenetic analyses were performed respectively for
each Fusarium species complex using different datasets. Combined
with morphological characters, these isolates were identified to 12
species in the FFSC (Fig. 8), 17 species in the FIESC (Fig. 9), one
species in the FNSC (Fig. 10), two species in the FOSC (Fig. 11),
nine species in the FSAMSC (Fig. 12), and two species in the FTSC
(Fig. 13). In summary, the 608 selected strains were identified to 43
species, including 35 known and eight novel species.
Furthermore, single gene trees were evaluated respectively for
FFSC (Supplementary Fig. S3), FIESC (Supplementary Fig. S4),
FSAMSC (Supplementary Fig. S7) and FTSC (Supplementary Fig.
S8). The phylogenetic analyses based on single genes showed that
the rpb2 locus provided a better resolution in species recognition
for the six species complexes. Using the three most species-rich
complexes (FFSC, FIESC, FSAMSC) as examples, the rpb2 locus
was able to recognise 59, 33, and 35 species among the FFSC
(with 84 species), FIESC (with 44 species), and FSAMSC (with 41
species), respectively.
Phylogenomic assessment of Fusarium and allied
genera
Employing 228 assembled genomes covering 17 Fusarium
species complexes, 11 Fusarium allied genera and one outgroup
(Stylonectria norvegica IHI 201603), a high-confidence and genome-

102
 Fusarium spp. on cereals in China

LC18700
0.03 LC18823
LC18695
FIESC LC18261
CaM-rpb2-tef1 LC18632
LC18444
New Chinese record LC18421
LC18745
New host record (maize) LC18738
LC18799
New host record (rice) LC18698
LC18508
New host record (wheat) LC18419
LC18402
LC18633
LC18425
LC18649
LC18684
LC18689
LC18340
LC18429
Incarnatum clade

LC18642

Incarnatum clade
LC18696
LC18514 F. luffae
LC18693
LC18451
LC18404
LC18794
LC18694
LC18687
LC18635
74/- LC18428
LC18504
Equiseti clade

LC18477
LC18407
10× LC18362
LC18544
DG1301 “F. incarnatum ” in Gai et al. (2016);
LC18644 causing maize stalk rot
LC18673
LC18545
Camptoceras 96/1
LC12167 T
clade NRRL32522
10×
70/- LC18443
0.05 LC18410
83/1 LC18683
LC18686
CQ1038

Fig. 9. Phylogeny inferred based on the combined CaM-rpb2-tef1 gene regions of the Fusarium incarnatum-equiseti species complex (FIESC). Fusarium
concolor (NRRL 13459) was used as an outgroup. Strains isolated in this study were indicated in red. Pathogenetic strains from previous studies were
indicated in green. The RAxML Bootstrap support values (ML-BS > 70 %) and Bayesian posterior probabilities (BI-PP > 0.9) were displayed at the nodes
(ML-BS / BI-PP). Ex-type, ex-epitype and ex-neotype strains were indicated in bold with T, ET, and NT, respectively.

scale phylogenetic tree was generated (Fig. 14). The Gblocks filtered
alignment of 1 001 single-copy orthologs (Supplementary Table S4)
consisted of 223 451 characters, including alignment gaps. The
genome sizes of the four cereal-associated species-rich complexes
(i.e., FFSC, FIESC, FOSC and FSAMSC) differed significantly (P
< 2e-16, Supplementary Fig. S9), with FOSC having the largest
genome size (av. ± SD: 52.6 ± 4.2 Mb) and FSAMSC having the
smallest genome size (av. ± SD: 37.5 ± 3.7 Mb). In our phylogenomic
tree, 193 nodes (86 %) received 100 % bootstrap support, including
the nodes F1, F2, and F3 (Fig. 14). Meanwhile, the gCF and sCF
values resolved higher in node F3 (gCF 71.1 %, sCF 70.3 %) than
in F2 (gCF 46.5 %, sCF 46.7 %) and F1 (gCF 51.3 %, sCF 47.1 %).
There are only two subtle topology differences between our
phylogenomic tree (Fig. 14) and the multi-locus trees in previous
studies (Xia et al. 2019, Crous et al. 2021, Wang et al. 2022a). First,
in our phylogenomic tree, F. camptoceras (previously included in
F. camptoceras species complex, FCAMSC) clustered within the
Equiseti clade of the FIESC (Fig. 14), while the FCAMSC formed a
separate sister clade to the FIESC in previous phylogenetic studies
(Xia et al. 2019, Crous et al. 2021, Wang et al. 2022a). This is not
surprising, as when considering the FIESC and the FCAMSC as two
separate species complexes, the clade representing the FIESC was
not statistically supported in previous phylogenetic trees (Xia et al.
2019, Crous et al. 2021, Wang et al. 2022a), indicating that previous
multi-locus analyses could not provide sufficient phylogenetic
resolution to reveal the evolutionary relationship between the two
species complexes. However, when the FCAMSC and the FIESC
were considered together as a whole, this larger group is clearly
a distinct evolutionary lineage that is highly supported in the
phylogenomic tree (support value = 100 %; Fig. 14), as well as in
previous multi-locus trees (Crous et al. 2021). Therefore, we herein
include the FCAMSC in FIESC as the Camptoceras clade (Fig. 14).
Second, Bisifusarium (also known as F. dimerum species complex)
and Rectifusarium (also known as F. ventricosum species complex),
appearing basal in the tree, were paraphyletic in our phylogenomic
tree (Fig. 14), in agreement with Lombard et al. (2015) and Crous et
al. (2021), but differed from O’Donnell et al. (2013) and Geiser et al.
(2021) in which Bisifusarium and Rectifusarium clustered together
forming a separate clade. However, in both publications, the clade
including Bisifusarium and Rectifusarium was not statistically
supported (O’Donnell et al. 2013, Geiser et al. 2021). Overall, our
phylogenomic tree is essentially similar with that of Crous et al.
(2021), and our data resolved several remaining conflicts among
phylogenies inferred from different studies.

www.studiesinmycology.org 103
Han et al.

LC18595
LC18674
0.03 LC18631
LC18691
FIESC LC18682
CaM-rpb2-tef1 LC18716
LC18584
New Chinese record LC18567
LC18793
New host record (maize) LC18816
LC18513
New host record (rice) LC18648
LC18420
New host record (wheat) LC18629
LC18630
LC18742
LC18454 F. sulawesiense
NRRL43730
LC18510
LC18641
LC18638
LC18267
Incarnatum clade

LC18634
78/- LC18618
LC18685
LC18612
LC18792
-/0.99 LC18426
LC18442
LC18620
LC18614
LC18787
LC18692
-/0.99
LC18699

Incarnatum clade
LC18294
Equiseti clade

84/- LC18608
LC18576
10× LC18688
LC18396
LC18640
LC18539
InaCC F940 T
LC18400
87/1 Indo 167
Camptoceras Fusarium sp. (FIESC32)
10×
clade InaCC F964
LC18625
0.05 LC18295
LC18535
SDBR-CMU425 “F. melonis ” in
SDBR-CMU424 Khuna et al. (2022)
93/1 LC18585
LC18423 F. pernambucanum
96/1
LC18380
NRRL 34070
86/- LC18702
URM 7559 T
NRRL32181
NRRL34001
NRRL 31160
94/0.99
94/1 NRRL32182 F. mianyangense sp. nov.
LC15879 T
99/0.98 LC18549
83/-
100/1 SDBR-CMU423 F. citrullicola
98/1 SDBR-CMU422 T
LC12145
90/1 LC12146
LC7188 T F. irregulare
85/0.98
MRC 2804
98/1 NRRL 54142
NRRL 43639 T F. multiceps
100/1 NRRL 34003
MUM 1859 T F. caatingaense

Fig. 9. (Continued).

Phylogenomic analyses within the FSAMSC
FSAMSC is one of the most species-rich complexes containing 41
accepted species, 35 of which have available genome data. Species
within the FSAMSC particularly the Fg clade, however, exhibit
almost indistinguishable morphological differences (Sarver et al.
2011) and few nucleotide differences (Laraba et al. 2021), although
they have been recognised as different species in previous studies
(O’Donnell et al. 2000a, 2004, Starkey et al. 2007). Therefore, to
better understand the evolutionary relationship of species within
the FSAMSC, especially the Fg clade, a phylogenomic tree of
the FSAMSC (Fig. 15) was inferred employing 5 139 single-copy
orthologs (Supplementary Table S5) obtained from 81 assembled
genomes, with Fusarium nelsonii NRRL 13338 as an outgroup (Fig.
15). Our phylogenomic tree is strongly supported by UFBoot values,
but weakly supported by gCF and sCF values (Supplementary
Fig. S10B), suggesting strongly conflicting signals among genes
(Minh et al. 2020b). Meanwhile, the conflicting topologies were

104
 Fusarium spp. on cereals in China

LC18441
75/0.99 LC18452
0.03 -/0.99
LC18675
FIESC LC18636
CaM-rpb2-tef1 LC18795
LC18506
New Chinese record LC18710
73/0.99 LC18534
LC18610
New host record (maize) 96/0.98 InaCC F965 T F. tanahbumbuense
100/1
LC18659
New host record (rice) LC18427
97/1 LC18438
New host record (wheat) Azerbaijan 53-3 “F. cf. incarnatum ” in Özer et al. (2020)
Azerbaijan 43 causing wheat crown and root rot
70/0.97 LC18805
100/1 LC12160 T F. guilinense
85/1
100/1 CBS 161.25 Ex-type of “F. bubalinum ”
LC18436 T in Xia et al. (2019)
NRRL 13379
100/1 LC18382
F. nothincarnatum sp. nov.
Incarnatum clade

97/1 CBS 132907

Incarnatum clade
-/0.95 NRRL 32866
100/1 ITEM 7155
F. incarnatum
CBS 132.73 NT
NRRL 54973 T F. monophialidicum
NRRL 20841 T F. coffeatum
LC18709
99/1 NRRL 22244
73/- LC18596
86/- LC18800 F. nanum
100/1 LC12168 T
89/1
LC18363
98/1 LC18681
Equiseti clade

98/1 ITEM 6748

CBS 143598 F. persicinum
10× 79/0.97
CBS 479.83 T
JS21 “F. incarnatum ” in Wang et al. (2021)
JS9 causing rice spikelet rot
96/1 JS3 F. hainanense
100/1
LC18701
LC11638 T
83/0.99 90/1 NRRL 26417
Camptoceras
clade
CBS 131385 T F. aberrans
10× CBS 119866
0.05 LC18243
LC7922
-/0.98
LC18333 T
CBS 130905 F. weifangense sp. nov.
99/1 LMSF-Id01
CBS 621.87
100/1 CPC 35143
83/-
LC18311
LC18317
98/1 93/1 LC6896 T F. citri
NRRL 52765
94/1 CQ1039 T
100/1 LC18763 F. humuli
LC18553
100/1 CBS 131383
F. fasciculatum
CBS 131382 T

Fig. 9. (Continued).

further confirmed by the comparison of phylogenomic and multi-
locus phylogenetic trees (see Supplementary Fig. S11 for more
details). This discordance is potentially due to incomplete lineage
sorting (ILS), horizontal gene transfer (HGT), gene duplication
and loss, hybridisation, or recombination (Degnan & Rosenberg
2009). In general, both phylogenomic and multi-locus phylogenetic
trees revealed five major clades (Graminearum, Sporotrichioides,
Sambucinum, Brachygibbosum and Longipes clades), and both
provide effective resolution for species delimitation within the
FSAMSC.
Distribution and pathogenicity of Fusarium spp. on
diseased cereals
Based on multi-locus phylogenetic analyses, the 608 representative
Fusarium strains were identified as 43 species. Further analyses
showed that species richness is higher on maize (34 species),
followed by wheat (23 species) and rice (18 species), and only nine
species were shared by all three kinds of cereals (Fig. 16A, C).
Species with high proportion of isolation in maize samples were
F. verticillioides (24 %) and F. annulatum (17 %), compared to F.
asiaticum (30 %) and F. graminearum (22 %) in wheat samples and
F. sulawesiense (17 %) in rice samples (Fig. 16B). The majority of
Fusarium species collected in this study (98 % species from 90 %
samples) were from regions affected by a monsoon climate (Fig.
16C, Supplementary Table S1).
Interestingly, a total of 315 diseased samples were used for
fungal isolation. Of these, 176 samples (56 %) were observed
to have a co-infection (Fig. 17), half of which contain previously
reported dominant pathogens, including F. annulatum (previously
usually known as “F. proliferatum”), F. asiaticum, F. graminearum, F.
pseudograminearum, and F. verticillioides (Fig. 17, Supplementary
Table S6). In addition, co-infection by two species can be observed
from 59 % of the samples (Supplementary Fig. S12).

www.studiesinmycology.org 105
Han et al.

0.03 LC18422
LC18341
LC18339
FIESC
LC18822
CaM-rpb2-tef1 LC18242
95/1
LC18664
New Chinese record LC18759
LC18619
New host record (maize) LC18639 F. ipomoeae
-/0.95
LC18447
New host record (rice) LC0166
74/1 LC7923
New host record (wheat) mmpp-1 “F. equiseti ” in Li et al. (2014)
100/1
LC18509 causing corn sheath rot
LC18453
98/1
81/1 LC18697
LC18474
80/0.98 98/1 LC18409
LC18378
LC12165 T
LC18561
Incarnatum clade

99/1
NRRL 36448 T
NRRL36401 F. duofalcatisporum
89/0.98 100/1 NRRL 36323 ET
F. compactum
LC18530
LC18379
LC15878 T
89/0.99 -/0.99 LPPC072
99/1

Equiseti clade
LPPC079 F. jinanense sp. nov.
-/0.96 LPPC078
LPPC076 “Fusarium sp.”
98/1 LPPC056 in Lima et al. (2020)
74/0.98
LPPC077
Equiseti clade

98/1 FRCR10113 “FIESC 31a” in Short et al. (2011)

IMI 300797 T
10× MRC 2609
NRRL52753 F. lacertarum
94/1 2Ar097
78/1 NRRL 36123
Azerbaijan 63-6
Azerbaijan 57-5 “F. equiseti ” in Özer et al. (2020)
Azerbaijan 61-5 causing wheat crown and root rot
Camptoceras 80/1 Azerbaijan 75-5
clade
10× Azerbaijan 26-8 F. clavus
Azerbaijan 33-5
0.05 Azerbaijan 16-6
100/1 F16 “FIESC ” in Okello et al. (2019);
CBS 126202 T causing corn root rot
10× LC18293
-/1 LC18605
100/1 LC6026
100/1
LC18440 F. arcuatisporum
71/0.96
LC12147 T
97/1
NRRL 25477 T F. longicaudatum
NRRL 43638 T F. brevicaudatum
-/0.97
CBS 119880 T F. serpentinum
80/1 NRRL 26922 T F. neoscirpi
-/0.95 NRRL 36478 NT F. scirpi
CBS 148244 T F. wereldwijsianum
ATCC 11853 T F. cateniforme
NRRL 36372 F. longifundum
97/1 CBS 307.94 ET
100/1 CPC35134 F. equiseti
NRRL 25796 T
100/1 NRRL43636
F. toxicum
90/1
NRRL 43635 T F. gracilipes
NRRL 36269 T F. flagelliforme
CBS 131777 T
100/1 CBS 131788 F. croceum
CPC 35240
100/1 Indo 175
F. mucidum
CBS 102395 T
Camptoceras

100/1 CBS 190.60

93/1 CBS 189.60 T F. neosemitectum
clade

100/1 IMI 112500 ET F. camptoceras

96/1 InaCC F963 T F. kotabaruense
98/- LC18372
100/1 LC18376
F. fecundum sp. nov.
5× LC15875 T
NRRL 13459 F. concolor Outgroup

Fig. 9. (Continued).

106
 Fusarium spp. on cereals in China

LC2823
0.02 100/1
100/1 LC2819 F. paranisikadoi
FNSC
rpb1-rpb2-tef1 88/1 LC2800 T
98/1 CBS 577.97 T F. miscanthi

100/1
NRRL25179
83/1 F. nisikadoi
CBS 456.97 T
CBS 116011 T F. gaditjirri
78/0.99 96/1
CBS 125536 T F. lyarnte
5× LC18609
-/1
LC18652
-/0.97 LC18583
LC18507
F. commune
LC18568
-/0.99
NRRL 28387
CBS 110090 T
LC18486
5×
NRRL 13994 T F. concolor Outgroup

Fig. 10. Phylogeny inferred based on the combined rpb1-rpb2-tef1 gene regions of the Fusarium nisikadoi species complex (FNSC). Fusarium concolor
(NRRL 13994) was used as an outgroup. Strains isolated in this study were indicated in red. The RAxML Bootstrap support values (ML-BS > 70 %) and
Bayesian posterior probabilities (BI-PP > 0.9) were displayed at the nodes (ML-BS / BI-PP). Ex-type strains were indicated in bold with T.

0.004 CBS 130308

FOSC 85/1 LC18297 F. cugenangense
CaM-rpb2-tef1 72/1
CBS 131393
New host
record (maize) 72/1 CBS 130304

99/1
CBS 255.52
CBS 217.49 F. elaeidis
99/1
CBS 218.49
CBS 116612
CBS 116613 T F. gossypinum
97/1
CBS 116611
4×
-/1
-/1 CBS 744.79
LC18485
70/- LC18832 F. nirenbergiae
79/1
CBS 127.81
CBS 840.88 T
95/1
CBS 238.94 T
87/0.9 CBS 247.61 F. curvatum
4× CBS 141.95
CBS 177.31 F. udum Outgroup

Fig. 11. Phylogeny inferred based on the combined CaM-rpb2-tef1 gene regions of the Fusarium oxysporum species complex (FOSC). Fusarium udum (CBS
177.31) was used as an outgroup. Strains isolated in this study were indicated in red. The RAxML Bootstrap support values (ML-BS > 70 %) and Bayesian
posterior probabilities (BI-PP > 0.9) were displayed at the nodes (ML-BS / BI-PP). Ex-type strains were indicated in bold with T.

www.studiesinmycology.org 107
Han et al.

LC18262
LC18291
0.02 LC18572
LC18637
LC18401
FSAMSC LC18305
H3-rpb1-rpb2-tef1 LC18287
LC18251
New Chinese record LC18299
LC18336
LC18826
LC18594
LC18266
LC18325

Graminearum clade
LC18256
LC18250
LC18825
-/0.99 LC18259
LC18300
0.02 LC18308
LC18324
LC18289
LC18265
Sporotrichioides clade

NRRL13818 T
LC18739
2× LC18323
LC18403
LC18690
LC18283
Sambucinum clade
LC18342
4× LC18369
Brachygibbosum clade
LC18329
Longipes clade LC18344
LC18258
LC18338
LC18628 F. asiaticum
LC18650
LC18327
LC18290
LC18288
LC18316

Graminearum clade
LC18678
LC18332
LC18393
LC18271
LC18280
LC18285
LC18302
LC18286
LC18254
LC18397
LC18617
LC18282
LC18253
LC18278
NRRL28720
84/0.93 99/1 LC18274
LC18273
LC18303
LC18582
LC18505
LC18334
LC18257
-/0.98 LC18565
LC18264
LC18343
NRRL26156
NRRL6101
LC18321
LC18345
100/1 LC18660
LC18326
99/1 CBS 123752 T
NRRL45665 F. ussurianum
85/1 -/0.95 NRRL38207
93/0.99 NRRL37605 T
LC18758 F. vorosii
100/1 LC15880
NRRL26755
NRRL26754 T F. acacia-mearnsii
-/0.98 99/1 NRRL54222 T
-/0.99 NRRL54221 F. nepalense
85/1 NRRL46738 T
NRRL46726 F. aethiopicum
NRRL46718
LC18704
NRRL28436
LC18383
LC18542
97/0.97 LC18384
LC18773 F. meridionale
LC18774
NRRL29010
NRRL28723
NRRL28721

Fig. 12. Phylogeny inferred based on the combined H3-rpb1-rpb2-tef1 gene regions of the Fusarium sambucinum species complex (FSAMSC). Fusarium
nelsonii (NRRL 13338) was used as an outgroup. Strains isolated in this study were indicated in red. The RaxML Bootstrap support values (ML-BS > 70 %)
and Bayesian posterior probabilities (BI-PP > 0.9) were displayed at the nodes (ML-BS / BI-PP). Ex-type and ex-epitype strains were indicated in bold with
T and ET, respectively.

108
 Fusarium spp. on cereals in China

NRRL28585
NRRL 2903 T F. austroamericanum
0.02 NRRL31238
99/0.99
NRRL31281 T F. brasilicum
FSAMSC NRRL29297 T
NRRL29306 F. cortaderiae
H3-rpb1-rpb2-tef1
NRRL36905 T F. gerlachii
New Chinese record CBS 415.86 T F. mesoamericanum
LC18770
LC18322
LC18364
LC18784
LC18772

Graminearum clade
LC18764
LC18748
LC18284
LC18309
LC18721
0.02
LC18768
LC18346
LC18777
LC18724
LC18476
Sporotrichioides clade

LC18449
LC18263
2×
LC18260
LC18245
LC18679
LC18353
Sambucinum clade LC18314
4×
LC18771
LC18315
Brachygibbosum clade
LC18750
Longipes clade LC18298
90/1 LC18720
LC18708
LC18775
LC18387
NRRL6394
LC18663
NRRL28336

Graminearum clade
NRRL5883
NRRL13383
LC18247
LC18255
LC18246
LC18368
LC18543
LC18335
LC18767
LC18666
LC18766
LC18307
LC18381
LC18765 F. graminearum
LC18747
LC18292
LC18395
NRRL31084
LC18301
LC18705
LC18665
-/1
LC18643
LC18529
LC18672
LC18670
LC18252
LC18435
LC18621
LC18516
LC18668
LC18412
LC18371
LC18359
LC18552
LC18752
LC18373
LC18667
LC18676
LC18385
LC18669
LC18347
78/- LC18310
LC18546
LC18796
LC18769
LC18275
NRRL28063
LC18281
LC18279
88/1 LC18711
LC18761
88/1 LC18244
CBS 136009 T
88/0.97 LC18328
LC18337
LC18330
LC18304
LC18593
LC18272

Fig. 12. (Continued).

www.studiesinmycology.org 109
Han et al.

0.02 100/1 LC18779

FSAMSC LC18778
H3-rpb1-rpb2-tef1 LC18515
LC18749
New Chinese record LC18719
LC18386
LC18703
LC18723
LC18782
LC18715

Graminearum clade
LC18415 F. boothii
100/1 LC18520
NRRL26916 T
88/- LC18733
LC18722
0.02 LC18732
NRRL29020
NRRL29105

Graminearum clade
100/1 NRRL29011
Sporotrichioides clade

NRRL54196 F. louisianense
100/1 CBS 127525 T
NRRL13721
2× 100/0.99 NRRL25491 F. cerealis
NRRL25475 T F. culmorum
NRRL13393 T F. lunulosporum
Sambucinum clade
LC18354
LC18551
4× LC18268
Brachygibbosum clade 100/1 LC18365
Longipes clade 100/0.99 LC18360
LC18318
LC18358
LC18550
LC18276
100/0.96 LC18320
LC18554 F. pseudograminearum
LC18374
LC18375
100/1 LC18671
LC18352
LC18361
100/1 LC18357
NRRL28062 T
100/1 LC18370
LC18377
100/1 LC18366
NRRL29298 T
NRRL29380 F. dactylidis
100/1 NRRL66764 T F. subtropicale
NRRL39664 F. praegraminearum
100/1 NRRL29977
99/1 100/1 100/1 NRRL3299 T F. sporotrichioides
NRRL53431 F. sibiricum
98/1 NRRL53430 T
NRRL53417

Sporotrichioides clade
100/1 CBS113234 T F. langsethiae
100/1 NRRL53409
96/1
NRRL66249
100/1 NRRL66248
F. goolgardi
100/0.98 NRRL66250 T
100/1 CBS 201 63 T
NRRL36351 F. nodosum
100/1 NRRL54056 T
NRRL54058 F. palustre
100/1
100/0.95 NRRL31970
LC18306
100/1 91/1 NRRL26908 T F. armeniacum
99/1 LC18662
100/1 LC15881
LC18661
81/1 NRRL 66748
NRRL 66749 T F. chaquense
LC18351
NRRL 26941 ET
Sambucinum clade

NRRL66297
100/0.99 NRRL13714
LC18712 F. poae
90/0.99
LC18570
-/0.97 75/0.97
LC18718
97/1 100/1 NRRL13392 T F. robustum
100/1 NRRL22187 F. sambucinum
100/1 NRRL22196
100/1 CBS 458 93 T F. venenatum
100/0.96 NRRL25349
100/1 NRRL 3509 T F. kyushuense
LC18277
-/1 NRRL28507 T F. musarum
92/0.99 NRRL13829
100/1 NRRL34033 F. brachygibbosum
98/1 NRRL 20954 T
100/1 MRC 2486 F. subflagellisporum Brachygibbosum
CBS 144211 T clade
100/1 CBS 144217 F. transvaalense
CBS 144212
NRRL 20695 ET F. longipes Longipes clade
NRRL13338 F. nelsonii Outgroup

Fig. 12. (Continued).

110
 Fusarium spp. on cereals in China

96/- LC18269
0.03 LC18319
92/1
FTSC LC18556
ITS-rpb1-rpb2-tef1 LC18557
LC18555
89/1
LC18558
LC18270
100/1
LC18313 F. avenaceum
91/1 LC18349
99/1
LC18560
85/1 LC18559
96/0.98
NRRL 25128
92/1 NRRL 54939
LC18592
82/1 CBS 408.86 NT
LC13816
75/-
98/1 LC13817 T F. paeoniae
88/1
LC5166
74/1 LC6037
100/1 LC6043 F. alpinum
LC6045 T
LC4957 T
100/1 LC13813 F. chongqingense
LC13814
LC18348
88/0.96
-/1 LC18331
71/1 LC18312
-/1
LC18680
NRRL 52789
F. acuminatum
LC18744
99/1
75/1 NRRL 36147
LC18780
98/1 LC18350
LC18356
5× -/1
84/1 CBS 253.50
F. tricinctum
NRRL 25481 ET
CBS 122710 T F. sinense
95/1 LC1112
CBS 143608 T F. iranicum
5×
NRRL 13459 F. concolor Outgroup

Fig. 13. Phylogeny inferred based on the combined ITS-rpb1-rpb2-tef1 gene regions of the Fusarium tricinctum species complex (FTSC). Fusarium concolor
(NRRL 13459) was used as an outgroup. Strains isolated in this study were indicated in red. The RAxML Bootstrap support values (ML-BS > 70 %) and
Bayesian posterior probabilities (BI-PP > 0.9) were displayed at the nodes (ML-BS / BI-PP). Ex-type, ex-epitype, and ex-neotype strains were indicated in
bold with T, ET, and NT, respectively.

Furthermore, we summarised the world records of Fusarium
species associated with cereals (Table 2). The data were retrieved
from the USDA fungal database (more than 1 600 records) (Farr
& Rossman 2022), previous studies (168 peer-reviewed papers,
Table 2) and this study (2 020 strains, Supplementary Table
S1). According to the current taxonomy updated by Crous et al.
(2021) and this study, these records correspond to an estimated
97 Fusarium species, belonging to 13 species complexes and
one singleton. Among them, 39 and 52 host records for Fusarium
species for the world and China were updated, respectively (Table
2). A total of 62 species have been recorded as cereal pathogens
(Table 2), of which 18 species (F. acuminatum, F. annulatum, F.
arcuatisporum, F. armeniacum, F. awaxy, F. concentricum, F.
erosum, F. ipomoeae, F. jinanense, F. luffae, F. mianyangense,
F. nirenbergiae, F. pernambucanum, F. planum, F. sacchari, F.
sanyaense, F. sulawesiense and F. tanahbumbuense) were
proven as pathogens of maize stalk rot for the first time in this
study (Fig. 7). Notably, the DSI varies among seedlings infected

www.studiesinmycology.org 111
Han et al.

100/30.9/90.5 F. verticillioides 7600

0.04 100/35.8/93.1 F. verticillioides LC18525
100/12.3/57.1
Phylogenomic tree 100/9.9/52.6
F. musae NRRL 25059
F. coicis NRRL 66233 T
228 assembled genomes 100/14.3/53.4 100/4.9/39.7 F. planum LC15876 T
100/13.7/72.2 F. ramigenum NRRL 25208 T
1001 single-copy orthologs F. tjaetaba NRRL 66243 T
100/27.6/91.3 100/3.4/45
100/11.9/60.5 F. napiforme NRRL 25196
0.04 FFSC F. brevicatenulatum NRRL 25447
FOSC
100/2.1/40.2 F. pseudoanthophilum NRRL 25211 T
FNSC
100/11.3/44.6
F. pseudonygamai NRRL 13592 T
100/4.4/35.9
FnewSC

100/5.1/49.1
F. thapsinum NRRL 22049
F. xyrophilum NRRL 62721
FRSC

FburSC 100/12.5/59.6 F. pseudocircinatum NRRL 36939

FCOSC

FFBSC
100/5.6/42.6 100/7.8/44.3 F. denticulatum NRRL 25311 T
FSAMSC -/15.3/37.8 F. nygamai MRC8546
FCSC
100/26.4/83.5 F. mundagurra NRRL 66235 T
FASC F. phyllophilum NRRL 13617 T
FIESC 100/4.8/44.9 F. xylarioides NRRL 25486 ET
FTSC 100/13.7/63.5 F. udum NRRL 25194
F. nurragi (singleton)
F. acutatum NRRL 13308
FHSC
F. secorum NRRL 62593 T
F3
FtorSC
-/8/34.7 F. subglutinans NRRL 66333
FLSC 100/23.9/91.6 -/5/48.6 F. subglutinans LC18249
FBSC 100/20.7/93.2 F. awaxy LC18783
Cyanonectria

Neocosmospora
100/13.9/74.8 Fusarium sp. RC 528
100/6.2/49.5 F. temperatum LC18813
Albonectria 100/12.3/69.9
Setofusarium
100/4.5/34.5
F. temperatum CMWF389
F2 Geejayessia
100/5.2/47.4
F. bactridioides NRRL 66639
Nothofusarium
-/1.8/39.3 100/3.7/42.5 F. bulbicola NRRL 25176
Luteonectria F. succisae NRRL 13298
F1 Bisifusarium 100/3.3/51.7 F. circinatum NRRL 25331
Rectifusarium 100/16.9/85.8 F. anthophilum NRRL 25214
Neonectria
98/8.4/36.9 F. pininemorale CMW 25243 T
Corinectria
100/6.1/54.8 100/26.6/79.1 F. sororula FCC 5425
Stylonectria
100/6.2/55.2 F. guttiforme NRRL 22945 FFSC
100/3.8/43.2 F. fracticaudum CBS 137234
F. begoniae NRRL 25300 T
100/28/76.6 F. sterilihyphosum NRRL 25623 T
100/5.1/55.2 F. tupiense NRRL 53984
F. mexicanum NRRL 53147 T
F. agapanthi NRRL 31653
100/8.19/36.4 98/7.6/47.3 F. annulatum NRRL 62905
100/10/65.6 100/7.9/71.5 F. annulatum LC18417
100/14.9/87.8
F. annulatum ITEM 2341

Fusarium
100/5.4/46.6
F. annulatum ET1
100/16.1/76.8 F. annulatum F8_4S_2B
100/5.6/42 F. siculi KOD 1856
100/8.2/76.8 F. erosum LC15877 T
100/5.5/91.2 F. globosum NRRL 26131 T
100/7.6/68.9 100/15/76.9 Fusarium sp. FGSC 8932
Fusarium sp. Augusto2
100/24.5/96.9
100/19.3/53 Fusarium sp. MRC2276
100/20.8/75.8 Fusarium sp. IMI 58289
98/7.6/46.1 F. fujikuroi LC18819
100/24.3/82.8 F. elaeagni LC18815
100/22.4/62.8 F. sanyaense LC15882 T
F. mangiferae NRRL 25226
100/13/60.5 F. concentricum NRRL 25181
100/35.5/99.2 F. concentricum LC18523
100/52.9/97.9 F. sacchari LC18522
100/10.3/94.7 F. sacchari NRRL 66326
-/1.2/32.6 F. dlaminii NRRL 13164 T
-/1.1/41.2 F. cugenangense NRRL26413
100/2.8/70.3 F. cugenangense LC18297
-/6.5/36.5 F. elaeidis RBG6448
100/4.4/84.1
F. duoseptatum Fol-114
-/0.3/50.4 F. glycines Fom009
100/5.7/62.9 -/0.5/30.8 F. gossypinum Foc021
F. fabacearum Fom004
-/0.4/39.4
100/32.6/60.2 F. libertatis RBG5714
F. hoodiae Fo5
100/4.4/61.9 F. trachichlamydosporum 160527
100/17.6/91.3 Fusarium sp. EthFoc-75
F. oxysporum G76
-/1/36.7 F. veterinarium MRL8996 FOSC
-/1.8/30 F. pharetrum Fo1
100/12.4/91.4 100/2.6/52.6 F. languescens KOD888
100/3.6/49.5 F. nirenbergiae LC18485
F. nirenbergiae N139
F. curvatum PHW726
100/8.39/64.3 F. triseptatum 14-004
100/43.2/68.3
100/19.2/86.5 Fusarium sp. Fo24
F. odoratissimum NRRL 54006
-/2.5/39.5 F. foetens NRRL 38302
100/29.1/65.3 100/56.9/94 F. nisikadoi NRRL 25179
100/39.8/81.2 F. miscanthi NRRL 26231
-/4.9/25.9 F. lyarnte NRRL 54252 FNSC
100/47.9/62.2 -/4.9/49.8
F. gaditjirrii NRRL 45417
100/44.2/99.2 F. commune NRRL 28387
F. commune LC18583
100/27.1/61.2 F. newnesense NRRL 66241 FnewSC
100/40.2/82.3 F. redolens NRRL 22901
2× F. spartum NRRL 66896 FRSC
100/40.6/53.6 F. hostae NRRL 29888
100/64.2/88.8 F. algeriense NRRL 66647
100/52.2/65.8 F. burgessii NRRL 66654
F. beomiforme NRRL 25174
FburSC
100/59.4/76.7 F. concolor NRRL 13459
100/36.6/51.2
100/43/55.7 F. austroafricanum NRRL 53441 FCOSC
F. anguioides NRRL 25385
F. falsibabinda NRRL 25539 FFBSC

Fig. 14. Maximum likelihood phylogenomic tree of Fusarium and allied genera. A total of 1 001 single-copy orthologs were employed in the analysis.
Stylonectria norvegica IHI 201603 was used as an outgroup. Strains sequenced in this study were indicated in red. The IQ-TREE ultrafast bootstrap support
values (UFBoot ≥ 95 %), gCF and sCF values were displayed at the nodes (UFBoot / gCF / sCF). Arrows “F1” (= “Terminal Fusarium clade”), “F2” and “F3”
indicate the three alternative Fusarium generic hypotheses sensu Geiser et al. (2013). Ex-type, ex-epitype and ex-neotype strains were indicated in bold with
T, ET, and NT, respectively. Subdivision of the Fusarium clade represents the recognised species complexes, including F. aywerte SC (FASC), F. buharicum
SC (FBSC), F. burgessii SC (FburSC), F. chlamydosporum SC (FCSC), F. concolor SC (FCOSC), F. falsibabinda SC (FFBSC), F. fujikuroi SC (FFSC), F.
heterosporum SC (FHSC), F. incarnatum-equiseti SC (FIESC), F. lateritium SC (FLSC), F. newnesense SC (FnewSC), F. nisikadoi SC (FNSC), F. oxysporum
SC (FOSC), F. redolens SC (FRSC), F. sambucinum SC (FSAMSC), F. torreyae SC (FtorSC) and F. tricinctum SC (FTSC).

112
 Fusarium spp. on cereals in China

100/25.8/97.7 F. asiaticum NRRL 28720

0.04
100/2.2/48.6 F. asiaticum LC18397
Phylogenomic tree -/0.6/25.4 F. ussurianum CBS 123752 T
228 assembled genomes -/0.6/39.4 F. nepalense CBS 127943
1001 single-copy orthologs 100/23.1/97.4 F. vorosii LC15880
-/0.3/38
F. vorosii CBS 119177
0.04 FFSC
FOSC
99/1.1/44.3 F. acaciae-mearnsii NRRL 26754 T
FNSC F. aethiopicum CBS 122858 T
100/5.9/47.9 -/0.5/32.6 F. austroamericanum NRRL 2903 T
FnewSC
FRSC
100/3.7/59.3
FburSC F. cortaderiae CBS 119183 T
100/10.4/83.8
F. brasilicum NRRL 31281 T
FCOSC

FFBSC
100/20/98.4
FSAMSC F. meridionale NRRL28721
F. meridionale LC18774
FCSC

FASC
100/19.7/97.7 100/13.9/75.2
FIESC
100/7.9/77.9 F. graminearum LC18796
F. graminearum PH-1
FTSC
F. nurragi (singleton)
100/2.3/40.3
FHSC
F. gerlachii CBS 119176
FtorSC
F3
FLSC 100/22.8/71.6 100/1.1/55.4 F. louisianense CBS 127525 T
FBSC
Cyanonectria 100/27.3/99.3
F. boothii CBS 316.73 T
Neocosmospora F. boothii LC18723
Albonectria
Setofusarium 100/11.2/54.4 100/31.6/68.6 F. mesoamericanum CBS 415.86 T
F2 Geejayessia F. cerealis S18/34
100/52.3/99.2
Nothofusarium

Luteonectria
F. culmorum NRRL 25475 T
F1
100/57.5/80.4 F. pseudograminearum LC18671
Bisifusarium
Rectifusarium

Neonectria
F. pseudograminearum RBG5266
Corinectria F. praegraminearum NRRL 39664
Stylonectria
60/15.1/29.6 100/62.1/94.9 F. subtropicale NRRL 66764
100/22.3/38.8 100/52.1/83.4 F. venenatum NRRL 66329
F. sambucinum NRRL 13708 FSAMSC
100/72/98.2
F. kyushuense LC18277
100/44/68.3 F. kyushuense NRRL 25348
100/31/41 F. poae NRRL 26941 ET
100/71.2/99 F. poae LC18712
100/52.5/69.7 F. sporotrichioides NRRL 3299 T
100/35/86.8 F. sibiricum NRRL 53430 T
100/22.9/70.7 F. langsethiae Fl201059
100/37.9/72.2 100/22.5/67 F. nodosum NRRL 36351
100/31.1/49.4
F. goolgardi NRRL 66250 T
100/40.4/92.3 F. armeniacum NRRL 25141 T
100/51.5/92.8 F. armeniacum LC15881
100/34.4/61.2
F. chaquense NRRL 66749 T

Fusarium
100/20.2/38
F. palustre NRRL 54050
100/24.3/47.7 100/17/35.5
F. transvaalense NRRL 31008
F. brachygibbosum HN-1
F. longipes NRRL 20695 T
100/69.2/89 F. nelsonii NRRL 13338
100/31.5/53.7
F. atrovinosum NRRL 13444 FCSC
F. aywerte NRRL 25410 FASC
100/18/81.7 F. mianyangense LC15879 T
-/6.3/36.9 Fusarium sp. NRRL 31160
100/11.2/70.7 F. sulawesiense LC18688
100/24.5/94.5 F. luffae NRRL 66473
100/62.4/69 100/6.4/53.7 F. luffae LC18508
F. caatingaense NRRL 66470
4× 100/2.5/42.2 F. tanahbumbuense NRRL 66471
100/13.6/67.5
98/2.4/35.5 F. tanahbumbuense LC18534
-/5.4/31.2 F. guilinense LC18805
Incarnatum

100/3.5/50.5
F. incarnatum ITEM 7155
99/2.8/35.6
100/31.9/38.7 F. nothincarnatum LC18436 T
100/30/94.1
100/13.6/59.8 F. nanum LC18709
100/12.2/67.8 F. nanum NRRL 66324
F. hainanense LC18701 FIESC
100/9/43.7
100/19.8/59.5
F. hainanense NRRL 66475
F. coffeatum NRRL 66322
100/45.7/97.6
Fusarium sp. NRRL 66334
100/22.4/65.5
F. weifangense LC18333 T
100/32.7/86.5 F. humuli LC18553
F. clavus NRRL 66337
100/68.4/89
100/13.3/47.7
F. clavus LC18293
Equiseti

100/20.8/36.9 100/25.2/67.1 F. ipomoeae LC18759

85/5.2/35.6 F. jinanense LC15878 T
100/16.1/59.2
100/9.2/49.9 F. flagelliforme NRRL 13405
F. scirpi NRRL 66328
100/9.7/40.2
F. equiseti NRRL 66338
100/33/38.7
F. camptoceras NRRL 13381
Camptoceras
100/29.6/66.2 F. fecundum LC15875 T

Fig. 14. (Continued).

www.studiesinmycology.org 113
Han et al.

0.04 100/54.6/97 F. acuminatum F829

Phylogenomic tree
100/35.5/64.6 F. acuminatum LC18312
97/29.9/41.6
100/54.3/71.6 F. tricinctum NRRL 25481
228 assembled genomes 100/54.7/84.7
F. avenaceum LC18558
100/68.3/70.2
100/63.4/77.8
F. avenaceum Fa05001 FTSC
1001 single-copy orthologs
F. torulosum NRRL 22747
F. nurragi NRRL 36452 Not assigned

Fusarium
0.04 FFSC
100/71.1/70.3
FOSC
F3 F. graminum NRRL 20692
FHSC
FNSC
FnewSC
100/35/40.1
100/83.7/91.3 F. heterosporum NRRL 20693
F. continuum NRRL 66286
FRSC

FburSC
100/62.2/79.5
FCOSC F. zanthoxyli NRRL 66285 FtorSC
FFBSC 100/30.9/42.2 F. torreyae NRRL 54149
100/15.7/31.7
FSAMSC
100/63.8/78.2 F. lateritium NRRL 13622
FLSC
FCSC

FASC F. sarcochroum NRRL 20472

FIESC
F. stilboides NRRL 20429
100/52.5/56.1
FTSC
F. buharicum NRRL 13371
100/72.8/79.1
F. nurragi (singleton)

FHSC F. sublunatum NRRL 13384 FBSC

FtorSC C. cyanostoma NRRL 53998
F3
FLSC
C. buxi NRRL 36148 Cyanonectria
FBSC
Cyanonectria 100/22.5/53 N. floridana NRRL62606
Neocosmospora 100/15.6/52 N. kuroshio UCR3666
Albonectria 100/16.6/48.1 N. ambrosia NRRL 20438 ET
Setofusarium
100/45.4/81.2
F2 Geejayessia 100/10.5/34 N. tuaranensis NRRL 46518
100/41.4/66.4
Nothofusarium
N. obliquiseptata NRRL 62610
F1
Luteonectria

Bisifusarium
100/31.2/58 Neocomospora sp. NRRL 66088
100/24.6/41.1 N. pisi 77-13-4
Neocomospora
Rectifusarium

Neonectria 100/49.6/72.7 N. mori JS-169

100/28.6/47.8
N. rectiphora NRRL 22396
Corinectria

Stylonectria 100/24.2/47.4
-/14.6/31.2 N. metavorans FSSC_6
100/30.7/63.5 N. haematococca LQ1
100/15.9/35.6 100/52/62.7 N. falciformis NRRL 43529 T
100/72/75.6 N. vasinfecta NRRL 22166 ET
100/10.5/41.9 N. protoensiformis NRRL 22178
100/33.9/50 N. illudens NRRL 22090
100/88.3/96.2 A. rigidiuscula NRRL 13412
100/46.5/46.7 A. albosuccinea NRRL 20459 Albonectria
F2
S. setosum NRRL 36526 Setofusarium
Terminal G. atrofusca NRRL 22316
100/80.9/74.1
G. zealandicum NRRL 22465
Geejayessia
Fusarium 100/31.2/44.7
clade
100/26.7/38.5 No. devonianum NRRL 22134 Nothofusarium
100/82.5/84.6 L. nematophila NRRL 54600
L. albida NRRL_22152 Luteonectria
=

100/51.3/47.1 B. penzigii NRRL 20711

F1 100/89.3/87.3
100/86.9/73.4 B. dimerum NRRL 20691 Bisifusarium
2× B. domesticum NRRL 29976
R. robinianum NRRL 25729 Rectifusarium
100/70.7/64.6 Ne. coccinea CBS 119158
100/85.2/75.7 Ne. punicea CBS 119724 Neonectria
100/55.4/45.5 Ne. hederae CBS 714.97
Co. fuckeliana CBS 125109 Corinectria
Stylonectria norvegica IHI 201603 Outgroup
Fig. 14. (Continued).

by different Fusarium species in this study (Fig. 7). For instance,
the DSI of seedlings infected by F. annulatum was 68.75 % even
under low conidium concentrations (1 × 106 conidia/mL) (Fig. 7E),
while those infected by F. awaxy was 6.25 % under low conidium
concentrations (1 × 106 conidia/mL), but appeared 59.38 % under
higher concentrations (1 × 107 conidia/mL) (Fig. 7H).
Taxonomy
Fusarium fujikuroi species complex (FFSC)
As the largest and best-studied species complex in the genus
Fusarium, the FFSC comprises 84 described species separated
into five major clades (African clade, African clade B, African clade
C, American clade, and the Asian clade) (Yilmaz et al. 2021, Wang
et al. 2022a). This species complex includes many important plant
pathogens that cause various diseases and produce numerous
mycotoxins (Choi et al. 2018, Duan et al. 2020, Qiu et al. 2020,
Yilmaz et al. 2021). The FFSC can be distinguished from other
complexes by its typical Fusarium macroconidia, abundant
microconidia and rare chlamydospore formation. In the present
study, 227 strains clustered into three major clades (African clade,
American clade, and Asian clade) and 12 subclades, representing
nine known and three novel species (Fig. 8).
Fusarium annulatum Bugnic., Rev. Gén. Bot. 59: 13. 1952.
Materials examined: (See Supplementary Table S1).
Notes: Fusarium annulatum was proposed by Bugnicourt (1952),
with CBS 258.54 as ex-type strain. Later, a phylogenetic analysis
based on LSU-SSU-tub2 suggested that CBS 258.54 clustered with
the representative strains (CBS 217.76, NRRL 25089, etc.) of F.
proliferatum (O’Donnell et al. 1998a). Given that F. annulatum was
rarely reported and has only one collection (CBS 258.54), whereas
F. proliferatum represented by CBS 217.76 has been widely used,
O’Donnell et al. (1998a) recommended treating F. annulatum as
synonym of F. proliferatum, but did not formalise the proposal.
Recently, a multi-locus phylogenetic analyses including the epitype
of F. proliferatum (CBS 480.96) and additional sequences of CBS
258.54 (CaM, rpb1, rpb2, tef1) demonstrated that CBS 217.76
clustered together with CBS 258.54, but clustered distant from

114
 Fusarium spp. on cereals in China

0.01 100/13.4/91 F. asiaticum CBS 110258

99/6.58/39.4 F. asiaticum NRRL 26156
100/11.3/60.6 F. asiaticum NRRL 6101 F. asiaticum
Phylogenomic tree of FSAMSC 100/40/95.1 F. asiaticum LC18397
81 assembled genomes F. asiaticum NRRL 28720
5139 single copy orthologous genes 100/5.12/44.1
100/13.1/70.4 F. ussurianum CBS 123752 T
100/44.3/97.1 F. ussurianum 29813 F. ussurianum
100/1.54/40.4 F. ussurianum 65202
100/16.6/56.2 F. vorosii CBS 119177
100/38.6/94.9
100/1.87/45.9
F. vorosii CBS 119178 F. vorosii
F. vorosii LC15880
100/49.4/97.3
F. nepalense CBS 127669
F. nepalense
100/2.8/48.1 F. nepalense CBS 127943
100/16.7/44.1 F. acaciae-mearnsii CBS 110253
100/42.1/97.4
F. acaciae-mearnsii CBS 110255 F. acaciae-mearnsii
100/3.41/40.5 F. acaciae-mearnsii NRRL 26754 T
F. aethiopicum CBS 122858 T F. aethiopicum
100/15.9/57.1
100/31.4/91.4
F. graminearum LC18796
F. graminearum PH-1 F. graminearum
100/16.6/80.9
F. graminearum CBS 138562
100/37.1/94.9
F. gerlachii CBS 119175
100/3.79/47 100/31.8/79.4 F. gerlachii
F. gerlachii CBS 119176

Graminearum clade
100/49.5/97.5
F. louisianense CBS 127524
100/9.3/35.5 100/2.41/46.5
F. louisianense CBS 127525 T F. louisianense
100/13.4/55.6
F. boothii CBS 119170
100/48/98.3 95/1.5/35.1 F. boothii CBS 316.73 T F. boothii
100/11.4/62.8 F. boothii CBS 110251
100/1.56/38.6
F. boothii LC18723
F. mesoamericanum CBS 415.86 T F. mesoamericanum
100/28.8/90.5
100/11/33.6 F. meridionale CBS 110249
F. meridionale LC18774
100/21.3/83.4 100/44.9/74.8 F. meridionale NRRL28721 F. meridionale
100/29.2/91.5 F. meridionale 38FSP
100/6.38/56.3 F. brasilicum NRRL 31281 T
100/25.9/93.9 F. brasilicum
F. brasilicum CBS 119179
100/9.92/87.5
100/6.46/48.1
F. cortaderiae CBS 123655
F. cortaderiae CBS 119183 F. cortaderiae
100/24.2/90.7 F. cortaderiae NRRL 29297 T
100/53.4/69.5
F. austroamericanum NRRL 2903 T
100/59.2/98.3 F. austroamericanum CBS 110246 F. austroamericanum
100/14.2/53.3 F. austroamericanum 3FSP
100/23.5/55.8
F. culmorum Class2-1B F. culmorum
F. culmorum NRRL 25475 T
2× F. cerealis S18/34 F. cerealis
100/83/84.5
-/15.2/31.6 F. pseudograminearum CS3096
100/18.2/48 F. pseudograminearum RBG5266
100/71.2/98.1 F. pseudograminearum CS3270 F. pseudograminearum
F. pseudograminearum LC18671
100/83.5/94.6 F. praegraminearum NRRL 39664 F. praegraminearum
100/25/33.6 F. subtropicale NRRL 66764 F. subtropicale

Sporotrichioides clade Sambucinum clade

100/86.1/98.9 F. sambucinum F-4
F. sambucinum
100/72.7/79.5 F. sambucinum NRRL 13708
100/84.5/99.3 F. venenatum A3/5
100/36.1/40.8 F. venenatum
F. venenatum NRRL 66329
100/89.1/98.2 F. kyushuense LC18277
100/68/73.1 F. kyushuense NRRL 25348 F. kyushuense
99/21.8/39.5 F. poae 2516
4× 100/86.6/99 F. poae LC18712
F. poae DAOMC 252244 F. poae
100/80.7/72.3 -/16.5/35.6
F. poae NRRL 26941 ET
100/43.4/76.8 F. sporotrichioides S18/43
100/50.9/86.3 F. sporotrichioides NRRL 3299 T F. sporotrichioides
100/40.5/74.5 F. sibiricum NRRL 53430 T F. sibiricum
100/35.1/64.1 100/74.6/99.5
F. langsethiae Fe2391
F. langsethiae Fl201059 F. langsethiae
100/24.7/42.3
F. goolgardi NRRL 66250 T F. goolgardi
F. nodosum NRRL 36351 F. nodosum
4× 100/63.3/74 -/19.4/37.6 F. chaquense NRRL 66750
100/55.2/95.7 F. chaquense NRRL 66748 F. chaquense
100/74.5/94.5 F. chaquense NRRL 66749 T
F. armeniacum LC15881
100/39.5/49.3 100/55.8/90.2 F. armeniacum NRRL 25141 T F. armeniacum
F. palustre NRRL 54050 F. palustre
100/63.3/87.6 F. longipes NRRL 20695 T Longipes
2× 100/70/82.5 F. longipes NRRL 13317 F. longipes
100/89.6/92.6 Fusarium sp. NRRL 13374 Fusarium sp. clade
Fusarium sp. NRRL 13368 Fusarium sp.
100/41.1/43.8 100/89/98.6 F. brachygibbosum FSAMSC_23
F. brachygibbosum
Brachygibbosum
100/55.5/60.9 F. brachygibbosum HN-1 clade
F. transvaalense NRRL 31008 F. transvaalense
F. nelsonii NRRL 13338 Outgroup

Fig. 15. Maximum likelihood phylogenomic tree of the Fusarium sambucinum species complex (FSAMSC). A total of 5 139 single copy orthologs were
employed in the analysis. F. nelsonii (NRRL 13338) was used as an outgroup. Strains sequenced in this study were indicated in red. The IQ-TREE ultrafast
bootstrap support values (UFBoot ≥ 95 %), gCF and sCF values were displayed at the nodes (UFBoot / gCF / sCF). Ex-type and ex-epitype strains were
indicated in bold with T and ET, respectively.

www.studiesinmycology.org 115
Han et al.

A C
90
F. annulatum
80
70 F. awaxy
Maize Wheat 60 F. concentricum
50 F. elaeagni
6
14 5 40 F. erosum

FFSC
30
F. fujikuroi
20
9 10 F. planum
5 3 0 F. sacchari
F. sanyaense
F. subglutinans
1 F. temperatum
F. verticillioides
F. arcuatisporum
Rice F. clavus
F. compactum
F. fecundum
F. guilinense
B Other species
F. hainanense

FIESC
FIESC F.sulawesiense F. humuli
FFSC F.annulatum FSAMSC F.asiaticum F. ipomoeae
FFSC F.fujikuroi FSAMSC F.boothii F. jinanense
FFSC F.verticillioides FSAMSC F.graminearum
FIESC F.ipomoeae F. luffae
FSAMSC F.pseudograminearum F. mianyangense
FIESC F.luffae
F. nanum
100% F. nothincarnatum
F. pernambucanum
F. sulawesiense
F. tanahbumbuense
F. weifangense
Relative Percentage

SC SC
FO FN
75% 13% F. commune
F. cugenangense
17% F. nirenbergiae
20% F. armeniacum
13%
18% F. asiaticum
F. boothii
50%

FSAMSC
30% 13% F. graminearum
24%
F. kyushuense
14%
F. meridionale
11% F. poae
20% F. pseudograminearum
25% 17% F. vorosii
18%

FTSC
22% 21% F. acuminatum
11% F. avenaceum
15% 20% 16%
M

Te per l m n
Tr per co soo
W

Te rop un
Pl t
R e

Su au

12% 13%
ic
ai

at

op ate nt n
he

11% 11%
m ate on
m ica tai
bt mo
e
z

ic
a

al mo en

0%
m ns t a
on o l
Te ent ate
ze

e
Su nta au
e

at

co em on l

on l
T o ca

so ica

so on
so rat
m p l
ic

m Tr on
m tr n

a
he
ai

in er
i
R

s i

on
on op

on op
ou at

on e

in
M

nt p
m Pl

m
b

Host Climate
Host Climate

Fig. 16. A. The number of unique and shared Fusarium species among different hosts. B. The relative percentage of Fusarium species in different groups
(host: maize, rice, wheat; climate regions: regions affected by plateau mountain, subtropical monsoon, temperate continental, temperate monsoon, and
tropical monsoon climate). The smaller proportion strains of Fusarium were defined as “Other species”, including F. acuminatum, F. arcuatisporum, F.
armeniacum, F. awaxy, F. clavus, F. commune, F. compactum, F. concentricum, F. cugenangense, F. elaeagni, F. erosum, F. fecundum, F. guilinense,
F. hainanense, F. humuli, F. ipomoeae, F. jinanense, F. kyushuense, F. meridionale, F. mianyangense, F. nanum, F. nirenbergiae, F. nothincarnatum, F.
pernambucanum, F. planum, F. poae, F. sacchari, F. sanyaense, F. subglutinans, F. tanahbumbuense, F. temperatum, F. vorosii, and F. weifangense. C.
Detailed information on Fusarium composition among different hosts and climate regions. The number of isolates (0–90) was represented by the shade of
colour (light to dark).

CBS 480.96. Therefore, CBS 217.76 and CBS 480.96 represent
two distinct species. In the current study, based on the taxonomic
treatment of Yilmaz et al. (2021), we further confirmed that many
cereals pathogenic strains (including F1, P2, 24ALH, 51ALH,
Azerbaijan 71-3) previously identified as F. proliferatum (Wulff et al.
2010, Okello et al. 2019, Özer et al. 2020), are actually F. annulatum
(Fig. 8). Meanwhile, our results also showed that F. annulatum has
a broad host range and geographical distribution (Fig. 16C). In
addition, our inoculation test showed its high pathogenicity to maize
seedlings (DSI = 68.75 % when CC = 1 × 106 conidia/mL) (Fig. 7E).
Fusarium awaxy Petters-Vandresen et al., Persoonia 43: 363.
2019.
Material examined: (See Supplementary Table S1).
Notes: Fusarium awaxy was originally described from rotten stalks
of Zea mays in Brazil (Crous et al. 2019), and we herein reported it
for the first time from China (Fig. 8). This species is closely related
to the cosmopolitan species F. subglutinans (Figs 8, 14), and both
species have been confirmed for causing maize stalk rot (Leslie &

116
 Fusarium spp. on cereals in China

17 Samples
F. g appears in 5 samples
F. p appears in 15 samples

5 Co-infection
samples
F. g appears in 5 samples
F. p appears in 4 samples
F. g & F. p appear in 4 samples
Sa 8
m 8
pl
es
Co 4
- 4
sa infe
m cti
ple on

4 sa ples
18

es
37 s
Co-infection

mpl
am
Samples

les
pea 1 samp s
FCR

23 s les
e
samples

ears in 52 s
mpl

amp
0 sa

in 3
ies
No common pathogens 5

in 3

s
ec

in 3
r in

F. g ppear
were reported from
19 es sp 22
sp

ears
FHB

ars
previous studies
ci ecie

app
RSR spe s

.aa
g ap
e
app
app
spe26 27 ies

F
F. a

& F.
F. g
cie c
s spe

F. a
MSR MER

31 78
Co-infection Co-infection
samples samples

F. an appears in 13 samples F. an appears in 41 samples 126

46 Samples
F. v appears in 14 samples F. v appears in 49 samples
Samples
F. an & F. v appear in 6 samples F. an & F. v appear in 31 samples

F. an appears in 17 samples F. an appears in 45 samples

F. v appears in 18 samples F. v appears in 70 samples

Fig. 17. Summary of co-infections discovered in this study. The white circle represents the number of species isolated from different disease samples (only
one species was isolated from the rice bakanae disease sample, thus information was not shown in this figure). The pentagon represents the number of
co-infection samples, also marked the occurrence of common pathogens, including F. a, F. an, F. g, F. p and F. v. The outside sectors of pentagon represent
the number of whole samples, also marked the occurrence of common pathogens as previously mentioned.
Abbreviations: Fusarium crown rot of wheat (FCR), Fusarium head blight of wheat (FHB), maize ear rot (MER), maize stalk rot (MSR), rice spikelet rot (RSR),
F. asiaticum (F. a), F. annulatum (F. an), F. graminearum (F. g), F. pseudograminearum (F. p), F. verticillioides (F. v).

Summerell 2006: Fig. 7H). Morphologically, they differ from each
other in their sporodochia colour (Crous et al. 2019). In addition,
F. subglutinans has been reported for causing human keratitis
(Al-Hatmi et al. 2014), but F. awaxy does not grow above 32 °C,
suggesting the inability to cause human infection (Crous et al.
2019).
and Asia (Aoki et al. 2001, Choi et al. 2018, Du et al. 2020). The
pathogenicity of this species in causing maize ear rot, rice bakanae
disease and maize stalk rot has been confirmed by Du et al. (2020),
Choi et al. (2018) and this study (Fig. 7I).
Fusarium elaeagni M.M. Wang & L. Cai, Persoonia 48: 35 2022.

Fusarium concentricum Nirenberg & O’Donnell, Mycologia 90:
442. 1998.
Material examined: (See Supplementary Table S1).
Notes: Fusarium concentricum was originally described from Musa
sapientum in Costa Rica, and from Nilaparvata lugens in Korea
(Nirenberg & O’Donnell 1998). It has since been reported from
other hosts, including maize, rice and wheat from central America
Material examined: (See Supplementary Table S1).
Notes: Fusarium elaeagni was originally described from Elaeagnus
pungens (Wang et al. 2022a), and subsequently from rice in this
study. This species is closely related to F. fujikuroi (Figs 8, 14)
but could be distinguished by morphological characters, i.e.,
sporodochial colour, macroconidial septa, microconidial shape, and
the type of aerial phialides (Wang et al. 2022a).

www.studiesinmycology.org 117
 Table 2. Summary of Fusarium species reported from cereals in literatures and the present study.

118
References of Host records in China2 Host records worldwide (except China)2
Han et al.

species publication
and subsequent
Current name1 Reported name1 Complex1 Pathogens1 adjustment Maize Rice Wheat References3 Maize Rice Wheat References3
F. algeriense F. algeriense FburSC FCR Laraba et al. (2017) n/a n/a n/a n/a n/a n/a √ Özer et al. (2020)
F. beomiforme F. beomiforme FburSC FCR Nelson et al. (1987) n/a n/a n/a n/a √ n/a n/a Laraba et al. (2017)
F. anguioides F. anguioides FCOSC n/a Sherbakoff (1915) n/a n/a n/a n/a √ √ √ Mulenko et al. (2008)
F. concolor F. concolor FCOSC n/a Reinking (1934) n/a n/a n/a n/a n/a n/a √ Ebbels & Allen (1979)
F. atrovinosum F. atrovinosum FCSC n/a Lombard et al. (2019c) n/a n/a n/a n/a n/a n/a √ Lombard et al. (2019c)
F. chlamydosporum F. chlamydosporum FCSC FCR Wollenweber & n/a n/a n/a n/a n/a √ √ Chehri et al. (2010)
Reinking (1925)
F. nelsonii F. nelsonii FCSC MSR Marasas et al. (1998) √ n/a n/a Zhang et al. (2021b) √ n/a √ Marasas et al. (1998),
Chehri et al. (2010)
F. andiyazi F. andiyazi FFSC MER; RBD Marasas et al. (2001) √ √ n/a Zhang et al. (2014a), √ √ n/a Wulff et al. (2010),
Qiu et al. (2020) Leyva-Madrigal et al.
(2015), Venturini et al.
(2017)
F. annulatum F. annulatum FFSC FCR; FHB; Bugnicourt (1952), * * * Huang et al. (2011), * √ * O’Donnell et al. (1998),
MSR; MER; Yilmaz et al. (2021) Qiu et al. (2020), Okello et al. (2019),
RBD present study Özer et al. (2020)
F. anthophilum F. anthophilum FFSC FCR; FHB Wollenweber (1916) n/a n/a n/a n/a n/a n/a √ Chehri et al. (2010)
F. awaxy F. awaxy FFSC MSR Crous et al. (2019) * n/a n/a present study √ n/a n/a Crous et al. (2019)
F. brevicatenulatum F. brevicatenulatum, FFSC MER; RBD Nirenberg et al. (1998) n/a n/a n/a n/a √ √ n/a Amatulli et al. (2010),
F. pseudoanthophilum Tsehaye et al. (2016)

F. concentricum F. concentricum FFSC MER; MSR; Nirenberg & O’Donnell √√ * n/a Du et al. (2020), √ √ √ Aoki et al. (2001), Choi
RBD (1998) present study et al. (2018)
F. dlaminii F. dlaminii FFSC n/a Marasas et al. (1985) n/a n/a n/a n/a √ n/a n/a Scauflaire et al. (2011)
F. elaeagni F. elaeagni FFSC n/a Wang et al. (2022a) n/a * n/a present study n/a n/a n/a n/a
F. erosum F. erosum FFSC MSR present study * n/a n/a present study n/a n/a n/a n/a
F. fujikuroi F. fujikuroi, F. FFSC FCR; FHB; Nirenberg (1976) √√ √√ √√ Duan et al. (2020), √ √ √ McGuire & Crandall
moniliforme, F. sacchari MER; MSR; Qiu et al. (2020), (1967), Byrnes
var. subglutinans, F. RBD; RSR present study & Carroll (1986),
moniliforme var. majus, Adikaram &
Gibberella fujikuroi, Yakandawala (2020)
Lisea fujikuroi
F. globosum F. globosum FFSC n/a Rheeder et al. (1996) n/a n/a n/a n/a √ n/a √ Nirenberg & O’Donnell
(1998); Moses et al.
(2010)
F. madaense F. madaense FFSC MSR Ezekiel et al. (2020) n/a n/a n/a n/a √ √ n/a Costa et al. (2022)
F. napiforme F. napiforme FFSC RBD Marasas et al. (1987) n/a n/a n/a n/a n/a √ n/a Amatulli et al. (2010)
 Table 2. (Continued).
References of Host records in China2 Host records worldwide (except China)2
species publication
and subsequent
Current name1 Reported name1 Complex1 Pathogens1 adjustment Maize Rice Wheat References3 Maize Rice Wheat References3
F. nygamai F. nygamai FFSC FHB; MSR Burgess & Trimboli n/a n/a n/a n/a √ √ √ Balmas et al. (2000),
(1986) Leyva-Madrigal et al.
(2015)
F. proliferatum F. proliferatum, FFSC ? Nirenberg (1976) ? ? ? Huang et al. (2010), ? ? ? Wulff et al. (2010),
F. proliferatum var. Qiu et al. (2020) Yasuhara-Bell et al.
minus (2018), Özer et al.
(2020)
F. pseudoanthophilum F. pseudoanthophilum FFSC n/a Nirenberg et al. (1998) n/a n/a n/a n/a √ n/a n/a Tsehaye et al. (2016)

www.studiesinmycology.org
F. pseudonygamai F. pseudonygamai FFSC RBD Nirenberg & O’Donnell n/a n/a n/a n/a n/a √ n/a Bashyal et al. (2016)
(1998)
F. planum F. planum FFSC MSR present study * * * present study n/a n/a n/a n/a
F. sacchari F. sacchari, FFSC FHB; MSR; Gams (1971) √√ * √ Wang et al. (2015), √ √ √ Mulenko et al. (2008),
Cephalosporium MER; RBD Duan et al. (2019), Bashyal et al. (2016)
sacchari present study
F. sanyaense F. sanyaense FFSC MSR present study * n/a n/a present study n/a n/a n/a n/a
F. subglutinans F. subglutinans, FFSC MER; MSR; Nelson et al. (1983) √√ n/a * Gai et al. (2017), √ √ √ Byrnes & Carroll
F. moniliforme RBD present study (1986), Pak et al.
var. subglutinans, (2016)
Gibberella fujikuroi var.
subglutinans
F. temperatum F. temperatum FFSC MER; MSR Scauflaire et al. (2011) √√ n/a n/a Zhang et al. (2014c), √ n/a n/a Varela et al. (2013)
Gai et al. (2017),
present study
F. thapsinum F. thapsinum FFSC MER; MSR; Klittich et al. (1997) √ √ n/a Dong et al. (2020b), √ √ n/a Rahjoo et al. (2008),
RBD Zhang et al. (2021a) Bashyal et al. (2016)

F. verticillioides F. verticillioides, FFSC FCR; FHB; Nirenberg (1976), √√ √√ n/a Gai et al. (2017), √ √ √ Chehri et al. (2010),
Fusarium moniliforme MSR; MER; Yilmaz et al. (2021) Dong et al. (2020b), Wulff et al. (2010),
var. majus, Gibberella RBD Qiu et al. (2020), Gräfenhan et al. (2011)
moniliform, Gibberella present study
moniliformis
F. graminum F. avenaceum var. FHSC n/a Corda (1837) n/a n/a n/a n/a n/a n/a √ Mulenko et al. (2008)
graminum
F. heterosporum F. heterosporum FHSC FCR Nees von Esenbeck n/a n/a n/a n/a √ √ √ Tunali et al. (2008),
(1818) Mulenko et al. (2008)
F. aberrans F. aberrans FIESC n/a Xia et al. (2019) n/a n/a n/a n/a n/a √ n/a Xia et al. (2019)
F. arcuatisporum F. arcuatisporum FIESC MSR Wang et al. (2019a) * n/a n/a present study n/a n/a n/a n/a
F. camptoceras F. camptoceras FIESC n/a Wollenweber & n/a n/a n/a n/a n/a √ √ Chehri et al. (2010)
Reinking (1925)

119
Fusarium spp. on cereals in China
 Table 2. (Continued).

120
References of Host records in China2 Host records worldwide (except China)2
Han et al.

species publication
and subsequent
Current name1 Reported name1 Complex1 Pathogens1 adjustment Maize Rice Wheat References3 Maize Rice Wheat References3
F. clavus (as ‘clavum’) F. clavus (as ‘clavum’) FIESC n/a Xia et al. (2019) n/a n/a * present study * n/a * Okello et al. (2019),
Özer et al. (2020)
F. compactum F. compactum FIESC FCR Raillo (1950) * n/a n/a present study n/a n/a √ Tunali et al. (2008)
F. nothincarnatum F. nothincarnatum FIESC n/a present study n/a * * present study n/a * n/a O’Donnell et al. (2009)
F. equiseti F. equiseti, FIESC ? Saccardo (1886) ? n/a ? Li et al. (2014), Xu et ? ? ? Aguín et al. (2014),
Gibberella intricans al. (2016), Gai et al. Barkat et al. (2016)
(2017)
F. fasciculatum F. fasciculatum FIESC n/a Xia et al. (2019) n/a n/a n/a n/a n/a √ n/a Xia et al. (2019)
F. guilinense F. guilinense FIESC n/a Wang et al. (2019a) n/a * n/a present study n/a n/a n/a n/a
F. hainanense F. hainanense FIESC n/a Wang et al. (2019a) * * n/a Wang et al. (2021), n/a √ n/a Xia et al. (2019)
present study
F. humuli F. humuli FIESC n/a Wang et al. (2019a) n/a * * present study n/a n/a n/a n/a
F. incarnatum F. incarnatum, F. FIESC ? Saccardo (1886) ? n/a ? Gai et al. (2016, ? ? ? Tsehaye et al. (2016),
semitectum, F. 2017) Choi et al. (2018),
semitectum var. majus, Özer et al. (2020)
F. diversisporum, F.
pallidoroseum, F.
semitectum
F. ipomoeae F. ipomoeae FIESC MSR Wang et al. (2019a) * √ * Li et al. (2014), n/a n/a n/a n/a
Wang et al. (2019a),
present study
F. jinanense F. jinanense FIESC MSR present study * n/a n/a present study n/a n/a n/a n/a
F. luffae F. luffae FIESC MSR Wang et al. (2019a) * * * Gai et al. (2016), n/a n/a n/a n/a
present study
F. mianyangense F. mianyangense FIESC MSR present study * * n/a present study n/a n/a n/a n/a
F. nanum F. nanum FIESC n/a Wang et al. (2019a) * n/a * present study n/a n/a n/a n/a
F. pernambucanum F. pernambucanum FIESC MSR Santos et al. (2019) * n/a n/a present study n/a n/a n/a n/a
F. sulawesiense (as F. sulawesiense (as FIESC MSR Maryani et al. (2019b) * √√ * Wang et al. (2019a), n/a n/a n/a n/a
‘sulawense’) ‘sulawense’) present study
F. tanahbumbuense F. tanahbumbuense FIESC MSR Maryani et al. (2019b) * * * present study n/a n/a * Özer et al. (2020)
F. weifangense F. weifangense FIESC n/a present study n/a n/a * present study n/a n/a n/a n/a
F. fecundum F. fecundum FIESC n/a present study n/a * * present study n/a n/a n/a n/a
F. lateritium F. lateritium FLSC FCR Nees von Esenbeck n/a n/a n/a n/a √ √ √ Richardson (1979),
(1817) Mulenko et al. (2008),
Tunali et al. (2008)
F. sarcochroum F. sarcochroum FLSC n/a Saccardo (1879) n/a n/a n/a n/a √ n/a n/a Mulenko et al. (2008)
F. miscanthi F. miscanthi FnewSC MER Gams et al. (1999) √ n/a n/a Shang et al. (2020) n/a n/a n/a n/a
F. nisikadoi F. nisikadoi FnewSC n/a Nirenberg (1997) n/a n/a n/a n/a n/a n/a √ Nirenberg (1997)
 Table 2. (Continued).
References of Host records in China2 Host records worldwide (except China)2
species publication
and subsequent
Current name1 Reported name1 Complex1 Pathogens1 adjustment Maize Rice Wheat References3 Maize Rice Wheat References3
F. commune F. commune FNSC MSR; RBD Skovgaard et al. √√ * n/a Xi et al. (2019), √ √ n/a Choi et al. (2018),
(2003) present study Husna et al. (2020),
Mezzalama et al.
(2021)
F. carminascens F. carminascens FOSC n/a Lombard et al. n/a n/a n/a n/a √ n/a n/a Lombard et al. (2019b)
(2019b)
F. cugenangense F. cugenangense FOSC n/a Maryani et al. (2019a) * n/a n/a present study n/a n/a n/a n/a
F. fabacearum F. fabacearum FOSC n/a Lombard et al. n/a n/a n/a n/a √ n/a n/a Lombard et al. (2019b)
(2019b)

www.studiesinmycology.org
F. inflexum F. inflexum FOSC FCR Schneider & Dalchow n/a n/a n/a n/a n/a n/a √ Tunali et al. (2008)
(1975)
F. languescens F. languescens FOSC n/a Lombard et al. n/a n/a n/a n/a √ n/a n/a Lombard et al. (2019b)
(2019b)
F. nirenbergiae F. nirenbergiae FOSC MSR Lombard et al. * n/a n/a present study n/a n/a n/a n/a
(2019b)
F. oxysporum F. oxysporum, FOSC FCR; FHB; von Schlechtendal n/a n/a n/a n/a √ √ √ Amatulli et al. (2010),
F. aurantiacum, MER; MSR; (1824) Barkat et al. (2016),
F. oxysporum, RBD Abdul Rahm et al.
F. vasinfectum, (2020)
F. orthoceras
F. hostae F. hostae FRSC FCR Geiser et al. (2001) n/a n/a n/a n/a n/a n/a √ Özer et al. (2019)
F. redolens F. redolens, F. FRSC FCR Wollenweber (1913) n/a √ √ Tai (1979), Wang et √ n/a √ Mulenko et al. (2008),
oxysporum var. al. (2019b) Esmaeili Taheri et al.
redolens (2011)
F. acaciae-mearnsii F. acaciae-mearnsii FSAMSC n/a O’Donnell et al. (2004) n/a n/a √ Liu et al. (2018) n/a n/a √ Beukes et al. (2017)
F. armeniacum F. armeniacum, F. FSAMSC FHB; MSR Burgess et al. (1993) * n/a * present study √ n/a √ Burgess et al. (1993),
acuminatum subsp. Krone et al. (2020)
armeniacum
F. asiaticum F. asiaticum FSAMSC FCR; FHB; O’Donnell et al. (2004) √√ √√ √√ Zhang et al. (2007, √ √ √ Gomes et al. (2015),
MER; MSR; 2015, 2016), Hao Beukes et al. (2017),
RSR et al. (2017), Dong Khaledi et al. (2017)
et al. (2020b, c),
present study

F. boothii F. boothii FSAMSC FHB; MER; O’Donnell et al. (2004) √√ n/a n/a Gai et al. (2017), √ n/a √ Beukes et al. (2017)
MSR present study
F. brachygibbosum F. brachygibbosum FSAMSC FCR; MSR Padwick (1945) √ n/a n/a Shan et al. (2017) n/a n/a √ Özer et al. (2020)
F. cerealis F. cerealis, FSAMSC FHB; MSR Saccardo (1886) √ n/a n/a Shan et al. (2018) √ n/a √ Castañares et al.
F. crookwellense (2019), Xue et al.
(2019)

121
Fusarium spp. on cereals in China
 Table 2. (Continued).

122
References of Host records in China2 Host records worldwide (except China)2
Han et al.

species publication
and subsequent
Current name1 Reported name1 Complex1 Pathogens1 adjustment Maize Rice Wheat References3 Maize Rice Wheat References3
F. cortaderiae F. cortaderiae FSAMSC MER; MSR O’Donnell et al. (2004) n/a n/a n/a n/a √ √ √ Gomes et al. (2015),
Kuhnem et al. (2016),
Beukes et al. (2017)
F. culmorum F. culmorum FSAMSC FCR; FHB; Saccardo (1892) √ n/a √ Tai (1979), Zhuang √ n/a √ Aguín et al. (2014),
MSR; MER (2005), Li et al. Touati-Hattab et al.
(2016), Xu et al. (2016)
(2016), Xia et al.
(2021)
F. gerlachii F. gerlachii FSAMSC FHB Starkey et al. (2007) n/a n/a n/a n/a n/a n/a √ Starkey et al. (2007)
F. graminearum F. graminearum, FSAMSC FCR; FHB; Schwabe (1839) √√ √√ √√ Tai (1979), Zhuang √ √ √ Devay et al. (1957),
Gibberella roseum f. MSR; MER; (2005), Zhang et Pennycook (1989),
cerealis, Gibberella RBD; RSR al. (2007, 2015), Cho & Shin (2004)
zeae Dong et al. (2020b),
present study
F. kyushuense F. kyushuense FSAMSC FHB; MER; Aoki & O’Donnell √ √ * Zhao & Lu (2007), n/a n/a √ Sandoval-Denis et al.
MSR (1998) Wang et al. (2014), (2018b)
Cao et al. (2021),
present study
F. langsethiae F. langsethiae FSAMSC n/a Torp & Nirenberg n/a n/a n/a n/a n/a n/a √ Lukanowski et al.
(2004) (2008)
F. louisianense F. louisianense FSAMSC FHB Sarver et al. (2011) n/a n/a n/a n/a n/a n/a √ Yasuhara-Bell et al.
(2018)
F. meridionale F. meridionale FSAMSC FHB; MER; O’Donnell et al. (2004) √√ √ * Zhang et al. (2014b), √ √ √ Gomes et al. (2015),
MSR; RSR Gai et al. (2017), Kuhnem et al. (2016),
Dong et al. (2020a), Khaledi et al. (2017)
present study
F. nepalense F. nepalense FSAMSC RSR Sarver et al. (2011) n/a n/a n/a n/a n/a √ n/a Sarver et al. (2011)
F. nodosum F. nodosum FSAMSC n/a Lombard et al. (2019c) n/a n/a n/a n/a n/a n/a √ Lombard et al. (2019c)
F. poae F. poae FSAMSC FHB; MER Wollenweber (1914) √√ n/a √√ Tai (1979), Xu et √ n/a √ Logrieco et al. (2002a),
al. (2020), present Yli-Mattila et al. (2004)
study
F. pseudograminearum F. pseudograminearum FSAMSC FCR; FHB Aoki & O’Donnell * n/a √√ Li et al. (2012), Xu √ n/a √ Obanor et al. (2010),
(1999) et al. (2015), Zhang Abdallah-Nekache et
et al. (2015), Ji et al. (2019)
al. (2016), present
study
F. sambucinum F. sambucinu, FSAMSC n/a Link (1809), Gams n/a n/a n/a n/a √ √ √ Mulenko et al. (2008),
Gibberella pulicaris, F. (1997) Chehri et al. (2010)
roseum
 Table 2. (Continued).
References of Host records in China2 Host records worldwide (except China)2
species publication
and subsequent
Current name1 Reported name1 Complex1 Pathogens1 adjustment Maize Rice Wheat References3 Maize Rice Wheat References3
F. sporotrichioides F. sporotrichioides, FSAMSC FHB; MER; Sherbakoff (1915) √ n/a n/a Wang et al. (2020) √ √ √ Tekauz et al. (2004),
F. sporotrichioides var. RSR Amatulli et al. (2010),
sporotrichioides Wang et al. (2020)
F. venenatum F. venenatum FSAMSC FCR Nirenberg (1995) n/a n/a n/a n/a √ n/a √ Sandoval-Denis et al.
(2018a, b)
F. vorosii F. vorosii FSAMSC FHB; MSR; Starkey et al. (2007) * n/a n/a present study √ √ √ Starkey et al. (2007),
MER Lee et al. (2016)

F. acuminatum F. acuminatum, F. FTSC FCR; FHB; Sherbakoff (1915) * n/a √√ Pan et al. (2015), √ √ √ Desjardins et al.

www.studiesinmycology.org
scirpi, F. scirpi var. MSR Zhang et al. (2015), (2000), Mao et al.
acuminatum present study (1998), Shrestha et al.
(2021)
F. avenaceum F. avenaceum, FTSC FCR; FHB; Saccardo (1886) √ n/a √√ Zhuang (2005), √ √ √ Logrieco et al. (2002b);
Gibberella avenacea MER Zhang et al. (2013, Amatulli et al. (2010)
2015), Ma et al.
(2019), present
study
F. flocciferum F. flocciferum FTSC n/a Sturm (1829) n/a n/a n/a n/a √ n/a √ Gerlach & Ershad
(1970), Sandoval-
Denis et al. (2018a)
F. torulosum F. torulosum FTSC n/a Nirenberg (1995) n/a n/a n/a n/a n/a n/a √ Kristensen et al.
(2005)
F. tricinctum F. tricinctum FTSC n/a Saccardo (1886) n/a √ n/a Li et al. (2019b) √ n/a √ Mulenko et al. (2008),
Castañareset al.
(2011)
F. trichothecioides F. trichothecioides n/a FCR Jamieson & n/a n/a n/a n/a n/a n/a √ Chehri et al. (2010)
Wollenweber (1912)
1
Abbreviations: F. = Fusarium. FburSC = F. burgessii species complex. FCSC = F. chlamydosporum species complex. FCOSC = F. concolor species complex. FFSC = F. fujikuroi species complex. FHSC
= F. heterosporum species complex. FIESC = F. incarnatum-equiseti species complex. FLSC = F. lateritium species complex. FnewSC = F. newnesense species complex. FNSC = F. nisikadoi species
complex. FOSC = F. oxysporum species complex. FRSC = F. redolens species complex. FSAMSC = F. sambucinum species complex. FTSC = F. tricinctum species complex. FCR = Fusarium crown rot of
wheat. FHB = Fusarium head blight of wheat. MSR = maize stalk rot. MER = maize ear rot. RBD = Rice bakanae disease. RSR = Rice spikelet rot. Maize = Zea mays. Rice = Oryza sp. Wheat =Triticum sp.
2
n/a: No record found. √: Species previously reported from cereals in literatures. √√: Species also reported on cereals in the present study. *: New records on cereals in China or updated records on
cereals by re-identification. ?: The records on cereals need to be further confirmed.
3
If there are more than three references for a particular record, only several representative references were listed here.

123
Fusarium spp. on cereals in China
Han et al.
Fusarium erosum S.L. Han, M.M. Wang & L. Cai, sp. nov.
MycoBank MB 847021. Fig. 18.
Etymology: Refers to its colony margin on PDA, erose.
Sporodochia cream (4A3), formed frequently on carnation leaves,
and often covered by aerial sparse mycelium. Sporodochial
conidiophores densely, irregularly and verticillate branched,
bearing apical whorls of 2–4 phialides. Sporodochial phialides
subulate to subcylindrical, smooth, thin-walled, 12.4–19.8 × 2.0–
3.8 μm. Sporodochial conidia falcate, slender, straight to slightly
curved dorsiventrally, with a curved to pointed apical cell and a
well-developed foot-shaped basal cell, hyaline, thin- and smooth-
walled, 3(–5)-septate: 3-septate conidia: 29.3–46.6 × 3.5–4.7
μm (av. ± SD: 39.8 ± 5.8 × 4.0 ± 0.4 μm); 4-septate conidia:
42.7–50.6 × 3.5–4.7 μm (av. ± SD: 46.4 ± 2.3 × 4.0 ± 0.3 μm);
5-septate conidia: 39.4–50.5 × 3.5–5.1 μm (av. ± SD: 46.8 ± 2.8
× 4.2 ± 0.4 μm). Aerial conidiophores borne on aerial mycelium,
straight or flexuous, erect or prostrate, smooth- and thin-walled,
bearing terminal or lateral phialides. Aerial phialide mono- and
polyphialides, subulate to subcylindrical, smooth- and thin-walled,
periclinal thickening inconspicuous or absent, 9.7–32.1 × 1.9–3.5
μm. Aerial conidia single on the tips of phialides, ovoid, hyaline,
smooth- and thin-walled, aseptate, 3.7–11.3 × 1.8–3.5 μm (av. ±
SD: 7.2 ± 1.7 × 2.7 ± 0.4 μm). Chlamydospores not observed.
Culture characteristics: Colonies on PDA incubated at 25 °C in
the dark reaching 72–82 mm diam in 7 d; convex, with abundant
aerial mycelium, colony margin lightly erose; surface purplish white
(14A2), reverse pinkish white (10A2) in the centre, white (–A1) at
the margin; odour absent. On OA in the dark reaching 66–67 mm in
7 d; convex, with abundant aerial mycelium, margin entire; surface
pinkish white (10A2), reverse greyish red (10C4); odour absent.
Typus: China, Guangdong Province, Meizhou City (E116.3, N24.52), from
the symptomatic tissues of maize stalk rot, 7 Jun. 2021, Y.M. Wu (holotype
HMAS 351950, ex-type living culture CGMCC3.23518 = LC15877 =
HSL2912).
Additional materials examined: (See Supplementary Table S1).
Notes: The three isolates representing F. erosum were resolved
as a strongly supported genealogically exclusive lineage in the
phylogeny inferred from combined CaM, rpb1, rpb2, tef1, and
tub2 loci (Fig. 8). Fusarium erosum is closely related to F. siculi
and F. globosum, but differs by 20 bp and 12 bp from the latter
two species respectively in the combined dataset. Morphologically,
F. erosum differs in the types of aerial conidia production and the
number of septa. For example, F. erosum produces aseptate,
ovoid aerial conidia; F. siculi produces 0–1-septate, subcylindrical
to clavate aerial conidia; while three types of aerial conidia were
found in F. globosum: clavate with a truncate base (0–3-septate),
napiform/pyriform, and globose (0–1-septate) which often have
a distinct papilla (Rheeder et al. 1996, Leslie & Summerell 2006,
Sandoval-Denis et al. 2018a). The pathogenicity test fulfilling
Koch’s postulates confirmed its pathogenicity, causing maize stalk
rot (Fig. 7J).
Fusarium fujikuroi Nirenberg, Mitt. Biol. Bundesanst. Land-
Forstw. Berlin-Dahlem 169: 32. 1976.
Synonyms: see Crous et al. (2021).
Material examined: (See Supplementary Table S1).
124
Notes: As a pathogen causing rice bakanae disease, F. fujikuroi
has been widely studied, but some are under different synonyms
(e.g., F. moniliforme var. subglutinans, F. moniliforme var.
intermedium, F. moniliforme and Gibberella fujikuroi) based on
previous morphological identification systems (Booth 1971). With
the application of multi-locus analyses, F. fujikuroi was gradually
revealed to be a pathogen of various crops worldwide (Farr &
Rossman 2022), causing maize ear rot, maize stalk rot, wheat
scab, wheat crown rot and rice spikelet rot (Wulff et al. 2010, Duan
et al. 2020, Qiu et al. 2020, this study).
Fusarium planum S.L. Han, M.M. Wang & L. Cai, sp. nov.
MycoBank MB 847022. Fig. 19.
Etymology: Referring to its colony elevation in PDA, flat.
Sporodochia cadmium orange (5A8), formed infrequently inside
agar. Sporodochial conidiophores densely and irregularly
branched, bearing apical whorls of 3–5 phialides. Sporodochial
phialides subulate to subcylindrical, smooth, thin-walled, 9.0–17.5
× 2.3–3.9 μm. Sporodochial conidia falcate, slender, straight to
slightly curved dorsiventrally, with a conical to slightly papillate
apical cell and obtuse to barely notched basal cell, hyaline, thin-
and smooth-walled, (1–)3–4(–5)-septate: 1-septate conidia: 14.4–
22.1 × 3.1–3.9 μm (av. ± SD: 17.6 ± 2.3 × 3.5 ± 0.3 μm); 2-septate
conidia: 21.5–28.5 × 3.2–4.3 μm (av. ± SD: 25 ± 2.4 × 3.7 ± 0.4
μm); 3-septate conidia: 25–43 × 3.0–4.5 μm (av. ± SD: 35.8 ± 5.7
× 3.6 ± 0.4 μm); 4-septate conidia: 41.8–49.4 × 3.3–5.0 μm (av. ±
SD: 44.5 ± 2.8 × 4.2 ± 0.5 μm); 5-septate conidia: 40.5–48.3 × 3.4–
4.8 μm (av. ± SD: 43.7 ± 4.1 × 4.2 ± 0.5 μm). Aerial conidiophores
borne on aerial mycelium, straight or flexuous, erect or prostrate,
smooth- and thin-walled, bearing terminal or lateral phialides. Aerial
phialides monophialide, subulate to subcylindrical, smooth- and
thin-walled, periclinal thickening inconspicuous or absent, 12.6–25
× 2–2.8 μm. Aerial conidia often forming false heads, subcylindrical
to clavate, hyaline, smooth- and thin-walled, aseptate, 5–10.6 ×
1.7–2.3 μm (av. ± SD: 7.7 ± 1.3 × 2.1 ± 0.2 μm). Chlamydospores
not observed.
Culture characteristics: Colonies on PDA incubated at 25 °C in the
dark reaching 68–70 mm diam in 7 d; flat, aerial mycelia scant,
colony margin entire; surface greyish orange (6B5) in the centre,
pale (2A2) at the margin; reverse peach (7A4) in the centre, pale
(2A2) at the margin; odour absent. On OA in the dark reaching
69–71 mm in 7 d; convex, with abundant aerial mycelium, margin
entire; surface white (–A1), reverse pastel pink (11A4) in the centre,
white (–A1) at the margin; odour absent.
Typus: China, Guangdong Province, Qingyuan City (E113.42, N24.19),
from the symptomatic tissues of maize ear rot, 21 Nov. 2020, S.Q. Wang
(holotype HMAS 351949, ex-type living culture CGMCC3.23517 =
LC15876 = HSL2645).
Additional materials examined: (See Supplementary Table S1).
Notes: The isolates representing F. planum were resolved as a
strongly supported genealogically exclusive lineage in the phylogeny
inferred from combined CaM, rpb1, rpb2, tef1, and tub2 loci (Fig.
8). Fusarium planum is closely related to F. andiyazi, F. madaense
and F. mirum, but differs by 23 bp and 31 bp from F. andiyazi and
F. madaense in the 5-locus (CaM-rpb1-rpb2-tef1-tub2) dataset and
11 bp from F. mirum in the 3-locus (rpb2-tef1-tub2) dataset (CaM,
rpb1 and the latter half of rpb2 sequence were not available for
 Fusarium spp. on cereals in China

Fig. 18. Morphology of Fusarium erosum (CGMCC3.23518, ex-type culture). A. Colony on PDA. B. Colony on OA. C. Sporodochia. D. Sporodochial
conidiophores and phialides. E. Sporodochial conidia. F. Aerial conidiophores and phialides. G. Phialides and aerial conidia. Scale bars = 10 μm.

F. mirum). Morphologically, this species is distinguished based
on the number of septa in sporodochial conidia (1–5-septate in F.
planum vs 3–6-septate in F. andiyazi, 0–6-septate in F. madaense,
1–6-septate in F. mirum); and the number of septa in aerial conidia
(aseptate in F. planum vs 0–2-septate in F. andiyazi and F. mirum,
0–3-septate in F. madaense) (Marasas et al. 2001, Ezekiel et al.
2020, Costa et al. 2022). The pathogenicity test fulfilling the Koch’s
postulates confirmed its pathogenicity and ability to cause maize
stalk rot (Fig. 7Q).

www.studiesinmycology.org 125
Han et al.

Fig. 19. Morphology of Fusarium planum (CGMCC3.23517, ex-type culture). A. Colony on PDA. B. Colony on OA. C. Sporodochia. D. Sporodochial
conidiophores and phialides. E. Sporodochial conidia. F. Aerial conidiophores and phialides. G. Aerial conidia. Scale bars = 10 μm.

Fusarium sacchari (E.J. Butler) W. Gams, Cephalosporium-artige Material examined: (See Supplementary Table S1).
Schimmelpilze: 218. 1971.
Basionym: Cephalosporium sacchari E.J. Butler, Mem. Dept. Agric. Notes: Fusarium sacchari is a common pathogen of diverse crops
India, Bot. Ser. 6: 185. 1913. worldwide (Farr & Rossman 2022). In China, its correlation with maize
Synonyms: see Crous et al. (2021). ear rot, wheat scab, rice spikelet rot and maize stalk rot was confirmed
by Duan et al. (2019), Wang et al. (2015) and this study (Fig. 7R).

126

Fusarium sanyaense S.L. Han, M.M. Wang & L. Cai, sp. nov.
MycoBank MB 847023. Fig. 20.
Etymology: Named after the city, Sanya, where the holotype was
collected.
Sporodochia champagne (4B4), formed frequently on carnation
leaves, and infrequently on agar. Sporodochial conidiophores
densely and irregularly branched, bearing apical whorls of 2–3
phialides. Sporodochial phialides subulate to subcylindrical,
smooth, thin-walled, 9.3–19 × 2.5–4.3 μm. Sporodochial conidia
falcate, slightly slender, straight to slightly curved dorsiventrally,
with a conical to slightly papillate apical cell and a well-developed
and foot-shaped basal cell, hyaline, thin- and smooth-walled,
3–5-septate: 3-septate conidia: 25.3–50.6 × 2.7–4.3 μm (av. ± SD:
38.3 ± 6.2 × 3.6 ± 0.5 μm), 4-septate conidia: 42.4–61.1 × 2.6–5.1
μm (av. ± SD: 50.6 ± 4.8 × 3.9 ± 0.6 μm), 5-septate conidia: 45.7–
67.2 × 3.4–4.5 μm (av. ± SD: 55.3 ± 5.2 × 3.9 ± 0.4 μm). Aerial
conidiophores borne on aerial mycelium, straight or flexuous, erect
or prostrate, smooth- and thin-walled, bearing terminal or lateral
phialides. Aerial phialides mono- and polyphialides, subulate
to subcylindrical, smooth- and thin-walled, periclinal thickening
inconspicuous or absent, 11–27.6 × 2.2–3.4 μm. Aerial conidia
single on the tips of phialides, ovoid, hyaline, smooth- and thin-
walled, aseptate: 4.4–11 × 1.9–4.2 μm (av. ± SD: 6.5 ± 1.6 × 2.7 ±
0.5 μm). Chlamydospores not observed.
Culture characteristics: Colonies on PDA incubated at 25 °C in
the dark reaching 46–55 mm diam in 7 d; raised, aerial mycelia
lightly scant, colony margin undulate; surface flamingo (12A4) in
the centre, white (–A1) at the margin, reverse greyish ruby (12D5)
in the centre, white (–A1) at the margin; odour absent. On OA in the
dark reaching 47–58 mm in 7 d; flat, aerial mycelia scant, margin
undulate; surface amaranth (14E7) in the centre, reverse orange
white (5A2); odour absent.
Typus: China, Hainan Province, Sanya City (E109.75, N18.39), from the
symptomatic tissues of maize stalk rot, 6 Feb. 2021, Y.J. Li (holotype
HMAS 351955, ex-type living culture CGMCC3.23523 = LC15882 =
HSL2737).
Additional materials examined: (See Supplementary Table S1).
Notes: The three isolates representing F. sanyaense were resolved
as a strongly supported genealogically exclusive lineage in the
phylogeny inferred from combined CaM, rpb1, rpb2, tef1, and
tub2 loci (Fig. 8). Fusarium sanyaense is closely related to F.
lumajangense, F. mangiferae and F. proliferatum, but differed by
18 bp from F. mangiferae in the 5-locus (CaM-rpb1-rpb2-tef1-
tub2) dataset, 13 bp from F. lumajangense in the 3-locus (rpb2-
tef1-tub2) dataset (CaM and rpb1 sequences are not available
for F. lumajangense) and 10 bp from F. proliferatum in the 4-locus
(CaM-rpb2-tef1-tub2) dataset (rpb1 sequence is not available for F.
proliferatum). Morphologically, they could be distinguished based
on the size of sporodochial conidia (25.3–67.2 × 2.7–4.5 μm in F.
sanyaense vs 30.0–56.0 × 3.0–4.5 μm in F. lumajangense, 43.1–
61.4 × 1.9–3.4 μm in F. mangiferae, and 16.5–60.5 × 1.5–4 μm in
F. proliferatum), and the number of septa in sporodochial conidia
(3–5-septate in F. sanyaense, F. lumajangense and F. madaense
vs 1–4-septate in F. proliferatum) (Britz et al. 2002, Maryani et
al. 2019b, Yilmaz et al. 2021). Pathogenicity tests fulfilling the
Koch’s postulates confirmed its ability to cause maize stalk rot
(Supplementary Fig. 7S).
www.studiesinmycology.org
Fusarium spp. on cereals in China
Fusarium subglutinans (Wollenw. & Reinking) P.E. Nelson et
al., Fusarium species. An illustrated manual for identification: 135.
1983.
Basionym: Fusarium moniliforme var. subglutinans Wollenw. &
Reinking, Phytopathology 15: 163. 1925.
Synonyms: see Crous et al. (2021).
Material examined: (See Supplementary Table S1).
Notes: Fusarium subglutinans is known for causing cereal, animal and
human diseases (e.g., maize ear rot, animal rapid death and human
keratitis) and producing various mycotoxins (e.g., moniliformin,
fusaproliferin) (Kriek et al. 1977, Bacon & Hinton 1996, Lew et al.
1996, Al-Hatmi et al. 2014, Farr & Rossman 2022). Despite its widely
recognised threats to agricultural and public health, its taxonomy was
unstable as it lacked a living ex-type culture and holotype specimen,
which was resolved by Yilmaz et al. (2021), who designated CBS
747.97 as its neotype. Twelve strains obtained from this study
clustered together with the neotype, of which one strain was isolated
from wheat, as a new host record in China (Table 2).
Fusarium temperatum Scaufl. & Munaut, Mycologia 103: 593.
2011.
Material examined: (See Supplementary Table S1).
Notes: Fusarium temperatum was first reported as a pathogen on
maize in Belgium (Scauflaire et al. 2011), and subsequently on
humans in Mexico (Al-Hatmi et al. 2014). In China, its ability to
cause maize ear rot and maize stalk rot have been confirmed by
Zhang et al. (2014c) and Liu et al. (2022b). Notably, the existence
of sexual reproduction of F. temperatum in the field (Scauflaire et al.
2011), together with the semipermeable species boundary with its
relative species F. subglutinans (Fumero et al. 2021), may facilitate
the genetic recombination and further contribute to the high genetic
diversity of F. temperatum. This species appears to be highly
adaptable and would potentially be widely distributed.
Fusarium verticillioides (Sacc.) Nirenberg, Mitt. Biol. Bundesanst.
Land-Forstw. 169: 26. 1976.
Basionym: Oospora verticillioides Sacc., Fung. Ital., Fasc. 17–28:
pl. 879. 1881.
Synonyms: see Crous et al. (2021).
Material examined: (See Supplementary Table S1).
Notes: Fusarium verticillioides was first isolated from maize in Italy
as Oospora verticillioides (Saccardo 1881). The controversy on the
taxonomy of this species was recently summarised and resolved
(Yilmaz et al. 2021). Fusarium verticillioides is cosmopolitan and
notorious, being predominately a pathogen of maize, causing a
massive quality and yield reduction (Murillo-Williams & Munkvold
2008, Blacutt et al. 2018, Schoeman et al. 2018). In our study,
Fusarium verticillioides is also one of the dominant species on
maize, with a total of 88 representative strains from diseased maize
and from 88 locations (Supplementary Table S1).
Fusarium incarnatum-equiseti species complex (FIESC)
Species within the FIESC are cosmopolitan in various ecological
types. The species relationships within this group have only
recently been clarified. Previously, members of this group were
in most cases identified as F. equiseti or F. incarnatum, based on
morphological similarities or ITS/tef1 sequences (Khoa et al. 2004,
127
Han et al.

Fig. 20. Morphology of Fusarium sanyaense (CGMCC3.23523, ex-type culture). A. Colony on PDA. B. Colony on OA. C. Sporodochia. D. Sporodochial
conidiophores and phialides. E. Sporodochial conidia. F. Aerial conidiophores and phialides. G. Aerial conidia. Scale bars = 10 μm.

Leslie & Summerell 2006, Marín et al. 2012). With the application of
genealogical concordance phylogenetic species recognition, FIESC
has been revealed to include 32 phylogenetic species separated in
the Incarnatum and Equiseti clades (O’Donnell et al. 2009, 2012,
Villani et al. 2016). By employing morphological characters and multi-
locus phylogenetic relationships, the species within the FIESC were
clarified and delimitated, and the majority of the cryptic phylo-species
have been provided with Latin binomials (Wang et al. 2019a, Xia et
al. 2019). Furthermore, our phylogenomic tree (Fig. 14) support the
merger of FCAMSC into the FIESC (as the Camptoceras clade).
Thus, the FIESC now includes 44 species, which is characterised by a
dorsiventral curvature of its macroconidia, abundant chlamydospores,

128

and mostly lacking microconidia (Wang et al. 2019a). To date, about
half of the species in this complex have been reported from cereals
(Table 2). However, the pathogenicity of several species remains
suspicious due to uncertainty of the identities of isolates used, e.g., F.
incarnatum (Fig. 9). In this study, 147 strains clustered into 19 distinct
clades (13 in Incarnatum clade, five in Equiseti clade, and one in
Camptoceras clade), representing 14 known and five novel species
(Fig. 9).
Fusarium arcuatisporum M.M. Wang et al., Persoonia 43: 78.
2019.
Material examined: (See Supplementary Table S1).
Notes: Fusarium arcuatisporum was first described based on isolation
from Nelumbo nucifera, Brassica campestris, and Oryza sp. from
China (Wang et al. 2019a). Previously, this species has been isolated
from a human toenail, as an unnamed phylogenetic species (FIESC 7)
(Leslie & Summerell 2006). Here we update a new host record (maize),
and confirm its ability to cause maize stalk rot (Fig. 7F).
Fusarium clavus J.W. Xia et al., [as ‘clavum’], Persoonia 43: 199.
2019.
Material examined: (See Supplementary Table S1).
Notes: Fusarium clavus was first recognised by O’Donnell et al.
(2009) as an unnamed phylogenetic species (FIESC 5), and later
formally named and described by Xia et al. (2019). To date, F.
clavus has been reported from humans, insects, plants and various
environments (Xia et al. 2019, Matic et al. 2020). Notably, several
isolates of this species have been reported from maize (Okello et
al. 2019) and wheat (Özer et al. 2020), but inaccurately identified as
FIESC or F. equiseti, based on tef1 phylogenetic analysis (Okello et
al. 2019, Özer et al. 2020, Fig. 9). These inaccurate identification
results are common, because species within the FIESC could not
be distinguished based on only tef1 sequences, especially when
using the previously wrongly named reference sequences from
databases. In this study, we reported it as a new Chinese record.
Fusarium compactum (Wollenw.) Raillo, Fungi of the Genus
Fusarium: 180. 1950.
Basionym: Fusarium scirpi var. compactum Wollenw., Fusaria
Autogr. Delin. 3: no. 924. 1930.
Synonyms: see Crous et al. (2021).
Material examined: (See Supplementary Table S1).
Notes: The phylogenetic relationship of Fusarium compactum
was revealed by O’Donnell et al. (2009), which represents a well-
supported phylogenetic species (FIESC 3). Later, Xia et al. (2019)
designated an epitype for F. compactum to stabilise the use of
this name. To date, this species has been reported from at least
18 substrates/hosts, e.g., Austrostipa aristiglumis, Gossypium
barbadense, Triticum aestivum (Bentley et al. 2007, Tunali et al.
2008, Schroers et al. 2011), and maize (this study).
Fusarium fecundum S.L. Han, M.M. Wang & L. Cai, sp. nov.
MycoBank MB 847024. Fig. 21.
Etymology: Refers to its high fecundity of aerial conidia in CLA.
Sporodochia not observed. Aerial conidiophores borne on aerial
mycelium, straight or flexuous, erect or prostrate, smooth- and
www.studiesinmycology.org
Fusarium spp. on cereals in China
thin-walled, bearing terminal or lateral phialides. Aerial phialides
mono- and polyphialides, subulate to subcylindrical, smooth- and
thin-walled, periclinal thickening inconspicuous or absent, 8–44
× 2.5–3.7 μm. Aerial conidia falcate, the dorsal side curved than
the ventral; with a blunt, conical to pointed apical cell and papillate
basal cell, hyaline, smooth- and thin-walled, (1–)2–4(–6)-septate:
1-septate conidia: 13–14 × 3.5–4 μm (av. ± SD: 13.6 ± 0.4 × 3.8 ±
0.2 μm); 2-septate conidia: 12.6–26 × 3.6–5.4 μm (av. ± SD: 18 ±
4.6 × 4.3 ± 0.6 μm); 3-septate conidia: 24.1–33.1 × 4.5–6.5 μm (av.
± SD: 29.6 ± 2.5 × 5.5 ± 0.7 μm); 4-septate conidia: 30.9–38.5 ×
5.4–5.9 μm (av. ± SD: 33.4 ± 3.1× 5.7 ± 0.2 μm); 5-septate conidia:
30.5–40.1 × 5.4–6.4 μm (av. ± SD: 36.7 ± 5.8 × 6.0 ± 0.4 μm);
6-septate conidia: 33.6–35.8 × 6.1–6.8 μm (av. ± SD: 34.4 ± 1 ×
6.4 ± 0.3 μm). Chlamydospores not observed.
Culture characteristics: Colonies on PDA incubated at 25 °C in
the dark reaching 84–90 mm diam in 7 d; raised, felty to velvety,
radiate, with abundant aerial mycelia, colony margin entire; surface
greyish yellow (2B5) in the centre, white (–A1) at the margin;
reverse milk white (1A2) in the centre, white (–A1) at the margin;
odour absent. On OA in the dark reaching 76–84 mm in 7 d; raised,
felty to dusty, with abundant aerial mycelium, margin entire; surface
white, reverse mimosa (2B8); odour absent.
Typus: China, Shaanxi Province, Hanzhong city (E107.632; N33.211),
obtained from the symptomatic tissues of wheat scab, 13 May 2021, Y.J.
Chen (holotype HMAS 351948, ex-type living culture CGMCC3.23516 =
LC15875 = HSL1587).
Additional materials examined: (See Supplementary Table S1).
Notes: The three isolates representing F. fecundum were resolved
as a strongly supported genealogically exclusive lineage in the
phylogenies inferred from combined CaM, rpb2, and tef1 loci (Fig.
9), and genomic datasets (Fig. 14). Phylogenetically, F. fecundum
is closely related to the species within the previous FCAMSC (F.
kotabaruense, F. camptoceras and F. neosemitectum), but differs
by 83 bp, 84 bp and 84 bp in the combined dataset, respectively.
Morphologically, this species is distinguishable from closely
related species based on its conidial size (13–40.1 × 3.5–6.8 μm
in F. fecundum vs 21–45 ×5–7.5 μm in F. kotabaruense, 15–51 ×
4–7 μm in F. camptoceras, 17–41 × 3–6 μm in F. neosemitectum)
and the number of conidial septa (1–6-septate in F. fecundum vs
2–7-septate in F. kotabaruense, 0–7-septate in F. camptoceras,
1–5-septate in F. neosemitectum) (Marasas et al. 1998, Maryani et
al. 2019b, Xia et al. 2019).
Fusarium guilinense M.M. Wang et al., Persoonia 43: 80. 2019.
New synonym: Fusarium bubalinum J.W. Xia et al., Persoonia 43:
199. 2019.
Material examined: (See Supplementary Table S1).
Notes: Fusarium guilinense was first reported from China from
leaves of Musa nana (Wang et al. 2019a), and in this study from
rice glumes (Supplementary Table S1). In addition, Xia et al. (2019)
in their analyses, did not include the ex-type isolate of F. guilinense
(also F. caatingaense, F. citri, F. hainanense, F. humuli, F. ipomoeae,
F. irregulare, F. luffae, F. nanum and F. pernambucanum), thus could
not reflect on species relationships in this group. Here our multi-
locus phylogenetic analyses clearly showed that “F. bubalinum”
(Xia et al. 2019) clustered within the F. guilinense clade (Fig. 9).
Therefore, we consider F. bubalinum as a synonym of F. guilinense.
129
Han et al.
Fig. 21. Morphology of Fusarium fecundum (CGMCC3.23516, ex-type culture). A. Colony on PDA. B. Colony on OA. C–E. Aerial conidiophores and
phialides. F. Aerial conidia. Scale bars = 10 μm.
Fusarium hainanense M.M. Wang et al., Persoonia 43: 82. 2019.
Material examined: (See Supplementary Table S1).
Notes: Fusarium hainanense was first reported from Musa nana
and Oryza sp. (Wang et al. 2019a), and subsequently from Acacia
sp., Musa acuminata, Oryza australiensis (Xia et al. 2019), and
maize (this study). Three isolates (JS21, JS3, JS9) of rice spikelet
rot clustered with the ex-type strain of F. hainanense in our multi-
locus analyses (Fig. 9).
130
Fusarium humuli M.M. Wang et al., Persoonia 43: 83. 2019.
Material examined: (See Table Supplementary S1).
Notes: Fusarium humuli was first reported from China on 12
different hosts, including Humulus scandens (Wang et al. 2019a),
and is herein reported from rice and wheat as new host records.
Phylogenetically, this species clusters in the Incarnatum clade of
FIESC, closely related to F. citri, F. fasciculatum and F. weifangense
(Wang et al. 2019a, Xia et al. 2019, this study). Morphologically,

these four species could be distinguished based on the morphology
of their sporodochial conidia (Wang et al. 2019a, Xia et al. 2019,
this study).
Fusarium ipomoeae M.M. Wang et al., Persoonia 43: 83. 2019.
Material examined: (See Table Supplementary S1).
Notes: Fusarium ipomoeae has been isolated from multiple hosts
(Wang et al. 2019a, Xia et al. 2019, Zhou et al. 2020, Xu et al.
2021b). Notably, one strain of this species has been reported as
a pathogen of maize but previously misidentified as F. equiseti
through tef1 BLASTn in GenBank (Li et al. 2014, Fig. 9). Here,
we isolated F. ipomoeae from maize stalks rot (Fig. 2E), maize ear
rot (Fig. 1A), wheat scab (Fig. 3D) and rice spikelet rot (Fig. 5E),
updating two new host (maize and wheat) records (Table 2), and
confirmed its pathogenicity to maize (Fig. 7K).
Fusarium jinanense S.L. Han, M.M. Wang & L. Cai, sp. nov.
MycoBank MB 847025. Fig. 22.
Etymology: Named after the city, Jinan, where the holotype was
collected.
Sporodochia melon (5A6), formed infrequently on carnation leaves
or agar. Sporodochial conidiophores densely and irregularly
branched, bearing apical whorls of 3–6 phialides. Sporodochial
phialides subulate to subcylindrical, smooth, thin-walled, 8–14
× 2.5–4 μm. Sporodochial conidia falcate, curved dorsoventrally,
tapering towards both ends, with an elongated or whip-like
curved apical cell and a well-developed to elongate foot-shaped
basal cell, hyaline, thin- and smooth-walled, (4–)5(–6)-septate:
4-septate conidia: 34.5–43.5 × 3.7–4.7 μm (av. ± SD: 34.6 ± 0.1
× 3.9 ± 0.2 μm); 5-septate conidia: 50–58 × 3.9–5.2 μm (av. ±
SD: 54.5 ± 3.5 × 4.6 ± 0.6 μm); 6-septate conidia: 58.7–63.8 ×
4.1–4.5 μm (av. ± SD: 61.3 ± 2.8 × 4.2 ± 0.2 μm). Aerial conidia
not observed. Chlamydospores abundant, globose, subglobose to
ovoid, subhyaline, smooth or rough-walled, terminal or intercalary,
solitary, in pairs or forming long chains, 6.2–10.3 μm diam.
Culture characteristics: Colonies on PDA incubated at 25 °C in the
dark reaching 67–73 mm diam in 7 d; flat, felty to velvety, radiate,
with abundant aerial mycelium, colony margin undulate; surface
cream (4A3) in the centre, white (–A1) at the margin; reverse
flame yellow (4A8) in the centre, white (–A1) at the margin; odour
absent. On OA in the dark reaching 98–101 mm in 7 d; flat, felty to
dusty, with abundant aerial mycelium, margin entire; surface white,
reverse curry yellow (4C8) in the centre, cream (4A3) at the margin;
odour absent.
Typus: China, Shandong Province, Jinan City (E117.1; N36.4), obtained
from the symptomatic tissues of maize ear rot, 29 Sep. 2020, X.Y. Liu
(holotype HMAS 351951, ex-type living culture CGMCC3.23519 =
LC15878 = HSL751).
Additional materials examined: (See Supplementary Table S1).
Notes: The isolates representing F. jinanense were resolved
as a strongly supported genealogically exclusive lineage in the
phylogeny inferred from combined CaM, rpb2, and tef1 loci (Fig. 9).
Fusarium jinanense is closely related to F. lacertarum, but differs
by 14 bp in the three loci dataset. Morphologically, F. jinanense
is distinguished from F. lacertarum based on the morphologies of
www.studiesinmycology.org
Fusarium spp. on cereals in China
conidia (4–6-septate, dorsiventral curvature conidia in F. jinanense
vs 2–4-septate, typical Fusarium conidia in F. lacertarum); the
presence of sporodochia (which are absent in F. lacertarum),
and the absence of aerial conidia (present in F. lacertarum)
(Subrahmanyam 1983, Leslie & Summerell 2006). Pathogenicity
tests confirmed its ability to cause maize stalk rot (Fig. 7L).
Fusarium mianyangense S.L. Han, M.M. Wang & L. Cai, sp. nov.
MycoBank MB 847026. Fig. 23.
Etymology: Named after the city, Mianyang, where the holotype
was collected.
Sporodochia cream (4A3), formed frequently on carnation leaves,
and infrequently on agar. Sporodochial conidiophores densely
and irregularly branched, bearing apical whorls of 3–5 phialides.
Sporodochial phialides subulate to subcylindrical, smooth, thin-
walled, 7.5–13.6 × 1.7–3.8 μm. Sporodochial conidia falcate, the
dorsal side curved than the ventral, with a blunt apical cell and
well-developed foot-shaped basal cell, hyaline, smooth- and thin-
walled, 3(–5)-septate: 3-septate conidia: 24.5–29.9 × 2.8–4.7 μm
(av. ± SD: 27.3 ± 1.6 × 3.6 ± 0.4 μm); 4-septate conidia: 27.6–34.1
× 2.5–4.5 μm (av. ± SD: 30.9 ± 1.8 × 3.6 ± 1.4 μm); 5-septate
conidia: 29.5–36.6 × 3.0–4.9 μm (av. ± SD: 33.0 ± 2.3 × 3.9 ±
0.5 μm). Aerial conidia not observed. Chlamydospores abundant,
globose to subglobose, subhyaline, smooth or rough-walled,
intercalary, solitary or forming long chains, 6.0–14.0 μm diam.
Culture characteristics: Colonies on PDA incubated at 25 °C
in the dark reaching 74–80 mm diam in 7 d; flat, felty to velvety,
with abundant aerial mycelium, colony margin entire; surface
white; reverse orange white (5A2) in the centre, white (A1) at the
margin; odour absent. On OA in the dark reaching 73–80 mm in 7
d; convex, with abundant aerial mycelium, margin entire; surface
white, reverse apricot (5B6) in the centre, cream (4A3) at the
margin; odour absent.
Typus: China, Sichuan Province, Mianyang City (E105.15, N31.78),
obtained from the symptomatic tissues of Oryza sativa spikelet rot, 4
Oct. 2020, M.L. Feng (holotype HMAS 351952, ex-type living culture
CGMCC3.23520 = LC15879 = HSL859).
Additional materials examined: (See Supplementary Table S1).
Notes: Isolates representing F. mianyangense were resolved
as a strongly supported genealogically exclusive lineage in the
phylogenies inferred from combined CaM, rpb2, and tef1 loci (Fig.
9). Fusarium mianyangense is closely related to F. citrullicola,
but differs by 15 bp in the three loci dataset. Morphologically,
they are distinguished from each other in the number of septa
in sporodochial conidia (3–5-septate in F. mianyangense vs
1–5-septate in F. citrullicola) and the size of sporodochial conidia
(24.5–36.6 × 2.5–4.9 μm in F. mianyangense vs 8–39 × 2–4.9 μm
in F. citrullicola) (Khuna et al. 2022). Pathogenicity tests fulfilling
the Koch’s postulates confirmed its ability to cause maize stalk rot
(Fig. 7N).
Fusarium luffae M.M. Wang et al., Persoonia 43: 85. 2019.
Material examined: (See Supplementary Table S1).
Notes: Fusarium luffae has been reported as endophyte of Luffa
aegyptiaca, Humulus scandens and Setaria verticillata in previous
131
Han et al.

Fig. 22. Morphology of Fusarium jinanense (CGMCC3.23519, ex-type culture). A. Colony on PDA. B. Colony on OA. C. Sporodochia. D, E. Sporodochial
conidiophores and phialides. F. Sporodochial conidia. G. Chlamydospores. Scale bars = 10 μm.

studies (Wang et al. 2019a, Xia et al. 2019). In addition, one tef1) phylogenetic analyses (Fig. 9). We herein confirmed the
pathogenic strain isolated from maize stalk rot was previously pathogenicity of F. luffae (Fig. 7M) and confirmed three new host
misidentified as F. incarnatum through tef1 BLASTn (Gai et al. records (maize, rice and wheat).
2016), but it clustered with F. luffae in our multi-locus (CaM-rpb2-

132
 Fusarium spp. on cereals in China

Fig. 23. Morphology of Fusarium mianyangense (CGMCC3.23520, ex-type culture). A. Colony on PDA. B. Colony on OA. C. Sporodochia. D, E. Sporodochial
conidiophores and conidiogenous cells. F. Sporodochial conidia. G. Chlamydospores. Scale bars = 10 μm.

Fusarium nanum M.M. Wang et al., Persoonia 43: 85. 2019.
Material examined: (See Supplementary Table S1).
Notes: Fusarium nanum appears to be a broad host range
species, which has been reported from Musa nana, Oryza sp.,
Solanum lycopersicum, Glycine max, Musa nana, Triticum sp.,
maize and wheat (Wang et al. 2019a, Xia et al. 2019, this study).
Phylogenetically, it clustered in the Incarnatum clade, which
includes 19 species, with 16 of them reported from cereals (Wang
et al. 2019a, Xia et al. 2019, this study).
Fusarium nothincarnatum S.L. Han, M.M. Wang & L. Cai, sp.
nov. MycoBank MB 847027. Fig. 24.
Etymology: Noth = nothus in Greek, fake, close but different;
incarnatum = incarnatum-like morphology.

www.studiesinmycology.org 133
Han et al.

Fig. 24. Morphology of Fusarium nothincarnatum (CGMCC3.24286, ex-type culture). A. Colony on PDA. B. Colony on OA. C. Sporodochia. D. Sporodochial
conidiophores and conidiogenous cells. E. Sporodochial conidia. F. Aerial conidiophores and phialides. G. Aerial conidia. H. Chlamydospores. Scale bars
= 10 μm.

Sporodochia cream (4A3), formed abundantly on carnation leaves
and the surface of the medium. Sporodochial conidiophores densely
and irregularly branched, bearing apical whorls of 3–5 phialides.
Sporodochial phialides subulate to subcylindrical, with a short-
flared apical collarette, smooth, thin-walled, 6.1–17.8 × 2.3–4.0 μm.
Sporodochial conidia falcate, the dorsal side curved than the ventral,
with a curved apical cell and poorly-developed foot-shaped basal
cell, hyaline, thin- and smooth-walled, (0–)3–5-septate; 0-septate
conidia: 8.7–23.3 × 1.9–2.9 μm (av. ± SD: 16.5 ± 6.3 × 2.5 ± 0.4 μm),
1-septate conidia: 14.6–19.0 × 2.3–2.8 μm (av. ± SD: 16.9 ± 1.7 × 2.6
± 0.2 μm), 2-septate conidia: 13.6–26.4 × 2.6–4.0 μm (av. ± SD: 20.1
± 3.9 × 3.0 ± 0.4 μm), 3-septate conidia: 25.8–37.7 × 3.3–4.8 μm
(av. ± SD: 32.9 ± 3.3 × 3.9 ± 0.4 μm), 4-septate conidia: 34.7–41.8 ×
3.2–4.6 μm (av. ± SD: 38.2 ± 2.1 × 4.1 ± 0.3 μm), 5-septate conidia:

134

32.5–41.5 × 2.9–4.9 μm (av. ± SD: 37.3 ± 2.2 × 3.7 ± 0.4 μm).
Aerial conidiophores borne on aerial mycelium, straight or flexuous,
erect or prostrate, smooth- and thin-walled, unbranched, sympodial
or irregularly branched, bearing terminal or lateral phialides; Aerial
phialides monophialidic, subulate to subcylindrical, smooth- and thin-
walled, periclinal thickening inconspicuous or absent, sometimes
proliferating percurrently, 8.2–21.6 × 1.4–3.5 μm. Aerial conidia
falcate, curved dorsiventrally, with curved apical cell and blunt
to barely notched basal cell, hyaline, smooth- and thin-walled,
3(–5)-septate: 3-septate conidia: 17.7–34.8 × 3.0–4.5 μm (av. ± SD:
26.4 ± 4.2 × 3.7 ± 0.4 μm); 4-septate conidia: 30.6–39.9 × 3.2–7.4 μm
(av. ± SD: 35.9 ± 2.4 × 4.0 ± 0.7 μm); 5-septate conidia: 32.7–42.4 ×
3.2–4.5 μm (av. ± SD: 36.2 ± 3.0 × 3.7 ± 0.4 μm). Chlamydospores
abundant, globose, subglobose to ovoid, subhyaline, smooth-walled,
intercalary, solitary, in pairs or forming chains, 7.3–12.4 μm diam.
Culture characteristics: Colonies on PDA incubated at 25 °C in
the dark reaching 77–79 mm diam in 7 d; flat, felty to velvety, with
abundant aerial mycelium, colony margin entire; surface white (A1);
reverse orange white (5A2) in the centre, white (A1) at the margin;
odour absent. On OA in the dark reaching 73–76 mm in 7 d; raised,
with relatively sparse aerial mycelium, margin entire; surface white
(A1), reverse milk white (1A2); odour absent.
Typus: China, Heilongjiang Province, Daqing City (E124.81, N46.04),
obtained from the symptomatic tissues of Oryza sativa spikelet rot,
7 Oct. 2020, Y.J. Li (holotype HMAS 352343, ex-type living culture
CGMCC3.24286 = LC18436 = HSL221).
Additional materials examined: (See Supplementary Table S1).
Notes: Isolates representing F. nothincarnatum were resolved
as a strongly supported genealogically exclusive lineage in the
phylogenies inferred from combined CaM, rpb2, and tef1 (Fig.
9), and genomic datasets (Fig. 14). Fusarium nothincarnatum is
closely related to F. incarnatum, but differs by 23 bp in the three
loci dataset. Morphologically, F. nothincarnatum is distinguished
from F. incarnatum based on the number of septa in sporodochial
conidia (0–5-septate in F. nothincarnatum vs 1–6-septate in F.
incarnatum); the morphology of sporodochial conidia (the dorsal
side more curved than the ventral, with more curved apical cell in
F. nothincarnatum); the type of aerial phialides (monophialides in F.
nothincarnatum vs mono- and polyphialides in F. incarnatum); and
the morphologies of aerial conidia (F. nothincarnatum produces
only falcate aerial conidia with 3–5 septa; while two types of aerial
conidia were found in F. incarnatum: ellipsoidal to fusoid-shaped
with 0–3 septa, and falcate shaped with 1–7 septa) (Xia et al. 2019).
Fusarium pernambucanum A.C.S. Santos et al., Mycologia 111:
253. 2019.
New synonym: Fusarium melonis S. Khuna et al., J. Fungi 8: 1135.
2022, nom. inval., Art. 40.8 (Shenzen).
Material examined: (See Supplementary Table S1).
Notes: Fusarium pernambucanum was originally reported from
Aleurocanthus woglumi (Santos et al. 2019), and subsequently from
Cucumis melo (Medeiros Araújo et al. 2020). This study expands
its host range (maize) with confirmed pathogenicity (Fig. 7P). In
addition, the inclusion of a larger sampling of F. pernambucanum
isolates for the multi-locus phylogenetic analysis clearly showed
that the ex-type isolate (SDBR-CMU424) of F. melonis (Khuna
et al. 2022) clustered within the F. pernambucanum clade (Fig.
www.studiesinmycology.org
Fusarium spp. on cereals in China
9). Therefore, we consider F. melonis as a later synonym of F.
pernambucanum.
Fusarium sulawesiense Maryani et al. (as ‘sulawense’), Persoonia
43: 65. 2019.
Material examined: (See Supplementary Table S1).
Notes: Fusarium sulawesiense was originally reported from Musa
acuminata (Maryani et al. 2019b), and subsequently from rice
(Wang et al. 2019a). This study expands its host range (maize and
wheat) with confirmed pathogenicity (Fig. 7T).
Fusarium tanahbumbuense Maryani et al., Persoonia 43: 63.
2019.
Material examined: (See Table S1).
Notes: Fusarium tanahbumbuense was first obtained from infected
pseudostem of Musa sp. var. Pisang Hawa (ABB), but when
conducting pathogenicity trials, it only caused a slight discoloration
in the corm without further disease development (Maryani et al.
2019b). Later, two isolates of this species were recorded as a
pathogen of wheat, but misidentified as F. incarnatum based on
tef1 phylogenetic analysis (Özer et al. 2020, Fig. 9). Here we add
two new host records (maize and rice), and confirm its ability to
cause maize stalk rot (Fig. 7U).
Fusarium weifangense S.L. Han, M.M. Wang & L. Cai, sp. nov.
MycoBank MB 847028. Fig. 25.
Etymology: Named after the city, Weifang, where the holotype was
collected.
Sporodochia milk white (1A2), formed frequently on carnation leaves.
Sporodochial conidiophores densely and irregularly branched,
bearing apical whorls of 3–4 phialides. Sporodochial phialides
subulate to subcylindrical, smooth, thin-walled, 8.8–29.9 × 3.1–5.1
μm. Sporodochial conidia falcate, the dorsal side curved than the
ventral, with a blunt apical cell and poorly-developed foot-shaped
basal cell, hyaline, smooth- and thin-walled, (3–)5(–7)-septate:
3-septate conidia: 26.5–30.9 × 4.5–5.8 μm (av. ± SD: 28.8 ± 1.7 × 4.9
± 0.4 μm); 4-septate conidia: 28.0–35.4 × 4.1–5.5 μm (av. ± SD: 31.0
± 2.1 × 4.7 ± 0.3 μm); 5-septate conidia: 30.0–49.4 × 4.9–6.7 μm
(av. ± SD: 37.2 ± 4.3 × 5.6 ± 0.4 μm); 6-septate conidia: 37.7–49.2 ×
5.1–7.1 μm (av. ± SD: 44.5 ± 3.7 × 5.9 ± 0.7 μm); 7-septate conidia:
35.5–36 × 4.8–5.6 μm (av. ± SD: 35.7 ± 0.3 × 5.2 ± 0.6 μm). Aerial
conidia and chlamydospores not observed.
Culture characteristics: Colonies on PDA incubated at 25 °C
in the dark reaching 69–79 mm diam in 7 d; flat, felty to velvety,
with abundant aerial mycelium, colony margin entire; surface
white (A1); reverse milk white (1A2); odour absent. On OA in the
dark reaching 76–83 mm in 7 d; crateriform, with abundant aerial
mycelium, margin entire; surface white (A1), reverse cream (4A3);
odour absent.
Typus: China, Shandong Province, Weifang City (E119.79, N36.23), from
the symptomatic tissues of wheat scab, 18 May 2021, P. Shen (holotype
HMAS 352342, ex-type living culture CGMCC3.24285 = LC18333 =
HSL1800).
Additional materials examined: (See Supplementary Table S1).
135
Han et al.

Fig. 25. Morphology of Fusarium weifangense (CGMCC3.24285, ex-type culture). A. Colony on PDA. B. Colony on OA. C. Sporodochia. D, E. Sporodochial
conidiophores and conidiogenous cells. F. Sporodochial conidia. Scale bars = 10 μm.

Notes: The isolates representing F. weifangense were resolved
as a strongly supported genealogically exclusive lineage in the
phylogeny inferred from combined CaM, rpb2, and tef1 loci (Fig.
9). Fusarium weifangense is closely related to F. citri and F. humuli,
but differs by 37 bp and 51 bp in the three loci dataset, respectively.
Morphologically, F. weifangense could be distinguished from the
latter two species in the number of septa in sporodochial conidia
(3–7-septate in F. weifangense vs 3–5-septate in F. citri and F.
humuli), the size of sporodochial conidia (26.5–49.4 × 4.1–7.1 μm
in F. weifangense vs 25.5–40.5 × 3–5.5 μm in F. citri vs 21–35 ×
2–3 μm in F. humuli) (Wang et al. 2019a).

136

Fusarium nisikadoi species complex (FNSC)
FNSC now includes six species (F. commune, F. gaditjirrii, F.
lyarnte, F. miscanthi, F. nisikadoi and F. paranisikadoi), all of which
are associated with plants (Nirenberg 1997, Gams et al. 1999,
Skovgaard et al. 2003, Phan et al. 2004, Crous et al. 2021, Wang
et al. 2022a). In this study, all six obtained strains belonging to
this complex were identified as F. commune based on multi-locus
analyses (Fig. 10).
Fusarium commune K. Skovg. et al., Mycologia 95: 632. 2003.
Material examined: (See Supplementary Table S1).
Notes: Fusarium commune has been reported as pathogens of rice
wilt, rice root rot, and maize stalk rot by Husna et al. (2020) and
Xi et al. (2019). This species is pathologically similar to species in
FOSC, causing root rot and wilt diseases on a variety of plants (Ma
et al. 2010, Maryani et al. 2019a, McTaggart et al. 2021).
Fusarium oxysporum species complex (FOSC)
Members of FOSC are mostly soil-borne fungi causing root and
vascular wilt diseases (Ma et al. 2010, Maryani et al. 2019a,
McTaggart et al. 2021). Previously, the FOSC has been classified
as one species which included more than 100 formae speciales,
based on subspecific classification systems (Snyder & Hansen
1940, Gordon 1965, Lombard et al. 2019b). The F. oxysporum
strains belonging to the same forma specialis, however, have been
shown to represent multiple species based on the multi-locus and
phylogenomic analyses (Zhang & Ma 2017, Lombard et al. 2019b,
McTaggart et al. 2021). For instance, Fusarium oxysporum f. sp.
lycopersici, has been shown to be an assemblage of two distinct
species, namely F. nirenbergiae and F. languescens (Lombard et
al. 2019b). With the continuous clarification of the phylogenetic
relationships in this species complex, up to 31 cryptic species
have been recognised and formally named (Lombard et al. 2019b,
Maryani et al. 2019a, Wang et al. 2022a). Recently, population
genomics analyses based on 410 genomes within the FOSC
suggested that long-term sexual or parasexual reproduction have
contributed to the species diversity of this complex, stepping away
from the previous hypothesis suggesting strictly clonal propagation
(McTaggart et al. 2021).
Fusarium cugenangense Maryani et al., Stud. Mycol. 92: 181.
2018 [2019].
Material examined: (See Supplementary Table S1).
Notes: The banana Fusarium wilt pathogen, previously called F.
oxysporum f. sp. cubense has been confirmed to include nine
independent phylogenetic lineages (Maryani et al. 2019a). Among
them, the lineage referred to as Foc Lineage L7 by Fourie et al.
(2009), was recently formally described as a new species Fusarium
cugenangense (Maryani et al. 2019a). According to multi-locus
analyses of available data, F. cugenangense appears to have a very
wide host range, including Acer palmatum, Crocus sp., Gossypium
barbadense, Hordeum vulgare, Solanum tuberosum, Smilax sp.,
Tulipa gesneriana, Musa nana, Musa sp., Vicia faba and Zea mays
(Maryani et al. 2019a, Wang et al. 2022a, this study).
www.studiesinmycology.org
Fusarium spp. on cereals in China
Fusarium nirenbergiae L. Lombard & Crous, Persoonia 43: 29.
2018 [2019].
Material examined: (See Supplementary Table S1).
Notes: Fusarium nirenbergiae has been isolated from at least 20
host genera (Lombard et al. 2019b, Wang et al. 2022a), and has
been recorded to contain isolates which were previously classified
in 14 different forma specialis, e.g., F. oxysporum f. sp. bouvardiae,
F. oxysporum f. sp. cubense, F. oxysporum f. sp. lycopersici, etc.
(Lombard et al. 2019b, McTaggart et al. 2021). In this study, we
reported a new host record of F. nirenbergiae and confirmed its
pathogenicity (Fig. 7O).
Fusarium sambucinum species complex (FSAMSC)
According to the multi-locus phylogenetic (Fig. 12) and
phylogenomic support (Fig. 15), the FSAMSC now includes 41
described species (Crous et al. 2021, Laraba et al. 2021, Lombard
et al. 2022), and almost half of the species in this complex have
been reported from cereals (Table 2). The 205 isolates obtained in
this study were identified as nine known species (Fig. 12).
Fusarium armeniacum (G.A. Forbes et al.) L.W. Burgess &
Summerell, Stud. Mycol. 98: 86. 2021.
Basionym: Fusarium acuminatum subsp. armeniacum G.A. Forbes
et al., Mycologia 85: 120. 1993.
Material examined: (See Supplementary Table S1).
Notes: Fusarium armeniacum has been recorded as causal agent
of wheat scab, root rot and seed rot of various plants (Wing et al.
1993, Leslie & Summerell 2006, Summerell et al. 2010, Krone et
al. 2020). Here we update two new host records (maize and wheat)
in China, and confirm its ability to cause maize stalk rot (Fig. 7G).
Fusarium asiaticum O’Donnell et al., Fungal Genet. Biol. 41: 619.
2004.
Material examined: (See Supplementary Table S1).
Notes: Fusarium asiaticum is one of the main pathogens of wheat
scab in the world, especially in Asia (Suga et al. 2008, Zhang et al.
2012, Castañares et al. 2016), and it is also a notorious pathogen
of wheat crown rot, maize ear rot, maize stalk rot and rice spikelet
rot (Desjardins & Proctor 2011, Gomes et al. 2015, Zhang et al.
2016, Dong et al. 2020b, Xi et al. 2021). In our study, most strains
of this species were isolated from blighted wheat spikes (wheat
scab) from southern China, supporting earlier findings that it is a
dominant agent of wheat scab in China (Zhang et al. 2012, Yang et
al. 2018, Xu et al. 2021a).
Fusarium boothii O’Donnell et al., Fungal Genetics Biol. 41: 618.
2004.
Material examined: (See Supplementary Table S1).
Notes: Fusarium boothii has been reported as a pathogen of wheat
scab, maize ear rot and stalk rot (Malihipour et al. 2012, Zhang
et al. 2016, Beukes et al. 2017, Gai et al. 2017). The hybrid of F.
graminearum × F. boothii has been reported from maize in France
and South Africa (Boutigny et al. 2011, 2013). Future comparative
genomic analyses of F. graminearum, F. boothii, F. graminearum ×
137
Han et al.
F. boothii would be useful for understanding the speciation of these
closely related species.
Fusarium graminearum Schwabe, Fl. Anhalt. 2: 285. 1839.
Synonyms: see Crous et al. (2021).
Material examined: (See Supplementary Table S1).
Notes: Fusarium graminearum, with the smallest genome in the
whole genus (Supplementary Table S3), has been considered as
one of the top 10 most economically harmful fungal pathogens
(Dean et al. 2012). This species is widely distributed on different
hosts with different lifestyles (pathogens, endophytes, saprophytes)
(Cuomo et al. 2007, Starkey et al. 2007, Talas & McDonald
2015, Lofgren et al. 2018, Sarowar et al. 2019). In our study, F.
graminearum was also one of the most frequently isolated species
(85 strains) and, in many cases, co-occurred with other pathogens
in the same diseased plant, leading to co-infection (Supplementary
Table S6).
Fusarium kyushuense O’Donnell & T. Aoki, Mycoscience 39: 2.
1998.
Material examined: (See Supplementary Table S1).
Notes: Fusarium kyushuense clustered within the Sambucinum
clade, closely related to F. venenatum and F. poae (Fig. 12), all of
which have been reported as cereal pathogens (Table 2). In China,
F. kyushuense has been reported as pathogen causing maize ear
and stalk rot (Wang et al. 2014, Cao et al. 2021). Here we report F.
kyushuense for the first time from diseased wheat (Fig. 3C).
Fusarium meridionale T. Aoki et al., Fungal Genet. Biol. 41: 618.
2004.
Material examined: (See Supplementary Table S1).
Notes: Fusarium meridionale was originally known from the
Southern Hemisphere, but is now known to have a global distribution
(O’Donnell et al. 2004, Farr & Rossman 2022). To date, this species
has been reported as pathogens of maize ear rot, maize stalk rot,
wheat scab and rice spikelet rot (Zhang et al. 2014b, 2016, Dong
et al. 2020a). Herein we newly record this species from wheat in
China.
Fusarium poae (Peck) Wollenw., in Lewis, Bull. Maine. Agric. Exp.
Sta. 219: 254. 1913 [1914].
Basionym: Sporotrichum poae Peck, Bull. New York State Mus. 67:
29. 1904 [1903].
Synonyms: see Crous et al. (2021).
Material examined: (See Supplementary Table S1).
Notes: Fusarium poae produces a series of mycotoxins, such as
diacetoxyscirpenol, beauvericin and nivalenol (Laraba et al. 2021).
This species has been widely recorded from cereals, but appears
to be pathologically less aggressive compared with F. graminearum
(Bottalico & Perrone 2002, Xu et al. 2020, Laraba et al. 2021). In
our investigation, F. poae appeared to be more frequently recorded
from alpine and dry areas (Fig. 16C; Supplementary Table S1).
Fusarium pseudograminearum O’Donnell & T. Aoki, Mycologia
91: 604. 1999.
138
Synonyms: see Crous et al. (2021).
Material examined: (See Supplementary Table S1).
Notes: Fusarium pseudograminearum is a well-known mycotoxin
(3-acetyldeoxynivalenol, zearalenone, nivalenol and culmorin)
producing fungus (Farr & Rossman 2022, Laraba et al. 2021). It
is also a major causal agent of wheat crown rot in Northern China
(Li et al. 2012, Xu et al. 2015), which was further confirmed in our
study (Supplementary Table S1).
Fusarium vorosii B. Tóth et al., Fungal Genet. Biol. 44: 1202.
2007.
Material examined: (See Supplementary Table S1).
Notes: Fusarium vorosii was first described as a pathogen of wheat
scab by Starkey et al. (2007). Later, it has been isolated from other
cereals, including Hordeum vulgare, Oryza sativa and Zea mays
(Lee et al. 2016). To date, this species has been reported from
five countries (Farr & Rossman 2022), including Hungary, Serbia,
Japan, Korea and China (this study).
Fusarium tricinctum species complex (FTSC)
Species in FTSC are widely distributed in various grains and
produce a broad range of mycotoxins (Leslie & Summerell 2006).
Currently, 14 cryptic species have been identified and described in
this complex (Wang et al. 2022a), among which F. acuminatum and
F. avenaceum have the widest host range (more than 250 different
hosts). Coincidentally, all 20 strains of this complex isolated in this
study were identified as F. acuminatum or F. avenaceum (Fig. 13).
Fusarium acuminatum Ellis & Everh., Proc. Acad. Nat. Sci.
Philadelphia 47: 441. 1895.
Synonyms: see Crous et al. (2021).
Material examined: (See Supplementary Table S1).
Notes: Fusarium acuminatum was usually reported from temperate
regions as a soil saprobe or pathogen of root and crown diseases
of various plants (Leslie & Summerell 2006, Zhang et al. 2015, this
study: Fig. 7D). In this study, eight strains isolated from diseased
cereals clustered with the currently widely used reference strain of
Fusarium acuminatum (NRRL 52789) (O’Donnell et al. 2012, Li et
al. 2019a, Wang et al. 2022a).
Fusarium avenaceum (Fr.) Sacc., Syll. Fung. 4: 713. 1886.
Basionym: Fusisporium avenaceum Fr., Syst. Mycol. 2: 238. 1822,
nom. sanct. [Fr., l.c.].
Synonyms: see Crous et al. (2021).
Material examined: (See Supplementary Table S1).
Notes: Fusarium avenaceum is a cosmopolitan species and has
been recorded from more than 250 hosts (Leslie & Summerell
2006, Ma et al. 2019, Crous et al. 2021, Farr & Rossman 2022). On
cereals it has been associated with maize ear rot, wheat scab and
wheat crown rot (Logrieco et al. 2002b, Vogelgsang et al. 2008a, b,
Zhang et al. 2015), but due to the lack of sequence data we were
unable to confirm the species identify in previous studies. In this
investigation, 12 representative strains from wheat scab clustered
together with the ex-neotype of F. avenaceum (Crous et al. 2021).

DISCUSSION
“Broad” and “narrow” generic concept of Fusarium
Fusarium species have attracted much attention from plant
pathologists, food chemists and taxonomists because of their
widespread distribution, pathogenicity and mycotoxin production
(Marasas et al. 1984, Aoki et al. 2012, Yang et al. 2018, Torbati
et al. 2019, Crous et al. 2021, Tralamazza et al. 2021). However,
especially in the past decade, there have been several controversial
proposals on whether Fusarium should remain broadly defined to
keep most of the well-known pathogens under the generic name
Fusarium, or circumscribe Fusarium in a narrower sense, but
monophyletic, morphologically meaningful and as a definable
unit (Crous et al. 2021, Geiser et al. 2021). The “broad” concept
emphasised that the “terminal Fusarium clade” (F1) is monophyletic
(Fig. 14), with the same synapomorphy (fusarium-like macroconidia)
(Geiser et al. 2021). However, fusarium-like asexual macroconidia
occur in many other genera (e.g., Atractium, Fusicolla, Macroconia)
outside the “terminal Fusarium clade” (Crous et al. 2021). Under
the “narrow” concept, a set of synapomorphies on both sexual and
asexual characters could be used to distinguish the genus Fusarium
from allied genera (Crous et al. 2021). Moreover, recent genomic
analyses have revealed distinct divergence patterns between
Fusarium s. str. and other fusarioid taxa in natural selection,
translational selection and codon usage bias, which further support
the “narrow” Fusarium concept (Hill et al. 2022).
In our phylogenomic tree, 193 nodes (86 %) received 100 %
bootstrap support, including the nodes F1, F2, and F3 (Fig. 14).
Thus, we calculated concordance factors (gCF and sCF) as
complementary information which may help to improve the accuracy
of our interpretations of phylogenetic reconstructions (Fig. 14,
Supplementary Fig. S10A). As we had previously expected, the
gCF and sCF values resolved higher in node F3 (gCF 71.1 %, sCF
70.3 %) than in F2 (gCF 46.5 %, sCF 46.7 %) and F1 (gCF 51.3
%, sCF 47.1 %). Notably, low concordance values do not mean
that the phylogenetic tree is unresolved, but rather gives us further
insights on how related or congruent the genes are in resolving the
species phylogeny (Minh et al. 2020b). In our case, among the 1 001
single-copy orthologous gene trees, 712 of them support node F3
(Fusarium s.str.), while only 465 and 514 of them support node F2 and
F1, respectively. Our phylogenomic analyses (Fig. 14) thus further
support the rationality of the “narrow” Fusarium concept (assigning
Fusarium to node F3) as that of Gräfenhan et al. (2011), Lombard et
al. (2015) and Crous et al. (2021). Although the selection of a “narrow”
concept has inevitably brought in more name changes, in this scheme
the well-supported genealogically exclusive Fusarium species were
clearly associated with synapomorphies, including sexual morphs
(dark purple to black perithecia and subhyaline, smooth, 1–3-septate
ascospores), asexual morphs (macroconidia with variously shaped
apical and basal cells), and trichothecene mycotoxin production
(Lombard et al. 2015, Crous et al. 2021). Despite the sampling still
being unbalanced (e.g., few from Bisifusarium, and Rectifusarium),
our 1 001 homologous loci of 228 assembled genomes provided
much more phylogenetic information and a higher resolution than
previous multi-locus and genomic data (Crous et al. 2021, Geiser
et al. 2021). It is hoped that in the future more type material-derived
genomes will be sequenced and made publicly available (Crous et
al. 2022), in turn establishing more robust and natural classifications,
with species and generic names being more meaningful with regards
to their evolutionary relationships and phenotypic traits.
www.studiesinmycology.org
Fusarium spp. on cereals in China
Co-infections of Fusarium species on cereals
In the present study, there is a notable phenomenon that various
Fusarium species were isolated from the same cereal disease,
and these co-infection samples account for 56 % of the whole 315
samples (Fig. 17, Supplementary Table S6). Almost all species
isolated from co-infection samples have been previously reported
as pathogens (Table 2, Supplementary Table S6), and notably, it
is impossible to distinguish the co-infection species only through
the disease symptoms on the host. In an extreme example of
this study, four different species (i.e., F. luffae, F. sulawesiense,
F. tanahbumbuense, and F. verticillioides) were isolated from
the same diseased maize ear sample (Fig. 1F) collected from
Lianyungang city (E119.09, N34.5), Jiangsu Province. This type
of co-infection (or mixed infection) phenomenon has been noted
and discussed in previous plant or human diseases (Waner 1994,
Tarashi et al. 2017, Strauss et al. 2021, Wang et al. 2022b, Zhang et
al. 2022). Using wheat scab as an example, a recent study showed
that multiple Fusarium species have been isolated from the same
diseased wheat head samples (Wang et al. 2022b).
Previous studies suggested that pathogens occur more
frequently in an antagonistic or synergistic manner (van Kan et al.
2014, Bashyal et al. 2016, Gao et al. 2021, Mesny et al. 2021,
de Faria Ferreira 2022). For instance, both F. aglaonematis
and F. elaeidis could cause stem rot in Aglaonema modestum
independently, but co-infection enhanced plant disease severity
(Zhang et al. 2022). In contrast, F. graminearum causes more
serious wheat scab than co-infection of F. graminearum and F.
poae (Tan et al. 2020). The concepts of the pathobiome appear to
provide a more holistic perspective to understand the occurrence
of diseases, rather than simply employing the “one pathogen–
one disease” theory (Vayssier-Taussat et al. 2014, 2015, Sweet
& Bulling 2017, Bass et al. 2019). First, the pathobiome reflects
a more natural state of interaction between the host and its
microbes, as the boundaries between pathogens, endophytes
and saprophytes are somewhat ambiguous and relative (Álvarez-
Loayza et al. 2011, van Kan et al. 2014, Lofgren et al. 2018, Hill et
al. 2022). Many so-called “pathogens” only cause plant symptoms
at higher conidial concentrations (Fig. 7), and in many cases they
present different lifestyles on different plants (Varga et al. 2015,
Lofgren et al. 2018). Secondly, the co-occurrence of different
species may promote the emergence of new pathogenic varieties
through interspecific hybridization (Boutigny et al. 2011, 2013) or
gene transfer (Ma 2014, Vlaardingerbroek et al. 2016, Simbaqueba
et al. 2018), thus serve as a potential driver of pathogen evolution.
For example, F. nirenbergiae (Fo47) assimilated the pathogenicity
genes from F. languescens (Fol4287) via horizontal gene transfer
(Vlaardingerbroek et al. 2016, McTaggart et al. 2021). Thirdly, the
pathobiome vision provides a new perspective to explain why the
higher richness of fungal pathogens is usually associated with a
more harmful threat to plant health (Liu et al. 2022c), because
co-infection may enhance the reproduction and transmission
capacity of pathogens (Susi et al. 2015). The co-infection widely
detected in this study suggested that Fusarium pathogens may
have close interaction with each other in the process of the disease
development but the specific mechanisms in different diseases/
hosts remain to be revealed.
There is no doubt that co-infection will pose diagnostic
challenges for plant pathologists and quarantine officials. The
traditional isolation and culture-based protocols may often
underestimate the diversity of pathogens, ignoring one or more
other pathogens. Given the vast species number and the difficulty
139
Han et al.
in pathogen recognition, there is an urgent need to develop rapid
and efficient diagnosis protocols for the identification of Fusarium
species. The gene chip is likely a useful technical option for the
recognition of known species (Shi et al. 2012, Yin et al. 2020,
Yu et al. 2022), and Ward et al. (2008) has made a successful
attempt in the genus Fusarium. Given the considerable number
of Fusarium species causing a same disease as noted in this
study (Supplementary Table S6), more specific primers need to
be designed in future studies to diagnose these cereal pathogens
more accurately. The high-throughput sequencing is also potentially
useful but currently, widely used 2nd generation sequencing could
only reveal the pathogens at the generic level in most cases. The
3rd generation sequencing represented by PacBio technology
enabling longer reads of sequences would be potentially useful in
revealing the diversity of the pathobiome. Meanwhile, considering
the complex interactions among pathogenic Fusarium species, it is
necessary to analyse the functional complexities of the pathobiome
based on genome plasticity, metabolomics and microbial
interactions. A better understanding of the Fusarium diversity
and related pathobiome may revolutionize our understanding of
Fusarium pathogenicity and allow us to more effectively prevent
and control these diseases.
Need for universal barcode
Based on currently available data (Table 2), the Fusarium diseases
associated with cereals are mainly caused by members of FFSC,
FIESC, and FSAMSC. Our results were in agreement with previous
studies that the combination of CaM, rpb1, rpb2, tef1, and tub2
datasets could recognise all species within the FFSC (Yilmaz et al.
2021); and the combination of CaM, rpb2, and tef1 datasets could
recognise all species within the FIESC (Wang et al. 2019a, Xia et
al. 2019). As for the FSAMSC, we recommend to use concatenat-
ed H3-rpb1-rpb2-tef1 loci for species identification. In addition to
these three species-rich complexes, other cereal-related Fusarium
species could be discerned by rpb2 and tef1 datasets (Crous et al.
2021, Wang et al. 2022a, this study). As noted above, it is quite
frustrating that different complexes require different combinations
of molecular fragments to achieve correct identification, making the
identification process cumbersome and difficult for trainees and
plant pathologists. Taxonomists should continue to search for more
universal and useful barcodes to facilitate rapid and accurate iden-
tification of Fusarium species. For the currently widely sequenced
loci, even the most effective species recognition barcode (rpb2)
could only recognize 59, 33 and 35 species from the FFSC (with 84
species), FIESC (with 43 species), and FSMSC (with 41 species),
respectively.
Host preference of complexes and species
Similar to previous studies, several Fusarium species complexes
present certain host preferences (Gale et al. 2011, Zhang et al.
2012, 2015, Leyva-Madrigal et al. 2015, Yang et al. 2018, Duan
et al. 2020). For example, in this study, 90 % of diseased wheat
samples were associated with the FSAMSC, while 83 % of diseased
maize samples were associated with the FFSC (Supplementary
Table S1). These host preferences are usually explained as the
results of the co-evolution of Fusarium species with angiosperms in
warm and humid regions (Leslie & Summerell 2006, Ploetz 2006,
Przemieniecki et al. 2014, Aamot et al. 2015, Lofgren et al. 2018,
Vorob’eva & Toropova 2020). Taking Fusarium oxysporum f. sp.
cubense as an example, it has been identified and delimited as nine
140
independent species (O’Donnell et al. 1998b, Fourie et al. 2009,
Maryani et al. 2019a), and these species are believed to have long
co-evolved with their banana hosts in Asia (Ploetz & Pegg 1997,
Mostert et al. 2017, Maryani et al. 2019a).
Checklist of cereal-associated Fusarium species
In this study, we updated 39 and 52 host records for Fusarium
species for the world and China, respectively, and for the first
time (Table 2), confirmed the pathogenicity of 18 species causing
maize stalk rot (Fig. 7). According to the updated records presented
in this study, about 79 % of the new host records in China were
from new species published since 2019 (Table 2), indicating that
the description rate of new species in Fusarium has significantly
increased, along with the establishment of the new classification
scheme for the genus. The previous classification was confusing,
resulting in many sequences in public databases being assigned
to incorrect names or widely used complex names. For example:
i) most strains historically identified as F. proliferatum (a well-
known pathogen of maize) in previous studies (Leslie & Summerell
2006, Qiu et al. 2020) have been shown to be F. annulatum based
on the updated taxonomic system (Yilmaz et al. 2021); ii) many
pathogenic isolates previously recognised as F. incarnatum were
re-identified as different species (F. clavus, F. hainanense, F. luffae,
and F. tanahbumbuense) in the current study (Fig. 9). Considering
the large number of cryptic Fusarium species, there will be more
cereal-associated Fusarium species reported in the future. For
instance, there are 74 genealogically exclusive phylogenetically
distinct species in the FSAMSC, whereas only 41 of them were
formally named to date (Laraba et al. 2021).
ACKNOWLEDGEMENTS
We are very grateful to all who helped us to contact farmers, collect
diseased samples in their farmland, or provide photographs of diseased
cereals (Supplementary Fig. S1). The name of all participants are listed
in Supplementary Table S7. Funding for this study has been provided by
National Science and Technology Fundamental Resources Investigation
Program of China (2021FY100900) for fungal genome sequencing, NSFC
(31725001, 32070023) and Biological Resources Programme, CAS (KFJ-
BRP-009) for fungal diversity survey, the Major Scientific Research Focus
Project of Henan Academy of Science (210105002) for academic visiting
of JWW to IMCAS, and the Two Thousand Plan Foundation of Jiangxi
Province (jxsq2019102026) for LC to visit Jiangxi Agricultural University.
We are very grateful to Prof. P.W. Crous for inspiring our idea of sample
collection through a citizen science approach, as well as spending time in
editing our manuscript.
DECLARATION ON CONFLICT OF INTEREST
The authors declare that there is no conflict of interest.
REFERENCES
Aamot HU, Ward TJ, Brodal G, et al. (2015). Genetic and phenotypic
diversity within the Fusarium graminearum species complex in
Norway. European Journal of Plant Pathology 142: 501–519.
Abdallah-Nekache N, Laraba I, Ducos C, et al. (2019). Occurrence of
Fusarium head blight and Fusarium crown rot in Algerian wheat:
identification of associated species and assessment of aggressiveness.
European Journal of Plant Pathology 154: 499–512.

Abdul Rahm M, Mohamed Gh K, Essia Reha NA (2020). Prevalence
and transmission of seed-borne fungi of maize and their control by
phenolic antioxidants. Plant Pathology Journal 19: 176–184.
Adikaram NKB, Yakandawala DMD (2020). A checklist of plant pathogenic
fungi and Oomycota in Sri Lanka. Ceylon Journal of Science 49:
93–123.
Aguín O, Cao A, Pintos C, et al. (2014). Occurrence of Fusarium species
in maize kernels grown in north western Spain. Plant Pathology 63:
946–951.
Al-Hatmi AM, Bonifaz A, de Hoog GS, et al. (2014). Keratitis by Fusarium
temperatum, a novel opportunist. BMC Infectious Diseases 14: 588–
597.
Alexey G, Vladislav S, Nikolay V, et al. (2013). QUAST: quality assessment
tool for genome assemblies. Bioinformatics 29: 1072–1075.
Álvarez-Loayza P, White JF Jr, Torres MS, et al. (2011). Light converts
endosymbiotic fungus to pathogen, influencing seedling survival and
niche-space filling of a common tropical tree, Iriartea deltoidea. PLoS
ONE 6: e16386.
Amatulli MT, Spadaro D, Gullino ML, et al. (2010). Molecular identification
of Fusarium spp. associated with bakanae disease of rice in Italy and
assessment of their pathogenicity. Plant Pathology 59: 839–844.
Andrews S, Babraham B (2010). FastQC: a quality control tool for high
throughput sequence data. <http://www.bioinformatics.babraham.
ac.uk/projects/fastqc>.
Aoki T, O’Donnell K (1998). Fusarium kyushuense sp. nov. from Japan.
Mycoscience 39: 1–6.
Aoki T, O’Donnell K (1999). Morphological and molecular characterization
of Fusarium pseudograminearum sp. nov., formerly recognized as the
Group 1 population of F. graminearum. Mycologia 91: 597–609.
Aoki T, O’Donnell K, Geiser DM (2014). Systematics of key phytopathogenic
Fusarium species: current status and future challenges. Journal of
General Plant Pathology 80: 189–201.
Aoki T, O’Donnell K, Ichikawa K (2001). Fusarium fractiflexum sp. nov.
and two other species within the Gibberella fujikuroi species complex
recently discovered in Japan that form aerial conidia in false heads.
Mycoscience 42: 461–478.
Aoki T, Ward TJ, Kistler HC, et al. (2012). Systematics, phylogeny and
trichothecene mycotoxin potential of Fusarium head blight cereal
pathogens. Mycotoxins 62: 91–102.
Bacon CW, Hinton DM (1996). Symptomless endophytic colonization
of maize by Fusarium moniliforme. Canadian Journal of Botany 74:
1195–1202.
Balmas V, Corda P, Marcello A, et al. (2000). Fusarium nygamai associated
with Fusarium foot rot of rice in Sardinia. Plant Disease 84: 807–807.
Bankevich A, Nurk S, Antipov D, et al. (2012). SPAdes: a new genome
assembly algorithm and its applications to single-cell sequencing.
Journal of Computational Biology 19: 455–477.
Barkat EH, Hardy GESJ, Ren Y, et al. (2016). Fungal contaminants of
stored wheat vary between Australian states. Australasian Plant
Pathology 45: 621–628.
Bashyal BM, Aggarwal R, Sharma S, et al. (2016). Single and combined
effects of three Fusarium species associated with rice seeds on the
severity of bakanae disease of rice. Journal of Plant Pathology 98:
405–412.
Bass D, Stentiford GD, Wang HC, et al. (2019). The pathobiome in animal
and plant diseases. Trends in Ecology and Evolution 34: 996–1008.
Bentley AR, Petrovic T, Griffiths SP, et al. (2007). Crop pathogens and
other Fusarium species associated with Austrostipa aristiglumis.
Australasian Plant Pathology 36: 434–438.
Beukes I, Rose LJ, van Coller GJ, et al. (2017). Disease development and
mycotoxin production by the Fusarium graminearum species complex
associated with South African maize and wheat. European Journal of
Plant Pathology 150: 893–910.
Blacutt AA, Gold SE, Voss KA, et al. (2018). Fusarium verticillioides:
advancements in understanding the toxicity, virulence, and
niche adaptations of a model mycotoxigenic pathogen of maize.
Phytopathology 108: 312–326.
Booth C (1971). The genus Fusarium. Commonwealth Mycological Institte,
Kew, Surrey, England.
www.studiesinmycology.org
Fusarium spp. on cereals in China
Bottalico A, Perrone G (2002). Toxigenic Fusarium species and mycotoxins
associated with head blight in small-grain cereals in Europe. European
Journal of Plant Pathology 108: 611–624.
Boutigny AL, Ward TJ, Ballois N, et al. (2013). Diversity of the Fusarium
graminearum species complex on French cereals. European Journal
of Plant Pathology 138: 133–148.
Boutigny AL, Ward TJ, Van Coller GJ, et al. (2011). Analysis of the Fusarium
graminearum species complex from wheat, barley and maize in South
Africa provides evidence of species-specific differences in host
preference. Fungal Genetics and Biology 48: 914–920.
Britz H, Steenkamp ET, Coutinho TA, et al. (2002). Two new species of
Fusarium section Liseola associated with mango malformation.
Mycologia 94: 722–730.
Bugnicourt F (1952). Une espèce fusarienne nouvelle, parasite du riz.
Revue Générale de Botanique 59: 13–18.
Burgess LW, Forbes GA, Windels C, et al. (1993). Characterization and
distribution of Fusarium acuminatum subsp. armeniacum subsp. nov.
Mycologia 85: 119–124.
Burgess LW, Trimboli D (1986). Characterization and distribution of
Fusarium nygamai sp. nov. Mycologia 78: 223–229.
Byrnes KJ, Carroll RB (1986). Fungi causing stalk rot of conventional-
tillage and no-tillage corn in Delaware. Plant Disease 70: 238–239.
Cao Y, Zhang J, Han S, et al. (2021). First report of maize stalk rot caused
by Fusarium kyushuense in China. Plant Disease 105: 3759–3759.
Castañares E, Dinolfo MI, Del Ponte EM, et al. (2016). Species composition
and genetic structure of Fusarium graminearum species complex
populations affecting the main barley growing regions of South
America. Plant Pathology 65: 930–939.
Castañares E, Martínez M, Cristos D, et al. (2019). Fusarium species
and mycotoxin contamination in maize in Buenos Aires Province,
Argentina. European Journal of Plant Pathology 155: 1265–1275.
Castañares E, Stenglein SA, Dinolfo MI, et al. (2011). Fusarium tricinctum
associated with head blight on wheat in Argentina. Plant Disease 95:
496–496.
Castresana J (2000). Selection of conserved blocks from multiple
alignments for their use in phylogenetic analysis. Molecular Biology
and Evolution 17: 540–552.
Chehri K, Salleh B, Yli-mattila T, et al. (2010). Occurrence, pathogenicity
and distribution of Fusarium spp. in stored wheat seeds Kermanshah
Province, Iran. Pakistan Journal of Biological Sciences 13: 1178–1186.
Chiang KS, Liu HI, Bock CH (2017). A discussion on disease severity index
values. Part I: warning on inherent errors and suggestions to maximise
accuracy. Annals of Applied Biology 171: 139–154.
Cho WD, Shin HD. (2004). List of plant diseases in Korea. Korean Society
of Plant Pathology, Korea.
Choi HW, Hong SK, Lee YK, et al. (2018). Taxonomy of Fusarium
fujikuroi species complex associated with bakanae on rice in Korea.
Australasian Plant Pathology 47: 23–34.
Corda ACJ (1837). Icones fungorum hucusque cognitorum. J.G. Calve,
Austria.
Costa MM, Saleh AA, Melo MP, et al. (2022). Fusarium mirum sp. nov.,
intertwining Fusarium madaense and Fusarium andiyazi, pathogens
of tropical grasses. Fungal Biology 126: 250–266.
Crous PW, Gams W, Stalpers JA, et al. (2004). MycoBank: an online
initiative to launch mycology into the 21st century. Studies in Mycology
50: 19–22.
Crous PW, Lombard L, Sandoval-Denis M, et al. (2021). Fusarium: more
than a node or a foot-shaped basal cell. Studies in Mycology 98: 1–184.
Crous PW, Sandoval-Denis M, Costa MM, et al. (2022). Fusarium and
allied fusarioid taxa (FUSA). 1. Fungal Systematics and Evolution 9:
161–200.
Crous PW, Wingfield MJ, Lombard L, et al. (2019). Fungal planet
description sheets: 951–1041. Persoonia 43: 223–425.
Cuomo CA, Gueldener U, Xu JR, et al. (2007). The Fusarium graminearum
genome reveals a link between localized polymorphism and pathogen
specialization. Science 317: 1400–1402.
Dean R, Van Kan JA, Pretorius ZA, et al. (2012). The Top 10 fungal
pathogens in molecular plant pathology. Molecular Plant Pathology
13: 414–430.
141
Han et al.
Degnan JH, Rosenberg NA (2009). Gene tree discordance, phylogenetic
inference and the multispecies coalescent. Trends in Ecology &
Evolution 24: 332–340.
Desjardins AE (2006). Fusarium mycotoxins: chemistry, genetics and
biology. American Phytopathological Society, USA.
Desjardins AE, Manandhar HK, Plattner RD, et al. (2000). Fusarium species
from nepalese rice and production of mycotoxins and gibberellic acid
by selected species. Applied and Environmental Microbiology 66:
1020–1025.
Desjardins AE, Proctor RH (2011). Genetic diversity and trichothecene
chemotypes of the Fusarium graminearum clade isolated from maize
in Nepal and identification of a putative new lineage. Fungal Biology
115: 38–48.
Devay JE, Covey RP, Nair PN (1957). Corn diseases and their importance
in Minnesota in 1956. Plant Disease Reporter 41: 505–507.
de Faria Ferreira M, Brito-Santos F, Henrique Nascimento Theodoro
P, et al. (2022). Mixed infection by Cryptococcus neoformans and
Cryptococcus gattii and coinfection with paracoccidioidomycosis in
PLHIV. Medical Mycology Case Reports 35: 48–50.
Dong F, Xu JH, Shi JR, et al. (2020a). First report of Fusarium head blight
caused by Fusarium meridionale in rice in China. Plant Disease 104:
2726–2726.
Dong F, Zhang X, Xu JH, et al. (2020b). Analysis of Fusarium graminearum
species complex from freshly harvested rice in Jiangsu Province
(China). Plant Disease 104: 2138–2143.
Dong HY, Qin PW, Gao ZG, et al. (2020c). First report of seedling blight
of maize caused by Fusarium asiaticum in Northeast China. Plant
Disease 105: 1206–1026.
Du Q, Duan CX, Li SC, et al. (2020). First report of maize ear rot caused
by Fusarium concentricum in China. Plant Disease 104: 1539–1540.
Duan CX, Du Q, Tang ZL, et al. (2019). First report of maize ear rot caused
by Fusarium sacchari in China. Plant Disease 103: 2674−2674.
Duan CX, Wang BB, Sun FF, et al. (2020). Occurrence of maize ear rot
caused by Fusarium fujikuroi in China. Plant Disease 104: 587−587.
Ebbels DL, Allen DJ. (1979). A supplementary and annotated list of plant
diseases, pathogens and associated fungi in Tanzania. Commonwealth
Mycological Institute, UK.
Emms DM, Kelly S (2015). OrthoFinder: solving fundamental biases
in whole genome comparisons dramatically improves orthogroup
inference accuracy. Genome Biology 16:157−170.
Emms DM, Kelly S (2019). OrthoFinder: phylogenetic orthology inference
for comparative genomics. Genome Biology 20: 238−251.
Esmaeili Taheri A, Hamel C, Gan Y, et al. (2011). First report of Fusarium
redolens from Saskatchewan and its comparative pathogenicity.
Canadian Journal of Plant Pathology 33: 559−564.
Ezekiel CN, Kraak B, Sandoval-Denis M, et al. (2020). Diversity and toxigenicity
of fungi and description of Fusarium madaense sp. nov. from cereals,
legumes and soils in north-central Nigeria. MycoKeys 67: 95−124.
Farr DF, Rossman AY. (2022). Fungal Databases, U.S. National Fungus
Collections, ARS, USDA. <https://nt.ars-grin.gov/fungaldatabases/>.
Accessed on 13 August 2022.
Fisher NL, Burgess LW, Toussoun TA, et al. (1982). Carnation leaves
as a substrate and for preserving cultures of Fusarium species.
Phytopathology 72: 151−153.
Fourie G, Steenkamp ET, Gordon TR, et al. (2009). Evolutionary
relationships among the Fusarium oxysporum f. sp. cubense vegetative
compatibility groups. Applied and Environmental Microbiology 75:
4770−4781.
Fumero MV, Yue W, Chiotta ML, et al. (2021). Divergence and gene flow
between Fusarium subglutinans and F. temperatum isolated from
maize in Argentina. Phytopathology 111: 170−183.
Gai XT, Xuan YH, Gao ZG (2017). Diversity and pathogenicity of Fusarium
graminearum species complex from maize stalk and ear rot strains in
northeast China. Plant Pathology 66: 1267−1275.
Gai XT, Yang RX, Pan XJ, et al. (2016). First report of Fusarium incarnatum
causing stalk rot on maize in China. Plant Disease 100: 1010–1010.
Gale LR, Harrison SA, Ward TJ, et al. (2011). Nivalenol-type populations
of Fusarium graminearum and F. asiaticum are prevalent on wheat in
southern Louisiana. Phytopathology 101: 124−134.
142
Gams W (1971). Cephalosporium-artige schimmelpilze (Hyphomycetes).
Gustav Fischer Verlag, Stuttgart, Germany.
Gams W, Klamer M, O’Donnell K (1999). Fusarium miscanthi sp. nov. from
Miscanthus litter. Mycologia 91: 263−268.
Gams W, Nirenberg HI, Seifert KA, et al. (1997). Proposal to conserve the
name Fusarium sambucinum (Hyphomycetes). Taxon 46: 111−113.
Gao M, Xiong C, Gao C, et al. (2021). Disease-induced changes in plant
microbiome assembly and functional adaptation. Microbiome 9: 187.
Geiser DM, Al-Hatmi AMS, Aoki T, et al. (2021). Phylogenomic analysis
of a 55.1 kb 19-gene dataset resolves a monophyletic Fusarium that
includes the Fusarium solani species complex. Phytopathology 111:
1064−1079.
Geiser DM, Juba JH, Wang B, et al. (2001). Fusarium hostae sp. nov.,
a relative of F. redolens with a Gibberella teleomorph. Mycologia 93:
670−678.
Gerlach W, Ershad D (1970). Beitrag zur kenntnis der Fusarium-und
Cylindrocarpon-arten in Iran. Nova Hedwigia 20: 725−784.
Gomes LB, Ward TJ, Badiale-Furlong E, et al. (2015). Species composition,
toxigenic potential and pathogenicity of Fusarium graminearum
species complex isolates from southern Brazilian rice. Plant Pathology
64: 980−987.
Gordon WL (1965). Pathogenic strains of Fusarium oxysporum. Canadian
Journal of Botany 43: 1309−1318.
Gräfenhan T, Johnston PR, Vaughan MM, et al. (2016). Fusarium
praegraminearum sp. nov., a novel nivalenol mycotoxin-producing
pathogen from New Zealand can induce head blight on wheat.
Mycologia 108: 1229−1239.
Gräfenhan T, Schroers HJ, Nirenberg HI, et al. (2011). An overview of
the taxonomy, phylogeny, and typification of nectriaceous fungi in
Cosmospora, Acremonium, Fusarium, Stilbella, and Volutella. Studies
in Mycology 68: 79−113.
Han SB, Cao YY, Zhang J, et al. (2022). First report of Fusarium cf.
longipes associated with maize stalk rot in China. Plant Disease 106:
1064−1064.
Hao JJ, Xie SN, Sun J, et al. (2017). Analysis of Fusarium graminearum
species complex from wheat-maize rotation regions in Henan (China).
Plant Disease 101: 720−725.
Haridas S, Albert R, Binder M, et al. (2020). 101 Dothideomycetes
genomes: A test case for predicting lifestyles and emergence of
pathogens. Studies in Mycology 96: 141−153.
Hill R, Buggs RJA, Vu DT, et al. (2022). Lifestyle transitions in fusarioid
fungi are frequent and lack clear genomic signatures. Molecular
Biology and Evolution 39: msac085.
Hoang DT, Chernomor O, von Haeseler A, et al. (2018). UFBoot2:
improving the ultrafast bootstrap approximation. Molecular Biology
and Evolution 35: 518−522.
Huang SW, Wang L, Liu LM, et al. (2011). Rice spikelet rot disease in
China–1. Characterization of fungi associated with the disease. Crop
Protection 30: 1−9.
Huelsenbeck JP, Ronquist F (2001). MrBayes: Bayesian inference of
phylogeny. Bioinformatics 17: 754–755.
Husna A, Zakaria L, Mohamed Nor NMI (2020). Fusarium commune
associated with wilt and root rot disease in rice. Plant Pathology 70:
123−132.
Jamieson CO, Wollenweber HW (1912). An external dry rot of potato tubers
caused by Fusarium trichothecioides. Journal of the Washington
Academy of Sciences 2: 146−152.
Ji LJ, Kong LX, Li QS, et al. (2016). First report of Fusarium
pseudograminearum causing Fusarium head blight of wheat in Hebei
Province, China. Plant Disease 100: 220−220.
Jiang W, Han W, Wang R, et al. (2021). Development of an inoculation
technique for rapidly evaluating maize inbred lines for resistance to
stalk rot caused by Fusarium spp. in the field. Plant Disease 105:
2306−2313.
Jin QM, Lu ZZ, Pan SF, et al. (1994). Study on pathogenicities of pathogenic
fungi of corn stalk rot in corn seedling stage. Maize Science 1: 73−75.
Kalyaanamoorthy S, Minh BQ, Wong TKF, et al. (2017). ModelFinder: Fast
model selection for accurate phylogenetic estimates. Nature Methods
14: 587−589.

Katoh K, Standley DM (2013). MAFFT multiple sequence alignment
software version 7: improvements in performance and usability.
Molecular Biology and Evolution 30: 772−780.
Khaledi N, Taheri P, Falahati Rastegar M (2017). Identification, virulence
factors characterization, pathogenicity and aggressiveness analysis of
Fusarium spp., causing wheat head blight in Iran. European Journal of
Plant Pathology 147: 897−918.
Khoa LV, Hatai K, Aoki T (2004). Fusarium incarnatum isolated from black
tiger shrimp, Penaeus monodon Fabricius, with black gill disease
cultured in Vietnam. Journal of Fish Diseases 27: 507−515.
Khuna S, Kumla J, Thitla T, et al. (2022). Morphology, molecular
identification, and pathogenicity of two novel Fusarium species
associated with postharvest fruit rot of cucurbits in northern Thailand.
Journal of Fungi 8: 1135−1152.
Klittich CJR, Leslie JF, Nelson PE, et al. (1997). Fusarium thapsinum
(Gibberella thapsina): a new species in section Liseola from sorghum.
Mycologia 89: 643−652.
Kornerup A, Wanscher JH. (1978). Methuen handbook of colour. 3rd edn.
Eyre Methuen, London.
Kriek NPJ, Marasas WFO, Steyn PS, et al. (1977). Toxicity of a moniliformin-
producing strain of Fusarium moniliforme var. subglutinans isolated
from maize. Food and Cosmetics Toxicology 15: 579−587.
Kristensen R, Torp M, Kosiak B, et al. (2005). Phylogeny and toxigenic
potential is correlated in Fusarium species as revealed by partial
translation elongation factor 1 alpha gene sequences. Mycological
Research 109: 173−186.
Krone MJ, Salazar M, Mideros S (2020). First report of Fusarium
armeniacum causing Fusarium head blight on soft red winter wheat in
Illinois. Plant Disease 105: 1199−1199.
Kuhnem PR, Ward TJ, Silva CN, et al. (2016). Composition and toxigenic
potential of the Fusarium graminearum species complex from maize
ears, stalks and stubble in Brazil. Plant Pathology 65: 1185−1191.
Kumar S, Stecher G, Tamura K (2016). MEGA7: molecular evolutionary
genetics analysis version 7.0 for bigger datasets. Molecular Biology
and Evolution 33: 1870−1874.
Lana FD, Madden LV, Carvalho CP, et al. (2022). Impact of Gibberella ear
rot on grain quality and yield components in maize as influenced by
hybrid reaction. Plant Disease 106: 3061–3075.
Laraba I, Keddad A, Boureghda H, et al. (2017). Fusarium algeriense, sp.
nov., a novel toxigenic crown rot pathogen of durum wheat from Algeria
is nested in the Fusarium burgessii species complex. Mycologia 109:
935−950.
Laraba I, McCormick SP, Vaughan MM, et al. (2021). Phylogenetic
diversity, trichothecene potential, and pathogenicity within Fusarium
sambucinum species complex. PLoS ONE 16: e0245037.
Laurence MH, Walsh JL, Shuttleworth LA, et al. (2016). Six novel species
of Fusarium from natural ecosystems in Australia. Fungal Diversity 77:
349−366.
Lee T, Paek JS, Lee KA, et al. (2016). Occurrence of toxigenic Fusarium
vorosii among small grain cereals in Korea. The Plant Pathology
Journal 32: 407−413.
Leslie JF, Summerell BA. (2006). The Fusarium Laboratory Manual.
Blackwell Publishing Professional, USA.
Lew H, Chelkowski J, Pronczuk P, et al. (1996). Occurrence of the
mycotoxin moniliformin in maize (Zea mays L.) ears infected by
Fusarium subglutinans (Wollenw. & Reinking) Nelson et al. Food
Additives and Contaminants 13: 321−324.
Leyva-Madrigal KY, Larralde-Corona CP, Apodaca-Sánchez MA, et al.
(2015). Fusarium species from the Fusarium fujikuroi species complex
involved in mixed infections of maize in Northern Sinaloa, Mexico.
Journal of Phytopathology 163: 486−497.
Li HL, He XL, Ding SL, et al. (2016). First report of Fusarium culmorum
causing crown rot of wheat in China. Plant Disease 100: 2532−2532.
Li HL, Yuan HX, Fu B, et al. (2012). First report of Fusarium
pseudograminearum causing crown rot of wheat in Henan, China.
Plant Disease 96: 1065−1065.
Li PP, Cao ZY, Wang K, et al. (2014). First report of Fusarium equiseti
causing a sheath rot of corn in China. Plant Disease 98: 998−998.
Li YG, Jiang WY, Jiang D, et al. (2019a). First report of fruit rot on
www.studiesinmycology.org
Fusarium spp. on cereals in China
postharvest pumpkin caused by Fusarium acuminatum in China. Plant
Disease 103: 1035−1035.
Li YG, Zhang X, Zhang R, et al. (2019b). Occurrence of seedling blight
caused by Fusarium tricinctum on rice in China. Plant Disease 103:
1789-1790.
Lima EN, Oster AH, Bordallo PN, et al. (2020). A novel lineage in the
Fusarium incarnatum-equiseti species complex is one of the causal
agents of Fusarium rot on melon fruits in northeast Brazil. Plant
Pathology 70: 133−143.
Link HF (1809). Observationes in ordines plantarum naturals, Dissetatio I.
Gesellschaft Naturforschender Freunde zu Berlin, Magazin 3: 3−42.
Liu F, Ma ZY, Hou LW, et al. (2022a). Updating species diversity of
Colletotrichum, with a phylogenomic overview. Studies in Mycology
101: 1−56.
Liu J, Han Y, Li W, et al. (2022b). Identification of pathogens and evaluation
of resistance and genetic diversity of maize inbred lines to stalk rot in
Heilongjiang Province, China. Plant Disease: https://doi.org/10.1094/
PDIS-03-22-0525-RE.
Liu S, García-Palacios P, Tedersoo L, et al. (2022c). Phylotype diversity
within soil fungal functional groups drives ecosystem stability. Nature
Ecology and Evolution 6: 900−909.
Liu X, Fang X, Yu F, et al. (2022d). Improved whole-genome sequence of
Fusarium meridionale, the fungal pathogen causing Fusarium head
blight in rice. Molecular Plant-Microbe Interactions 35: 85−89.
Liu XX, Wang Y, Qiu JF, et al. (2018). Analysis of population, mycotoxin
chemotypes and mycotoxin pollution of Fusarium from spring wheat in
northern China. Jiangsu Agricultural Sciences 46: 199−202.
Liu YJ, Whelen S, Hall BD (1999). Phylogenetic relationships among
ascomycetes: evidence from an RNA polymerse II subunit. Molecular
Biology and Evolution 16: 1799−1808.
Lofgren LA, LeBlanc NR, Certano AK, et al. (2018). Fusarium graminearum:
pathogen or endophyte of North American grasses?. New Phytologist
217: 1203−1212.
Logrieco A, Mule G, Moretti A, et al. (2002a). Toxigenic Fusarium species
and mycotoxins associated with maize ear rot in Europe. European
Journal of Plant Pathology 108: 597−609.
Logrieco A, Rizzo A, Ferracane R, et al. (2002b). Occurrence of beauvericin
and enniatins in wheat affected by Fusarium avenaceum head blight.
Applied and Environmental Microbiology 68: 82−85.
Lombard L, Sandoval-Denis M, Cai L, et al. (2019a). Changing the game:
resolving systematic issues in key Fusarium species complexes.
Persoonia 43: i−ii.
Lombard L, Sandoval-Denis M, Lamprecht SC, et al. (2019b). Epitypification
of Fusarium oxysporum − clearing the taxonomic chaos. Persoonia
43: 1−47.
Lombard L, van der Merwe NA, Groenewald JZ, et al. (2015). Generic
concepts in Nectriaceae. Studies in Mycology 80: 189−245.
Lombard L, van Doorn R, Crous PW (2019c). Neotypification of Fusarium
chlamydosporum − a reappraisal of a clinically important species
complex. Fungal Systematics and Evolution 4: 183−200.
Lombard L, van Doorn R, Groenewald JZ, et al. (2022). Fusarium diversity
associated with the Sorghum-Striga interaction in Ethiopia. Fungal
Systematics and Evolution 10: 177–215.
Lukanowski A, Lenc L, Sadowski C (2008). First report on the occurrence
of Fusarium langsethiae isolated from wheat kernels in Poland. Plant
Disease 92: 488−488.
Ma LJ (2014). Horizontal chromosome transfer and rational strategies to
manage Fusarium vascular wilt diseases. Molecular Plant Pathology
15: 763−766.
Ma LJ, van der Does HC, Borkovich KA, et al. (2010). Comparative
genomics reveals mobile pathogenicity chromosomes in Fusarium.
Nature 464: 367−373.
Ma N, Haseeb HA, Xing F, et al. (2019). Fusarium avenaceum: a toxigenic
pathogen causing ear rot on maize in Yunnan Province, China. Plant
Disease 103: 1424−1425.
Ma WF (2020). Analysis of China’s food security situation. Food Processing
46: 1−4.
Ma ZY, Wu Q, Zhou X, et al. (2021). Assembly and annotation of fungal
genome based on Illumina sequencing. Bio-protocol: e2003704.
143
Han et al.
Malihipour A, Gilbert J, Piercey-Normore M, et al. (2012). Molecular
phylogenetic analysis, trichothecene chemotype patterns, and
variation in aggressiveness of Fusarium isolates causing head blight
in wheat. Plant Disease 96: 1016−1025.
Mao W, Carroll RB, Whittington DP (1998) Association of Phoma terrestris,
Pythium irregulare, and Fusarium acuminatum in causing red root rot
of corn. Plant Disease 82: 337−342.
Marasas WFO, Nelson PE, Toussoun TA. (1984). Toxigenic Fusarium species:
identity and mycotoxicology. Pennsylvania State University, USA.
Marasas WFO, Nelson PE, Toussoun TA (1985). Fusarium dlamini, a new
species from southern Africa. Mycologia 77: 971−975.
Marasas WFO, Rabie CJ, Lübben A, et al. (1987). Fusarium napiforme,
a new species from millet and sorghum in southern Africa. Mycologia
79: 910−914.
Marasas WFO, Rheeder JP, Lamprecht SC, et al. (2001). Fusarium andiyazi
sp. nov., a new species from sorghum. Mycologia 93: 1203−1210.
Marasas WFO, Rheeder JP, Logrieco A, et al. (1998). Fusarium nelsonii
and F. musarum: two new species in Section Arthrosporiella related to
F. camptoceras. Mycologia 90: 505−513.
Marín P, Moretti A, Ritieni A, et al. (2012). Phylogenetic analyses and toxigenic
profiles of Fusarium equiseti and Fusarium acuminatum isolated from
cereals from southern Europe. Food Microbiology 31: 229−237.
Maryani N, Lombard L, Poerba YS, et al. (2019a). Phylogeny and genetic
diversity of the banana Fusarium wilt pathogen Fusarium oxysporum
f. sp. cubense in the Indonesian centre of origin. Studies in Mycology
92: 155−194.
Maryani N, Sandoval-Denis M, Lombard L, et al. (2019b). New endemic
Fusarium species hitch-hiking with pathogenic Fusarium strains
causing Panama disease in small-holder banana plots in Indonesia.
Persoonia 43: 48−69.
Matic S, Tabone G, Gullino ML, et al. (2020). Emerging leafy vegetable
crop diseases caused by the Fusarium incarnatum-equiseti species
complex. Phytopathologia Mediterranea 59: 303−317.
Matny ON (2015). Fusarium head blight and crown rot on wheat & barley:
losses and health risks. Advances in Plants & Agriculture Research
2: 38−43.
McGuire JU, Crandall BS. (1967). Survey of insect pests and plant diseases
of selected food crops of Mexico, central America and Panama. USDA
Int. agric. Development Service, USA.
McTaggart AR, James TY, Shivas RG, et al. (2021). Population genomics
reveals historical and ongoing recombination in the Fusarium
oxysporum species complex. Studies in Mycology 99: 100132.
Medeiros Araújo MB, Moreira GM, Nascimento LV, et al. (2020). Fusarium
rot of melon is caused by several Fusarium species. Plant Pathology
70: 712−721.
Mesny F, Miyauchi S, Thiergart T, et al. (2021). Genetic determinants
of endophytism in the Arabidopsis root mycobiome. Nature
Communications 12: 7227.
Mezzalama M, Guarnaccia V, Martino I, et al. (2021). First report of
Fusarium commune causing root and crown rot on maize in Italy. Plant
Disease 105: 4156.
Miller MA, Pfeiffer W, Schwartz T (2012) The CIPRES science gateway:
enabling high-impact science for phylogenetics researchers with
limited resources. In: Proceedings of the 1st conference of the extreme
science and engineering discovery environment: Bridging from the
extreme to the campus and beyond. Association for Computing
Machinery, USA: 1−8.
Minh BQ, Hahn MW, Lanfear R (2020b). New methods to calculate
concordance factors for phylogenomic datasets. Molecular Biology
and Evolution 37: 2727−2733.
Minh BQ, Schmidt HA, Chernomor O, et al. (2020a). IQ-TREE 2: New
models and efficient methods for phylogenetic inference in the
genomic era. Molecular Biology and Evolution 37: 1530−1534.
Moses LM, Marasas WF, Vismer HF, et al. (2010). Molecular characterization
of Fusarium globosum strains from South African maize and Japanese
wheat. Mycopathologia 170: 237−249.
Mostert D, Molina AB, Daniells J, et al. (2017). The distribution and host
range of the banana Fusarium wilt fungus, Fusarium oxysporum f. sp.
cubense, in Asia. PLoS ONE 12: e0181630.
144
Mulenko W, Majewski T, Ruszkiewicz-Michalska M. (2008). A preliminary
checklist of micromycetes in Poland. W. Szafer Institute of Botany,
Polish Academy of Sciences, Poland.
Murillo-Williams A, Munkvold GP (2008). Systemic infection by Fusarium
verticillioides in maize plants grown under three temperature regimes.
Plant Disease 92: 1695−1700.
Nees von Esenbeck CGD (1817). Das System der Pilze und Schwämme.
Stahel, Germany.
Nees von Esenbeck CGD, Nees von Esenbeck TFL (1818). De plantis
nonnullis e mycetoidearum regno tum nuper detectis, tum minus
cognitis commentatio prior doctoris Nees ab Esenbeck et Friderici
Nees fratrum. Nova Acta Physico-Medica Academiae Caesareae
Leopoldino-Carolinae Naturae Curiosorum 9: 226−262.
Nelson PE, Toussoun TA, Burgess LW (1987). Characterization of
Fusarium beomiforme sp. nov. Mycologia 79: 884−889.
Nelson PE, Toussoun TA, Marasas WFO. (1983). Fusarium species: an
Illustrated manual for identification. Pennsylvania State University
Press, USA.
Nganje WE, Kaitibie S, Wilson WW, et al. (2004). Economic impacts of
Fusarium head blight in wheat and barley: 1993-2001. Agribusiness
& Applied Economics Report 23627, North Dakota State University,
Department of Agribusiness and Applied Economics.
Nirenberg H (1976). Untersuchungen über die morphologische und
biologische Differenzierung in der Fusarium-Sektion Liseola.
Mitteilungen aus der Biologischen Bundesanstalt für Land- und
Forstwirtschaft Berlin-Dahlem 169: 1−117.
Nirenberg HI (1995). Morphological differentiation of Fusarium sambucinum
Fuckel sensu stricto, F. torulosum (Berk. & Curt.) Nirenberg comb. nov.
and F. venenatum Nirenberg sp. nov. Mycopathologia 129: 131−141.
Nirenberg HI (1997). Fusarium nisikadoi, a new species from Japan.
Mycoscience 38: 329−333.
Nirenberg HI, O’Donnell K (1998). New Fusarium species and combinations
within the Gibberella fujikuroi species complex. Mycologia 90: 434−458.
Nirenberg HI, O’Donnell K, Kroschel J, et al. (1998). Two new species of
Fusarium: Fusarium brevicatenulatum from the noxious weed Striga
asiatica in Madagascar and Fusarium pseudoanthophilum from Zea
mays in Zimbabwe. Mycologia 90: 459−464.
Nylander JAA (2004). MrModeltest v2. Program distributed by the author.
Evolutionary Biology Centre, Uppsala University, Sweden.
O’Donnell K, Cigelnik E (1997). Two divergent intragenomic rDNA ITS2
types within a monophyletic lineage of the fungus Fusarium are
nonorthologous. Molecular Phylogenetics and Evolution 7: 103−116.
O’Donnell K, Cigelnik E, Nirenberg HI (1998a). Molecular systematics
and phylogeography of the Gibberella fujikuroi species complex.
Mycologia 90: 465−493.
O’Donnell K, Humber RA, Geiser DM, et al. (2012). Phylogenetic diversity
of insecticolous fusaria inferred from multilocus DNA sequence data
and their molecular identification via FUSARIUM-ID and Fusarium
MLST. Mycologia 104: 427−445.
O’Donnell K, Kistlerr HC, Cigelnik E, et al. (1998b). Multiple evolutionary
origins of the fungus causing panama disease of banana: Concordant
evidence from nuclear and mitochondrial gene genealogies.
Proceedings of the National Academy of Sciences of the United States
of America 95: 2044-2049.
O’Donnell K, Kistler HC, Tacke BK, et al. (2000a). Gene genealogies
reveal global phylogeographic structure and reproductive isolation
among lineages of Fusarium graminearum, the fungus causing wheat
scab. Proceedings of the National Academy of Sciences of the United
States of America 97: 7905−7910.
O’Donnell K, McCormick SP, Busman M, et al. (2018). Marasas et al. 1984
“Toxigenic Fusarium Species: Identity and Mycotoxicology” revisited.
Mycologia 110: 1058−1080.
O’Donnell K, Nirenberg H, Aoki T, et al. (2000b). A multigene phylogeny
of the Gibberella fujikuroi species complex: detection of additional
phylogenetically distinct species. Mycoscience 41: 61−78.
O’Donnell K, Rooney AP, Proctor RH, et al. (2013). Phylogenetic analyses
of RPB1 and RPB2 support a middle Cretaceous origin for a clade
comprising all agriculturally and medically important fusaria. Fungal
Genetics and Biology 52: 20−31.

O’Donnell K, Sutton DA, Rinaldi MG, et al. (2009). Novel multilocus
sequence typing scheme reveals high genetic diversity of human
pathogenic members of the Fusarium incarnatum-F. equiseti and F.
chlamydosporum species complexes within the United States. Journal
of Clinical Microbiology 47: 3851−3861.
O’Donnell K, Sutton DA, Rinaldi MG, et al. (2010). Internet-accessible DNA
sequence database for identifying fusaria from human and animal
infections. Journal of Clinical Microbiology 48: 3708−3718.
O’Donnell K, Ward TJ, Geiser DM, et al. (2004). Genealogical concordance
between the mating type locus and seven other nuclear genes
supports formal recognition of nine phylogenetically distinct species
within the Fusarium graminearum clade. Fungal Genetics and Biology
41: 600−623.
O’Donnell K, Ward TJ, Robert VARG, et al. (2015). DNA sequence-
based identification of Fusarium: current status and future directions.
Phytoparasitica 43: 583−595.
O’Donnell K, Whitaker B, Laraba I, et al. (2022). DNA sequence-based
identification of Fusarium: a work in progress. Plant Disease 106:
1579−1609
Obanor F, Erginbas-Orakci G, Tunali B, et al. (2010). Fusarium culmorum is
a single phylogenetic species based on multilocus sequence analysis.
Fungal Biology 114: 753−765.
Okello PN, Petrović K, Kontz B, et al. (2019). Eight species of Fusarium
cause root rot of corn (Zea mays) in South Dakota. Plant Health
Progress 20: 38−43.
Özer G, İmren M, Bayraktar H, et al. (2019). First report of Fusarium
hostae causing crown rot on wheat in Azerbaijan. Plant Disease 103:
3278−3278.
Özer G, Paulitz TC, Imren M, et al. (2020). Identity and pathogenicity of
Fungi associated with crown and root rot of dryland winter wheat in
Azerbaijan. Plant Disease 104: 2149−2157.
Padwick GW (1945). Notes on Indian fungi. III. Mycological Papers 12:
1−12.
Pak D, You MP, Lanoiselet V, et al. (2016). Reservoir of cultivated rice
pathogens in wild rice in Australia. European Journal of Plant
Pathology 147: 295−311.
Palmer JM. (2016). Funannotate: pipeline for genome annotation. <https://
funannotate.readthedocs.io/en/latest/commands.html>.
Pan XJ, Chen N, Yao Y, et al. (2015). Population and pathogenicity of
Fusarium spp. causing wheat head blight in Northeast of China. Acta
Agriculturae Boreali-Sinica 30: 205−210.
Pennycook SR. (1989). Plant diseases recorded in New Zealand (Vol. 3).
Plant Diseases Division, DSIR, New Zealand.
Phan HT, Burgess LW, Summerell BA, et al. (2004). Gibberella gaditjirrii
(Fusarium gaditjirrii) sp. nov., a new species from tropical grasses in
Australia. Studies in Mycology 50: 261−272.
Ploetz RC (2006). Fusarium-induced diseases of tropical, perennial crops.
Phytopathology 96: 648−652.
Ploetz R, Pegg K (1997). Fusarium wilt of banana and Wallace’s line:
was the disease originally restricted to his Indo-Malayan region?.
Australasian Plant Pathology 26: 239−249.
Porebski S, Bailey LG, Baum BR (1997). Modification of a CTAB DNA
extraction protocol for plants containing high polysaccharide and
polyphenol components. Plant Molecular Biology Reporter 15: 8−15.
Przemieniecki SW, Kurowski TP, Korzekwa K (2014). Chemotypes
and geographic distribution of the Fusarium graminearum species
complex. Environmental Biotechnology 10: 45−54.
Qiu JB, Lu YA, He D, et al. (2020). Fusarium fujikuroi species complex
associated with rice, maize, and soybean from Jiangsu Province,
China: phylogenetic, pathogenic, and toxigenic analysis. Plant
Disease 104: 2193−2201.
Rahjoo V, Zad J, Javan-Nikkhah M, et al. (2008). Morphological and
molecular identification of Fusarium isolated from maize ears in Iran.
Journal of Plant Pathology 90: 463−468.
Raillo A (1950). Fungi of the genus Fusarium. Publication State Agricultural
Literature, Russia.
Raza M, Zhang ZF, Hyde KD, et al. (2019). Culturable plant pathogenic
fungi associated with sugarcane in southern China. Fungal Diversity
99: 1−104.
www.studiesinmycology.org
Fusarium spp. on cereals in China
Reeb V, Lutzoni F, Roux C (2004). Contribution of RPB2 to multilocus
phylogenetic studies of the Euascomycetes (Pezizomycotina, Fungi)
with special emphasis on the lichen-forming Acarosporaceae and
evolution of polyspory. Molecular Phylogenetics and Evolution 32:
1036−1060.
Reinking OA (1934). Interesting new Fusaria. Zentralblatt für Bakteriologie
und Parasitenkunde, Abteilung 2 89: 509–514.
Renev E, Zargaryan NY, Kekalo AY, et al. (2021). Infection of grain crops
with fungi of the genus Fusarium. BIO Web of Conferences 36:
04008−04015.
Rheeder JP, Marasas WFO, Nelson PE (1996). Fusarium globosum, a new
species from corn in southern Africa. Mycologia 88: 509−513.
Richardson MJ (1979). An annotated list of seed-borne diseases. 4th edn.
International Seed Testing Association, Switzerland.
Ronquist F, Huelsenbeck JP (2003). MrBayes 3: Bayesian phylogenetic
inference under mixed models. Bioinformatics 19: 1572−1574.
Roux J, Steenkamp ET, Marasas WFO, et al. (2001). Characterization of
Fusarium graminearum from Acacia and Eucalyptus using β-tubulin
and histone gene sequences. Mycologia 93: 704−711.
Saccardo PA (1881). Fungi Italici Autographice Delineati. Patavii, Italy.
Saccardo PA (1879). Fungi Gallici lecti a cl. viris P. Brunaud, C.C. Gillet et
Abb. Letendre. Michelia 1: 500−538.
Saccardo PA (1886). Sylloge Hyphomycetum. Sylloge Fungorum 4: 1−807.
Saccardo PA (1892). Supplementum Universale, Pars II. Discomyceteae-
Hyphomyceteae. Sylloge Fungorum 10: 1−964.
Sandoval-Denis M, Guarnaccia V, Polizzi G, et al. (2018a). Symptomatic
citrus trees reveal a new pathogenic lineage in Fusarium and two new
Neocosmospora species. Persoonia 40: 1−25.
Sandoval-Denis M, Swart WJ, Crous PW (2018b). New Fusarium species
from the Kruger National Park, South Africa. MycoKeys 34: 63−92.
Santos A, Trindade JVC, Lima CS, et al. (2019). Morphology, phylogeny, and
sexual stage of Fusarium caatingaense and Fusarium pernambucanum,
new species of the Fusarium incarnatum-equiseti species complex
associated with insects in Brazil. Mycologia 111: 244−259.
Sarowar S, Alam ST, Makandar R, et al. (2019). Targeting the pattern-
triggered immunity pathway to enhance resistance to Fusarium
graminearum. Molecular Plant Pathology 20: 626−640.
Sarver BA, Ward TJ, Gale LR, et al. (2011). Novel Fusarium head
blight pathogens from Nepal and Louisiana revealed by multilocus
genealogical concordance. Fungal Genetics and Biology 48:
1096−1107.
Savary S, Willocquet L, Pethybridge SJ, et al. (2019). The global burden
of pathogens and pests on major food crops. Nature Ecology and
Evolution 3: 430−439.
Scauflaire J, Gourgue M, Munaut F (2011). Fusarium temperatum sp.
nov. from maize, an emergent species closely related to Fusarium
subglutinans. Mycologia 103: 586−597.
Schneider R, Dalchow J (1975). Fusarium inflexum spec. nov., als erreger
einer welkekrankheit an Vicia faba L. in Deutschland. Journal of
Phytopathology 82: 70−82.
Schoeman A, Flett BC, Janse van Rensburg B, et al. (2018). Pathogenicity
and toxigenicity of Fusarium verticillioides isolates collected from
maize roots, stems and ears in South Africa. European Journal of
Plant Pathology 152: 677−689.
Schroers HJ, Gräfenhan T, Nirenberg HI, et al. (2011). A revision of
Cyanonectria and Geejayessia gen. nov., and related species with
Fusarium-like anamorphs. Studies in Mycology 68: 115−138.
Schwabe SH (1839). Flora Anhaltina. Apud Ge. Reimerum, Germany.
Seppey M, Manni M, Zdobnov EM (2019). BUSCO: assessing genome
assembly and annotation completeness. Methods in Molecular
Biology 1962: 227−245.
Shan L, Zhang J, Ma N, et al. (2018). First report of maize stalk rot disease
caused by Fusarium cerealis in Yunnan, China. Plant Disease 102:
444−444.
Shan LY, Cui WY, Zhang DD, et al. (2017). First report of Fusarium
brachygibbosum causing maize stalk rot in China. Plant Disease 101:
837−837.
Shang G, Yu H, Yang J, et al. (2020). First report of Fusarium miscanthi
causing ear rot on maize in China. Plant Disease 105: 1565−1565.
145
Han et al.
Sherbakoff CD (1915). Fusaria of potatoes. New York (Ithaca) Agriculture
6: 87−270.
Shi XC, Liu XQ, Xie XL, et al. (2012). Gene chip array for differentiation
of mycobacterial species and detection of drug resistance. Chinese
Medical Journal 125: 3292−3297.
Short DP, O’Donnell K, Zhang N, et al. (2011). Widespread occurrence of
diverse human pathogenic types of the fungus Fusarium detected in
plumbing drains. Journal of Clinical Microbiology 49: 4264−4272.
Shrestha S, Poudel RS, Zhong S (2021). Identification of fungal species
associated with crown and root rots of wheat and evaluation of plant
reactions to the pathogens in North Dakota. Plant Disease 105:
3564−3572.
Simbaqueba J, Catanzariti AM, Gonzalez C, et al. (2018). Evidence for
horizontal gene transfer and separation of effector recognition from
effector function revealed by analysis of effector genes shared
between cape gooseberry- and tomato-infecting formae speciales of
Fusarium oxysporum. Molecular Plant Pathology 19: 2302−2318.
Skovgaard K, Rosendahl S, O’Donnell K, et al. (2003). Fusarium
commune is a new species identified by morphological and molecular
phylogenetic data. Mycologia 95: 630−636.
Snyder WC, Hansen HN (1940). The species concept in Fusarium.
American Journal of Botany 27: 64−67.
Snyder WC, Hansen HN (1941). The species concept in Fusarium with
reference to section Martiella. American Journal of Botany 28: 738−742.
Snyder WC, Hansen HN (1945). The species concept in Fusarium with
reference to Discolour and other sections. American Journal of Botany
32: 657−666.
Snyder WC, Hansen HN (1954). Variation and speciation in the genus
Fusarium. Annals of the New York Academy of Sciences 60: 16−23.
Stamatakis A (2014). RAxML version 8: a tool for phylogenetic analysis
and post-analysis of large phylogenies. Bioinformatics 30: 1312−1313.
Starkey DE, Ward TJ, Aoki T, et al. (2007). Global molecular surveillance
reveals novel Fusarium head blight species and trichothecene toxin
diversity. Fungal Genetics and Biology 44: 1191−1204.
Strauss AT, Bowerman L, Porath-Krause A, et al. (2021). Mixed infection,
risk projection, and misdirection: interactions among pathogens alter
links between host resources and disease. Ecology and Evolution 11:
9599−9609.
Sturm J (1829). Deutschlands Flora, Abt. III. Die Pilze Deutschlands. Nabu
Press, Germany.
Su PS, Ge WY, Wang HW, et al. (2021). Advances in understanding the
mechanisms of wheat-Fusarium graminearum interactions. Scientia
Sinca (Vitae) 51: 1493−1507.
Subrahmanyam A (1983). Fusarium laceratum. Mykosen 26: 478−480.
Suga H, Karugia GW, Ward T, et al. (2008). Molecular characterization of
the Fusarium graminearum species complex in Japan. Phytopathology
98: 159−166.
Summerell BA, Leslie JF, Liew ECY, et al. (2010). Fusarium species
associated with plants in Australia. Fungal Diversity 46: 1−27.
Susi H, Barrès B, Vale PF, et al. (2015). Co-infection alters population
dynamics of infectious disease. Nature Communications 6: 5975.
Sweet MJ, Bulling MT (2017). On the importance of the microbiome and
pathobiome in coral health and disease. Frontiers in Marine Science
4: 1−11.
Tai FL (1979). Sylloge Fungorum Sinicorum. Science Press, Academia
Sinica, China.
Talas F, McDonald BA (2015). Genome-wide analysis of Fusarium
graminearum field populations reveals hotspots of recombination.
BMC Genomics 16: 996.
Tan J, Ameye M, Landschoot S, et al. (2020). At the scene of the crime:
New insights into the role of weakly pathogenic members of the
Fusarium head blight disease complex. Molecular Plant Pathology 21:
1559-1572.
Tarashi S, Fateh A, Mirsaeidi M, et al. (2017). Mixed infections in
tuberculosis: the missing part in a puzzle. Tuberculosis (Edinb) 107:
168−174.
Tekauz A, McCallum B, Ames N, et al. (2004). Fusarium head blight of
oat – current status in western Canada. Canadian Journal of Plant
Pathology 26: 473−479.
146
Torbati M, Arzanlou M, Sandoval-Denis M, et al. (2019). Multigene
phylogeny reveals new fungicolous species in the Fusarium tricinctum
species complex and novel hosts in the genus Fusarium from Iran.
Mycological Progress 18: 119−133.
Torp M, Nirenberg HI (2004). Fusarium langsethiae sp. nov. on cereals in
Europe. International Journal of Food Microbiology 95: 247−256.
Torres-Cruz TJ, Whitaker BK, Proctor RH, et al. (2022). FUSARIUM-ID
v.3.0: an updated, downloadable resource for Fusarium species
identification. Plant Disease 106: 1610−1616.
Touati-Hattab S, Barreau C, Verdal-Bonnin MN, et al. (2016). Pathogenicity
and trichothecenes production of Fusarium culmorum strains causing
head blight on wheat and evaluation of resistance of the varieties
cultivated in Algeria. European Journal of Plant Pathology 145: 797−814.
Trail F (2009). For blighted waves of grain: Fusarium graminearum in the
postgenomics era. Plant Physiology 149: 103−110.
Tralamazza SM, Piacentini KC, Savi GD, et al. (2021). Wild rice (O.
latifolia) from natural ecosystems in the Pantanal region of Brazil:
Host to Fusarium incarnatum-equiseti species complex and highly
contaminated by zearalenone. International Journal of Food
Microbiology 345: 109127.
Tsehaye H, Brurberg MB, Sundheim L, et al. (2016). Natural occurrence
of Fusarium species and fumonisin on maize grains in Ethiopia.
European Journal of Plant Pathology 147: 141−155.
Tunali B, Nicol JM, Hodson D, et al. (2008). Root and crown rot Fungi
associated with spring, facultative, and winter wheat in Turkey. Plant
Disease 92: 1299−1306.
van Kan JA, Shaw MW, Grant-Downton RT (2014). Botrytis species:
relentless necrotrophic thugs or endophytes gone rogue?. Molecular
Plant Pathology 15: 957−961.
Varela CP, Casal OA, Padin MC, et al. (2013). First report of Fusarium
temperatum causing seedling blight and stalk rot on maize in Spain.
Plant Disease 97: 1252−1253.
Varga E, Wiesenberger G, Hametner C, et al. (2015). New tricks of an
old enemy: isolates of Fusarium graminearum produce a type A
trichothecene mycotoxin. Environmental Microbiology 17: 2588−2600.
Vayssier-Taussat M, Albina E, Citti C, et al. (2014). Shifting the paradigm
from pathogens to pathobiome: new concepts in the light of meta-
omics. Frontiers in Cellular and Infection Microbiology 4: 29.
Vayssier-Taussat M, Kazimirova M, Hubalek Z, et al. (2015). Emerging
horizons for tick-borne pathogens: from the ‘one pathogen-one
disease’ vision to the pathobiome paradigm. Future Microbiology 10:
2033−2043.
Venturini G, Toffolatti SL, Quaglino F, et al. (2017). First report of Fusarium
andiyazi causing ear rot on maize in Italy. Plant Disease 101: 839−839.
Villani A, Moretti A, De Saeger S, et al. (2016). A polyphasic approach
for characterization of a collection of cereal isolates of the Fusarium
incarnatum-equiseti species complex. International Journal of Food
Microbiology 234: 24−35.
Vlaardingerbroek I, Beerens B, Rose L, et al. (2016). Exchange of core
chromosomes and horizontal transfer of lineage-specific chromosomes
in Fusarium oxysporum. Environmental Microbiology 18: 3702−3713.
Vogelgsang S, Sulyok M, Banziger I, et al. (2008a). Effect of fungal strain
and cereal substrate on in vitro mycotoxin production by Fusarium
poae and Fusarium avenaceum. Food Additives and Contaminants:
Part A 25: 745−757.
Vogelgsang S, Sulyok M, Hecker A, et al. (2008b). Toxigenicity and
pathogenicity of Fusarium poae and Fusarium avenaceum on wheat.
European Journal of Plant Pathology 122: 265−276.
von Schlechtendal DFL. (1824). Flora Berolinensis, Pars secunda:
Cryptogamia. Ferdinandi Dümmler, Germany.
Vorob’eva I, Toropova E. (2020). Fungi ecological niches of the genus
Fusarium Link. BIO Web of Conferences 24: 00095.
Waner JL (1994). Mixed viral infections: detection and management.
Clinical Microbiology Reviews 7: 143−151.
Wang BB, Guo C, Sun SL, et al. (2020). First report of maize ear rot caused
by Fusarium sporotrichioides in China. Plant Disease 104: 567−568.
Wang JH, Li HP, Zhang JB, et al. (2014). First report of Fusarium maize
ear rot caused by Fusarium kyushuense in China. Plant Disease 98:
279−280.

Wang JH, Peng XD, Lin SH, et al. (2015). First report of Fusarium head
blight of wheat caused by Fusarium sacchari in China. Plant Disease
99: 160−160.
Wang L, Ge SL, Zhao KH, et al. (2021). First report of Fusarium incarnatum
causing spikelet rot on rice in China. Plant Disease 105: 3306−3306.
Wang MM, Chen Q, Diao YZ, et al. (2019a). Fusarium incarnatum-equiseti
complex from China. Persoonia 43: 70−89.
Wang MM, Crous PW, Sandoval-Denis M, et al. (2022a). Fusarium and
allied genera from China: species diversity and distribution. Persoonia
48: 1−53.
Wang Q, Song R, Fan S, et al. (2022b). Diversity of Fusarium community
assembly shapes mycotoxin accumulation of diseased wheat heads.
Molecular Ecology: https://doi.org/10.1111/mec.16618.
Wang S, Sun L, Li WQ, et al. (2019b). First report of seedling blight caused
by Fusarium redolens on rice in northeast China. Plant Disease 103:
1418−1418.
Wang XM, Shi J, Jin QM, et al. (2010). Field handbook of corn disease and
insects. Chinese Agricultural Science Technology Press, China.
Ward TJ, Clear RM, Rooney AP, et al. (2008). An adaptive evolutionary
shift in Fusarium head blight pathogen populations is driving the rapid
spread of more toxigenic Fusarium graminearum in North America.
Fungal Genetics and Biology 45: 473−484.
White TJ, Bruns T, Lee S, et al. (1990). Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics. In:
PCR protocols: a guide to methods and applications (Innis MA,
Gelfand DH, Sninsky JJ, White TJ, eds). Academic Press, San Diego
(California): 315–322.
Wickham H (2016). ggplot2: elegant graphics for data analysis. R package
version 3.4.0. <https://ggplot2.tidyverse.org/>.
Wing N, Lauren DR, Bryden WL, et al. (1993). Toxicity and trichothecene
production by Fusarium acuminatum subsp. acuminatum and Fusarium
acuminatum subsp. armeniacum. Natural Toxins 1: 229−234.
Wollenweber HW (1913). Studies on the Fusarium problem. Phytopathology
3: 24–50.
Wollenweber HW (1914). Identification of species of Fusarium occurring
on the sweet potato. Journal of Agricultural Research 2: 251−286.
Wollenweber HW (1916). Fusaria autographice delineata. Selbstverlag,
Berlin, Germany.
Wollenweber HW, Reinking OA (1925). Aliquot Fusaria tropicalia nova vel
revisa. Phytopathology 15: 155−169.
Wulff EG, Sorensen JL, Lubeck M, et al. (2010). Fusarium spp. associated
with rice bakanae: ecology, genetic diversity, pathogenicity and
toxigenicity. Environmental Microbiology 12: 649−657.
Xi K, Haseeb HA, Shan L, et al. (2019). First report of Fusarium commune
causing stalk rot on maize in Liaoning Province, China. Plant Disease
103: 773−773.
Xi K, Shan L, Yang Y, et al. (2021). Species diversity and chemotypes of
Fusarium species associated with maize stalk rot in Yunnan Province
of Southwest China. Frontiers in Microbiology 12: 652062.
Xia JW, Sandoval-Denis M, Crous PW, et al. (2019). Numbers to names
− restyling the Fusarium incarnatum-equiseti species complex.
Persoonia 43: 186−221.
Xia LK, Cao YY, Wang J, et al. (2021). First report of Fusarium culmorum
causing maize stalk rot in China. Plant Disease 106: 1521−1521.
Xu F, Liu W, Song Y, et al. (2021a). The distribution of Fusarium
graminearum and Fusarium asiaticum causing Fusarium head blight
of wheat in relation to climate and cropping system. Plant Disease
105: 2830−2835.
Xu F, Song YL, Yang GQ, et al. (2015). First Report of Fusarium
pseudograminearum from wheat heads with Fusarium head blight in
North China Plain. Plant Disease 99: 156−156.
Xu F, Wang JM, Yang GQ, et al. (2020). Occurrence of Fusarium poae from
wheat heads with Fusarium head blight in Henan Province of China.
Plant Protection 46: 60−64.
Xu M, Zhang X, Yu J, et al. (2021b). First report of Fusarium ipomoeae
causing peanut leaf spot in China. Plant Disease 105: 3754−3754.
Xu X, Yang GQ, Wang JM, et al. (2016). Composition and variation in
aggressiveness of Fusarium populations causing wheat head blight in
Henan Province. Acta Phytopathologica Sinica 46: 294−303.
www.studiesinmycology.org
Fusarium spp. on cereals in China
Xue AG, Chen Y, Seifert K, et al. (2019). Prevalence of Fusarium species
causing head blight of spring wheat, barley and oat in Ontario during
2001–2017. Canadian Journal of Plant Pathology 41: 392−402.
Yang MX, Zhang H, Kong XJ, et al. (2018). Host and cropping system shape
the Fusarium population: 3ADON-producers are ubiquitous in wheat
whereas NIV-producers are more prevalent in rice. Toxins 10: 115−127.
Yasuhara-Bell J, Pedley KF, Farman M, et al. (2018). Specific detection
of the wheat blast pathogen (Magnaporthe oryzae Triticum) by loop-
mediated isothermal amplification. Plant Disease 102: 2550−2559.
Ye J, Guo Y, Zhang D, et al. (2013). Cytological and molecular
characterization of quantitative trait locus qRfg1, which confers
resistance to Gibberella stalk rot in maize. Molecular Plant-Microbe
Interactions 26: 1417−1428.
Ye QM, Wang GC, Chen HK (1990). Identification of Fusarium moniliforme
and its similar species. Jiangxi Plant Protection 3: 13−15.
Yilmaz N, Sandoval-Denis M, Lombard L, et al. (2021). Redefining species
limits in the Fusarium fujikuroi species complex. Persoonia 46:
129−162.
Yin G, Bie S, Gu H, et al. (2020). Application of gene chip technology in
the diagnostic and drug resistance detection of Helicobacter pylori in
children. Journal of Gastroenterology and Hepatology 35: 1331−1339.
Yli-Mattila T, Paavanen-Huhtala S, Parikka P, et al. (2004). Molecular and
morphological diversity of Fusarium species in Finland and North-
Western Russia. European Journal of Plant Pathology 110: 573−585.
Yu JJ, Zhang X, Tian JH, et al. (2022). Research and development
of butterfly microfluidic gene chip for 19 common pathogenic
microorganisms of nosocomial infection. Journal of Clinical and
Nursing Research 6: 80−85.
Zhang H, Brankovics B, Luo W, et al. (2016). Crops are a main driver for
species diversity and the toxigenic potential of Fusarium isolates in
maize ears in China. World Mycotoxin Journal 9: 701−715.
Zhang H, Luo W, Pan Y, et al. (2014a). First report of Fusarium ear rot
of maize caused by Fusarium andiyazi in China. Plant Disease 98:
1428−1428.
Zhang H, Luo W, Pan Y, et al. (2014b). First report of Fusarium maize
ear rot caused by Fusarium meridionale in China. Plant Disease 98:
1156−1156.
Zhang H, Luo W, Pan Y, et al. (2014c). First report of Fusarium temperatum
causing Fusarium ear rot on maize in Northern China. Plant Disease
98: 1273−1273.
Zhang H, Van der Lee T, Waalwijk C, et al. (2012). Population analysis
of the Fusarium graminearum species complex from wheat in China
show a shift to more aggressive isolates. PLoS ONE 7: e31722.
Zhang JB, Li HP, Dang FJ, et al. (2007). Determination of the trichothecene
mycotoxin chemotypes and associated geographical distribution and
phylogenetic species of the Fusarium graminearum clade from China.
Mycological Research 111: 967−975.
Zhang J, Cao YY, Han SB, et al. (2021a). First report of Fusarium thapsinum
causing maize stalk rot in China. Plant Disease 105: 2722−2722.
Zhang K, Su YY, Cai L (2013). An optimized protocol of single spore
isolation for fungi. Cryptogamie, Mycologie 34: 349−356.
Zhang XJ, Guo C, Wang CM, et al. (2021). First report of maize stalk rot
caused by Fusarium nelsonii in China. Plant Disease 105: 4168−4168.
Zhang XX, Sun HY, Shen CM, et al. (2015). Survey of Fusarium spp.
causing wheat crown rot in major winter wheat growing regions of
China. Plant Disease 99: 1610−1615.
Zhang Y, Chen C, Mai Z, et al. (2022). Co-infection of Fusarium
aglaonematis sp. nov. and Fusarium elaeidis causing stem rot in
Aglaonema modestum in China. Frontiers in Microbiology 13: 1−14.
Zhang Y, Ma LJ (2017). Deciphering pathogenicity of Fusarium oxysporum
from a phylogenomics perspective. Advances in Genetics 100:
179−209.
Zhao ZH, Lu GZ (2007). Fusarium kyushuense, a newly recorded species
from China. Mycotaxon 102: 119−126.
Zhou LY, Yang SF, Wang SM, et al. (2020). Identification of Fusarium
ipomoeae as the causative agent of leaf spot disease in Bletilla striata
in China. Plant Disease 105: 1204−1204.
Zhuang WY (2005). Fungi of northwestern China. Mycotaxon Ltd. Ithaca,
China.
147
Han et al.
Supplementary Material: https://studiesinmycology.org/
Fig. S1. Sample collection by us and other people from various regions
in China. A. S.L. Han collecting rice spikelet rot samples at Jiangsu
Province, Yangzhou city. B. Y.J. Li collecting diseased maize samples at
Shanxi Province, Yangquan city. C. M.Y. Wang collecting wheat crown
rot samples at Shandong Province, Taian city. D. S.Q. Wang collecting
diseased maize samples at Guangdong Province, Qingyuan city. E. X.Y.
Liu collecting diseased maize samples at Shandong Province, Jinan city.
F. Y.M. Wu collecting maize ear rot samples at Guangdong Province,
Meizhou city. G. M.L. Feng collecting rice spikelet rot samples at Sichuan
Province, Mianyang city. H. G.J. Han collecting maize ear rot samples at
Shandong Province, Rizhao city. I–N. Local collectors showing photos of
diseased cereals to us to confirm the occurrence of cereal diseases. O–S.
We received the diseased samples and information from local collectors.
Fig. S2. Phylogeny inferred based on the combined rpb2-tef1 gene regions
of 608 representative Fusarium strains. Neocosmospora nelsonii (CBS
309.75) was used as an outgroup. Ex-type, ex-epitype and ex-neotype
strains were indicated with T, ET, and NT, respectively. Subdivision of the
Fusarium clade represent the recognised species complexes, including F.
fujikuroi SC (FFSC), F. incarnatum-equiseti SC (FIESC), F. nisikadoi SC
(FNSC), F. oxysporum SC (FOSC), F. sambucinum SC (FSAMSC), and F.
tricinctum SC (FTSC), which were shown in different colours.
Fig. S3. Phylogeny of the Fusarium fujikuroi species complex (FFSC)
inferred based on the CaM (A), rpb1 (B), rpb2 (C), tef1 (D), and tub2
(E) loci, respectively. Fusarium nirenbergiae (CBS 744.97) was used as
an outgroup. Strains sequenced in this study were indicated in red. The
RAxML Bootstrap support values (ML-BS > 70 %) were displayed at the
nodes. Ex-type, ex-epitype and ex-neotype strains were indicated with T,
ET, and NT, respectively.
Fig. S4. Phylogeny of the Fusarium incarnatum-equiseti species complex
(FIESC) inferred based on the CaM (A), rpb2 (B), and tef1 (C) loci,
respectively. Fusarium concolor (NRRL 13459) was used as an outgroup.
Strains sequenced in this study were indicated in red. The RAxML
Bootstrap support values (ML-BS > 70 %) were displayed at the nodes.
Ex-type, ex-epitype and ex-neotype strains were indicated with T, ET, and
NT, respectively.
Fig. S5. Phylogeny of the Fusarium nisikadoi species complex (FNSC)
inferred based on the rpb1 (A), rpb2 (B), and tef1 (C) loci, respectively.
Fusarium concolor (NRRL 13994) was used as an outgroup. Strains
sequenced in this study were indicated in red. The RAxML Bootstrap
support values (ML-BS > 70 %) were displayed at the nodes. Ex-type
strains were indicated with T.
Fig. S6. Phylogeny of the Fusarium oxysporum species complex (FOSC)
inferred based on the CaM (A), rpb2 (B), and tef1 (C) loci, respectively.
Fusarium udum (CBS 177.31) was used as an outgroup. Strains
sequenced in this study were indicated in red. The RAxML Bootstrap
support values (ML-BS > 70 %) were displayed at the nodes. Ex-type
strains were indicated with T.
148
Fig. S7. Phylogeny of the Fusarium sambucinum species complex
(FSAMSC) inferred based on the H3 (A), rpb1 (B), rpb2 (C), tef1 (D), and
H3-rpb1-rpb2-tef1 loci (E), respectively. Fusarium nelsonii (NRRL 13338)
was used as an outgroup. GCP clade in Sarver et al. (2011) were indicated
in green. Strains sequenced in this study were indicated in red. The RAxML
Bootstrap support values (ML-BS > 70 %) were displayed at the nodes.
Ex-type, ex-epitype and ex-neotype strains were indicated with T, ET, and
NT, respectively.
Fig. S8. Phylogeny of the Fusarium tricinctum species complex (FTSC)
inferred based on the ITS (A), rpb1 (B), rpb2 (C), and tef1 (D) loci,
respectively. Fusarium udum (CBS 177.31) was used as an outgroup.
Strains sequenced in this study were indicated in red. The RAxML
Bootstrap support values (ML-BS > 70 %) were displayed at the nodes.
Ex-type, ex-epitype, and ex-neotype strains were indicated with T, ET, and
NT, respectively.
Fig. S9. Genome sizes of the four cereal-associated species-rich
complexes (i.e., FFSC, FIESC, FOSC and FSAMSC) differs significantly
(P < 2e-16), average and standard deviation (av. ± SD) were annotated on
the corresponding boxplots.
Fig. S10. The scatter plot of gCF values against sCF values for all branches
of the phylogenetic tree of Fig. 14 (A) and Fig. 15 (B) is shown. The shade
of colour (bright to dark) indicated the support values of UFBoot (0–100).
Fig. S11. The topology conflicts within the Fg clade, between the
phylogenomic tree and the muli-locus phylogenetic tree.
Fig. S12. The total number of species discovered in samples collected
from various climate zones. The number on the diagram indicates the
species number detected from different climate zone, and the percentage
indicates the proportion of samples collected. The number of species co-
occurrence on one sample was represented by different colour.
Table S1. Collection details and GenBank accession numbers of 2 020
Fusarium strains isolated in this study. The 608 representative Fusarium
strains are in bold.
Table S2. Number of characters/model for BI of each locus in the
phylogenetic analyses of different Fusarium species complexes.
Table S3. Fusarium species for which whole-genome sequences are
retrieved from public databases, or generated in the current study
(indicated in bold).
Table S4. The number of genes in each orthogroup for each species in
Fig. 14.
Table S5. The number of genes in each orthogroup for each species in
Fig. 15.
Table S6. Detail information of co-infection.
Table S7. Acknowledgement of participants.