Acta Tropica 233 (2022) 106567

Contents lists available at ScienceDirect

Acta Tropica
journal homepage: www.elsevier.com/locate/actatropica

Anopheles blood meal sources and entomological indicators related to

Plasmodium transmission in malaria endemic areas of Colombia
Stefani Piedrahita a, Natalí Álvarez a, Nelson Naranjo-Díaz a, Sara Bickersmith b, Jan E. Conn b, c,
Margarita M. Correa a, *
a
Grupo de Microbiología Molecular, Escuela de Microbiología, Universidad de Antioquia, Calle 70 No. 52-21, Medellín, Colombia
b
New York State Department of Health, Wadsworth Center, Albany, NY, USA
c
Department of Biomedical Sciences, School of Public Health, State University of New York-Albany, Albany, NY, USA

A R T I C L E I N F O A B S T R A C T

Keywords: Malaria is an important public health problem, caused by Plasmodium parasites which are transmitted by female
Host Anopheles mosquitoes that bite humans to obtain blood. The aim of this work was to identify the blood feeding
Blood meal sources sources of Anopheles female mosquitoes and calculate their entomological indices in relation to Plasmodium
Anopheles
transmission. Mosquitoes were collected in malaria endemic localities of the Bajo Cauca and Pacific regions of
Entomological parameters
Colombia using human landing catch and barrier screens, from 18:00 to 24:00 hr, in 2018–2021. Animal cen­
Malaria
Colombia suses within a radius of ~250 m were carried out at each sampling site. A total of 2018 Anopheles specimens were
collected and the most abundant species were Anopheles (Nys.) darlingi and Anopheles (Nys.) nuneztovari. The
highest human biting rate was 77.5 bites per person per night (b/p/n) for An. nuneztovari in Córdoba-Pacific and
17.5 b/p/n for An. darlingi in Villa Grande-Bajo Cauca. Both species were active mainly in indoor unwalled rooms
of the houses. Only An. nuneztovari from Córdoba-Pacific was infected with Plasmodium, with an entomological
inoculation rate of 91.25 infective bites per year. Detection of blood feeding sources demonstrate that humans
were the most common host, however, An. nuneztovari showed a preference for feeding on dogs and An. darlingi
on pigs, dogs and Galliformes, rather than humans. These results contribute to entomological surveillance in­
formation and provide valuable data that can be used to tailor effective control interventions to minimize
human-vector contact in these malaria endemic regions.

1. Introduction
Malaria is considered one of the most important transmissible
parasitic diseases in the world; it is caused by parasites of the genus
Plasmodium, transmitted to humans by the bite of female Anopheles
mosquitoes (WHO, 2021). In the Americas, Colombia has the third
highest number of malaria cases (PAHO, 2021), with the Bajo Cauca-BC
and the Colombian Pacific-PAC the most endemic regions. In 2021, 72,
022 cases were reported, caused mainly by Plasmodium vivax Grassi and
Feletti, 1890, followed by Plasmodium falciparum Welch, 1897 (INS,
2021). Current vector control in the country is carried out primarily
through the use of Long-Lasting Insecticidal Nets (LLINs) and Indoor
Residual Spraying (IRS); these are recommended by WHO as the main
strategies to eliminate malaria (WHO, 2021). However, given the plas­
ticity of biting behavior and resistance to commonly used insecticides,
adjunct strategies to control and eliminate malaria transmission have
been proposed that consider vector behavior and blood feeding sources
(Wilke and Marrelli, 2015; Bøgh et al., 2001; Gentile et al., 2015). These
include zooprophylaxis (Mahande et al. 2007; Bogh et al. 2001) and
larval site management (LSM) (WHO, 2013).
Key aspects of vectorial capacity include interactions of the mos­
quito, parasite and host (Shaw and Catteruccia, 2019; Dye, 1986; Keven
et al., 2020). Mosquito vector density, biting behavior and competence
are important aspects which determine the capacity to transmit Plas­
modium to humans. In particular, Anopheles biting is a factor with great
impact on vectorial capacity, given that for a vector to transmit the
parasite, it must bite at least twice; initially, to acquire the parasite and
later, to inoculate it (Shaw and Catteruccia, 2019). Occasionally, a
vector must bite multiple times in order to complete the gonotrophic
cycle, increasing the risk of Plasmodium transmission to humans
(Tedrow et al., 2019; Oliveira et al., 2012). Furthermore, insecticide
selection pressure (Ogola et al., 2017) and environmental changes affect

* Corresponding author.
E-mail address: margarita.correao@udea.edu.co (M.M. Correa).

https://doi.org/10.1016/j.actatropica.2022.106567
Received 25 March 2022; Received in revised form 23 May 2022; Accepted 14 June 2022
Available online 15 June 2022
0001-706X/© 2022 Elsevier B.V. All rights reserved.
S. Piedrahita et al.
vector abundance and biting behavior (Hernández-Valencia et al., 2020;
Naranjo-Díaz et al., 2019), affecting vectorial capacity. Hence, these
entomological parameters should be evaluated for comparison among
malaria endemic localities. Determination of mosquito natural infection
by Plasmodium is also an important parameter for the estimation of
vector competence (Shaw and Catteruccia, 2019), as it incriminates the
Anopheles species that actually participates in malaria transmission
(Gutiérrez et al., 2008; 2009; Naranjo-Díaz et al., 2013).
Anopheles female mosquitoes feed on their host(s) to obtain blood
and related nutrients necessary for oviposition (Zhou et al., 2007). This
increases human exposure and the risk of Plasmodium infection. Various
studies in Latin America have recorded the blood feeding sources of
Anopheles species, which comprise humans, other mammalian verte­
brates and avian hosts (de Carvalho et al., 2014; Flores-Mendoza et al.,
1996). A preference for hosts other than humans has been identified in
species such as An. albimanus in Honduras (Escobar et al., 2020) and An.
darlingi in Peru (Moreno et al., 2017; Saavedra et al., 2019). Further­
more, geographic differences have been found in host choice and are
Fig. 1. Map showing Anopheles sampling sites in the malaria endemic Bajo Cauca and Pacific regions of Colombia. Localities are represented by color filled circles
(Designed in Arcgis 10.8 software).
2
Acta Tropica 233 (2022) 106567
often attributed to host availability and abundance, as in the case of An.
darlingi’s preference for Galliformes in Peru (Moreno et al., 2017), and
for bovines in Brazil (Nagaki et al., 2021). These host choices may
contribute to the maintenance of mosquito populations and continued
Plasmodium transmission (Oliveira et al., 2012). The aim of the present
study was to identify the blood meal hosts and entomological indices
related to Plasmodium transmission for the Anopheles species in the
malaria endemic areas of Bajo Cauca and Pacific of Colombia. This is the
first study in Colombia to evaluate the blood meal sources for important
or suspected Anopheles vector species, and the results provide important
information on their biting behavior and level of anthropophily, which
may be used to direct vector control interventions.
2. Materials and methods
2.1. Study area, specimen collection and processing
Anopheles mosquitoes were collected from 2018 to 2021, in four
S. Piedrahita et al.
localities: La Capilla and Villagrande in El Bagre municipality, Antioquia
department in the Bajo Cauca region, and in the Pacific region, San
Antonio in Istmina municipality, Chocó department and Córdoba, in
Buenaventura municipality, Valle del Cauca department (Fig. 1). The
Bajo Cauca and Pacific regions are the most malaria endemic regions of
the country and together report above 50% of the total malaria cases.
The localities were selected based on high malaria incidence; for
example, El Bagre and Buenaventura are the most endemic localities of
each region, respectively (INS, 2021). Two visits per locality were per­
formed, each for four consecutive nights. Collections were performed
between 18:00 and 24:00 h, simultaneously in two sites, most located
more than 1 km apart, with two collectors per site. In one site, adult
mosquitoes were collected while resting on barrier screens (2 m high x
10 m long polyethylene shade cloth netting, 70% shading) placed up to
10 m from the house, forming physical barriers for mosquitoes (Burkot
et al., 2013). Collections from these screens provide an estimate of the
direction of mosquito movement (for example, from the forest to the
house and vice-versa). In the second site, collections were performed
using protected human landing catch (HLC); one collector stayed in­
doors and the other in the peri‑domestic area, up to 10 m from the
house. The indoor areas constituted exposed parts of the house, such as
an open, unwalled kitchen or living room. Collections were carried out
under an informed consent and protocols approved by the Bioethics
Committee of Universidad de Antioquia (CBEIH-SIU, No. 18–35–810
and 18–41–823). Anopheles females collected on barrier screens were
dissected in the field under a stereomicroscope (AmScope SE 100-ZZ)
and their guts were individually preserved on Whatman FTA® paper
until processing in the laboratory for blood meal source detection. The
rest of the sample (legs, wings, thorax and head), as well as the speci­
mens caught by HLC, were stored in silica gel. Whole specimens were
identified using the taxonomic key of González and Carrejo (2009) and
both difficult species and the specimens that were dissected were
molecularly confirmed by PCR-RFLP-ITS2 (Zapata et al., 2007; Cien­
fuegos et al., 2011). In addition, two daily censuses were performed, day
and night, to estimate the number of humans, livestock maintained in
corrals and domestic animals present within a radius of up to 250 m
from each collection site.
2.2. Detection of vertebrate blood sources for Anopheles females
To identify the hosts that constitute food sources for Anopheles fe­
male mosquitoes, DNA was extracted from the gut samples preserved on
Whatman® paper. Two 2-mm diameter discs per blood meal sample
were cut using a sterile Harris Uni-Core® perforator. DNA extraction
Table 1
Primers used to amplify vertebrate MT-CYB and COI and Plasmodium 18S rRNA and COXIII gene regions.
Amplified Gene Primer
CYB mammalian vertebrates Pig573_F
Human741_F
Goat894_F
Dog368_F
Cow121_F
UNREV1025
CYB avian Galliforme_F
Galliforme_R
Passeriforme_F
Passeriforme_R
Columbiforme_F
Columbiforme_R
COI mammalian vertebrates Mod_RepCOI_F
Mod_RepCOI_R
18S rPlU_1
Plasmodium rPlU_5
rPlU_3
rPlU_4
COX III Plasmodium COXIII_F
COXIII_R
3
Acta Tropica 233 (2022) 106567
was carried out using a saline precipitation protocol (Rosero et al.,
2010), and then subjected to a multiplex PCR to amplify a CYB mito­
chondrial gene region using primers specific for humans, pigs, dogs,
cows and goats, and a universal reverse oligonucleotide UNREV1025
(Kent and Norris, 2005). Amplification conditions were optimized and
consisted of a cycle of 95 ◦ C for 5 min; 35 cycles at 95 ◦ C for 1 min, 58 ◦ C
for 1 min and 72 ◦ C for 1 min, with a final extension at 72 ◦ C for 7 min;
amplification products were visualized on a 2% agarose gel electro­
phoresis using a 100 bp molecular weight marker. The blood meal
sources were identified by amplicon size differences (Table 1). Avian
blood meal sources were detected by amplification of a CYB mito­
chondrial gene fragment using specific oligonucleotides for the Order
Galliformes (Ngo and Kramer, 2003). Positive controls for CYB ampli­
fications were DNA samples extracted from human, pig, cow, dog,
Galliformes and Passeriformes blood; DNA from male Anopheles guts was
used as the negative control.
In order to increase the probability of detecting blood sources, a COI
mitochondrial gene region PCR using the universal oligonucleotides
Mod_RepCOI_F and Mod_RepCOI_R was performed (Reeves et al., 2018).
Amplification conditions consisted of a 95 ◦ C cycle for 4 min, 40 cycles
at 95 ◦ C for 40 s, 48.5 ◦ C for 1 min and 72 ◦ C for 1 min, with a final
extension at 72 ◦ C for 7 min; 30% of COI amplicons were identified by
Sanger sequencing. COI gene sequences were edited in Geneious v. 8.0.2
(Kearse et al., 2012). Hosts were identified by performing a MegaBlast
analysis of each COI sequence (GenBank accessions numbers ON059489
to ON059504) against vertebrate sequences reported in the NCBI
database.
2.3. Detection of Anopheles natural infection by Plasmodium
A nested PCR assay was carried out with Plasmodium genus-specific
primers that amplify a fragment of the Plasmodium small ribosomal
subunit − 18S rRNA (Singh et al., 1999). Pools of up to five thoraces of
Anopheles female mosquitoes of the same species were used as the
template. If a pool gave a positive result, DNA samples from individual
mosquito specimens from that pool were tested anew with the Plasmo­
dium genus-specific PCR and if positive, the individual samples were
subjected to a new nested PCR using species-specific primers (Gutiérrez
et al., 2008; 2009). Considering that Anopheles infection rates are usually
low (Montoya et al., 2017; Gutiérrez et al., 2008; Naranjo-Díaz et al.,
2013), a second PCR based on the Plasmodium cytochrome oxidase
III-COXII gene was optimized in the laboratory and performed to in­
crease the probability of detecting Plasmodium natural infection in the
samples (Echeverry et al., 2017; 2016).
Sequence 5′ - 3′ Size (bp)
CCTCGCAGCCGTACATCTC 453
GGCTTACTTCTCTTCATTCTCTCCT 334
CCTAATCTTAGTACTTGTACCCTTCCTC 132
GGAATTGTACTATTATTCGCAACCAT 680
CATCGGCACAAATTTAGTCG 561
GGTTGTCCTCCAATTCATGTTA –
ATTTCGGCTCCCTATTAGCAG 210
GTCCGATGTGAAGGAAGATACAGATGAAGAAGAA
RGCMCTRGCHGCCTCMRTCCTAG 165
AAYGGGTGTTCKACTGGTTGGCT
CTMACMGGMYTACTACTMGCCG 333
GGTTTGGCCAATGTAGGGGAC
TNTTYTCMACYAACCACAAAGA 664
TTCDGGRTGNCCRAARAATCA
TCAAAGAATAAGCCATGCAAGTGA 1640
CCTGTTGTTGCCTTAAACTCC
TTTTTATAAGGATAACTACGGAAAAGCTGT 240
TACCCGTCATAGCCATGTTAGGCCAATACC
AGCGGTTAACCTTTCTTTTTCCTTACG 500
AGTGCATCATGTATGACAGCATGTT TACA
S. Piedrahita et al. Acta Tropica 233 (2022) 106567

2.4. Estimation of entomological indices
The entomological parameters, mosquito biting activity by hour and
indoor/outdoor biting preference, were estimated for Anopheles species
by locality. The human biting rate (HBR), infection rate (IR) and the
entomological inoculation rate (EIR) were calculated as previously
described (Naranjo-Diaz et al. 2013; Diakité et al., 2015). In addition,
the human blood index (HBI) was determined for each species calcu­
lating the proportion of mosquitoes feeding on human blood in relation
to the total number of mosquitoes analyzed (Pappa et al., 2011). The
forage ratio (wi), an indicator of a vector feeding preference for a specific
host, was calculated using a matrix constructed with the proportion of
hosts (oi) detected for each Anopheles species and the proportion of an­
imals registered at the collection site (pi) as: wi = opii (Hess et al., 1968).
The selection index (Bi) was calculated using the formula Bi = ∑wn i ,
wi
i=1
where wi is the forage ratio for the Anopheles species and n is the number
of blood sources available (Manly et al. 1993, as cited in Moreno et al.
2017). A wi value > 1 indicates preference, <1 indicates avoidance or
selection for another host, and ~ 1 indicates neither preference nor
avoidance.
3. Results
3.1. Anopheles species abundance and composition
A total of 2018 Anopheles specimens were collected, 524 on barrier
screens and 1494 by HLC in the Bajo Cauca-BC and Colombian Pacific-
PAC localities (Table 2). In the Bajo Cauca region, four Anopheles species
were detected, An. darlingi, An. nuneztovari, An. triannulatus and An.
braziliensis. The most abundant species in La Capilla was the main vector
An. darlingi in the first field trip (49.1%), whereas its abundance in the
second field trip was similar to that of An. nuneztovari (both: 37.5%). In
Villa Grande the most abundant species was the main vector An.
nuneztovari (58.3 and 48.4%, in the first and second field trip, respec­
tively), followed by An. darlingi (39.6 and 40%). In the Pacific region, in
the locality San Antonio, only the two main vectors An. nuneztovari and
An. darlingi were detected in both field trips, but An. nuneztovari was
most abundant (83.3% and 62.5%). In Córdoba, the only species
detected was An. nuneztovari (100%) (Table 2). A total of 524 Anopheles
females were collected on barrier screens, 57.8% rested on the inner side
(specimens coming from the house) and 42.2% on the outer side (pre­
sumed coming from the field towards the house). Most of these speci­
mens rested on the screen at an altitude lower than one meter from the
ground.
3.2. Anopheles blood meal sources
Regarding the census, a total of 439 human and vertebrate animals,
assumed to constitute potential mosquito hosts, were present around the
collection sites in the four localities. In general, for three localities,
human was the most abundant host representing more than 60% of the
total available hosts; chickens, dogs and cats were also detected. In the
locality La Capilla, the distribution of hosts was more diverse and pigs,
turkeys, horses and cows were also observed (Fig. 2). Of the total 524
specimens collected on barrier screens and analyzed by COI PCR, 125

Table 2
Abundance, composition and entomological parameters for the Anopheles species collected in Colombian malaria endemic localities by barrier screen and human
landing catch methods.
Region/ Municipality/ Locality/ Collection year and Species Specimens on barrier Specimens by human landing HBR IR (%) Annual
Coordinates month screens catch EIR
n (%)* n (%)

Bajo Cauca/ El Bagre 2018 October An. darlingi 26 (49.1) 18 (90) 2.25 – –
La Capilla/ An. 8 (15.1) 2 (10) 0.25 – –
nuneztovari
5◦ 7′ 49′ ’ N, 77◦ 18′ 35′ ’ W An. 19 (35.8) – – – –
triannulatus
2020 March An. darlingi 3 (37.5) 68 (63.6) 8.5 – –
An. 3 (37.5) 29 (27.1) 3.625 – –
nuneztovari
An. 1 (12.5) 1 (0.9) 0.125 – –
triannulatus
An. braziliensis 1 (12.5) 9 (8.4) 1.125 – –
Bajo Cauca/ El Bagre 2019 August An. darlingi 19 (39.6) 140 (62.2) 17.5 – –
Villa Grande/ An. 28 (58.3) 82 (36.4) 10.25 – –
nuneztovari
7◦ 32′ 0′ ’ N. 74◦ 42′ 16′ ’ W An. braziliensis 1 (2.1) 3 (1.3) 0.375 – –
2020 November An. darlingi 38 (40) 17 (50) 2.125 – –
An. 46 (48.4) 16 (47.1) 2 – –
nuneztovari
An. 11 (16.7) 1 (2.9) 0.125 – –
triannulatus
Pacífic/ Istmina 2018 October An. 55 (83.3) – – – –
nuneztovari
San Antonio/ An. darlingi 11 (16.7) – – – –
7◦ 31′ 25′ ’N, 75◦ 16′ 32′ ’ W 2021 February An. 5 (62.5) 48 (56.5) 6 – –
nuneztovari
An. darlingi 3 (37.5) 37 (43.5) 4.625 – –
Pacific/ Buenaventura 2019 May An. 126 (100) 620 (100) 77.5 – –
nuneztovari
Córdoba/
3◦ 52′ 19′ ’ N. 77◦ 4′ 11′ ’ W 2019 November An. 120 (100) 403 (100) 50.375 0.496** 91.25***
nuneztovari P. vivax
Total 524 1494

HBR: Human biting rate. IR: Infection rate. EIR: Entomological inoculation rate. The HBR was only calculated for mosquitoes collected by human landing catch.
*
The number of specimens per locality and field trip equals 100%.
**
Natural infection detected by nested PCR and positive for P. vivax.
***
Infective bites per year.

4
S. Piedrahita et al. Acta Tropica 233 (2022) 106567

Fig. 2. Percentage of human and vertebrate animals recorded at each collection site. The size of the bars represents the abundance of animals and humans that can be
potential hosts for Anopheles females. The X-axis depicts collection years and localities: La Capilla-BC, Villa Grande-BC, San Antonio-PAC, Córdoba-PAC. Humans
were the most abundant vertebrate.

amplified the mammalian vertebrates CYB region (Fig. 1 Supl) and 53 5.3% of blood meals consisted of more than one host, with 2.3% of
the COI region (Fig. 2 Supl). In general, there was agreement between Galliformes/human detected in An. darlingi and An. nuneztovari from
amplification of both markers, however, a few samples only amplified PAC localities and 3% Galliformes/dog in An. darlingi from Villa Grande-
one or the other. Various mammalian and avian blood sources were BC and An. nuneztovari from Córdoba-PAC (Fig. 3).
detected. The mammalian sources included: human (41.4%), dog
(31.6%), pig (3.8%) and cow (0.8%). Human blood was most frequently 3.3. Entomological indices and host choice
detected in An. nuneztovari and An. braziliensis from Villa Grande-BC, An.
nuneztovari from Córdoba-PAC and An. darlingi from San Antonio-PAC; Human Blood Index (HBI) values varied depending on the species
cow blood was only detected An. triannulatus from La Capilla-BC and locality, with the highest HBI corresponding to the primary malaria
(Table 3, Fig. 3). Among the avian class, the most frequent host was vectors, An. darlingi and An. nuneztovari. The HBI for An. nuneztovari was
the order Galliformes (9.8%), for An. darlingi and An. nuneztovari, with 40% in La Capilla-BC, 53.1% in Villa Grande-BC, and 49.2% in Córdoba-
Passeriformes detected only in An. nuneztovari (4.5%). Furthermore, PAC. HBI for An. darlingi was 20% in La Capilla-BC and 50% in San
Antonio-PAC. Anopheles triannulatus showed the lowest HBI, 16.7%
Table 3 (Table 4).
Mammalian hosts identified as blood sources for Anopheles females according to The Forage ratio (wi) varied by Anopheles species and locality
COI amplification and sequencing. (Table 4). The highest wi values were detected in specimens from La
Anopheles GenBank Accession COI sequence Location on barrier Capilla-BC (8.6 each for An. darlingi and An. triannulatus, and 17.0 for
species number identity screens An. braziliensis), which indicated a preference of these species for
An. darlingi ON059489 Sus scrofa House - Corral
feeding mainly on pig blood, while An. nuneztovari showed a preference
An. darlingi ON059490 Sus scrofa House - Corral mainly for dog blood (wi = 6.9). In PAC, depending on the locality, An.
An. darlingi ON059491 Sus scrofa House - Corral nuneztovari preferred Galliformes (wi = 6.3) or dog blood (wi = 5.8).
An. darlingi ON059492 Homo sapiens Forest - House Both the forage ratio and the selection index were high for both species
An. ON059493 Sus scrofa House - Corral
(Table 4).
triannulatus
An. ON059494 Sus scrofa House - Corral
triannulatus 3.4. Anopheles biting behavior
An. ON059495 Homo sapiens House - Road
nuneztovari Most Anopheles species bit mainly indoors in unwalled areas, i.e.,
An. ON059496 Bos taurus House - Corral
triannulatus
open kitchen spaces and living rooms. In the BC region, An. nuneztovari’s
An. ON059497 Homo sapiens House - Forest highest biting activity was in the uncovered indoor areas at 22:00 h in La
nuneztovari Capilla and 21:00 h in Villa Grande, while its maximum biting peak
An. ON059498 Sus scrofa House - Corral occurred at 20:00 h in Córdoba-PAC. The maximum biting peak for An.
triannulatus
darlingi was at 20:00 h in La Capilla-BC and 21:00 h in Villa Grande-BC.
An. ON059499 Homo sapiens House - Forest
nuneztovari In contrast, in San Antonio-PAC both vector species had biting activity
An. ON059500 Homo sapiens House - Forest mainly in the peridomestic area with a maximum peak at 22:00 h for An.
nuneztovari nuneztovari and at 20:00 h for An. darlingi (Fig. 4). Of the species
An. ON059501 Homo sapiens House - Forest collected only in the BC region, An. braziliensis had the highest biting
nuneztovari
An. ON059502 Canis lupus House - Forest
peak at 21:00 h and An. triannulatus specimens bit between 18:00 and
nuneztovari familiaris 20:00 h. The Human Biting Rate (HBR) varied depending on the species
An. ON059503 Canis lupus House – Forest and locality. The highest HBR was for An. nuneztovari in Córdoba-PAC
nuneztovari familiaris with 77.5 bites per person per night (b/p/n) and for An. darlingi in Villa
An. ON059504 Canis lupus House – Forest
Grande-BC with 17.5 b/p/n. The HBR for An. triannulatus and An. bra­
nuneztovari familiaris
ziliensis was lower than 1.1 b/p/n in BC (Table 2).
Homo sapiens: Human. Canis lupus familiaris: Labrador Family Dog. Sus scrofa:
Pig. Bos taurus: Cow.
Representative COI amplicons sequenced.

5
S. Piedrahita et al. Acta Tropica 233 (2022) 106567

Fig. 3. Quantitative interaction network of Anopheles species and hosts. The hosts that constitute the blood meal source for Anopheles females, as determined by
molecular methods, are shown in colored circles, where the size of the circles represents the abundance (n) of identified hosts. Straight lines represent the hosts for
the Anopheles species, with the thickness of the line representing the frequency of feeding on a particular host (Designed in Gephi program v. 9.02, images were taken
from the Biorender and Pinterest).

Table 4
Human blood index (HBI), forage ratio (wi) and host selection index (Bi) values of Anopheles mosquitoes captured by barrier screen in four localities.
Region Species Total HBI Human Dog Pig Cow Galliformes
/Locality hosts (%)
n
n wi Bi n wi Bi n wi Bi n wi Bi n wi Bi

Bajo Cauca An. darlingi 10 20 2 0.6 0.05 2 2.3 0.19 5 8.6 0.71 0 0 0 1 0.6 0.05
/La Capilla
An. 5 40 2 1.1 0.14 3 6.9 0.86 0 – – 0 – – 0 – 0
nuneztovari
An. 6 16.7 1 0.5 0.04 1 1.9 0.17 3 8.6 0.75 1 0.5 0.04 0 – 0
triannulatus
An. 1 0 0 – – 0 – – 1 17.0 1 0 – – 0 – 0
braziliensis
Bajo Cauca / An. darlingi 8 12.5 1 0.2 0.03 4 4.9 0.69 0 – – 0 – – 3 2 0.29
Villa Grande
An. 32* 53.1 17 0.9 0.17 14 4.3 0.83 0 – – 0 – – 0 – 0
nuneztovari
An. 1 100 1 1.6 1 0 – – 0 – – 0 – – 0 – 0
braziliensis
Pacific /San An. 7* 0 0 – – 1 0.5 0.07 0 – – 0 – – 4 6.3 0.93
Antonio nuneztovari
An. darlingi 4 50 2 0.9 0.14 0 – – 0 – – 0 – – 2 5.5 0.86
Pacific An. 59 49.2 29 0.6 0.08 17 5.8 0.75 0 – – 0 – – 10 1.3 0.17
/Córdoba nuneztovari

n = number of hosts as determined by the molecular test. wi: forage ratio (an indicator of a vector feeding preference for a specific host). Bi: Selection index.
*
The total n of host include Passeriformes detected in low abundance, wi and Bi are not calculated for Passeriformes because they cannot be surveyed.
The highest values are shown in bold.

3.5. Anopheles specimens naturally infected with Plasmodium be determined (P. vivax). The Entomological Inoculation Rate (EIR) was
91.25 infective bites per year in Córdoba-PAC (Table 2).
Of the 2018 specimens analyzed for natural infection by Plasmodium,
two An. nuneztovari from Córdoba-PAC were detected infected (Infection
Rate-IR of 0.496%), but in only one specimen could the parasite species

6
S. Piedrahita et al.
Fig. 4. Anopheles nuneztovari and An. darlingi biting activity measured by abundance of each species caught per hour by human landing catch indoors (blue bars)
versus outdoors (orange bars) for each of the collection localities.
4. Discussion
Determination of the hosts that constitute the blood sources for
Anopheles females may be useful for the design of novel vector control
strategies. In addition, the evaluation of entomological indicators
related to Plasmodium transmission is relevant to vector surveillance,
helping to define the rate of human-vector contact, to decrease the risk
of exposure and infection. This study set out to do both, and is the first
known work in Colombia that identifies the blood sources for important
malaria vectors in the main malaria endemic areas of Bajo Cauca and
Pacific regions.
In this study, the prevalent species were two of the main Colombian
malaria vectors; An. darlingi in Bajo Cauca localities and An. nuneztovari
in the Pacific region. Although An. nuneztovari is a species complex, only
An. nuneztovari s.s. has been recorded in Colombia (Naranjo-Díaz et al.,
2016b). Both An. darlingi and An. nuneztovari species are widely
distributed in endemic regions of the country but differ in abundance
among localities and time periods (Naranjo-Díaz et al., 2019; Olano
et al., 2001; Gutiérrez et al., 2008). It has been well documented that
their presence and abundance are influenced by landscape modifications
and anthropogenic activities such as small-scale crop farming, livestock
and fish farming, as well as open-pit mining (Naranjo-Díaz et al., 2014;
Naranjo-Díaz et al., 2019). These socio-economic activities are common
in the study localities and are known to generate larval habitats that
favor the proliferation of vector populations. For example, An. darlingi
uses flooded areas on the forest margins as larval habitats (Naranjo-Díaz
et al., 2019) and An. nuneztovari larvae are found in artificial and tem­
porary larval habitats with pasture vegetation; populations increase
during transition periods, between the dry to rainy seasons (Nar­
anjo-Díaz et al., 2013). We found that An. triannulatus and An. braziliensis
were only present in Bajo Cauca localities, in agreement with previous
reports for the region (Naranjo-Díaz et al., 2019). Anopheles triannulatus
has been noted as a zoophilic species, associated with cattle corrals
(Montoya et al., 2017; Rosero et al., 2013; Gutiérrez et al., 2008), which
could explain the presence of this species in the only study locality
where cattle were observed.
All anopheline species collected via barrier screens with detectable
blood meals fed mainly on mammals, primarily humans, dogs and pigs.
The HBI values confirmed the anthropophilic behavior of the main
vectors An. darlingi and An. nuneztovari and of the species An. braziliensis.
However, the forage ratio, an indicator of mosquito host preference,
demonstrated preferences for hosts other than humans (An. darlingi
showed a preference for pigs, dogs and Galliformes), though this pref­
erence may vary according to geography. In Peru, An. darlingi has shown
variable preferences for feeding on non-human hosts over humans
7
Acta Tropica 233 (2022) 106567
(Moreno et al., 2017; Saavedra et al., 2019), and in the present study,
Galliformes were third in the order of preference. Although An. darlingi
is considered to be highly anthropophilic (Naranjo-Díaz et al., 2016a),
these results show that depending on the region or locality, blood
feeding preferences vary. Other studies have shown host preference
variation according to locality (Zimmerman et al., 2006) and habitat
type, with urban or rural areas defining possible hosts (Flores-Mendoza
et al., 1996; Santos et al., 2019). The host preference detected may be
attributed to genetic factors of the vector that determine its orientation
by color, temperature and CO2 (Kemibala et al., 2020; Russell et al.,
2016) or to external aspects, such as host availability and abundance
(Rubio-Palis et al., 1994; Moreno et al., 2017).
Entomological parameters were determined for mosquitoes collected
by HLC. The HBR varied among species and localities, with the highest
rates for An. nuneztovari with 77.5 b/p/n in Córdoba-PAC and An. dar­
lingi with 17.5 b/p/n in Villa Grande-BC. This suggests that a person has
a higher risk of being bitten by An. nuneztovari mosquitoes in this Pacific
locality (Córdoba) than in the Bajo Cauca localities (HBR 0.25–10 b/p/
n). These results agree with previous reports that indicate a mainly
anthropophilic behavior for both species in the study regions (Gutiérrez
et al., 2009; Naranjo-Díaz et al., 2016a; Naranjo-Díaz et al., 2016b).
Previously reported HBRs for An. nuneztovari in PAC localities ranged
between 0.2–8.6 b/p/n (Naranjo-Díaz et al., 2014; Naranjo-Díaz et al.,
2016b; Naranjo-Díaz et al., 2013), but the HBR of 77.5 b/p/n detected
for this species in Córdoba-PAC is the highest ever reported for the re­
gion. Of concern, this high HBR suggests a higher infection risk for
humans in this locality where they are more exposed to mosquito bites.
The high HBR and in general, the difference in mosquito abundance and
behavior could have various explanations, including difference in
coverage by control interventions; also, environmental disturbances
may play a major role, as demonstrated in previous studies that have
evidenced that a transition from the forest land cover to other land
covers such as grass, play an important role in An. nuneztovari presence
and abundance (Hernández-Valencia et al., 2020), as is occurring in
some of these localities. But further and more detailed studies should be
conducted to establish the specific effect of these variables on mosquito
behavior. The situation is worse when considering the lack of appro­
priate control measures; for example, it was observed during the field
trips that the insecticide-impregnated mosquito nets used were very
deteriorated and torn; in fact, such nets were only distributed free of
charge in Colombia from 2010 to 2015, provided by the Global Fund as
part of a comprehensive intervention (Rodríguez Reyes et al., 2020).
Furthermore, there was a higher tendency for the vectors to bite in open
areas of the houses, such as unwalled kitchens and living rooms, where
people stay in the evenings during the peak biting hours which increases
S. Piedrahita et al.
infection risk. Barrier screen captures for this study showed mosquitoes
rested mainly on the inner side of the screens, indicating a probable
direction of flight from the house to the outside environment. This flight
orientation suggests that they have blood-fed from hosts in or near the
house and were traveling to rest outside for egg development prior to
oviposition (Burkot et al., 2013).
Regarding Plasmodium natural infection, An. nuneztovari was detec­
ted with P. vivax in Córdoba-PAC which demonstrates its importance as
a vector in this locality. Natural infection in An. nuneztovari has been
reported in other northwestern Colombia localities (Gutiérrez et al.,
2009; Naranjo-Díaz et al., 2013) and in Zacarias in the Pacific region
(Naranjo-Díaz et al., 2016b). These results and a previous report of
Plasmodium spp. infection in Córdoba-PAC (Montoya et al., 2017),
suggest that An. nuneztovari continues to play an important role in
regional malaria transmission. In this study An. darlingi was not found
infected, but previous studies reported Plasmodium infection in speci­
mens from Northwestern Colombia (Gutiérrez et al., 2009; Nar­
anjo-Díaz et al., 2016a). Infection rates for the Colombian malaria
vectors are usually low, 0.6 to 1.5 (Gutiérrez et al., 2008; 2009; Nar­
anjo-Díaz et al., 2016a), but its presence in these localities indicates it is
likely a vector supporting malaria transmission.
5. Conclusions
The results of this study provide new information on the feeding
behavior and host preference for the main Colombian malaria vectors
and two additional potential vector species. The findings contribute to
entomological surveillance and provide valuable information on Plas­
modium transmission dynamics, which can help to implement effective
control interventions directed to minimize human-vector contact, ac­
cording to the species bionomics. There were some limitations of the
study that could affect data interpretation, such as the number of
mosquitoes collected, which translates for example, into low numbers of
mosquitoes for entomological index calculations. In this study as in
previous ones, low infection rates were detected, and since the IR de­
termines final EIR values, it is difficult to interpret the real risk for
people in these malaria endemic regions. In addition, the parous rate, an
important indicator to estimate if control measures are working, was not
determined given that ovary dissections were not performed in the field;
the dissections were focused on extracting the guts for blood meal source
detection. Considering the limitations of this type of work, regarding
logistics and resources, it is recommended that health authorities in
charge of mosquito control carry out frequent surveys; in addition,
prevention and control interventions should be reinforced and coverage
increased.
Data availability
The datasets generated and analyzed during the current study are
available in the GenBank repository, under GenBank accessions
numbers ON059489 to ON059504.
Ethics approval and consent to participate
The methodology of this project was approved by the Review Board
of Sede de Investigación Universitaria-SIU, University of Antioquia
(CBEIH-SIU, 18–41–823 and 18–35–810).
Funding
This work received funding by University of Antioquia, Program­
matic project Code 2017–16344, and from the Departmento Admin­
istrativo de Ciencias, Tecnología e Inovación de Colombia-Colciencias
(Now Minciencias) project Code 753–2018. The funders had no role in
study design, data collection, analysis and interpretation of data or
preparation of the manuscript.
8
Acta Tropica 233 (2022) 106567
CRediT authorship contribution statement
Stefani Piedrahita: Investigation, Methodology, Formal analysis,
Visualization, Writing – original draft. Natalí Álvarez: Investigation,
Writing – review & editing. Nelson Naranjo-Díaz: Conceptualization,
Methodology, Formal analysis, Writing – review & editing. Sara Bick­
ersmith: Investigation, Methodology, Formal analysis, Writing – review
& editing. Jan E. Conn: Conceptualization, Methodology, Writing –
review & editing. Margarita M. Correa: Conceptualization, Methodol­
ogy, Funding acquisition, Project administration, Supervision, Writing –
review & editing.
Declaration of Competing Interest
The authors declare that there is no conflict of interest.
Acknowledgments
MMC received a Fulbright Research Scholarship spent at The Griffin
Laboratory, Wadsworth Center New York State Department of Health.
To members of the Molecular Microbiology Group, V. Vargas for labo­
ratory support, J.C. Hernandez and L.P. Muñoz for support with field
work.
Supplementary materials
Supplementary material associated with this article can be found, in
the online version, at doi:10.1016/j.actatropica.2022.106567.
References
Bøgh, C., Clarke, S.E., Pinder, M., Sanyang, F., Lindsay, S.W., 2001. Effect of passive
zooprophylaxis on malaria transmission in the Gambia. J. Med. Entomol. 38,
822–828. https://doi.org/10.1603/0022-2585-38.6.822.
Burkot, T.R., Russell, T.L., Reimer, L.J., Bugoro, H., Beebe, N.W., Cooper, R.D.,
Sukawati, S., Collins, F.H., Lobo, N.F., 2013. Barrier screens: a method to sample
blood-fed and host-seeking exophilic mosquitoes. Malar. J. 12, 49. https://doi.org/
10.1186/1475-2875-12-49.
Carvalho, G.C., dos Santos Malafronte, R., Miti Izumisawa, C., Souza Teixeira, R.,
Natal, L., Toledo Marrelli, M., 2014. Blood meal sources of mosquitoes captured in
municipal parks in São Paulo, Brazil. J. Vector Ecol. 39, 146–152. https://doi.org/
10.1111/j.1948-7134.2014.12081.
Cienfuegos, A.V., Rosero, D.A., Naranjo, N., Luckhart, S., Conn, J.E., Correa, M.M., 2011.
Evaluation of a PCR-RFLP-ITS2 assay for discrimination of Anopheles species in
Northern and Western Colombia. Acta Trop. 118, 128–135. https://doi.org/
10.1016/j.actatropica.2011.02.004.
Diakité, N.R., Guindo-Coulibaly, N., Adja, A.M., Ouattara, M., Coulibaly, J.T.,
Utzinger, J., N’Goran, E.K., 2015. Spatial and temporal variation of malaria
entomological parameters at the onset of a hydro-agricultural development in
Central Côte d’Ivoire. Malar. J. 14, 340. https://doi.org/10.1186/s12936-015-0871-
4.
Dye, C., 1986. Vectorial capacity: must we measure all its components? Parasitol. Today
2, 203–209. https://doi.org/10.1016/0169-4758(86)90082-7.
Echeverry, D.F., Deason, N.A., Davidson, J., Makuru, V., Xiao, H., Niedbalski, J.,
Kern, M., et al., 2016. Human malaria diagnosis using a single-step direct-PCR based
on the Plasmodium cytochrome oxidase III gene. Malar. J. 15, 128. https://doi.org/
10.1186/s12936-016-1185-x.
Echeverry, D.F., Deason, N.A., Makuru, V., Davidson, J., Xiao, H., Niedbalski, J., Yu, X.,
et al., 2017. Fast and robust single PCR for Plasmodium sporozoite detection in
mosquitoes using the cytochrome oxidase I gene. Malar. J. 16, 230. https://doi.org/
10.1186/s12936-017-1881-1.
Escobar, D., Ascencio, K., Ortiz, A., Palma, A., Sánchez, A., Fontecha, G., 2020. Blood
meal sources of Anopheles spp. in malaria endemic areas of Honduras. Insects 11,
450. https://doi.org/10.3390/insects11070450.
Flores-Mendoza, C., Cunha, R.A., Rocha, D.S., Lourenço-de-Oliveira, R., 1996.
Determinação das fontes alimentares de Anopheles Aquasalis (diptera: culicidae) no
Estado do Rio de Janeiro, Brasil, Pelo teste de precipitina. Rev. Saude Publica 30,
129–134.
Gentile, J.E., Rund, S.S.C., Madey, G.R., 2015. Modelling sterile insect technique to
control the population of Anopheles Gambiae. Malar. J. 14, 92. https://doi.org/
10.1186/s12936-015-0587-5.
González, R., Carrejo, N.S., 2009. Introducción Al Estudio Taxonómico De Anopheles de
Colombia. Universidad del Valle. Segunda edición, Cali. Colombia. Claves y Notas de
Distribución. Edited by Programa editorial.
Gutiérrez, L.A., González, J.J., Gómez, G.F., Castro, M.I., Rosero, D.A., Luckhart, S.,
Conn, J.E., Correa, M.M., 2009. Species composition and natural infectivity of
anthropophilic anopheles (Diptera: Culicidae) in Córdoba and Antioquia states in
S. Piedrahita et al.
Northwestern Colombia. Mem. Inst. Oswaldo Cruz 104, 1117–1124. http://www.nc
bi.nlm.nih.gov/pmc/articles/PMC3066193/.
Gutiérrez, L.A., Naranjo, N., Jaramillo, L.M., Muskus, C., Luckhart, S., Conn, J.E.,
Correa, M.M., 2008. Natural infectivity of Anopheles species from the Pacific and
Atlantic regions of Colombia. Acta Trop. 107, 99–105. https://doi.org/10.1016/j.
actatropica.2008.04.019.
Hernández-Valencia, J.C., Rincón, D.S., Marín, A., Naranjo-Díaz, N., Correa, M.M., 2020.
Effect of land cover and landscape fragmentation on Anopheline mosquito abundance
and diversity in an important Colombian malaria endemic Region. PLoS One 15,
e0240207. https://doi.org/10.1371/journal.pone.0240207.
Hess, A.D., Hayes, R.O., Tempelis, C.H., 1968. The use of the forage ratio technique in
mosquito host preference studies. Mosq. News 28, 386–389. ttps://www.biodiversit
ylibrary.org/part/129637.
INS, Instituto Nacional de Salud. Sistema de vigilancia en salud pública (Sivigila). 2021.
https://www.ins.gov.co/buscador-eventos/BoletinEpidemiologico/2021_Boletin_epi
demiologico_semana_52.pdf.
Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S.,
et al., 2012. Geneious basic: an integrated and extendable desktop software platform
for the organization and analysis of sequence data. Bioinformatics 28, 1647–1649.
https://doi.org/10.1093/bioinformatics/bts199.
Kemibala, E.E., Mafra-Neto, A., Saroli, J., Silva, R., Philbert, A., Ng’habi, K., Foster, W.A.,
Dekker, T., Mboera, L.E.G., 2020. Is Anopheles Gambiae attraction to floral and
human skin-based Odours and their combination modulated by previous blood meal
experience? Malar. J. 19, 318. https://doi.org/10.1186/s12936-020-03395-2.
Kent, R.J., Norris, D.E., 2005. Identification of mammalian blood meals in mosquitoes by
a multiplexed polymerase chain reaction targeting cytochrome B. Am. J. Trop. Med.
Hyg. 73, 336–342. https://pubmed.ncbi.nlm.nih.gov/16103600.
Keven, J.B., Artzberger, G., Gillies, M.L., Mbewe, R.B., Walker, E.D., 2020. Probe-based
multiplex QPCR identifies blood-meal hosts in Anopheles mosquitoes from Papua
New Guinea. Parasit. Vector 13, 111. https://doi.org/10.1186/s13071-020-3986-6.
Mahande, A., Mosha, F., Mahande, J., Kweka, E., 2007. Feeding and resting behaviour of
Malaria vector, Anopheles arabiensis with reference to Zooprophylaxis. Malar. J. 6,
100. https://doi.org/10.1186/1475-2875-6-100.
Montoya, C., Bascuñán, P., Rodríguez-Zabala, J., Correa, M.M., 2017. Abundance,
composition and natural infection of Anopheles mosquitoes from two malaria-
endemic regions of Colombia. Rev. Biomed. 37, 98–105.
Moreno, M., Saavedra, M.P., Bickersmith, S.A., Prussing, C., Michalski, A., Rios, C.T.,
Vinetz, J.M., Conn, J.E., 2017. Intensive trapping of blood-fed Anopheles darlingi in
Amazonian Peru reveals unexpectedly high proportions of avian blood-meals. PLoS
Negl. Trop. Dis. 11, e0005337 https://doi.org/10.1371/journal.pntd.0005337.
Nagaki, S.S., Chaves, L.S.M., López, R.V.M., Bergo, E.S., Laporta, G.Z., Conn, J.E.,
Sallum, M.A.M., 2021. Host feeding patterns of Nyssorhynchus darlingi (Diptera:
culicidae) in the Brazilian Amazon. Acta Trop. 213, 105751 https://doi.org/
10.1016/j.actatropica.2020.105751.
Naranjo-Díaz, N., Altamiranda-Saavedra, M., Correa, M.M., 2019. Anopheles Species
Composition and Entomological Parameters in Malaria Endemic Localities of North
West Colombia. Acta Trop. 190, 13–21. https://doi.org/10.1016/j.
actatropica.2018.10.011.
Naranjo-Díaz, N., Altamiranda, M., Luckhart, S., Conn, J.E., Correa, M.M., 2014. Malaria
vectors in ecologically heterogeneous localities of the Colombian Pacific Region.
PLoS One 9, e103769. https://doi.org/10.1371/journal.pone.0103769.
Naranjo-Díaz, N., Conn, J.E., Correa, M.M., 2016a. Behavior and population structure of
Anopheles darlingi in Colombia. Infect. Genet. Evol. 39, 64–73. https://doi.org/
10.1016/j.meegid.2016.01.004.
Naranjo-Díaz, N., Rosero, D.A., Rua-Uribe, G., Luckhart, S., Correa, M.M., 2013.
Abundance, behavior and entomological inoculation rates of anthropophilic
anophelines from a primary colombian malaria endemic Area. Parasit. Vector 6, 61.
https://doi.org/10.1186/1756-3305-6-61.
Naranjo-Díaz, N., Sallum, M.A.M., Correa, M.M., 2016b. Population dynamics of
Anopheles nuneztovari in Colombia. Infect. Genet. Evol 45, 56–65. https://doi.org/
10.1016/j.meegid.2016.08.019.
Ngo, K.A., Kramer, L.D., 2003. Identification of mosquito bloodmeals using polymerase
chain reaction (PCR) with order-specific primers. J. Med. Entomol. 40, 215–222.
https://doi.org/10.1603/0022-2585-40.2.215.
Ogola, E., Villinger, J., Mabuka, D., Omondi, D., Orindi, B., Mutunga, J., Owino, V.,
Masiga, D.K., 2017. Composition of Anopheles mosquitoes, their blood-meal hosts,
and Plasmodium falciparum infection rates in three islands with disparate bed net
coverage in lake Victoria, Kenya. Malar. J. 16, 360. https://doi.org/10.1186/
s12936-017-2015-5.
Olano, V., Brochero, H., Sáenz, R., Quiñones, M., Molina, J., 2001. Mapas preliminares
de La distribución de especies de Anopheles vectores de Malaria En Colombia. Rev.
Biomed. Revista del Instituto Nacional de Salud 21, 402–408.
Acta Tropica 233 (2022) 106567
Oliveira, C.D., Tadei, W.P., Abdalla, F.C., Pimenta, P.F.P., Marinotti, O., 2012. Multiple
blood meals in Anopheles Darlingi (Diptera: culicidae). J. Vector Ecol. 37, 351–358.
https://doi.org/10.1111/j.1948-7134.2012.00238.x.
PAHO. 2021. Pan-American American Health Organization. http://www.paho.org/h
q/index.php?option=com_content&view=article&id=2632:2010-interactive-malar
ia-statistics&Itemid=2130&lang=es.
Pappa, V., Reddy, M., Overgaard, H.J., Abaga, S., Caccone, A., 2011. Estimation of the
human blood index in malaria mosquito vectors in equatorial guinea after indoor
antivector interventions. Am. J. Trop. Med. Hyg. 84, 298–301. https://doi.org/
10.4269/ajtmh.2011.10-0463.
Reeves, L.E., Gillett-Kaufman, J.L., Kawahara, A.Y., Kaufman, P.E., 2018. Barcoding
blood meals: new vertebrate-specific primer sets for assigning taxonomic identities
to host DNA from mosquito blood meals. PLoS Negl. Trop. Dis. 12, e0006767
https://doi.org/10.1371/journal.pntd.0006767.
Rodríguez Reyes, A., Roncancio Melgarejo, C., Misnaza Castrillón, S., 2020. Estrategias
de comunicación para impactar conductas (COMBI) en enfermedades vectoriales en
América Latina. Rev. Méd. Risaralda 26 (1). https://doi.org/10.22517/
25395203.18721.
Rosero, D.A., Gutiérrez, L.A., Cienfuegos, A.V., Jaramillo, L.M., Correa, M.M., 2010.
Optimización de Un Procedimiento de Extracción de ADN Para Mosquitos Anofelinos.
Rev. Colomb. Entomol. 36, 260–263. http://www.scielo.org.co/scielo.php?scrip
t=sci_arttext&pid=S0120-04882010000200015&nrm=iso.
Rosero, D.A., Naranjo-Diaz, N., Álvarez, N., Cienfuegos, A.V., Torres, C., Luckhart, S.,
Correa, M.M., 2013. Colombian Anopheles triannulatus (Diptera: culicidae) naturally
Infected with Plasmodium spp. ISRN Parasitol., 927453 https://doi.org/10.5402/
2013/927453.
Rubio-Palis, Y., Curtis, C.F., Gonzales, C., AWirtz, R., 1994. Host choice of Anopheline
mosquitoes in a malaria endemic area of western Venezuela. Med. Vet. Entomol. 8,
275–280. https://doi.org/10.1111/j.1365-2915.1994.tb00509.x.
Russell, T.L., Beebe, N.W., Bugoro, H., Apairamo, A., Cooper, R.D., Collins, F.H., Lobo, N.
F., Burkot, T.R., 2016. Determinants of host feeding success by Anopheles farauti.
Malar. J. 15, 152. https://doi.org/10.1186/s12936-016-1168-y.
Saavedra, M.P., Conn, J.E., Álava, F., et al., 2019. Higher risk of malaria transmission
outdoors than indoors by Nyssorhynchus darlingi in riverine communities in the
Peruvian Amazon. Parasit. Vector. 12, 374. https://doi.org/10.1186/s13071-019-
3619-0.
Santos, C.S., Pie, M.R., daRocha, T.C., Navarro-Silva, M.A., 2019. Molecular
identification of blood meals in mosquitoes (Diptera: culicidae) in Urban and
forested Habitats in Southern Brazil. PLoS One 14, e0212517. https://doi.org/
10.1371/journal.pone.0212517.
Shaw, W.R., Catteruccia, F., 2019. Vector biology meets disease control: using basic
research to fight vector-borne diseases. Nat. Microbiol. 4, 20–34. https://doi.org/
10.1038/s41564-018-0214-7.
Singh, B., Bobogare, A., Cox-Singh, J., Snounou, G., Abdullah, M.S., Rahman, H.A., 1999.
A genus- and species-specific nested polymerase chain reaction malaria detection
assay for epidemiologic studies. Am. J. Trop. Med. Hyg. 60, 687–692.
Tedrow, R.E., Rakotomanga, T., Nepomichene, T., Howes, R.E., Ratovonjato, J.,
Ratsimbasoa, A.C., Svenson, G.J., Zimmerman, P.A., 2019. Anopheles mosquito
surveillance in Madagascar reveals multiple blood feeding behavior and Plasmodium
infection. PLoS Negl. Trop. Dis. 13, e0007176 https://doi.org/10.1371/journal.
pntd.0007176.
W.H.O. World Health Organization, 2013. Larval Source Management: A Supplementary
Measure for Malaria Vector control: An Operational Manual. World Health
Organization, Geneva, p. 128.
WHO, and Global Malaria Programme. 2021. World malaria report. World Health
Organization, 1–299. https://reliefweb.int/sites/reliefweb.int/files/resources/9789
24004049-eng.pdf.
Wilke, A.B.B., Marrelli, M.T., 2015. Paratransgenesis: a promising new strategy for
mosquito vector control. Parasit. Vector 8, 342. https://doi.org/10.1186/s13071-
015-0959-2.
Zapata, M.A., Cienfuegos, A.V., Quirós, O.I., Quiñones, M.L., Luckhart, S., Correa, M.M.,
2007. Discrimination of seven Anopheles species from San Pedro de Uraba,
Antioquia, Colombia, by polymerase Chain reaction-restriction fragment length
polymorphism analysis of its sequences. Am. J. Trop. Med. Hyg. 77, 67–72. https://
doi.org/10.4269/ajtmh.2007.77.67.
Zhou, G., Kohlhepp, P., Geiser, D., Frasquillo, M.C., Vazquez-Moreno, L., Winzerling, J.
J., 2007. Fate of blood meal iron in mosquitoes. J. Insect Physiol. 53, 1169–1178.
https://doi.org/10.1016/j.jinsphys.2007.06.009.
Zimmerman, R.H., Galardo, A.K., Lounibos, L.P., Arruda, M., Wirtz, R., 2006. Bloodmeal
hosts of Anopheles species (Diptera: culicidae) in a malaria-endemic area of the
Brazilian Amazon. J. Med. Entomol. 947–956. https://doi.org/10.1603/0022-2585
(2006)43. https://pubmed.ncbi.nlm.nih.gov/17017232/.