Senior High School

NOT

General Biology 2
Quarter 1 - Module 1
GENETICS

Name: _______________________________________________________________

Grade Level/Strand:_________________________________________________________

Department of Education ● Republic of the Philippine

1
 Module 1
Genetics
What This Module is About

This module demonstrates your understanding of the characteristics of Earth

that are necessary to support life, particularly on the essential components of this
planet that drives all living things or biotic factors (plants, animals, microorganisms) to
exist. It also emphasizes on the different subsystems (geosphere, hydrosphere,
atmosphere, and biosphere) that make up the Earth and how these systems interact
to produce the kind of Earth we live in today.
This module will help you explore the key concepts on topics that will help you
answer the questions pertaining to our very own, planet earth.
This module has eleven (11) lessons:
Lesson 1: Genetic Engineering
Lesson 2: Applications of Recombinant DNA
Lesson 3: History of Life on Earth
Lesson 4: Mechanisms that Produce Change in Populations
Lesson 5: Evolution and Origin of Biodiversity: Patterns of Descent with
Modification
Lesson 6: Development of Evolutionary Thought
Lesson 7: Evidences of Evolution
Lesson 8: Evolutionary Relationships of OrganismsLesson 9:
Systematics Based on Evolutionary Relationships: Tree of Life and
Systematics
Lesson 10: Systematics Based on Evolutionary Relationships:
Taxonomy
Lesson 11: Systematics Based on Evolutionary Relationships:
Cladistics and Phylogeny

What I Need to Know

After going through this module, you are expected to:
1. Outline the processes involved in genetic engineering. (STEM_BIO11/12-IIIa-b-6)
2. Discuss the applications of recombinant DNA. (STEM_BIO11/12-IIIa-b-7)
3. Describe general features of the history of life on Earth, including generally accepted
dates and sequence of the geologic time scale and characteristics of major groups of
organisms present during these time periods. (STEM_BIO11/12-IIIc-g-8)
4. Explain the mechanisms that produce change in populations from generation to
generation (e.g., artificial selection, natural selection, genetic drift, mutation,
recombination) (STEM_BIO11/12-IIIc-g-9)
5. Show patterns of descent with modification from
6. Common ancestors to produce the organismal diversity observed today.
STEM_BIO11/12-IIIc-g-10
7. Trace the development of evolutionary thought (STEM_BIO11/12-IIIc-g-11.
8. Explain evidences of evolution (e.g., biogeography, fossil record, DNA/protein sequences,
homology, and embryology) (STEM_BIO11/12-IIIc-g-12)
9. Infer evolutionary relationships among organisms using the evidence of evolution.
(STEM_BIO11/12-IIIc-10.
10. Explain how the structural and developmental characteristics and
relatedness of DNA sequences are used in classifying living things. STEM_BIO11/12IIIhj-14

2
 11. Identify the unique/ distinctive characteristics of a specific taxon relative to other taxa
(STEM_BIO11/12IIIhj 15)
12. Describe species diversity and cladistics, including the types of evidence and procedures that can
be used to establish evolutionary relationships. (STEM_BIO11/12IIIhj-16).

Lesson
Genetic Engineering
1
What I need to know
Learning Competency

The learners should be able to outline the steps involved in genetic

engineering (STEM_BIO11/12-III a-b-6)

At the end of the lesson, the learners will be able to:

• compare classical breeding with modern genetic engineering techniques;
• enumerate the steps in molecular cloning;
• describe some methods to introduce DNA into cells; and
• explain the selection and screening of transformants / genetically modified
organisms (GMOs)

What I know
Definition of Terms:
1. Genetic Engineering 6. Genome
2. DNA 7. Gene Mapping
3. Recombinant DNA 8. Biotechnology
4. Plasmids 9. Polymerase Chain Reaction
5. Cloning 10. Gene Therapy

What’s is it
INTRODUCTION:
Genetic engineering, the artificial manipulation, modification, and recombination of
DNA or other nucleic acid molecules in order to modify an organism or population of
organisms.
The term genetic engineering initially referred to various techniques used for the
modification or manipulation of organisms through the processes of heredity and
reproduction. As such, the term embraced both artificial selection and all the
interventions of biomedical techniques, among them artificial insemination, in vitro
fertilization (e.g., “test-tube” babies), cloning, and gene manipulation.
https://www.britannica.com/science/genetic-engineering

Classical plant breeding uses deliberate interbreeding (crossing) of closely or

distantly related individuals to produce new crop varieties or lines with desirable
3
 properties. Plants are crossbred to introduce traits/genes from one variety or line into
a new genetic background.
https://www.sciencedaily.com/terms/plant_breeding.htm#:~:text=Classical%20plant%20breeding%20uses%20de
liberate,i nto%20a%20new%20genetic%20background.

Genetic engineering is the process of using recombinant DNA (rDNA) technology to

alter the genetic makeup of an organism. Traditionally, humans have manipulated
genomes indirectly by controlling breeding and selecting offspring with desired traits.
Genetic engineering involves the direct manipulation of one or more genes. Most
often, a gene from another species is added to an organism's genome to give it a
desired phenotype.
https://www.genome.gov/genetics-glossary/Genetic
Engineering#:~:text=Genetic%20engineering%20is%20the%20process,selecting%20offspring%20with%20desire
d%20traits.

Genetic engineering involves the use of molecular techniques to modify the traits of a
target organism. The modification of traits may involve:
1. introduction of new traits into an organism
2. enhancement of a present trait by increasing the expression of the desired gene
3. enhancement of a present trait by disrupting the inhibition of the desired genes’ expression.
A general outline of recombinant DNA may be given as follows:
1. cutting or cleavage of DNA by restriction enzymes (REs)
2. selection of an appropriate vector or vehicle which would propagate the recombinant
DNA ( eg. circular plasmid in bacteria with a foreign gene of interest)
3. ligation (join together) of the gene of interest (eg. from animal) with the vector (cut
bacterial plasmid)
4. transfer of the recombinant plasmid into a host cell (that would carry out replication to
make huge copies of the recombined plasmid)
5. selection process to screen which cells actually contain the gene of interest
6. sequencing of the gene to find out the primary structure of the
protein Ways in which these plasmids may be introduced into
host organisms:

Biolistics. In this technique, a “gene gun” is used to fire DNA-coated pellets on plant
tissues.
Cells that survive the bombardment, and are able to take up the expression plasmid
coated pellets and acquire the ability to express the designed protein.

Plasmid insertion by Heat Shock Treatment. Heat Shock Treatment is a process

used to transfer plasmid DNA into bacteria. The target cells are pre-treated before
the procedure to increase the pore sizes of their plasma membranes. This
pretreatment (usually with CaCl2) is said to make the cells “competent” for accepting the
plasmid DNA. After the cells are made competent, they are incubated with the desired
plasmid at about 4°C for about 30min. The plasmids concentrate near the cells during
this time. Afterwards, a “Heat Shock” is done on the plasmid-cell solution by incubating it
at 42°C for 1 minute then back to 4°C for 2 minutes. The rapid rise and drop of
temperature is believed to increase and decrease the pore sizes in the membrane.
The plasmid DNA near the membrane surface is taken into the cells by this process.
The cells that took up the plasmids acquire new traits and are said to be
“transformed”.
Electroporation. This technique follows a similar methodology as Heat Shock
Treatment, but, the expansion of the membrane pores is done through an electric
“shock”. This method is commonly used for insertion of genes into mammalian cells.

4
 Some methods are:
Selection of plasmid DNA containing cells
Selection of transformed cells with the desired gene
PCR detection of plasmid DNA
Genetically Modified Organisms (GMOs)

What’s I’ve learned

POST QUIZ:

1. Determine which technologies are most appropriate for which cell types.

TECHNOLOGY CELL TYPE

1. Plants cells

2. Electroporation

3.Biolistics

4. Bacterial cells

5. Mammalian cells

What’s I can do
PERFORMANCE TASK:

1. Research on the pros and cons of genetic engineering.

PROS CONS
1.

2.

3.

4.

5
 Lesson Discuss the Applications of
2 Recombinant DNA

What I need to know

Learning Competency:
The learners should be able to discuss the applications of Recombinant
DNA Technology (STEM_BIO11/12-III a-b-7)

Specific Learning Outcomes:

At the end of the lesson, the learners will be able to:
• give examples of products from recombinant DNA technology;
• illustrate the use of databases to search genes for desired traits;
• describe steps in PCR to amplify and detect a gene of interest;
• identify the parts of an expression vector;
• explain how genes may be cloned and expressed

What I know

PRIOR KNOWLEDGE: Definition of Terms

1. Clone 6. Modified Trait

2. Plasmids 7. Human Genome
3. Biotechnology 8. Genetic Modified Organism
4. PCR Amplification
5. Detection

What’s is it

INTRODUCTION:

PRESENTATION OF RECOMBINANT DNA

There are many different traits that can be introduced to organisms to change their
properties. The following table shows examples of modified traits using cloned genes and
their applications:

6
MODIFIED TRAIT GENE RECIPIENT APPLICATION
MODIFICATION ORGANISM (FIELD)

Insulin Production Insertion of Human Bacteria (Medicine)

Insulin Gene Production of
Human
Insulin in Bacteria
Pest Resistance Insertion of Bt-toxin Corn / Maize (Agriculture)
gene Production of corn
plants with
increased
resistance to corn
boxer
Delayed Ripening Disruption of a Tomato plant Agriculture)
gene for a ripening Production of
enzyme (e.g. plants with fruits
polygalacturonase) that have delayed
ripening fruits.
These fruits will
survive longer
transport time,
allowing their
delivery to further
locations
(i.e. export
deliveries)
Chymosin Insertion of a gene Bacteria (Industry)
Production for chymosin Enhance large
scale production of
chymosin.
Thi
s enzyme
serves as a
substitute for rennet
in the coagulation
of milk. Rennet has
to be harvested
from calves. The
large scale
production of this
enzyme in bacteria
provides an
abundant supply of
this
important
component
for the cheese
production industry.

7
 PCR Amplification
Once a desired trait is chosen, information must be acquired for either its detection or
expression in a given organism.
1. Detection
Some researchers may be interested in determining if a given gene/trait is available
in a particular organism. If no previous research provides this information,
researchers may test the DNA of different organisms for the presence of these
specific genes. A technique that allows the detection of specific genes in target
organisms is called PCR.
PCR amplification is an in-vitro method that simulates DNA replication in vivo. It
utilizes a thermostable (heat-resistant) DNA polymerase that builds single stranded
DNA strands unto unwound DNA templates.
PCR uses repeated cycles of incubation at different temperatures to promote the
unwinding of the DNA template (~95°C); the annealing of a primer (a ~20bp
oligonucleotide sequence (recall RNA primers in DNA replication) onto the ssDNA
template strand (~54 - 60°C); and the extension of the generated ssDNA strand
through the binding of complementary bases to the template strand (~72° C). The
thermostability of the polymerase allows it to survive the repeated cycles of
denaturation, annealing and extension with little loss of enzyme function. Each cycle
of PCR doubles the amount of the target sequence. A typical PCR experiment
uses about 35 cycles of amplification. This increases the original amount of the target
sequence by 235 (i.e. ~34 billion) times.
Gene detection by PCR involves the design of primers that would only bind to
sequences that are specific to a target. For example, researchers would want to find
out if gene X (e.g. the gene for insulin) is available in a target organism (e.g. a
mouse, Mus musculus). Primers may be designed by looking at the available
sequences for gene X in the databases (e.g. all the genes for insulin in different
organisms; humans, pigs, cows, etc.). The different gene X sequences must be
aligned/ compared to match areas of sequence similarity (conserved sequences) and
areas of sequence dissimilarity (non-conserved sequences). Primers designed to
have the same sequence as the conserved areas will be specific for binding gene X
sequences in all the target organisms. Primers designed to have the same sequence
as the non-conserved areas will only be specific for the organisms which match its
sequence.

STEPS in PCR Amplification

Step 0: Undenatured Template ; Temp ~ 54 °"C;

Template: double stranded (ds) DNA strand. Complementary sequences are held together by H-
bonds
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)

Step 1: Template denaturation ; Temp ~ 95 °"C;

Template: single stranded (ss) DNA strands; DNA strands are separated; H-bonds between
complementary sequences are broken
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)

8
 Step 2: Primer Annealing ; Temp ~ 54 °"C (dependent on primer melting
temperature); Template: ssDNA strands. H-bonds are formed between complementary
sequences on the primers and the target sequences.
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
Direction of elongation CCATAGATC (Reverse Primer)

5’ GCGATGAGG 3’ Direction of elongation (Forward Primer)

3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)

Step 3: New DNA strand elongation ; Temp ~ 72 °"C;
The two new dsDNA strands are formed by the elongation of the generated ssDNA and the
H-bonds between the complementary sequences on these new strands and their templates.
Each of the new dsDNA strands is made up of one old strand from the original template, and
one new strand that was generated as a reverse complement of the template. This is called
semiconservative replication of the sequence.

New Strand 1:
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand) (old)
3’ CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC-5’ (Reverse Primer) (new)

New Strand 2:
5’ GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG-3’ (Forward Primer) (new)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand) (old)

Step 4: Repeat step 1 to 3 for N number of cycles (N is

usually 35) PCR Results
The expected product of PCR amplification will depend on the sequences / position at which the
primer sequences bind. If the forward primer starts binding at nucleotide 3 (coming from the 5’ end)
of
a 43bp long gene, and the reverse primer binds at a position complementary to nucleotide 39 of
the coding strand, then a 37bp product is expected per cycle of PC.

PCR Applications

PCR may be used to detect the presence of a desired gene in an organism.

Depending on the primer design, the expected product may represent only a specific
region of the gene or the entire gene itself. The first case is useful for detection of the
gene, or the detection of organisms with that specific gene within a sample. The
second case is useful for the amplification of the entire gene for eventual expression
in other organisms. The direct amplification/copying of a full gene is part of the process
for “cloning” that gene.
2. Cloning and Expression
Some genes provide economically, and industrially important products (e.g. insulin-
coding genes; genes for collagen degradation). In some cases, scientists would want
to put these genes into organisms for the expression of their products. One example
would be the insertion of an insulin- coding gene from the human genome into
bacteria. This allows the “transformed” bacteria to now produce human insulin as a
product.
Certain types of bacteria are capable of this process since they are able to take
genes within their cell membranes for eventual expression. The genes are normally
in the form of small, circular DNA structures called plasmids.

9
 What’s more

ACTIVITY:

1. Illustrate the steps in restriction digestion and PCR.

10
 Lesson History of Life on Earth
3
What I need to know

Learning Competency
The learners describe general features of the history of life on Earth, including
generally accepted dates and sequence of the geologic time scale and
characteristics (STEM_BIO11/12-IIIc-g-8)

Specific Learning Outcomes

At the end of the lesson, the learners will be able to:
• identify the dates and sequence of the periods in the geologic time scale;
• identify the major events in each major period;
• describe the characteristics of the major groups of organisms’ presents during a time
period;
• identify types of fossils; and
• describe causes of mass extinctions.

What I know

PRIOR KNOWLEDGE: Definition of Terms

1. Precambrian 6. Cambrian 11. Permian

2. Paleozoic 7. Ordovician 12. Triassic
3. Mesozoic 8. Silurian 13. Jurassic
4. Cenozoic 9. Devonian 14.Cretaceous
5. Epoch 10.Carboniferous

11
 What’s is it
INTRODUCTION:

https://clarkscience8.weebly.com/geologic-time-scale.html

12
The Geological Time Scale (GTS)

A. Four eras - Precambrian; Paleozoic; Mesozoic; Cenozoic

B. Periods under the Paleozoic era - Cambrian, Ordovician, Silurian,
Devonian, Carboniferous, Permian
C. Periods under the Mesozoic era - Triassic, Jurassic, Cretaceous
D. Periods under the Cenozoic era - Tertiary and Quaternary

CAMBRIAN EXPLOSION is the belief that there was a sudden, apparent explosion
of diversity in life forms about 545 million years ago. The explosion created the
complexity of multi-celled organisms in a relatively short time frame of 5 to 10 million
years. This explosion also created most of the major extant animal groups today.

TYPES OF FOSSILS DESCRIPTION EXAMPLES

Molds Impression made in a Shells

substrate = negative image
of
an organism
Casts When a mold is filled in
Petrified Organic material is converted
into stone
Original Remains Preserved wholly (frozen in
ice, trapped in tar pits,
dried/ dessicated inside
caves in arid regions or
encased in amber/
fossilized resin)
Carbon Film Carbon impression in
sedimentary rocks
Trace/ Ichnofossils Record the movements and
behaviors of the organism
Bones and teeth
Petrified trees;
Coal balls (fossilized plants
and their tissues, in round
ball shape)
Woolly mammoth;
Amber from the Baltic
Sea region
Leaf impression on the rock
Trackways, toothmarks,
gizzard rocks, coprolites
(fossilized dungs), burrows
and
nests

THE SIX WAYS OF FOSSILIZATION

1. Unaltered preservation - Small organism or part trapped in amber, hardened plant sap
2. Permineralization/ Petrification - The organic contents of bone and wood are
replaced with silica, calcite or pyrite, forming a rock-like fossil
3. Replacement - hard parts are dissolved and replaced by other minerals, like
calcite, silica, pyrite, or iron
4. Carbonization or Coalification - The other elements are removed and only the
carbon remained
5. Recrystalization - Hard parts are converted to more stable minerals or small crystals
turn into larger crystals
6. Authigenic preservation - Molds and casts are formed after most of the organism have
been destroyed or dissolved.

13
 DATING FOSSILS

Knowing the age of a fossil can help a scientist establish its position in the geologic time scale
and find its relationship with the other fossils. There are two ways to measure the age of a
fossil: relative dating and absolute dating.

1. RELATIVE DATING
Based upon the study of layer of rocks
Does not tell the exact age: only compare fossils as older or younger, depends on their
position in rock layer
Fossils in the uppermost rock layer/ strata are younger while those in the lowermost
deposition are oldest

How Relative Age is Determined

Law of Superposition: if a layer of rock is undisturbed, the fossils found on upper
layers are younger than those found in lower layers of rocks
However, because the Earth is active, rocks move and may disturb the layer making
this process not highly accurate.

Rules of Relative Dating

(From: http://staff.harrisonburg.k12.va.us/~esutliff/forms/Relative_Dating_1334236393.ppt)

A. LAW OF SUPERPOSITION: Sedimentary layers are deposited in a specific time-

youngest rocks on top, oldest rocks at the bottom

B. LAW OF ORIGINAL HORIZONTALITY: Deposition of rocks happen horizontally-

tilting, folding or breaking happened recently

C. LAW OF CROSS-CUTTING RELATIONSHIPS: If an igneous intrusion or a fault cuts

through existing rocks, the intrusion/fault is YOUNGER than the rock it cuts through
INDEX FOSSILS (guide fossils/ indicator fossils/ zone fossils): fossils from short-lived
organisms that lived in many places; used to define and identify geologic periods

2. ABSOLUTE DATING
• Determines the actual age of the fossil
• Through radiometric dating, using radioactive isotopes carbon-14 and potassium-40
• Considers the half-life or the time it takes for half of the atoms of the radioactive
element to decay
• The decay products of radioactive isotopes is stable atoms.

14
 What’s I’ve learned

MULTIPLE CHOICE. Choose the letter of the correct answer.

1. The largest division of the geologic time scale is the

A. Eon
B. Era
C.Period
D. Epoch

2. The Mesozoic Era was the Age of Reptiles while the

current Cenozoic Era is the Age of
A. Mammals
B. Birds
C.Humans
D. Technology

3. The layers in sedimentary rocks are also called

A. eras
B. epochs
C.strata
D. gaps

4. The movie “Jurassic Park” got its title from which era?
A. Paleozoic
B. Mesozoic
C.Cenozoic
D. Holozoic

5. During which era were the first land plants formed?

A. Cambrian
B. Pre-Cambrian
C.Paleozoic
D. Mesozoic

6. The era of middle life, a time of many changes on Earth

A. Paleozoic
B. Mesozoic
C.Cenozoic
D. Holozoic

7. What is the longest part of Earth’s history where trace fossils

appeared.
A. Pre-Cambrian
B. Paloezoic
C.Mesozoic
D. Cenozoic

15
8. The geologic time scale is subdivided into 4 groups. List
them from the largest to the smallest.
A. Eons, periods, epochs, eras
B. Eras, eons, periods, epochs
C.Epochs, periods, eras, eons
D. Eons, eras, periods, epochs

9. The end of this era was believed to be caused by a

comet or asteroid colliding with Earth, causing a huge
cloud of dust and smoke to rise into the atmosphere,
blocking out the sun.
A. Paleozoic
B. Holozoic
C.Mesozoic
D. Cenozoic

10. Which geologic event occurred during the Mesozoic era?

A. Pangaea formed
B. Asteroids killed the dinosaurs
C.The Rocky Mountains formed
D. The Pleistocene Ice began

RECOMMENDEDREADINGS

1.https://flexbooks.ck12.org/cbook/ck-12-middle-school-life-science-
2.0/section/4.13/primary/lesson/timeline-of-evolution-ms-ls/
2.https://flexbooks.ck12.org/cbook/ck-12-middle-school-earth-science-flexbook-
2.0/section/15.7/primary/lesson/geologic-time-scale-ms-es/
3.https://www.ck12.org/book/ck-12-earth-science-concepts-for-high-
school/section/10.7/

16
 Lesson Mechanisms that Produce
4 Change in Populations

What I need to know

Learning Competency
The learners shall be able to explain the mechanisms that produce change in populations from
generation to generation (STEM_BIO11/12-IIIc-g-9)

Specific Learning Outcomes

At the end of the lesson, the learners will be able to:

• explain that genetic variation is the prerequisite and should therefore be present for any
genetic process to cause change in populations from generation to generation;
• state the Hardy-Weinberg Principle;
• enumerate the conditions that should be present for a gene or in a larger scale, a population, to
attain Hardy-Weinberg equilibrium; and
• calculate gene and genotype frequencies and derive the Hardy-Weinbergequation

What I know
PRIOR KNOWLEDGE:

1. Natural Selection 6. Genetic Variation

2. Mitigation 7. DNA Sequence
3. Mutation 8. Genetic Drift
4. Genotype
5. Genetic Equilibrium

What’s new
PRE ACTIVITY: A Picture Paint a Thousand Words

1. Observe the two pictures and Recognize

the similarities and the differences between
individuals or animals belonging to the same
species.

Answers:

17
https://www.dogalize.com/2016/12/dog-breeds/
https://blogs.scientificamerican.com/observations/the-concept-of-race-is-
a-lie/

What’s is it

INTRODUCTION:
Hardy–Weinberg law The law that states that in an infinitely large, interbreeding
population in which mating is random and in which there is no selection, migration, or
mutation, gene and genotype frequencies will remain constant from generation to
generation. In practice these conditions are rarely strictly present, but unless any
departure is a marked one, there is no statistically significant movement away from
equilibrium. Consider a single pair of alleles, A and a, present in a diploid population
with frequencies of p and q respectively. Three genotypes are possible, AA, Aa, and
aa, and these will be present with frequencies of p2, 2pq, and q2 respectively.
https://www.encyclopedia.com/science-and-technology/biology-and-genetics/genetics-and-genetic-
engineering/hardy-weinberg-
law#:~:text=Hardy%E2%80%93Weinberg%20law%20The%20law,generation%2C%20with%20no%20o
verlap%20b etween
The five conditions that must be met for genetic equilibrium to occur
include:

1. No mutation (change) in the DNA sequence.

2. No migration (moving into or out of a population).
3. A very large population size.
4. Random mating.
5. No natural selection.
6.
https://www.ck12.org/book/ck-12-life-science-concepts-for-middle-school/section/4.9/

18
 The Hardy-Weinberg equation is a mathematical equation that can be used to
calculate the genetic variation of a population at equilibrium. he equation is an
expression of the principle known as Hardy-Weinberg equilibrium, which states that the
amount of genetic variation in a population will remain constant from one generation to
the next in the absence of disturbing factors.
p2 + 2pq + q2 = 1

where p is the frequency of the "A" allele and q is the frequency of the "a" allele in the
population. In the equation, p2 represents the frequency of the homozygous genotype AA,
q2 represents the frequency of the homozygous genotype aa, and 2pq represents the
frequency of the heterozygous genotype Aa. In addition, the sum of the allele frequencies for
all the alleles at the locus must be 1, so p + q = 1. If the p and q allele frequencies are known,
then the frequencies of the three genotypes may be calculated using the Hardy-Weinberg
equation.
https://www.nature.com/scitable/definition/hardy-weinberg-equation-299/#:~:text=Science%20at%20Scitable-
,Hardy%2DWeinberg%20equation,In%201908%2C%20G.%20H.&text=If%20the%20p%20and%20q,using%20the%2
0Hardy% 2DWeinberg%20equation.

Natural selection, genetic drift, and gene flow are the mechanisms that cause
changes in allele frequencies over time. When one or more of these forces are acting
in a population, the population violates the Hardy-Weinberg assumptions, and
evolution occurs.
Natural selection occurs when individuals with certain genotypes are more likely
than individuals with other genotypes to survive and reproduce, and thus to pass on
their alleles to the next generation. As Charles Darwin (1859) argued in On the Origin
of Species, if the following conditions are met, natural selection must occur:

1. There is variation among individuals within a population in some trait.

2. This variation is heritable (i.e., there is a genetic basis to the variation, such that
offspring tend to resemble their parents in this trait).
3. Variation in this trait is associated with variation in fitness (the average net
reproduction of individuals with a given genotype relative to that of individuals with
other genotypes).

Mutation. Although mutation is the original source of all genetic variation, mutation
rate for most organisms is pretty low. So, the impact of brand-new mutations on allele
frequencies from one generation to the next is usually not large. (However, natural
selection acting on the results of a mutation can be a powerful
mechanism

evolution!
)

19
Natural selection. Finally, the most famous mechanism of evolution! Natural
selection occurs when one allele (or combination of alleles of different genes) makes
an organism more or less fit, that is, able to survive and reproduce in a given
environment. If an allele reduces fitness, its frequency will tend to drop from one
generation to the next. We will look in detail at different forms of natural selection that
occur in populations.

Gene flow. Gene flow involves the movement of genes into or out of a population,
due to either the movement of individual organisms or their gametes (eggs and sperm,
e.g., through pollen dispersal by a plant). Organisms and gametes that enter a
population may have new alleles, or may bring in existing alleles but in different
proportions than those already in the population. Gene flow can be a strong agent of
evolution.

Non-infinite population size (genetic drift). Genetic drift involves changes in allele
frequency due to chance events – literally, "sampling error" in selecting alleles for the
next generation. Drift can occur in any population of non-infinite size, but it has a
stronger effect on small populations. We will look in detail at genetic drift and the
effects of population size.

20
 Lesson Evolution and Origin of
Biodiversity: Patterns of Descent with
5 Modification

What I need to know

Learning Competency

The learners shall be able to show patterns of descent with modification from common
ancestors to produce the organismal diversity observed today.
STEM_BIO11/12-IIIc-g-10

Specific Learning Outcomes

At the end of the lesson, the learners will be able to:
• define species according to the biological species concept;
• distinguish the various types of reproductive isolating mechanisms that can lead to speciation;
• discuss the different modes of speciation; and
• explain how evolution produce the tremendous amount of diversity among organisms.

What I know
PRIOR KNOWLEDGE: Definition of Terms

1. Species 6. Allopatric
2. Classification 7. Sympatric
3. Interbreeding 8. Parapatric
4. Isolating mechanism
5. Zygote

What’s new
PRE ACTIVITY: Answer the following questions briefly.

A. Identify or give an organism which can be an animal or a plant species.

Organism Characteristics (animal or plant)

1.

2.

3.

4.

5.

21
B. Identify the different kind of variants of
the species.
Example:
Specie: Cat
Kinds or Variants: Lion, Tiger, Cheetah
Specie Kinds of Variants

1.

2.

3.

4.

5.

What’s is it
INTRODUCTION:

Species, in biology, classification comprising related organisms that share common

characteristic and are capable of interbreeding.
https://www.britannica.com/science/species-taxon
Ernst Mayer’s definition: “Species are groups of interbreeding natural populations that
are reproductively isolated from other such groups.”

The reproductive isolating mechanisms

A. Pre-zygotic isolation mechanisms prevent fertilization and zygote formation.

I. geographic or ecological or habitat isolation – potential mates occupy different
areas or habitats thus, they never come in contact
II. temporal or seasonal isolation – different groups may not be reproductively mature
at the same season, or month or year
III. behavioral isolation – patterns of courtship are different
IV. mechanical isolation – differences in reproductive organs prevent successful
interbreeding
V. gametic isolation – incompatibilities between egg and sperm prevent fertilization
B. Post-zygotic isolation mechanisms allow fertilization but nonviable or weak or sterile
hybrids are formed.
I. hybrid inviability – fertilized egg fails to develop past the early embryonic stages
II. hybrid sterility – hybrids are sterile because gonads develop abnormally or there
is abnormal segregation of chromosomes during meiosis
III. hybrid breakdown - F1 hybrids are normal, vigorous and viable, but F2 contains
many weak or sterile individuals.
The modes of speciation:

A. Allopatric speciation or geographic speciation (allo – other, patric – place; ‘other

place’) - occurs when some members of a population become geographically
separated from the other members thereby preventing gene flow. Examples of
geographic barriers are bodies of water and mountain ranges.

22
B. Sympatric speciation (sym – same, patric – place; ‘same place’) - occurs when
members of a population that initially occupy the same habitat within the same range
diverge into two or more different species. It involves abrupt genetic changes that
quickly lead to the reproductive isolation of a group of individuals. Example is change
in chromosome number (polyploidization).
C. Parapatric speciation (para – beside, patric – place; ‘beside each other’) – occurs
when the groups that evolved to be separate species are geographic neighbors.
Gene flow occurs but with great distances is reduced. There is also abrupt change in
the environment over a geographic border and strong disruptive selection must also
happen.

23
 What’s I’ve learned
POST QUIZ:

Give examples on the reproductive isolating mechanisms.

MECHANISMS EXAMPLES
1.
1. Geographic Isolation

2.

3.

1.
2. Temporal or Seasonal Isolation

2.

3.

1.
3. Behavioral Isolation

2.

1.
4. Mechanical Isolation

2.

1.
5. Gametic Isolation

2.

3.

24
25